Review Packet
Characteristics of Life (changes, homeostasis, code, cells, growth, reproduce, evolution)
1. Organisms are made of one (uni-) or many (multi-) ________________.
2. Organisms must ________________ to ensure long-term species survival. Can be asexual or sexual.
3. Organisms are based on a universal ___________ (DNA).
4. Organisms have a particular pattern of ________________ and development throughout life.
6. Organisms detect and respond to __________________________ in their environment.
7. Organisms must maintain a stable internal environment ; called ________________________.
8. Populations of organisms experience genetic change over time; called _______________________.
Cells
Cell Types: For each characteristic, indicate yes or no for Prokaryotes and Eukaryotes
Characteristic
Nucleus?
Membrane-bound organelles?
Genetic material?
Complex?
Multicellular?
Bacteria?
Ribosomes?
Plants and Animals?
Prokaryote
Eukaryote
Differences between plant and animals cells (complete the table by identifying ONLY the differences)
Differences
Different organelles present
Shape due to cell wall
Plant
Animal
Cell Transport: In the boxes below, indicate what direction the water moves and what will happen to the cell.
Hypertonic Solution
Direction water moves:
Hypotonic Solution
Direction water moves:
Isotonic Solution
Direction water moves:
A cell in a hypertonic solution
will...
A cell in a hypotonic solution
will...
A cell in a isotonic solution
will...
Review Packet
a. In the after picture to the right, are the water molecules
moving into or out of the cell?
b. What type of solution is the cell in (hypotonic, hypertonic or isotonic)?
c. What will eventually happen to the cell?
Match the types of transport to the correct picture:
Exocytosis
endocytosis
______________
facilitated diffusion
_________________
active transport
___________________
______________
The Fluid Mosaic Model and Movement through the Cell Membrane
Word Bank: Diffusion, proteins, cell membrane, active transport, phospholipids, energy, low, high, osmosis
The cell membrane is composed of __________________ and ____________. The Fluid Mosaic Model describes the
__________________. Passive transport is also called ________________ and it doesn’t require ____________. Passive
transport moves molecules from areas of ________ to _________ concentration. _______________ is a type of
diffusion involving only the movement of water molecules. A nonspecific type of movement that requires energy is
______________________ which moves molecules from low to high concentration.
What is a selectively permeable membrane?
What is a concentration gradient?
Review Packet
Organic Molecules: Place the following characteristics and diagrams into one of the four categories of organic
compounds.
Monomer: nucleotide
Monomer: fatty acid
Monomer: amino acid
Monomer: monosaccharide
Glucose, fructose & sucrose
Waxes & phospholipids
DNA & RNA
Enzymes, meat, & actin
Found in the nucleus of cells
Made at the ribosome of the cell
Sugars
Fats
Starch
Waterproofing
Cell Membrane
Carbohydrates
Nucleic Acid
Protein
Lipid
Review Packet
Enzymes
Fill in the Blank Using the Following Words:
substrate, active site, denature, protein, -ase, catalyzes, activation
*Special kind of _______________ (macromolecule) that __________________ (speeds up) chemical reactions.
*_________________ - when the shape of the enzyme is changed, making it unable to function properly.
*Enzyme names usually end in ____________ _.
* _________________ - the substance on which an enzyme acts
*__________ ___________ - the specific site on the enzyme that binds to the substrate (the “business” end)
*Enzymes lower the ____________________ energy of a reaction, meaning they lower the amount of energy needed
for a reaction to progress.
E. Enzyme Activity graphs: Use the graph below to answer the following question.
What does the graph indicate about adding amylase to a starch solution?
Which biomolecule is amylase?
Digestion means: ____________________________________________
What do the dots on the graph mean? _________________________________________
Review Packet
Energy: Photosynthesis/Respiration
Photosynthesis & Respiration and food chains & webs
A.
B.
C.
D.
E.
F.
G.
H.
I.
J.
K.
What is the equation for photosynthesis? _______________________________________________
What are the reactants?
What are the products?
