ARVO 2012 Annual Meeting Abstracts by Scientific Section/Group – Biochemistry/Molecular Biology (BI)
113 Retinal Development
Sunday, May 6, 2012, 8:30 AM - 10:15 AM
Hall B/C Poster Session
Program #/Board # Range: 420-432/D1043-D1055
Organizing Section: Biochemistry/Molecular Biology
Program Number: 420 Poster Board Number: D1043
Presentation Time: 8:30 AM - 10:15 AM
RGC-potent retinal stem cells generated by replacing Atoh7 with Hes1
Ya-Ping Lin, Steven W. Wang. Department of Ophthalmology, UTHSC, Houston,
TX.
Purpose: The purpose of this project is to create retinal stem cells that are potent to
give rise to retinal ganglion cells (RGCs) using a novel genetic engineering
strategy. The proneural factor Atoh7 is required for cell cycle exit and essential for
retinal ganglion cell (RGC) formation. Contrarily, the inhibitor type bHLH factor
Hes1 prevents neurogenesis by promoting cell cycle entry and inhibiting Atoh7
activation. We hypothesize that replacing Atoh7 with Hes1 would lead to incessant
cell cycle reentry in retinal progenitor cells, thus creating retinal stem cells (RSCs).
We also hypothesize that reactivate Atoh7 in these RSCs can restore their RGC
forming potential. The current report provides experimental results for testing these
two hypotheses.
Methods: A mouse line (Atoh7Hes1/Hes1) carrying a genetic element of loxP-Hes1IRES-dsRed-loxP in place of Atoh7 coding sequence was generated. Excision of the
floxed element would allow an Atoh7-IRES-hrGFP cassette to resume Atoh7’s
genomic position. The final mouse line (Atoh7Hes1/Hes1;CreERTM) was generated by
crossing the Atoh7Hes1/Hes1 mice with a Cre-ERTM line that Cre activity could be
induced by administrating Tamoxifen. Dissociated retinal cells from E13.5
Atoh7Hes1/Hes1;CreERTM retinas were cultured to form neurospheres. Generated
neurospheres were treated with 4OH-Tamoxifen to restore Atoh7 and cells were
allowed for differentiation. Resulting cells were tested for their RGC properties.
Results: The Atoh7 promoter remained active in the neurospherical cells after
prolonged culture. This result indicated that Atoh7 could be restored after removal
of the inserted Hes1 element. Immunolabeling with a combination of RGC markers
showed that at least 90% of the neurosphere derived cells are positive for all tested
RGC markers after Atoh7 restoration. Co-culture of these cells with cells isolated
from RGC-depleted retinas showed that at least 50% of neurosphere derived Atoh7
reactivated cells exhibited RGC morphology.
Conclusions: Neurospheres were produced due to incessant cell cycle reentry
when a Hes1 cDNA was used to replace the Atoh7 coding sequence. A large
portion of neurosphere derived cells acquired RGC fate after Atoh7 restoration. We
present here a novel strategy for generating stem cells for specific neural cell type.
Commercial Relationships: Ya-Ping Lin, None; Steven W. Wang, None
Support: (1) NEI EY018352 E. Matilda ziegler Foundation for the Blind, Inc (2)
NEI Coregrant EY10608 Herman Eye Fund.
Program Number: 421 Poster Board Number: D1044
Presentation Time: 8:30 AM - 10:15 AM
A Near-complete Loss Of Retinal Ganglion Cells Causes Severe Reduction In
All Retinal Cell Types
Takae Kiyama1, Ling Bai2, Steven W. Wang1. 1Ophthalmology & Visual Science,
University of Texas Science Ctr, Houston, TX; 2The Second Affiliated Hospital,
Xi’an Jiaotong University, School of Medicine, Xi'an, Shaanxi,, China.
Purpose: Retinal ganglion cells (RGCs) are the first cell type to be born during
retinogenesis. In addition to their signal transmitting function in the mature visual
system, they also play important roles during retinogenesis. It has been shown that
RGCs affect the final cell number in a retina. Previous study comparing total cell
numbers in retinas with varying degrees of RGC loss leads to a hypothesis that
there is a non-linear relationship between the number of RGCs and the number of
total retinal cells. To test this hypothesis and further investigate RGCs’ role in
retinogenesis, we created a compound knockout mouse line with the lowest RGC
number known to date.
Methods: Math5 and Brn3b are essential transcription factors for RGC formation.
Knockout math5 and brn3b resulted in 95% and 80% of RGC loss respectively.
brn3bdta;six3-cre mutant ablating newborn RGCs by diphtheria toxin causes 98%
of developmental RGCs loss. Combinations of these mutants, a retina with near
complete loss of RGCs was postulated. We, therefore, created a math5-/;brn3bdta/dta;six3-cre mouse line to study retinogenesis in an environment with
virtually no RGCs.
Results: math5-/-;brn3bdta/dta;six3-cre retina lost virtually all RGCs. This resulted
the thinnest retina ever reported. Drastic reductions of cell numbers were observed
in all cell layers. Most noticeably, the outer nuclear layer was reduced to a thin line
of cells becoming indistinguishable from the inner nuclear layer. Total cell
numbers in the math5-/-;brn3bdta/dta;six3-cre retinas were drastically less than that of
math5-/-;brn3b-/- retinas which had 99% RGC loss.
Conclusions: In the math5-/-;brn3bdta/dta;six3-cre retina, which has virtually no
RGCs, numbers of all retinal cell types were drastically reduced comparing to a
defective retina that had only 1% RGCs. Results support our hypothesis that the
number of RGC forms a non-linear relationship to the number of total retinal cells.
RGCs are required, directly or indirectly, for formation or maintenance of all other
cell types during retinogenesis. More importantly, cumulative results indicate that
retinal histogenesis is not a preprogrammed neurogenic event.
Commercial Relationships: Takae Kiyama, None; Ling Bai, None; Steven W.
Wang, None
Support: NEI EY018352 E. Matilda ziegler Foundation for the Blind, Inc
Program Number: 422 Poster Board Number: D1045
Presentation Time: 8:30 AM - 10:15 AM
The Nucleolar Phosphoprotein Npm1 Regulates Retinal Progenitor Cellspecific Chx10 Gene Expression By Binding To Evolutionarily Conserved
Enhancer Elements
Yasuo Ouchi1, Yukihiro Baba2, Takashi Iwamoto1, Sumiko Watanabe2. 1Biomedical
Sciences, Chubu University, Kasugai, Japan; 2Molecular & Developmental Biol,
Univ of Tokyo, Inst Med Science, Tokyo, Japan.
Purpose: The homeodomain transcription factor Chx10 is the earliest characterized
specific marker for retinal progenitor cells (RPCs) and is known to play an
important role in RPC proliferation. To better understand the evolutionarily
conserved molecular mechanism of RPC maintenance, we attempted to identify the
Chx10 promoter and upstream factor using zebrafish and mice as animal models.
Methods: To identify evolutionarily conserved enhancer elements of Chx10 gene,
we applied bioinformatic analysis and sought to characterize the Chx10 promoter
using zebrafish as an animal model. Using a mouse animal model, we assessed the
evolutionarily conserved activity of the cis-regulatory region. To identify the
upstream protein, the minimal cis-regulatory motif was analyzed by an
electrophoretic mobility shift assay, and binding proteins were identified by
proteomic analysis. The transactivation activity of the gene was examined using
luciferase as a reporter gene. In order to elucidate the function of the upstream
protein, we electroporated the shRNA expressing plasmid into retinal explants
prepared from an E17.5 mouse eye
Results: By computer-based sequence analysis, we identified 4 evolutionarily
conserved non-coding sequences (CNS) in the Chx10 locus. Among them, using a
series of transient GFP reporter gene injections into zebrafish embryos, we found
that the cis-regulatory motif located 35 kb upstream of mouse Chx10 can control
GFP expression in RPCs in both zebrafish and mice. From the proteomic analysis
of the minimal cis-regulatory motif binding proteins, we identified NPM1 as a
novel upstream factor of Chx10. Both mouse and zebrafish homologs of NPM1
were strongly expressed in RPCs during retinal development. Interestingly, NPM1knockout mice were previously reported to die around E11.5 with a complete loss
of the eyes. When we assessed the transactivation activity using luciferase as a
reporter gene, we found that NPM1 directed reporter gene expression in a Cterminal DNA-binding motif-dependent manner. Moreover, the suppression of
NPM1 expression by shRNA decreased the number of Chx10-positive cells, downregulated cell proliferation, and induced apoptosis in RPCs.
Conclusions: These results suggest that NPM1 plays a pivotal role in RPCs
maintenance by regulating the Chx10 gene expression during retinal development.
Commercial Relationships: Yasuo Ouchi, None; Yukihiro Baba,
None; Takashi Iwamoto, None; Sumiko Watanabe, None
Support: None
Program Number: 423 Poster Board Number: D1046
Presentation Time: 8:30 AM - 10:15 AM
Onecut Transcription Factors Play Distinct Roles In The Developing And
Mature Retina
Jeffrey Trimarchi, Greg Martin. Genetics Development & Cell Biol, Iowa State
University, Ames, IA.
Purpose: During the course of retinal development, cycling progenitor cells give
rise to a variety of cell types (six neurons and one glia). Previously, in an effort to
uncover the intrinsic programs that drive cell fate decisions in these cells, we
profiled the gene expression programs of individual progenitor cells that expressed
the transcription Math5. We found significant clusters of genes that correlated
specifically with distinct subsets of these Math5+ cells. These clusters contained
many different transcription factors whose function in the developing retina was
unexplored. Here we report on an analysis of retinal development in mice
individually deficient for two of these transcription factors, Onecut1 and Onecut2.
Methods: We examined the retinas of mice deficient for either Onecut1 or Onecut2
by three main methods. We compared wildtype and knockout retinas by microarray
analysis, in situ hybridization and immunohistochemistry. We used a variety of
probes and antibodies to examine each of the different retinal cell types in these
knockout mice. These analyses were performed at multiple developmental time
points and in the adult.
Results: The combination of in situ hybridizations and immunostainings of the
Onecut2 deficient adult retinas showed that all of the retinal cell types are present.
Interestingly, however, the horizontal cells are significantly reduced. We observed
an approximately 50% loss of these cells in the Onecut2 knockout adult retina.
Microarray analysis of these retinas showed a consistent decrease in Lhx1,
providing a potential explanation for the horizontal cell loss. Onecut1 deficient
mice die at birth so their retinas were only analyzed during embryonic
Copyright 2012 by the Association for Research in Vision and Ophthalmology, Inc., all rights reserved. For permission to reproduce any abstract, contact the ARVO Office at pubs@arvo.org.
ARVO 2012 Annual Meeting Abstracts by Scientific Section/Group – Biochemistry/Molecular Biology (BI)
development. These mice showed decreases in some of the early born retinal cell
types by marker analysis of both microarrays and in situ hybridizations. We are
currently trying to decipher which ganglion cell subsets are affected by the loss of
Onecut1.
Conclusions: The Onecut transcription factors were found by us and others to be
expressed in retinal progenitor cells, at times consistent with when these cells are
making cell fate decisions. Analysis of mice deficient for Onecut2 revealed a
critical role for this transcription factor in the generation of a percentage of
horizontal cells. Loss of Onecut1, on the other hand, revealed additional defects in
the generation of other early born retinal cell types.
Commercial Relationships: Jeffrey Trimarchi, None; Greg Martin, None
Support: None
Program Number: 424 Poster Board Number: D1047
Presentation Time: 8:30 AM - 10:15 AM
Function Of Pias3 In Developing Retina Determined By The Analysis Of
Conditional Knockout Mice
Hannah Breit, Jerome E. Roger, Debbie Cheng, Lijin Dong, Anand Swaroop.
Neurobiol Neurodegnrtn & Repair, NEI, Bethesda, MD.
Purpose: Protein Inhibitor of Activated STAT3 (PIAS3) is a transcriptional
modulator that directly binds to multiple factors to regulate activity. PIAS3 also
functions as a SUMO (Small Ubiquitin-like Modifier)-E3 ligase, and covalent
linkage of SUMO proteins can modify the function of target proteins. Recently,
Blackshaw and our laboratory have demonstrated the importance of SUMOylation
in modulating activity of Nrl and Nr2e3, essential regulators of photoreceptor
differentiation. The importance of PIAS3 in rod and cone photoreceptor
differentiation has been shown by in vivo electroporation in newborn retina. In
order to analyze the consequence of the lack of PIAS3 expression early in retinal
development and identify new PIAS3 targets, we have generated and analyzed
conditional Pias3 knockout mice (CKO).
Methods: Pias3 floxed mice were produced by introducing LoxP sites flanking
exon 2 to 5 of the Pias3 gene through homologous recombination. Long range PCR
and Southern blots were used for screening the correct recombinants. Pias3-specific
deletion in the forebrain and retina was obtained by crossing floxed mice with RxCre mice. Immunohistochemistry (IHC) was performed on retinal sections and flat
mount retina.
Results: A specific deletion of Pias3 in the retina in Pias3f/f; Rx-Cre mice was
confirmed by RT-PCR and PCR on retinal cDNA and genomic DNA respectively,
with tail DNA used as control. Immunoblot analysis confirmed the complete
absence of Pias3 protein in retinas of Pias3f/f; Rx-Cre mice. Preliminary analyses
of different retinal cell types in 1-month old animals indicated decreased Muller
cells (Sox9-positive cells) with displaced cell bodies in the inner nuclear layer
compared to control. Absence of Pias3 expression in early retinal development did
not affect M-cone differentiation. IHC with anti-S-opsin antibody and PNA on flat
mount retina revealed an increased number of S-cones along the ventral-dorsal axis.
No obvious change was observed in other retinal cell types based on IHC. In 6month old Pias3 CKO, no signs of retinal degeneration were observed.
Conclusions: Initial analysis of Pias3 CKO showed an increase of S-cone
photoreceptors. Quantification of each cell type is being performed to fully evaluate
the effects of the lack of Pias3 expression during retinal development. Visual
function will be analyzed by ERG.
Commercial Relationships: Hannah Breit, None; Jerome E. Roger,
None; Debbie Cheng, None; Lijin Dong, None; Anand Swaroop, None
Support: NIH/NEI Intramural Funding
Program Number: 425 Poster Board Number: D1048
Presentation Time: 8:30 AM - 10:15 AM
Misexpression of Ptf1a regulates the expression of Atoh7 during chick
retinogenesis
Xavier P. Guillonneau1,2, Elise C. Lelievre1, Laura Houille-vernes1, Amelie
Slembrouck2, Jerome E. Roger3, Olivier Goureau2, Finn Hallböök4, Jean-Marc
Matter5, Florian Sennlaub1,2. 1UMRS 872 Centre de Recherche des Cordeliers,
INSERM Univ Paris 5 / Paris 6, Paris, France; 2Institut de la Vision,
INSERM/UPMC Univ Paris 06/CNRS/CHNO des Quinze-Vingts, Paris, France;
3
Neurobiol-Neurodegnt'n Rep Lab, National Institutes of Health, Bethesda, MD;
4
Department of Neuroscience, Uppsala University, Uppsala,, Sweden; 5Department
of Biochemistry, University of Geneva, Geneva, Switzerland.
Purpose: The pancreas transcription factor 1 subunit a (Ptf1a) is necessary for the
specification of horizontal cells and the majority of amacrine cell subtypes in the
mouse retina. The molecular basis underlying Ptf1a activity during retinogenesis
has remained largely unknown. To decipher theses mechanisms, we analyzed the
regulation of the expression of transcription factors involved in retinal
differentiation Ptf1a and the regulation of Ptf1a activity by PTF1 complex
cofactors.
Methods: Mutated forms of Ptf1a that are unable to interact with RBPJ and/or
RBPL were generated by PCR-based mutagenesis. Similarly mutated forms that
cannot heterodimerize with E-proteins were generated. Using a retrovirus-mediated
gene transfer approach, the mouse Ptf1a and these mutant forms of Ptf1a were
overexpressed during chick retinogenesis. The expression level of a set of
transcription factors was evaluated by qPCR. Atoh7 regulation was further assayed
by ISH and by coexpression of theses mutants with a reporter of atoh7 promoter
activity.
Results: Ptf1a misexpression was sufficient to promote the fates of amacrine and
horizontal cells from retinal progenitors and inhibit retinal ganglion cell and
photoreceptor differentiation in the chick retina. Ptf1a overexpression resulted in a
rapid downregulation of the transcription of genes involved in the photoreceptor
and ganglion cell lineage differentiation. Conversely, the transcription of genes
involved in the generation of amacrine and horizontal cells were upregulated.
Atoh7, a transcription factor involved in ganglion cell specification was found to be
strongly repressed by 6.4-fold by Ptf1a overexpression. This was confirmed by
ISH. Consistently, ex vivo, ectopic Ptf1a downregulated the activity of the chick
Atoh7 promoter. Using this reporter assay, we further demonstrated that the
binding of RBPJ to Ptf1a was necessary to inhibit atoh7 expression.
Conclusions: Our data provide a novel insight into the molecular basis of Ptf1a
activity on early cell specification in the chick retina. Particularly, it supports a
molecular model where Ptf1a might enable the recruitment of a pool of Atoh7positive precursors and drive them towards amacrine and HC fates.
Commercial Relationships: Xavier P. Guillonneau, None; Elise C. Lelievre,
None; Laura Houille-vernes, None; Amelie Slembrouck, None; Jerome E.
Roger, None; Olivier Goureau, None; Finn Hallböök, None; Jean-Marc Matter,
None; Florian Sennlaub, None
Support: INSERM, Retina France, EU (LSHG-CT-2005-512036, ERC-StG210345), French ANR (ANR-Geno-031-03, ANR-08-MNPS-003)
Program Number: 426 Poster Board Number: D1049
Presentation Time: 8:30 AM - 10:15 AM
Activation Of The p38 MAP/kinase Pathway Is Required For Retinoic Acid
Effects On Retina Photoreceptors
Luis E. Politi1,2A, Pablo De Genaro1, Maria V. Simon1,2, Nora P. Rotstein1,2A.
1
Neurobiology, Inst de Invest Bioquimicas, Bahia Blanca, Argentina; ABiology,
2
Universidad Nacional del Sur, Bahia Blanca, Argentina.
Purpose: Retinoic acid (RA) has a pivotal role in promoting cell differentiation in
several tissues. This vitamin A metabolite is critical during the development of the
nervous system, including the retina. In addition, RA has been shown to induce
apoptosis in diverse cell types. However, the mechanisms by which RA induces
these seemingly contradictory effects remain elusive. We here investigated these
effects of RA in rat retina neurons.
Methods: Pure neuronal cultures prepared from rat retinas were grown in
chemically defined media and supplemented at day 0 with RA, with or without
docosahexaenoic acid (DHA), a survival lipid molecule for photoreceptors (PHRs).