What form of energy is produced by photosynthesis? ______________________________
What biomolecule is the energy produced by photosynthesis: __________________________
In which cell organelle does photosynthesis occur? ___________________________
What is the equation for cell respiration? __________________________
What are the reactants? ______________________________
What are the products? ___________________________
What form of energy is produced by respiration? _______________________
Where in the cell does respiration take place? ____________________________
Fill in the Blanks Using the Following words:
heterotrophs, (4) CO2, (4) O2, glucose, chloroplasts, mitochondria, photosynthesis, chemical, respiration, autotrophs,
solar, (2) light, (2) C6H12O6, glucose, (2) water
a. _Autotrophs (plants)_use organelles called ______________________in their leaves to collect ____________ energy.
b. ____________________occurs so plants can make ___________________to use for energy.
c. Photosynthesis converts _____________________ energy into ______________________energy.
d. Photosynthesis uses _________________, ________________
and __________________ to form ___________& __________.
e. Animals that can’t make their own food are called
_______________________________.
f. Animals, plants, fungi, and protists all use organelles called
__________________ to perform a process called
_____________________ which breaks down food molecules to
produce ATP for energy.
g. Respiration uses ______ and __________________
to produce____________ and _______________.
h. The gas released by respiration is ____________; the gas taken in by
photosynthesis is ____________________.
i. The gas taken in by respiration is _________; the gas released by photosynthesis is _____________.
j. The letter ______ represents the rabbit dying and replacing nutrients in the soil which is decomposition.
k. The letter ______ represents carbon dioxide being taken in to perform photosynthesis.
l. The letters ______ and ______ show CO2 being released into the atmosphere by respiration in plant and animals.
m. The letters ______ and ______ show carbon compounds being ingested for metabolic purposes.
Review Packet
Fill in the cycle below.
1.___________________
(energy to photosynthesis)
3. _______________ and _________________
(products of respiration)
5. _______________________________
(energy made from respiration)
2. ___________________________
(what is this organelle?)
4. ________________ and _________________
(products of photosynthesis)
6. ____________________________
(what is this organelle?)
Cellular Respiration – converts ________ energy stored in glucose into ___________.
*General equation: O2 + C6H12O6 _____________ + ______________ + energy in the form of ________.
*Pathway depends on the organism and oxygen conditions. Regardless, the first step is glycolysis.
* Glycolysis – is splitting sugar
E. Aerobic respiration uses ________ to break down __________ which results in ________, _______, and _________.
F. Anaerobic respiration does not use oxygen. It is used by unicellular organisms that need less energy.
Review Packet
Cell Division: Cell cycle, mitosis, meiosis, DNA, protein synthesis
Mitosis
Identify the following stages of mitosis and indicate the correct order.
a. ________________
b.______________
c._____________
d. ______________
e._______________
1. What order should the phase above be in? ____________ _____________  _____________ 
____________  _______________  _________________
2. The Cell cycle is made of two stages: _Interphase_ and cell division. Interphase consists of 3 phases: ___, ___
and ____. During the _____ phase DNA is copied.
Controls on Cell Division
For Questions 1–6, write True if the statement is true. If the statement is false, change the underlined word or
words to make the statement true.
1. Cells tend to continue dividing when they come
into contact with other cells.
2. Cell division speeds up when the healing process
nears completion.
3. Proteins called growth factors regulate the timing
of the cell cycle in eukaryotic cells.
5. Growth factors are proteins that slow down the
cell cycle.
6. Once apoptosis is triggered, a cell proceeds to
self-destruct.
From One Cell to Many
1. Humans, pets, and petunias all pass through an early stage of development called a(n)
2. Cells become ________________
through the process of differentiation.
3. Most cells in the adult body are no longer capable of _________________
.
________________.
Review Packet
Meiosis
3. Look at the picture to the right. What is the term for this process?
a. In what phase of meiosis does the following occur?
b. What does this process cause in the gametes?