To evaluate p38 involvement in RA effects, phosphorylated-p38 levels were
determined; cultures were also treated with or without SB203580, a p38 specific
inhibitor, before RA addition. Several parameters of differentiation and apoptosis
were evaluated at different times in vitro. The effect of the pan caspase inhibitor ZVAD-FMK on apoptosis was also determined.
Results: RA significantly increased opsin and peripherin expression in PHRs and
stimulated axon outgrowth in PHRs and amacrine cells. RA selectively increased
apoptosis of PHRs by day 3 in vitro, which was prevented by pre-treatment with
the caspase pan-inhibitor Z-VAD-FMK. RA effects on opsin expression and
apoptosis were mediated by activation of the p38-MAPK pathway; RA promoted
p38 phosphorylation, whereas SB203580 blocked these effects, without affecting
axon outgrowth. Noteworthy, RA early induction of apoptosis was prevented by
supplementing the cultures with DHA.
Conclusions: This work shows that RA promoted differentiation in PHR while
simultaneously inducing an early onset of apoptosis. Both effects were mediated by
activation of the p38-MAPK pathway, whereas RA stimulation of axon outgrowth
was not, implying that RA simultaneously activated different signaling pathways in
retinal neurons. DHA prevention of RA-induced apoptosis suggests that RA might
activate apoptosis in PHRs with a deficient supply of trophic factors, underscoring
the need of an exquisite coordination in the supply of these factors. Thus, the dual
effects of RA might help to establish the final number of photoreceptors during
retina development.
Commercial Relationships: Luis E. Politi, None; Pablo De Genaro,
None; Maria V. Simon, None; Nora P. Rotstein, None
Support: ANPCYT, PICT2006-00711; CONICET; UNS
Program Number: 427 Poster Board Number: D1050
Presentation Time: 8:30 AM - 10:15 AM
Maintenance Of Retinal Progenitors And Multi-lineage Cell Differentiation
Require The Joint Functions Of Homeobox Genes Six3 And Six6 In Mice
Wei Liu1, Xue Li2, Guillermo Oliver3, Ales Cvekl1. 1Department of Ophthal &
Visual Sciences, Albert Einstein College of Med, New York, NY; 2Children's
Hospital Boston, Boston, MA; 3Department of Genetics and Tumor Cell Biology,
St Jude Children's Research Hospital, Memphis, TN.
Purpose: Homeodomain transcription factors Six3 and Six6 (with identical amino
acid sequence in their homoedomains) exhibit temporospatial expression in mouse
Copyright 2012 by the Association for Research in Vision and Ophthalmology, Inc., all rights reserved. For permission to reproduce any abstract, contact the ARVO Office at pubs@arvo.org.
ARVO 2012 Annual Meeting Abstracts by Scientific Section/Group – Biochemistry/Molecular Biology (BI)
retinal development, with the expression of Six3 prior to that of Six6. Importantly,
Six3 and Six6 are co-expressed in the immature and mature retinal progenitor cells.
Conditional inactivation of Six3 at E10.5 retinas in Six6-null mice demonstrated
that functional interactions between Six3 and Six6 are required for retinal
development. We are testing the hypothesis that the maintenance of retinal
progenitors and multi-lineage cell differentiation require the joint functions of
homeobox genes Six3 and Six6 in mice.
Methods: CAGG-CreER or Pax6 α-Cre mice were used to conditionally delete
floxed Six3 at E10.5 retinal cells in Six6 nulls.
Results: Individual inactivation of Six6 or Six3 in E10.5 retinal cells did not cause
any major defect in the identity of retinal progenitors and terminal cell
differentiation. In contrast, simultaneous inactivation of both Six3 and Six6 lead to
the following severe defects in the maintenance of retinal progenitors and multilineage cell differentiation in E14.5 Six3;Six6 null retinas. 1) The expression of
Sox2 (an essential factor that controls the competency of retinal progenitor cells)
and its downstream target Notch1 was severely reduced or ablated. 2) The
expression of Math5, Brn3b and Islet 1 (specific markers for ganglion cell
differentiation) was absent or severely downregulated. In addition, the expression
of Otx2 and Crx (specific markers for early photoreceptor cell differentiation) was
absent or severely reduced. In contrast, the expression of NeuroD (an important
factor that is involved in amacrine cell differentiation) was largely unaffected. 3)
The expression of Otx1 (a specific marker for ciliary margin) and Axin2 (an
endogenous readout of Wnt/β-catenin signaling that promotes ciliary margin cell
fate) was significantly elevated. 4) Pax6 expression (an important transcription
factor that is highly expressed in wildtype ciliary margin and moderately expressed
in retinal progenitor cells (RPCs) and is required for RPC multipotency) was
increased to the level of Pax6 expression in wildtype ciliary margin. This elevated
Pax6 expression in Six3;Six6 null retinas likely reflects Pax6 expression in ciliary
margin. 5) The expression of Rax (an important transcription factor that is required
for optic vesicle formation and Otx2 expression) was largely unaffected.
Conclusions: Maintenance of retinal progenitors and multi-lineage cell
differentiation require the joint functions of homeobox genes Six3 and Six6 in
mice.
Commercial Relationships: Wei Liu, None; Xue Li, None; Guillermo Oliver,
None; Ales Cvekl, None
Support: EYEY12162 (to G. O.), EY012200 (to. A. C.), RPB unrestricted grant
Program Number: 428 Poster Board Number: D1051
Presentation Time: 8:30 AM - 10:15 AM
Investigation Of The Association Between COL2A1 Gene Variants And Lattice
Degeneration Of The Retina
Akira Meguro1, Hidenao Ideta2, Ryuichi Ideta2, Hidetoshi Inoko3, Nobuhisa
Mizuki1. 1Department of Ophthalmology, Yokohama City Univ School of Med,
Yokohama, Japan; 2Ideta Eye Hospital, Kumamoto, Japan; 3Tokai University
School of Medicine, Isehara, Japan.
Purpose: Lattice degeneration of the retina is a vitreoretinal disorder characterized
by a visible fundus lesion predisposing the patient to retinal tears and detachment.
Since it has been suggested that the collagen type II alpha 1 (COL2A1) gene
variants may cause retinal detachment, we investigated whether COL2A1 variants
are associated with lattice degeneration of the retina.
Methods: Five hundred and fifty Japanese patients with lattice degeneration of the
retina and 640 Japanese healthy controls were recruited. We genotyped 9 singlenucleotide polymorphisms (SNPs) in the COL2A1 gene and assessed the allelic
diversity among cases and controls.
Results: The major allele of rs1793953 had a significantly increased risk of lattice
degeneration of the retina (P = 0.018, OR = 1.23, 95% CI = 1.04-1.45) whereas the
other SNPs did not show significant results.
Conclusions: Our results suggest that the COL2A1 gene may play an important
role in the largely unknown pathophysiology of lattice degeneration of the retina.
Commercial Relationships: Akira Meguro, None; Hidenao Ideta,
None; Ryuichi Ideta, None; Hidetoshi Inoko, None; Nobuhisa Mizuki, None
Support: None
Program Number: 429 Poster Board Number: D1052
Presentation Time: 8:30 AM - 10:15 AM
Hes1 Promotes Additional Cell Cycles At Atoh7’S Position
Steven W. Wang1, Ya-Ping Lin1, Rui Chen2, Takae Kiyama1. 1Ophthal & Visual
Science, Univ of Texas Medical Center, Houston, TX; 2Human Genome
Sequencing Center, Baylor College of Medicine, Houston, TX.
Purpose: The purpose of this project is to determine whether retinal precursors can
be coerced to reenter the cell cycle when Hes1 replaces Atoh7. The proneural factor
Atoh7 is required for cell cycle exit and essential for retinal ganglion cell (RGC)
formation. Oppositely, the inhibitor type bHLH factor Hes1 prevents neurogenesis
by promoting cell cycle reentry and inhibiting Atoh7 activation. In normal
neurogenesis, Hes1 is repeatedly recruited for adding cell numbers. Therefore, we
hypothesize that replacing Atoh7 with Hes1 would lead to cell cycle reentry in
retinal precursor cells, and that reactivation of Atoh7 after Hes1’s ectopic action
would restore RGCs in the retina. We provide here in vivo results for testing these
two hypotheses.
Methods: An Atoh7(Hes1/Hes1) mouse line carrying a genetic element of loxPHes1-IRES-dsRed-loxP in place of Atoh7 coding sequence was generated.
Excision of the floxed element would allow an Atoh7-IRES-hrGFP cassette to
resume Atoh7’s position. Retinas at different stages were analyzed using
proliferation markers to access cell cycle reentry. RNA-sequencing and qRT-PCR
were performed to access molecular shifts. The Atoh7(Hes1/Hes1) line was mated
to a Cre-ERTM line to generate a Atoh7(Hes1/Hes1);CreERTM line, in which
Tamoxifen was administered to reactivate Atoh7 for accessing RGC restoration.
Results: The Atoh7(Hes1/Hes1) retinas showed 50% more proliferating cells then
the wildtype retinas during early retinogenesis. In consistent with the cell
proliferation results, the Atoh7(Hes1/Hes1) retinas also had 50% more total retinal
cells then the wildtypes. The high proliferation rate was accompanied by a high
apoptotic rate resulting the thinnest adult retina we’ve ever seen. Results of RNAsequencing and qRT-PCR showed that neurogenic genes were downregulated and
cell cycle promoting genes were upregulated. Tamoxifen administration resulted in
massive RGC restoration, but some axons appeared to be misrouted forming an
ectopic optic disk in each retina examined. It appeared that there was a time shift
for RGC production.
Conclusions: Additional cell cycles can be coerced in retinal precursors by
replacing Atoh7 with Hes1. However, over-proliferated cells cannot survive in such
an aberrant retinal environment in which most cells stall in an undifferentiated, or
“confused,” state. Reactivation of Atoh7 can restore RGC production in vivo with
possible time shift into late retinogenesis.
Commercial Relationships: Steven W. Wang, None; Ya-Ping Lin, None; Rui
Chen, None; Takae Kiyama, None
Support: NIH Grant EY018352, E. Matilda Ziegler Foundation for the Blind, NIH
EY10608, Herman Eye Fund
Program Number: 430 Poster Board Number: D1053
Presentation Time: 8:30 AM - 10:15 AM
Expression Of The Gene Fatty Acid Binding Protein 7 (fabp7) Is Essential For
Embryonic Development Of The Zebrafish (Danio rerio) Retina And Is
Significantly Upregulated During The Regeneration Process In The Injured
Adult Zebrafish Retina
Patrick Yurco. Biological Sciences, Le Moyne College, Syracuse, NY.
Purpose: It is well established that the adult teleost fish neural retina is capable of
significant regeneration following injury. However, we are still discovering the
molecular and genetic determinants of this process. The current study examines the
importance of a target gene, fatty acid binding protein 7 (FABP7), during retinal
regeneration in the adult zebrafish as well as during embryonic development of the
neural retina. Using the techniques stated below, we wanted to determine if FABP7
plays a significant role during development of the fish retina and is necessarily reexpressed during regeneration of the adult fish retina.
Methods: Gene array, real-time qPCR and RT-PCR were utlilized to demonstrate
an increase in FABP7 gene expression following injury of the adult zebrafish retina
and within the developing embryonic retina. In addition, the spatial distribution of
FABP7 was determined using non-isotopic in situ hybridization and
immunohistochemistry (IHC). Subsequently, morpholinos were injected into 2-8
cell stage embryos and in the eyes of adult zebrafish as a means to knock-down
FABP7 expression. Real-time qPCR, RT-PCR, and in situ hybridization along with
IHC were used to examine any expression level changes in embryos and injured
adult retinas following incorporation of FABP7 morpholinos.
Results: Results observed from using the above techniques indicate that FABP7 is
highly expressed during neural retina development and following injury of the adult
zebrafish retina. Injection of morpholinos alters gene expression profiles in the
developing and injured fish retinas, as well as effecting the number of cells
passaging through the cell cycle in the injured retina.
Conclusions: The FABP7gene is highly expressed during embryonic development
of the neural retina and is upregulated in the adult zebrafish retina following injury.
Following MO-FABP7 exposure, alterations in the developing zebrafish retina
suggest a necessary role for FABP7 during formation of the retina and perhaps
during the regeneration process. These results further suggest a recapitulation of
development during the regeneration process of the adult fish retina.
Commercial Relationships: Patrick Yurco, None
Support: None
Program Number: 431 Poster Board Number: D1054
Presentation Time: 8:30 AM - 10:15 AM
Onecut 1 Is Essential For The Genesis Of Retinal Horizontal Cells
Xiuqian Mu1A,2, Fuguo Wu1B, Renzhong Li1B, Sapkota Darshan1A, Shengguo Li3,
Mengqing Xiang3, Steven J. Fliesler4,2, Maureen Gannon5. AOphthalmology and
Biochemistry, BOphthalmology, 1University at Buffalo, Buffalo, NY; 2SUNY Eye
Institute, Buffalo, NY; 3Ctr for Adv Biotech and Medicine, UMDNJ-Robert Wood
Johnson Med Sch, Piscataway, NJ; 4Ophthalmology, SUNY-Buffalo / VA Med
Ctr-Buffalo, Buffalo, NY; 5Molecular Physiology and Biophysics, Vanderbilt
University Medical Center, Nashville, TN.
Copyright 2012 by the Association for Research in Vision and Ophthalmology, Inc., all rights reserved. For permission to reproduce any abstract, contact the ARVO Office at pubs@arvo.org.
ARVO 2012 Annual Meeting Abstracts by Scientific Section/Group – Biochemistry/Molecular Biology (BI)
Purpose: Previously, we showed that the transcription factor Onecut 1 (Oc1) is
expressed in developing horizontal cells (HCs) and ganglion cells (RGCs) in the
mouse retina. Like other retinal cell types, during embryonic development,
horizontal cells arise from multipotent retinal progenitor cells and their genesis is
subject to regulation by transcriptional factors in a hierarchical manner. Here, we
further examined the function of Oc1 in mouse retinal development.
Methods: We conditionally knocked out Oc1 in the developing mouse retina by
crossing an Oc1-flox allele with the Six3-Cre transgenic line and examined the
consequences to retinal development, using histological and immunofluorescence
methods.
Results: Thickness of the outer nuclear layer in the Oc1-null retina was
diminished, relative to age-matched controls. Consistent with this, the majority
(~80%) of HCs were absent in the Oc1 knockout mouse retina at both adult and
embryonic stages, as determined by immunostaining for HC markers, such as
Lim1, Calbindin, NFL, and Pgp9.5, and this reduction was observed as early as
E14.5, implying that Oc1 is essential for the initial genesis of horizontal cells.
However, neither RGCs nor any of the other retinal cell types were affected, as
indicated by the expression of specific markers for those cell types. These results
indicate that Oc1 is a novel regulator for horizontal cell formation. Co-labeling
showed that Oc1 expression overlapped partially with that of other transcription
factors, including FoxN4, Ptf1a, Prox1 and Lim1, required for horizontal cell
development. Analysis of the expression of these factors in Oc1-null and FoxN4null retinas suggested a genetic relationship between Oc1 and other genes, such that
Oc1 is downstream of FoxN4, in parallel with Ptf1a, but is upstream of Prox1 and
Lim1. Studies are in progress, using electron microscopic, electrophysiological and
behavioral methods, to further assess how loss of horizontal cells affects retinal
circuitry and vision.
Conclusions: Oc1 plays an essential role in the development of horizontal cells and
is part of the gene regulatory hierarchy for horizontal cell formation.
Commercial Relationships: Xiuqian Mu, None; Fuguo Wu, None; Renzhong
Li, None; Sapkota Darshan, None; Shengguo Li, None; Mengqing Xiang,
None; Steven J. Fliesler, None; Maureen Gannon, None
Support: NIH Grant EY020545 (XM), EY007361 (SJF); The Whitehall
Foundation (XM); RPB Unrestricted Grant (XM, SJF)
Program Number: 432 Poster Board Number: D1055
Presentation Time: 8:30 AM - 10:15 AM
Induction Of Horizontal Cell Differentiation In Mouse Embryonic Retinal
Cells By Combinatorial Expression Of Foxn4, Prox1 And Sall3
Yukihiro Baba, Sumiko Watanabe. Inst of Medical Science, University of Tokyo,
Minato-ku, Japan.
Purpose: Several transcription factors such as Foxn4, Ptf1a, and Prox1 have been
shown to be essential for horizontal cell fate determination. Subsequently, LIM
class homeodomain transcription factor Lim1 was found to regulate horizontal cell
migration toward the outerneuroblastic layer. However, none of these factors were
sufficient to induce horizontal cells from retinal progenitor cells in mouse. In
addition, we found that the spalt-like zinc finger protein family Sall3 was essential
for maturation of horizontal cells, but again it could not induce horizontal cell fate
by itself. Therefore, it is suggested that combinational function of these
transcription factors may be required for horizontal cell differentiation. To verify
this hypothesis, gain-of-function analysis was performed with transcription factors
in combination to induce horizontal cell differentiation.
Methods: Condition of electroporation was carefully adjusted to achieve multiple
gene introductions to retinal progenitor cells. Various combinations of pCAG
plasmids encoding Foxn4, Ptf1a, Prox1, Lim1, and Sall3 were introduced into
mouse retina at embryonic day 17 by electroporation. After 11 days of explant
culture, the explants were harvested and frozen-sectioned. Retinal sub-types of
gene transfected cells were examined by immunohistochemical analysis using cell
type specific markers. In addition, morphology of transfected cells was observed
after monolayer culture.
Results: Single overexpression of any candidate genes failed to enhance the
expression of horizontal cell markers, in agreement with earlier studies. On the
other hand, combination of Foxn4, Prox1, and Sall3 induced the expression of
horizontal cell markers, NF160, NFL, and Calbindin-D 28k, whereas expression of
other cell type of markers was inhibited. In addition, transfected cells localized at
the appropriate position of mature horizontal cells. Furthermore, transfected cells in
the monolayer culture showed horizontal cell-like morphology, such as long
neurites.
Conclusions: Induction of horizontal cell differentiation was achieved by
combinational expression of Foxn4, Prox1, and Sall3, suggesting that collaborative
function of these genes is essential for horizontal cell differentiation.
Commercial Relationships: Yukihiro Baba, None; Sumiko Watanabe, None
Support: None
127 Retinal Disease: Clinical Studies
Sunday, May 6, 2012, 11:15 AM - 1:00 PM
Hall B/C Poster Session
Program #/Board # Range: 927-980/D971-D1024
Organizing Section: Biochemistry/Molecular Biology
Program Number: 927 Poster Board Number: D971
Presentation Time: 11:15 AM - 1:00 PM
Longitudinal Study Of Retinal Degeneration In An Experimental Retinal
Detachment Model Using Spectral-domain Optical Coherence Tomography
Ronald Lai, Raymond J. Lim, George Wu, Jeff Edelman. Biological Sciences,
Allergan, Inc, Irvine, CA.