4. If an organism has 6 chromosomes in its gametes, how many chromosomes will its body cell (somatic cell) have?
____
5. 7. If a liver cell of an organism has 32 chromosomes, how many will its gametes have? ______
Meiosis
Fill in the Blanks Using the Following Words:
gametes, 1, the same, 46, 23, eggs, sperm, homologous, diploid, half, 2, haploid, prophase, zygote, fertilization
1. Meiosis is a type of cell division that makes sex cells or __________________.
2. The two types of sex cells are ____________ and _____________.
3. Mitosis consists of ____ division(s), while meiosis consists of ______ division(s).
4. Mitosis makes cells with _____________ number of chromosomes as the parent cell, but meiosis produces cells with
____________ the number of chromosomes as the parent cell.
5. A human’s body cells have __________ chromosomes; sex cells or gametes have __________.
6. For every chromosome your mother gave you, there is a ________________ chromosome from your father with
information regarding the same trait(s).
7. When a cell has a full complement of homologs from each parent, the cell is said to be _____________ (2n).
8. Sex cells have only ONE set of chromosomes, they are called __________________.
9. When egg and sperm combine during __________________, the _________________ that is formed has the normal
2n number of chromosomes.
Review Packet
DNA
DNA & Protein Synthesis – the central dogma (DNA mRNA protein)
Fill in the Blanks Using the Following Words:
anticodon, nucleus, attaches, mRNA, unzips, single, protein, ribosome, mRNA, tRNA, pore, ribosome, codons, nucleotides, double,
S, Cytosine, Thymine, two, one, one, cytoplasm
Structure of DNA and RNA
DNA and RNA are made of ________________. Each nucleotide consists of three parts:
1) 5-carbon sugar (DNA = deoxyribose; RNA = ribose)
2) Phosphate (PO4)
3) Nitrogenous Base (DNA = ATGC, RNA = AUGC)
DNA is _____________-stranded and in the shape of a double-helix while RNA is ___________________-stranded.
DNA replication
Before a cell enters mitosis, the DNA replicates itself so that each daughter cell receives a copy of the DNA.
This occurs during the _____ phase of the cell cycle.
1) An enzyme _______ the strand by breaking the hydrogen bonds between nitrogenous bases.
2) Another enzyme _________ free nucleotides to the exposed templates.
Base-pairing rules – Adenine bonds with ___________ and Guanine with _____________. Replication
results in _____________ new molecules of DNA, each made of ___________
strand of old and ______________ strand of new DNA.
Protein synthesis – Two major steps
1) Transcription – production of ____________ from the DNA template. Happens in the
____________ of eukaryotic cells.
a) An enzyme temporarily unzips a gene to be read. At the same time, it builds a strand of
______________ that is complementary to the DNA.
b) When RNA polymerase finishes, the mRNA is released and travels to the
______________. It exits through a structure known as a nuclear ________________.
2) Translation – production of a _______________ from the mRNA template. Happens in
the _________________ and is accomplished by structures called __________________.
a) Ribosomes read the mRNA in 3-base segments called ______________. A codon chart
can be used to determine which amino acid will be brought to the ribosome when this
codon is encountered.
b) A different type of RNA called __________ carries individual amino acids to the
ribosome. Each tRNA has a 3-base region that is complementary to a codon – this is
called an _________________.
Review Packet
Identify the following parts of the DNA molecule
Adenine, Guanine, Thymine, Cytosine, Phosphate, Deoxyribose, Hydrogen Bond
Circle the answer that best completes the sentence.
1.
2.
3.
4.
5.
6.
7.
8.
9.
10.
Protein Synthesis occurs on structures called ribosomes/nuclei
mRNA is made in the nucleus/cytoplasm.
DNA Replication occurs in the nucleus/cytoplasm
tRNA and Amino Acids are floating around in the nucleus/cytoplasm.
DNA is double/single stranded.
DNA contains thymine/uracil.
RNA contains the sugar deoxyribose/ribose.
Transcription produces mRNA/tRNA.
Translation produces mRNA/tRNA.
Replication produces DNA/RNA.
H. Complete the following table
DNA
A
T
G
G
T
A
C
C
A
DNA
Replication
mRNA
tRNA
I. Transcription and Translation:
Use the codon chart below to transcribe and translate the following DNA
sequence.
DNA STRAND - TACGGCCATTTCGATTTGAGCATC
1. mRNA
____________________________________________________
2. amino acids: _________________________________________________________________
______________________________________________________________________________
3. This protein is made of _______________________ amino acids. (give the number of amino acids)
Review Packet
Genetics
Vocabulary Word Bank:
phenotype, gene, heredity, genetics, genome, recessive, dominant, trait, genotype, alleles, homozygous,
heterozygous
1. ________________- two different alleles, a hybrid (Tt)
2. _______________- is the passing of characteristics from parent to offspring
3. _______________________- is the type of genes or alleles present in an organism’s genome
4. _____________________- form of gene that always shows even in the presence of recessive allele.
5. _________________________- all of the genes in an organism
6. __________________________- are different forms of the same gene (ex: tall vs. short)
7. ____________________________- two alleles of the same form that make up a genotype, pure breed (TT or tt)
9. __________________________- form of a gene only expressed in a homozygous state
10. _____________________________- is an inherited characteristic
11. ______________________- is an organism’s physical appearance
12. ___________________________- is the study of heredity
13. _____________________________- is a segment of DNA located on a chromosome
Mendelian Genetics
Word Bank: monohybrid, dihybrid, independent assortment, segregation, Punnett square, P, F1, F2,
incomplete dominance, codominance, sex-linked traits
1.
____________________________- table used to diagram the probability of getting certain genotypes
2.
A ____________________________________ cross looks at only one trait
3.
A ________________________________ cross looks at two traits at a time
4.
The first generation of a ‘cross’ is the ________ or parental generation
5.
The offspring of the _______ generation is the F1 generation
6.
The offspring of the _______ generation is the F2 generation
7.
The Law of ________________________________ states that each gene is inherited separately from others if
they are on different chromosomes
8.
The Law of _____________________________ states the 2 alleles for each trait separate as gametes form
9.
___________________________ is blending of traits; red flowers + white flowers = pink
10.
________________________________- both alleles are expressed equally, as in blood typing (A+B = AB)
11.
____________________________- controlled by genes on sex chromosomes and are often more common in
males than in females; colorblindness, hemophilia
Review Packet
Evolution
Short Answer: Using the diagram to the right, answer the question
1. The forelimbs of the organisms are examples of what types of
structure?
____________________________
Evolution- the theory that there is a gradual change in characteristics
over time.
The diagram below is a cladogram which shows evolutionary relationships between organisms.
a. Which 2 organisms are the most related?
(mya = millions of years ago)
b. How long ago did A & D split?
A
B
C
D
c. Which organism is most related to G?
E
G
F
d. Which 2 organisms are the LEAST related?
1
e. Which 2 organisms are MORE related: D & E or E & G?
3 mya
f. Which 2 organisms are LESS related: A & D or D & F?
g. Which 2 organisms split ~8 mya?
8 mya
h. Which organisms would be in the same phylum as G?
i. If organism B is Felis domesticus, what is the most likely genus of organism C?
11 mya
Classification, Taxonomy & Kingdoms
1. Place the following characteristics in the proper Kingdoms. Those that are used more than once have
the number of times they will be used in parentheses.
yeast
eukaryotes(4)
mushroom
protozoan
amphibian
E. coli
conifer
only unicellular
flower
bird
decomposer (2)
K. Animalia
K. Plantae
prokaryotes
heterotroph & autotroph (2)
only autotrophs
multicellular (3)
fish
cell walls
K. Fungi
only heterotrophs(2)
algae
mold
multi- & unicellular
mammals
insects
K. Protista
moss
tree
reptile
fern
K. Archaebacteria &
Eubacteria
Classification cont.
2. Order of Classification: ___________, ___________, ________________, __________, ____________,
_____________, _________________, ______________________
3. Organisms named by Genus species (binomial nomenclature). What is the scientific name of a human?
Review Packet
Graphs: Look at the Graphs below and answer the questions that follow.