Purpose: Detachment of photoreceptors from the retinal pigment epithelium occurs
in retinal disorders, such as retinal detachment and age-related macular
degeneration, resulting in loss of photoreceptors and vision. Using spectral-domain
optical coherence tomography, this study longitudinally examined the course of
photoreceptor degeneration, morphological changes and autofluorescence
appearance in the retina after experimental retinal detachment in rat.
Methods: Retinal detachment was induced in male Brown-Norway rats by
subretinal injection of sodium hyaluronate. On day 0, 1, 3, 7, 14 and 30, eyes of the
animals were examined using confocal scanning laser ophthalmoscopy (cSLO) for
en-face visualization and SD-OCT for cross-sectional imaging of retinal structures
(Heidelberg Spectralis HRA +OCT). Autofluorescence was detected using cSLO in
the AF mode. At each time point, histology was performed on two animals to
correlate structural findings in SD-OCT with microscopic data. TUNEL staining
was used to evaluate cell death. Microglial cells were identified with Isolectin-IB4
labeling.
Results: A partial retinal detachment that occupied about 40-50% of the fundus
was induced in the right eye of each animal. Separation of the neural retina from
the retinal pigment epithelium was confirmed with SD-OCT imaging immediately
after retinal detachment induction. By day 3, significant TUNEL staining and
microglial cells were observed in the photoreceptor layers. At the immediate
junctional detached zone, inner/outer segments (IS/OS) of the detached
photoreceptors appeared longer and extended towards the RPE. Seven days after
detachment, the photoreceptor layer thickness in the detached area was thinner
when compared with that in the non-detached area, while amoeboid-like
autofluorescent structures were present in the detached area. Retinal flatmounts
labeled with Isolectin-IB4 suggested that these autofluorescent bodies were
activated microglial cells, which continued to increase in number and intensity 14
and 30 days after detachment. By day 30, both the photoreceptor layer thickness
and the photoreceptor IS/OS of the detached area were markedly reduced.
Conclusions: SD-OCT provides structural imaging for the extent of photoreceptor
degeneration, while autofluorescence reflects the progress of degeneration by
monitoring activated microglia in the diseased retina. Combining autofluorescence
imaging with SD-OCT imaging is therefore useful in monitoring the in vivo
progress of photoreceptor degeneration and evaluating drug therapy efficacy.
Commercial Relationships: Ronald Lai, Allergan (E); Raymond J. Lim,
Allergan (E); George Wu, Allergan (E); Jeff Edelman, Allergan (E)
Support: None
Program Number: 928 Poster Board Number: D972
Presentation Time: 11:15 AM - 1:00 PM
IOP in Patients after Multiple Ozurdex Implants for Retinal Vein Occlusion
David G. Dodwell, Darrel A. Krimmel. Ophthalmology, Illinois Retina Center,
Springfield, IL.
Purpose: Evaluate the intraocular pressure (IOP) in patients receiving serial
intravitreal Ozurdex (IVO) therapy for macular edema (ME) secondary to branch(BRVO) or central retinal vein occlusion (CRVO)
Methods: Single center, retrospective, consecutive case study of all patients
receiving 2 or more IVO implants for ME secondary RVO, with at least 3
months(mo) follow-up(f/u) after last IVO. Patients were monitored every 3-6
weeks(wk) after IVO with Cirrus HD-OCT(Zeiss). IVO was given in a treat and
extend method with retreatment (re-Rx) after recurrent ME was observed on OCT.
VA, IOP (Tonopen/pneumotonometry) and OCT data were acquired at all visits.
Results: 37 eyes of 37 patients with ME secondary to RVO (8 CRVO, 29 BRVO)
received a total of 165 IVO, mean: 4.5 IVO/patient (2-10) during a mean f/u after
first IVO of 71 wk(26-103). IVO consistently decreased ME on OCT. IVO re-Rx
occurred at a mean of 17.4 wk(9-61) after prior IVO. At first IVO, mean IOP was
14.8 mmHg(9-22) and 10 eyes were on topical glaucoma therapy (27%). Of these,
2 eyes had open angle glaucoma and 8 had triamcinolone (TA)-induced glaucoma
from prior therapy. During f/u of all 37 eyes, the mean highest IOP change from
baseline was +7.46 mmHg (-3-+20). Post-IVO IOP increased ≥10 mmHg in 10
eyes (27%). The mean highest IOP change from baseline in these 10 eyes was
+15.5 mmHg (+11-+20). Of the ten eyes with ≥10 mmHg elevation in IOP, 4 eyes
increased after 1st IVO and 3, 1, and 2 eyes increased ≥10 mmHg after the 2nd,
3rd, and 4th IVO, respectively. 2 of 10 eyes(20%) on topical glaucoma therapy
prior to 1st IVO and 8 of 27(30%) eyes not on glaucoma therapy prior to 1st IVO
had an IOP increase of >10 mm Hg. Topical glaucoma therapy at 1st IVO was not a
Copyright 2012 by the Association for Research in Vision and Ophthalmology, Inc., all rights reserved. For permission to reproduce any abstract, contact the ARVO Office at pubs@arvo.org.
ARVO 2012 Annual Meeting Abstracts by Scientific Section/Group – Biochemistry/Molecular Biology (BI)
risk factor for subsequent IOP elevation post-IVO(t=0.586; p=0.562). 3 eyes had
glaucoma valves implanted: 1 had no history of glaucoma or prior steroid therapy
and 2 had been on 3-4 glaucoma drops for TA-induced glaucoma before IVO
therapy. No patient developed rubeosis iridis.
Conclusions: Topical glaucoma therapy prior to IVO treatment was not a risk
factor for IOP elevation and did not prevent successful serial IVO. Multiple IVO
for ME secondary to RVO, given an average of every 4 months, was safe and
effective. Any Increase in IOP was well controlled and did not prevent continued
IVO. Further study regarding the frequency of IVO for ME secondary to RVO may
be of benefit.
Commercial Relationships: David G. Dodwell, Allergan (C); Darrel A.
Krimmel, None
Support: None
Program Number: 929 Poster Board Number: D973
Presentation Time: 11:15 AM - 1:00 PM
Characterization of the Inflammatory Lesions of Multifocal Choroiditis with
Spectral-Domain Optical Coherence Tomography and Fundus
Autofluorescence Imaging
Naomi R. Goldberg1,2, K. Bailey Freund1,2, Jason Slakter1,2, Richard Spaide1,2.
1
Ophthalmology, Vitreous Retina Macula Consultants of NY, New York, NY;
2
LuEsther T. Mertz Retinal Research Center, Manhattan Eye, Ear, and Throat
Institute, New York, NY.
Purpose: To characterize with high-definition spectral domain optical coherence
tomography (SD-OCT) and fundus autoflourescence (FAF) imaging the various
modes of expression seen in multifocal choroiditis, an inflammatory disease that
has a high risk of secondary choroidal neovascularization.
Methods: This was a retrospective review of consecutive patients with MFC
examined in a large group retina practice based in New York City. All patients
underwent eye-tracked SD-OCT scanning and FAF imaging at baseline and followup. The abnormalities seen with these imaging modalities were correlated with
ophthalmoscopic and angiographic findings.
Results: There were 44 eyes of 27 patients evaluated. The acute inflammatory
lesions of multifocal choroiditis appeared as mounds of homogeneous
hyperreflective material immediately under the retinal pigment epithelium (RPE)
using SD-OCT imaging. These same lesions had surrounding hyperautofluorescent
edges with FAF imaging. In many lesions, the material appeared to erode through
the RPE and infiltrated into the overlying outer retina. Choroidal thickening, loss of
underlying choroidal vascular detail or both were evident below the site of subRPE inflammation only in select lesions. Many of the sub-RPE lesions had no
observable associated choroidal abnormality. Some of the sub-RPE lesions
resolved both with and without treatment, leaving behind intact retina or foci of
outer retinal atrophy with corresponding hypo-autofluorescence on FAF. Other
sub-RPE lesions appeared to evolve into choroidal neovascularization that, unlike
the acute lesions, contained material that had heterogeneous reflectivity. These
lesions often progressed to fibrosis and loss of the overlying photoreceptors as seen
with SD-OCT and reactive changes in the involved RPE appearing as altered FAF
patterns. Recurrences of inflammatory activity caused a reappearance of the subRPE lesions at sites of prior inflammation.
Conclusions: The sub-RPE space is a major site of inflammation for what is called
multifocal choroiditis. SD-OCT, together with FAF, appears useful for
characterizing the various lesions seen in multifocal choroiditis and helping to
identify disease activity and response to treatment, as well as improving our
understanding of the underlying disease pathogenesis.
Commercial Relationships: Naomi R. Goldberg, None; K. Bailey Freund,
None; Jason Slakter, None; Richard Spaide, Topcon Medical Systems (P)
Support: None
Program Number: 930 Poster Board Number: D974
Presentation Time: 11:15 AM - 1:00 PM
Subthreshold Laser Treatment Versus Threshold Laser Treatment for
Symptomatic Retinal Arterial Macroaneurysm
Matteo Prati1, Maurizio B. Parodi1, Pierluigi Iacono2, Umberto De Benedetto1,
Karl A. Knutsson1, Lorenzo Iuliano1, Kontadakis Stylianos3, Francesco Bandello1.
1
Department of Ophthalmology, University Scientific Institute San Raffaele,
Milano, Italy; 2Eye Clinic, Fondazione GB Bietti, Rome, Gorizia, Italy;
3
Department of Ophthalmology, San Raffaele Scientific Institute, Milano, Italy.
Purpose: To compare the effects of subthreshold laser treatment (STLT) with
threshold laser treatment (TLT) in patients affected by symptomatic retinal arterial
macroaneurism (RAM).