In which year was there likely an
abundance of bluegill food?
In which year was there likely an
increase in bluegill predators?
What is on the x-axis? _________________________
What is on the y-axis? ________________________
What is the dependent variable? ___________________
What is the independent variable? _______________
What was the bluegill population in 1991? ____________
What happened to the population from 1996 to 2000? ______________
What is on the x-axis? _____________________
What is on the y-axis? _______________________
What is the dependent variable? ____________________
What is the independent variable? ____________________
Which data point (1-4) is probably invalid? _______
How many days did it take for the fungi to reach 200 g? _____
Review Packet
Use the dichotomous key to identify the flower.
Use the diagram to the right to answer the following questions. Which
species went extinct?
How long ago?
Which of the beetles below are most closely related? Justify your answer.
Review Packet
Viruses- Word Bank:
vaccines, host, lysogenic, capsid, bacterial, living, diseases, cells, DNA, lytic, RNA
1. Not considered ______________ because they need a _host_ cell to reproduce and are not made of
________________________.
2. Cause ___________________________ such as AIDS, common colds, and flu.
3. Basic structure consists of a __________ (protein coat), nucleic acid core (can be ________ or __________).
4. Two types of life cycles 1) _______________ – viral entry, assembly of new viruses, burst out of cell 2)
____________ – viral entry, hides as a provirus and is copied when cell divides, enters lytic cycle when triggered.
5. ________________ are used to prevent viral infection; made of non-functional virus parts that trick our immune
systems.
6. Viral infections cannot be treated with antibiotics. Only ____________________ infections can be treated with
antibiotics.
D. Kingdom Protista (The “everything-else” kingdom)
Word Bank:
cilia
algae
flagella
pseudopods
protozoa
Most unicellular but some are multicellular
Some cause diseases such as malaria.
Classified based on nutrition:
1) Plant-like protists – “_________________” ; All are mostly autotrophic
2) Animal-like protists – “__________________” ; All are heterotrophic
3) Fungus-like protists – slime molds & water molds; All are heterotrophic/saprobic
How do the following cells move to the right?
A
B
C
A. _______________
B. _____________________
C. ___________________
E. Kingdom Fungi (Molds, mushrooms, yeast, mildew)
Word Bank:
chitin, fungus, hyphae, outside, multicellular, eukaryotic, algae
1. Cell type: __________________
2. # of cells: most ______________________; yeast is unicellular
3. Cell wall made of: ____________________
4. Digest food ___________________ of their bodies (extracellular digestion)
5. Composed of microscopic filaments called _______________________.
F. Lichens
Example of mutualism between a ______________________ and an ______________________.
Review Packet
Kingdom Plantae
1. cell type: _______________________________
2. # of cells: ______________________________
3. nutrition: ________________________________
4. Flowers are structures specialized for _________________ reproduction.
5. The male part is called the ___________________________. Pollen is produced in the _______________.
6. The female part is called the _____________. Eggs are produced in the _________________.
7. Identify structures 1-5 from the flower picture.
1.
2.
3.
4.
5.
Kingdom Animalia
1. Cell type: _________________________________________
2. # of cells: _____________________________________________
3. Do animals have a cell wall? _______________ chloroplasts? ____________________
4. Most animal species are __________________________________, meaning they have no backbone.
Body Systems
Circulatory System
The circulatory system (heart, arteries, veins, blood) is important for carrying
______________ to cells and ___________ away from cells
Blood is considered a tissue because, white & red blood cells work together
Digestive System
The digestive system _____________ food into organic molecules that can be used by cells in
cellular respiration to produce ATP energy.
The digestive system also removes solid wastes from the body. The ________
__________________ in cells perform a similar function.
Excretory System
The excretory system removes liquid wastes from the body and helps regulate the amount of water in the body.
Immune System Word Bank: skin, vaccine, antibodies, pathogen
1. The body’s first line of defense is the __________________________.
2. _____________________________ are made by your body to fight specific pathogenic organisms or viruses.