Methods: The trial was registered at Clinicaltrail.gov (number NCT01301326).
Patients affected by symptomatic RAM, characterized by exudative manifestations
involving the fovea and best corrected visual acuity (BCVA) worse than 20/80
Snellen equivalent, were recruited. Patients were randomly assigned to STLT or
TLT and regularly followed up for 12 months. Primary outcome measures:
Changes in central point thickness (CPT) at the end of the follow-up. Secondary
outcome measures: Changes in mean BCVA at the end of the follow-up, and
identification of post-laser alterations.
Results: In this single centre, randomized, clinical trial, 12 patients were
randomized to STLT and 13 to TLT. CPT at baseline was 332µm and 341µm,
changing to 249µm and 226µm at the 12-month examination, in STLT and TLT,
respectively, with a statistically significant difference (p<0.001). BCVA changed
from 0.72 to 0.28 LogMAR in the STLT subgroup and from 0.76 to 0.26 LogMAR
in the TLT subgroup with a statistically significant difference (p<0.001). Three
eyes (23%) treated with TLT developed an epiretinal membrane with subjective
metamorphopsia.
Conclusions: This pilot randomized clinical trial shows that similar improvements
in BCVA and CPT can be obtained with both laser approaches. The inferior laser
energy delivered by STLT can reduce the complication rate.
Commercial Relationships: Matteo Prati, None; Maurizio B. Parodi,
None; Pierluigi Iacono, None; Umberto De Benedetto, None; Karl A. Knutsson,
None; Lorenzo Iuliano, None; Kontadakis Stylianos, None; Francesco
Bandello, Alcon (C), Alimera (C), Allergan (C), Bausch & Lomb (C), Bayer (C),
Genentech (C), Novartis (C), Pfizer (C), Theà (C)
Support: None
Clinical Trial: http://www.clinicaltrials.gov, NCT01301326
Program Number: 931 Poster Board Number: D975
Presentation Time: 11:15 AM - 1:00 PM
Reversible and Irreversible Sequelae of Interrupting Anti-VEGF Therapy
Teddy Lyu, Brian Lehpamer, Scott E. Brodie. Ophthalmology, The Mount Sinai
Medical Center, New York, NY.
Purpose: Various strategies have been described for the use of intravitreal AntiVEGF injections in the treatment of macular diseases. These strategies involve
injections of bevacizumab (Avastin®) or ranibizumab (Lucentis®) at monthly,
PRN, or “Inject-And-Extend” intervals. While good outcomes have been reported
following close surveillance and timely treatments, there is limited data describing
the sequalae, reversible or irreversible, from interruptions in therapy. This study
examines the effects of Anti-VEGF treatment interruptions on best-corrected visual
acuity.
Methods: A retrospective chart review included 79 eyes from 76 patients who
received monthly intravitreal injections of bevacizumab (1.25 mg/0.05 mL) or
ranibizumab (0.5 mg/0.05 mL). Of the 79 eyes, 33 eyes were treated for exudative
age-related macular degeneration, 18 eyes were treated for central or branch retinal
vein occlusion, and 28 eyes were treated for clinically significant macular edema.
Inclusion criteria included eyes having had at least three consecutive monthly AntiVEGF injections, an interruption in treatment of at least one month, followed by
three consecutive monthly injections. The following parameters were followed:
mean number of injections, mean duration of Anti-VEGF treatment interruption,
pre-interruption visual acuity, post-interruption visual acuity, final visual acuity.
Visual acuity was measured using the Snellen scale.
Results: The ARMD, Vein Occlusion, and CSME groups received an average of
16.8, 5.28, and 5.29 monthly injections, respectively. The average lengths of
treatment interruption were 4.87 (ARMD), 3.67 (Vein Occlusion), and 2.68
(CSME) months. In the ARMD group, 43% (14/33) suffered a loss of one or two
lines, and 15.2% (5/33) suffered a loss of greater than two lines after treatment
hiatus. In the Vein Occlusion group, 39% (7/18) suffered a loss of one or two lines,
and 11.1% (2/18) suffered a loss of greater than two lines after treatment hiatus.
And finally, in the CSME group, 25% (7/28) suffered a loss of one or two lines,
and 3.6% (1/28) suffered a loss of greater than two lines after treatment hiatus. The
visual acuity loss appears to be irreversible in the majority of cases. Only three eyes
in the ARMD, zero eyes in the Vein Occlusion, and two eyes in the CSME group
recovered to the pre-hiatus visual acuity after resuming monthly injections.
Conclusions: We demonstrated that a substantial percentage of patients who
undergo treatment hiatus are at risk of visual acuity loss. Visual acuity shows some
recovery with resumption of treatment. However, in our subset of patients with loss
of visual acuity after hiatus, the visual acuity loss is mostly irreversible.
Commercial Relationships: Teddy Lyu, None; Brian Lehpamer, None; Scott
E. Brodie, None
Support: None
Program Number: 932 Poster Board Number: D976
Presentation Time: 11:15 AM - 1:00 PM
Long-term Results Of Photodynamic Therapy For Chronic Central Serous
Chorioretinopathy. 3-years Follow-up
Aristides J. Mendoza, Sr., Mónica A. Garay, Yamelys Adasme. Retina & Vitreous
Service, Clinica de Especialidades Oftalmologicas, Porlamar, Venezuela.
Purpose: To report long-term functional and anatomic results of photodynamic
therapy (PDT) with verteporfin for chronic central serous chorioretinopathy
(CSCR).
Methods: A retrospective analysis of 10 eyes of 9 patients with CSCR was
performed. Best Corrected Visual Acuity (BCVA), central foveal thickness, and
angiographic features were evaluated before and after treatment with PDT. 36
months later we compared the same parameters and evaluated new ones, Ishihara´s
test and the photoreceptor inner and outer segment junction line using spectral
domain optical coherence tomography (SD-OCT).
Copyright 2012 by the Association for Research in Vision and Ophthalmology, Inc., all rights reserved. For permission to reproduce any abstract, contact the ARVO Office at pubs@arvo.org.
ARVO 2012 Annual Meeting Abstracts by Scientific Section/Group – Biochemistry/Molecular Biology (BI)
Results: During first controls after PDT, BCVA improved 1 to 6 lines of vision
(Snellen´s chart) in 8 eyes (80%), mean central foveal thickness and macular
volumen decreased in all cases. 36 months later BCVA was unchanged in 5 eyes
(50%) and it reduced 1 to 3 lines of vision in 5 eyes (50%). OCT showed focal
detachment of retinal pigmentary epithelium in 3 eyes (30%), neurosensorial
detachment and choroidal neovascular membranes in 2 eyes (20%). Ishihara´s test
revealed discromatopsy in 3 eyes (30%) and one of this presented severe reduction
in thickness and macular volumen of external retinal layers by SD-OCT.
Conclusions: The long-term efficacy of PDT for chronic central serous
chorioretinopathy is temporary. Larger studies and follow-ups are needed to
assosiate new therapies that provide best results for long time.
Commercial Relationships: Aristides J. Mendoza, Sr., None; Mónica A.
Garay, None; Yamelys Adasme, None
Support: None
Program Number: 933 Poster Board Number: D977
Presentation Time: 11:15 AM - 1:00 PM
Fundus Autofluorescence Imaging Patterns In Central Serous
Chorioretinopathy According To Chronicity
Won June Lee, Byung Ro Lee, Yong Un Shin, Sam Seo. Ophthalmology, Hanyang
Unirversity College of Medicine, Seoul, Republic of Korea.
Purpose: To investigate the patterns of fundus autofluorescence (FAF) in central
serous chorioretinopathy (CSC) according to chronicity.
Methods: Retrospective, observational case series. FAF images from 67
consecutive eyes of 63 patients diagnosed with CSC were retrospectively evaluated
and compared with angiographic and spectral-domain optical coherence
tomography (SD-OCT) findings. Fluorescein angiography and FAF imaging was
performed using an F-10 confocal scanning laser ophthalmoscope (cSLO)
(Nidek,Gmagori, Japan).
Results: Acute CSC eyes (18/21 eyes; 85.7%) were characterized by decreased
FAF intensity at the leakage point or in the area of serous retinal detachment. In
early chronic CSC eyes, increased FAF intensity was seen at the site of serous
retinal detachment in 13/17 eyes (76.5%). Eyes with late chronic CSC had irregular
FAF image patterns with decreased intensity over areas of RPE atrophy in 26/29
eyes (89.7%). In 15 eyes, discrete granules with increased FAF intensity were
observed. In 10 eyes, drainage tracts showed different FAF intensities according to
chronicity that corresponded to the RPE status as determined by SD-OCT.
Conclusions: FAF imaging patterns in CSC eyes differ according to the course of
the disease, reflecting RPE and outer retinal changes. FAF imaging is therefore a
useful noninvasive technique for evaluating the chronicity of CSC.
Commercial Relationships: Won June Lee, None; Byung Ro Lee, None; Yong
Un Shin, None; Sam Seo, None
Support: None
Program Number: 934 Poster Board Number: D978
Presentation Time: 11:15 AM - 1:00 PM
Central Serous Retinopathy in Cancer Patients
Adeel Khan1, Christopher Garrett2A, Bernard F. Godley1, Ghassan Ghorayeb1, Bita
Esmaeli2B, Dan S. Gombos2B, Jade Schiffman2B, Stella K. Kim2B. 1Ophthalmology
and Visual Sciences, UT Medical Branch, Galveston, TX; AGI Medical Oncology,
B
Ophthalmology Section/Head and Neck Surgery, 2UT MD Anderson Cancer
Center, Houston, TX.
Purpose: To describe central serous retinopathy (CSR) in cancer patients from a
tertiary cancer center.
Methods: IRB-approved retrospective review was conducted for patients
diagnosed with CSR from MD Anderson Cancer Center from January 2000- July
2011. Chart review included patients’ demographics, cancer and its treatment
history, ocular presentation, and follow-ups. Literature review was performed for
current data on CSR in cancer patients.
Results: 18 cases were identified with mean follow up of 7.2 months (range 1-18
months) for 13 patients (5 were lost to followup after CSR).The patients’
demographics included age range of 20 to 76 with median age of 42.3 years. 67%
of patients were male and 33% female. Cancer diagnoses included leukemia(8),
lymphoma (2) and 8 solid organ cancers (gastrointestinal(1), breast(1),
testicular(1), lung(1), brain(1), melanoma (1), renal cell (1), tonsillar cancer(1)).
50% of patients were in remission from their cancer and 50% were in active
treatment. 67% of patients were on systemic steroid, 11% patients were on clinical
trial on MEK (mitogen activated protein kinase) inhibitor, and 33% patients
developed CSR without any obvious precipitating medication. One patient had
whole brain radiation including the posterior orbit, without any other evidence of
radiation retinal toxicities. Initial vision ranged from 20/20 to counting fingers.
Diagnoses were made with funduscopic evaluation, fluorescein angiography, and
when available, optical coherence tomography (OCT). Of the 13 patients with
available followup, 69% (9/13) patients had resolution of CSR by mean followup
of 7.6 weeks (range 3-19). Of those with complete resolution, 4/9 patients were
observed without treatment, 3/9 patients required discontinuation of systemic
steroids, 2/9 patients required discontinuation of MEK inhibitors. CSR recurred in
1 patient when MEK inhibitor was restarted at a lower dose but resolved
completely when it was discontinued for the second time. Among the 4 patients
who did not improve during their followup with MDACC, 3 were treated at an
outside facility and 1 died within 1 month. Overall, 44.4% (8/18) patients died with
the mean survival of 4.7 months from the diagnosis of CSR (range 0.4-11). There is
paucity of data regarding CSR in cancer patients in the literature.
Conclusions: CSR in cancer patients are described. This study marks first in the
literature to describe CSR in the cancer population. Systemic steroid appears to
play a role in CSR in majority of the cancer patients who develop CSR. Unlike
systemic steroid, which is a known risk factor of CSR, MEK inhibitor appears to
play a role in the development of CSR, which is also a new finding within the
literature. Further studies are warranted.
Commercial Relationships: Adeel Khan, None; Christopher Garrett,
None; Bernard F. Godley, None; Ghassan Ghorayeb, None; Bita Esmaeli,
None; Dan S. Gombos, None; Jade Schiffman, None; Stella K. Kim, None
Support: Charles H. Griffenberg Memorial Fund
Program Number: 935 Poster Board Number: D979
Presentation Time: 11:15 AM - 1:00 PM
Incidence And Modes Of Exogenous Corticosteroid Exposure Among Patients
Diagnosed With Central Serous Chorioretinopathy
Khoa Lam1, Susanna S. Park2. 1UC Davis School of Medicine, Davis, CA;
2
Department of Opthalmology & Vision Science, Univ of California Davis Eye Ctr,
Sacramento, CA.
Purpose: To assess the incidence and possible modes of exogenous corticosteroid
exposure in patients diagnosed with central serous chorioretinopathy (CSCR).
Methods: A retrospective chart review of all patients diagnosed with CSCR during
the period between 12/2005 - 12/2009 was performed. Information was obtained
with regards to patient demographics and any documented known history of
primary and/or secondary exposure to exogenous corticosteroids.
Results: Medical records of 96 patients diagnosed with CSCR were reviewed.
Patient age ranges from 30 to 77 years (median, 48 years). Seventy-four of 96
patients (77%) are male. Forty-seven of 96 patients (49%) were diagnosed with
their initial episodes. Among the 96 patients, 44 (46%) had documented prior
exposure to exogenous corticosteroid, among which 41 cases (93%) involved
primary exposure whereas 3 cases (7%) resulted from presumed secondary
exposure (e.g. through physical contact or close vicinity to those who have primary
exposure). Among 23 patients with documented discontinuation of corticosteroid
exposure, eighteen (78%) showed clinical improvement and/or eventual resolution.
The modes of corticosteroid exposure are variable as follows: 12 of 44 (27%)
involved topical creams, 29 of 44 (66%) involved inhalants, 11 of 44 (25%)
involved oral medications, 6 of 44 (14%) involved injections (intraarticular,
intramuscular), and 3 of 44 (7%) involved eye drops.
Conclusions: History of exposure to exogenous corticosteroid is common among
patients diagnosed with CSCR. The mode of exposure can be highly variable and
may potentially involve both primary or secondary means.
Commercial Relationships: Khoa Lam, None; Susanna S. Park, None
Support: None
Program Number: 936 Poster Board Number: D980
Presentation Time: 11:15 AM - 1:00 PM
Intravitreal Aflibercept Injection in Central Retinal Vein Occlusion: 1-year
Results of the Phase 3 COPERNICUS Study
David M. Brown1, Julia A. Haller2, David S. Boyer3, Jeffrey S. Heier4, W. L. Clark5,
Alyson J. Berliner6, Robert Vitti6, Oliver Zeitz7A, Rupert Sandbrink7B. 1Retina
Consultants of Houston, Houston, TX; 2Ophthalmology, Wills Eye Institute,
Philadelphia, PA; 3Ophthalmology, Retina Vitreous Assoc Med Group, Los
Angeles, CA; 4Ophthalmic Consultants of Boston, Boston, MA; 5Palmetto Retina
Center, West Columbia, SC; 6Ophthalmology, Regeneron, Tarrytown, NY; AGlobal
Clinical Development, BGCD TA NOHI, 7Bayer HealthCare, Berlin, Germany.
Purpose: To assess the efficacy and safety of intravitreal aflibercept injection (IAI)
in patients with macular edema secondary to central retinal vein occlusion
(CRVO).
Methods: This was a randomized, double-masked, Phase 3 study in which patients
received 6 monthly injections of either 2 mg IAI (VEGF Trap-Eye; 114 patients) or
sham injections (73 patients). From Week 24 to Week 52, all patients received 2
mg IAI as-needed (PRN) according to retreatment criteria. The primary endpoint
was the proportion of patients who gained ≥15 ETDRS letters from baseline at
Week 24. Additional secondary visual, anatomic, and Quality of Life NEI VFQ-25
outcomes at Weeks 24 and 52 were also evaluated.
Results: At Week 24, the primary endpoint showed a statistically significant
difference between the two groups: 56.1% of IAI patients gained ≥15 ETDRS
letters from baseline vs 12.3% of sham patients (P<0.0001). Similarly, at Week 52,
55.3% of IAI/IAI PRN patients gained ≥15 letters vs 30.1% of sham/IAI PRN
patients (P<0.01). At Week 52, IAI/IAI PRN patients gained a mean of 16.2 letters
of vision vs 3.8 letters for sham/IAI PRN (P<0.001). Mean number of injections
was 2.7 for IAI/IAI PRN vs 3.9 for sham/IAI PRN. Mean change in central retinal
Copyright 2012 by the Association for Research in Vision and Ophthalmology, Inc., all rights reserved. For permission to reproduce any abstract, contact the ARVO Office at pubs@arvo.org.
ARVO 2012 Annual Meeting Abstracts by Scientific Section/Group – Biochemistry/Molecular Biology (BI)
thickness was -413.0 µm for IAI/IAI PRN vs -381.8 µm for sham/IAI PRN.
Proportion of patients with ocular neovascularization at Week 24 were 0% for IAI
patients and 6.8% for sham patients, respectively; at Week 52 after receiving IAI
PRN, the proportions were 0% and 6.8% for IAI/IAI PRN and sham/IAI PRN
patients. At Week 24, the mean change from baseline in the VFQ-25 total score
was 7.2 vs 0.7 for the IAI and sham groups; at Week 52, the scores were 7.5 vs 5.1
for the IAI/IAI PRN and sham/IAI PRN groups. Most common adverse events
among all patients were conjunctival hemorrhage, visual acuity reduced, and eye
pain.
Conclusions: Monthly dosing with 2 mg intravitreal aflibercept injection in
patients with macular edema secondary to CRVO resulted in a statistically
significant improvement in visual acuity at Week 24 that was maintained through
Week 52 with PRN dosing compared with control sham/IAI PRN treatment.
Intravitreal aflibercept injection was generally well tolerated and had a generally
favorable safety profile.
Commercial Relationships: David M. Brown, Allergan (C), Genetech (C),
Regeneron (F, C); Julia A. Haller, Allergan (C), Genentech (C), Regeneron (C,
R); David S. Boyer, Regeneron (C); Jeffrey S. Heier, Allergan (C), Genentech
(C), Regeneron (C); W. L. Clark, Genentech (C), Regeneron (F, C); Alyson J.
Berliner, Regeneron (E); Robert Vitti, Regeneron (E); Oliver Zeitz, Bayer
HealthCare (E); Rupert Sandbrink, Bayer HealthCare (E)
Support: None
Clinical Trial: http://www.clinicaltrials.gov, NCT00943072
Program Number: 937 Poster Board Number: D981
Presentation Time: 11:15 AM - 1:00 PM
Time-periodic Characteristics In The Morphology Of Central Serous
Chorioretinopathy Evaluated By Cube Volume Scan Using Spectral Domain
Optical Coherence Tomography
sam seo, Byung Ro Lee, Yong Un Shin, Won june Lee. ophthalmology, hanyang
university hospital, seoul, Republic of Korea.