3. A _________________________ is any organism or agent (virus) that causes illness.
4. A ______________________ can be made by using dead or weakened viruses that are injected into the body.
Musculatory System
Muscle cells use a lot of energy and often contain many _________________ (cell part important for producing
usable energy).
Nervous System .
The nervous system controls the all the functions of the body. It’s role is similar to the _____________ in a cell.
Respiratory System
The respiratory system allows oxygen to enter the blood and carbon dioxide to leave the blood.
Skeletal System
A skeletal system supports the body and protects the critical organs of the body (brain, heart, lungs, etc.)
Review Packet
Ecology
Ecology - how organisms interact with each other and their environment
Ecological hierarchy from largest to smallest: ____________, ______________, ______________, ________________,
_______________, ________________
A. Biomes – Large geographic areas with characteristic ________________ ranges, rainfall, and organisms.
B. Ecosystems – defined by characteristic biotic and abiotic factors
1) biotic factors – living
2) abiotic factors – non-living
3) Niche – Area where organisms live and thrive
C. Ecosystem dynamics
Trophic levels – feeding levels, often represented as levels on a pyramid
Biomass – total ___________________ or organic matter at each trophic level
1) Producers – autotrophic; highest biomass
2) Primary consumers – eat autotrophs; lower biomass
3) Secondary consumers – eat primary consumers; lower biomass
Scavengers- Eat left overs
Herbivores- Eat Plants
Carnivores- Eat Meat
Omnivores- Eat Meat & Plants
Community – consists of ____________the organisms that live in an area.
Population – all the organisms of the same ____________________ living in an area.
Symbiotic relationships – two organisms live closely together;
a) parasitism – parasite _______________________ while the host is ________________________.
(eg. ticks, fleas, tapeworms)
b) mutualism – both parties ____________________________ (eg. lichens, nitrogen-fixing bacteria in root nodules)
c) commensalism – one benefits, the other is mostly _____________________________ (eg. orchids, vultures follow
hyenas)
E. Food Chains and Webs – graphical displays of energy transfer between and among
trophic levels
Food chain – linear (straight line)
Food web – shows all the interconnected food chains in an ecosystem
In chains and webs, arrows point in the direction of energy flow (from prey to predator)
Using the food web at right:
a) Where do killifish get their energy?___________________________________
b) How many different organisms get energy from snappers? ______
c) Do orcas get energy indirectly from diatoms? ____________
d) Which organism provides nutrients for the largest number of organisms?
Review Packet
F. Ecological Succession – community changes in which new populations or organisms gradually replace existing ones
Occurs because of natural or human disturbance (volcanic eruption/deforestation)
1) _______________________ communities – first to colonize an area; gradually
replaced by members of the climax community
2) Climax community – community that has reached relative stability; VA climax
community is mostly oak/hickory deciduous forest.
Order the steps of succession (A-D) in the diagram at right
________________
G. Nutrient Cycles
Water cycle (define the terms)
1) Precipitation2) Transpiration –
3) Evaporation 4) Runoff –
H. Carbon and Oxygen cycles – (Word Bank: burned, H2O, autotrophs (2), CO2, respire, O2, aerobic, food)
1) Photosynthesis releases ______ from __________________ .
2) Respiration releases ________ from _____________________ .
3) Carbon dioxide is released when fossil fuels are ____________, and when organisms
________________.
4) Oxygen is produced by __________________ during photosynthesis.
5) Oxygen is consumed by _________________________ organisms for use during cellular respiration.
B
Match the following components of the carbon cycle to the
appropriate letter in the diagram.
carbon dioxide in the atmosphere ___________
decomposition ___________
combustion (burning of fossil fuels) ___________
photosynthesis ___________
cellular respiration ___________
I. Nitrogen Cycle
1) Nitrogen _____________________________ - converting gaseous
nitrogen in atmosphere into usable forms.
a) What organisms are the primary fixers of nitrogen?
___________________________________
2) ________________________________________ - process by which
bacteria break down nitrogen compounds and release nitrogen gas back
into the atmosphere.
C
A
E
D