Purpose: To investigate the time-period characteristics associated with
morphologic changes incentral serous chorioretinopathy (CSC) using cube volume
scans acquired by spectral-domainoptical coherence tomography(SD-OCT).
DESIGN: Retrospective, Observational case series.
Methods: Patients underwent visual acuity measurement, fundus examination,
fluorescein angiography (FA), indocyanin green angiography (IA), and SD-OCT
cube volume scans. Patients were classified into three groups according to the onset
of subjective symptomsof 6 weeks and 6 months. SD-OCT findings among the
three groups were evaluated and compared.
Results: A total of 45 eyes from three groups of 15 patients each were included in
the study.Shallow retinal detachment was observed significantly more in eyes with
late chronic CSC than in eyes with acute and early chronic CSC (P=0.001, 0.021,
respectively). Shallow irregular pigment epithelial detachment (PED) was observed
significantly more in eyes with early chronic CSC than in eyes with acute and late
chronic CSC (P=0.035, 0.035, respectively). Flat PED was observed significantly
more in eyes with late chronic CSC than in eyes with acute and early chronic CSC
(P=0.035, 0.035, respectively). Posterior granulations or subretinal precipitations
were observed significantly more in eyes with early chronic and late chronic CSC
than in eyes with acute CSC (P=0.021, 0.003, respectively). Fibrinous exudates
were observed significantly more in eyes with early chronic CSC than in eyes with
acute CSC (P=0.017).
Conclusions: Detailed investigation of the RPE and outer retina using SD-OCT
could help estimate the duration of CSC.
Commercial Relationships: sam seo, None; Byung Ro Lee, None; Yong Un
Shin, None; Won june Lee, None
Support: None
type, followed DIF, PLH, and CME type while in the secondary ERM group, the
order was VMT, DIF, CME and PLH type. Mean CMT change was best in VMT
type, followed CME, DIF, and PLH type irrespectively etiology. Eye with
disruption of IS/OS junction disruption had lower postoperative BCVA and there
was better correlation in the idiopathic ERM group than secondary ERM between
status of IS/OS junction and VA improvement. In the idiopathic ERM group,
Postoperative BCVA was better in subgroup of combination of bevacizumab than
subgroup of only ERM peeling. Especially, combination of bevacizumab had
significantly better effect in the DIF type ERM than any other type.
Conclusions: Morphologic classification in ERM seen on OCT and IS/OS junction
status may be a predictive factor for surgical outcomes irrespectively etiology. In
addition, concomitant administration of bevacizumab after ERM peeing may help
to improve surgical outcomes in the idiopathic ERM, especially diffuse type.
Commercial Relationships: Jung Min Park, None; Sang Jin Seo, None; Soo
Jung Lee, None
Support: None
Program Number: 939 Poster Board Number: D983
Presentation Time: 11:15 AM - 1:00 PM
Inconsistency in laboratory testing in a subset of patients with Retinal Vein
Occlusion (RVO): Bilateral disease or age 55 years or less
David E. Fingerhut1A, Peng Zhao1B, Lucia Wolgast1C, Jacob Rand1C, Umar Mian1A.
A
Ophthalmology, BEinstein College of Medicine, CHematology, 1Montefiore
Medical Center, Bronx, NY.
Purpose: To evaluate the patterns of lab testing and abnormalities in patients with
high risk of vascular or hematologic diseases with RVO.
Methods: Retrospective chart review for patients with ICD-9 code 362.35 & 36 at
Montefiore Medical Center from 6/08 to 7/11. Patients were included if under age
56 years or with bilateral disease.
Results: Of 232 patients with the diagnosis of RVO, 5%(11) had bilateral disease
(bilateral) and 15% (35) were under 56 yrs (younger). In the younger group, 37%
had CRVO, 25% had BRVO, and 6% had HRVO. In the bilateral group, out of 22
eyes, there were 5 (22.7%) CRVO, 10 (45.5%) BRVO, and 7 (31.8%) HRVO. With
respect to coagulation testing, no labs were drawn in 3/35 (8.6%) of the younger
and 5/11 (45.5%) of the bilateral. TABLE Other labs that were normal included:
ANA, plasminogen, anticardiolipin (IgG/M), anti-thrombin III, factor V Leiden,
protein C, protein S, and sickle cell trait. These tests were done in 3 to 20% of the
younger patients.
Conclusions: In this series, a very high percentage of young patients had RVO.
Hypertension (HTN) was the most common co morbidity in both groups and seen
in only 1/3 of patients; hyperlipidemia and diabetes were next most common in the
bilateral group and younger group, respectively. Two patients did not have any comorbidities. None of the patients had any vasculitic or hematologic diseases. No
consistent pattern of lab testing was asertained. Nearly all younger patients had
some coagulation tests sent. Nearly 50% of bilateral disease had no thrombophilia
testing performed. Most tests for specific diseases were negative. These results
indicate a lack of standard approach to diagnostic testing and very poor test
positivity. There is a need to develop a pertinent and standardized set of test for
Program Number: 938 Poster Board Number: D982
Presentation Time: 11:15 AM - 1:00 PM
Surgical Outcomes According To Morphologic Differences In ERM On OCT
And Effect Of Combination Of Bevacizumab With ERM Peeling
Jung Min Park1, Sang Jin Seo1, Soo Jung Lee2. 1Ophthalmology, Maryknoll,
Busan, Republic of Korea; 2Ophthalmology, Haeundae Paik Hospital, Inje
University College of Medicine, Busan, Republic of Korea.
Purpose: To evaluate whether morphologic in ERM seen on OCT may help predict
surgical outcomes and Effect of Bevacizumab combination with ERM peeling on
each ERM type.
Methods: 81 eyes of 79 patients with ERM who underwent vitrectomy for ERM
peeling were retrospectively reviewed. We classified ERM into idiopathic &
secondary according to etiology, and according to preoperative macular contour on
OCT, categorized into 4-types(Diffuse, Cystoid macular edema, Pseudolamellar
hole, Vitreomacular traction type). Moreover, IS/OS junction status was
investigated on OCT. Additionally, we compared surgical outcomes between group
of only ERM peeling and group of combination bevacizumab. Main outcome
measurements were central macular thickness (CMT) and best-corrected visual
acuity (BCVA).
Results: In the Idiopathic ERM group, Mean BCVA change was best in the VMT
Copyright 2012 by the Association for Research in Vision and Ophthalmology, Inc., all rights reserved. For permission to reproduce any abstract, contact the ARVO Office at pubs@arvo.org.
ARVO 2012 Annual Meeting Abstracts by Scientific Section/Group – Biochemistry/Molecular Biology (BI)
these patients.
Commercial Relationships: David E. Fingerhut, None; Peng Zhao,
None; Lucia Wolgast, None; Jacob Rand, None; Umar Mian, None
Support: Unrestricted RPB grant
Program Number: 940 Poster Board Number: D984
Presentation Time: 11:15 AM - 1:00 PM
Vitelliform Maculopathy And Hypernormal Erg: Ophthalmic And Systemic
Intrafamilial Phenotipic Variability In Melas Mitochondriopathy
Fernanda B. Porto1,2, Juliana Gurgel-Giannetti2, Shirley A. Sampaio1. 1Centro
Oftalmologico de Minas Gerais, Belo Horizonte, Brazil; 2Hospital das Clínicas
UFMG, Belo Horizonte, Brazil.
Purpose: To report ocular findings in the mitochondrial encephalomyopathy, lactic
acidosis, and stroke-like episodes (MELAS syndrome) in a family with MTTL1
mutation.
Methods: Each patient underwent full ophthalmic examination after providing
informed consent. Full-field (ff) ERG was performed with contact lens recording
electrodes and incorporated the ISCEV Standards. Further tests performed included
multifocal (m) ERG according to the ISCEV guidelines, fundus autofluorescence
imaging (FAI), optical coherence tomography (OCT) and fundus fluorescein
angiography.
Results: A 30 year-old man developed ataxia and mioclonal epilepsia. He
presented six stroke-like episodes in the last 2 years. He showed a myopathic
pattern on EMG and ragged-red fibers on muscle biopsy. Ophthalmic evaluation
disclosed yellow lesions in the macula resembling an adult-onset vitelliform
macular dystrophy and peripheral pigmentary retinopathy in his both eyes. FAI
showed increased hyperfluorescence with presumed lipofuscin accumulation. OCT
demonstrated accumulation of material in the sub-neurosensorial retinal space; the
photoreceptor and outer plexiform layers thickness were irregular at the extrafoveal
region, where there was deletion of the MLI. ffERG had diminished scotopic and
photopic responses. mfERG revealed central and peripheral reduction of function.
Her sister was a 21-year-old woman with sensorineural deafness since 9-year-old.
RNM, EMG and muscle biopsy were normal. She presented no ophthalmic
symptoms. Full-field ERG was supranormal. mfERG revealed central preservation
of function and reduction of function in the periphery . FAI was normal. OCT
revealed extrafoveal deletion of the MLI and irregular thickness of the
photoreceptor and outer plexiform layers.
Their mother presented sensorineural deafness, cardiomiopathy and diabetes. She
was suddenly dead at 45 years old.
Conclusions: MELAS syndrome is a genetically heterogeneous mitochondrial
disorder with a variable clinical and ophthalmic phenotype, as we present herein.
The retina, in particular the retinal pigment epithelium, is involved by MTTL1
defect, and patients with MELAS phenotype should be examined for the presence
of retinal manifestations, even if they are asymptomatic. The supranormal ERG
responses suggests that MTTL1 may also interfere hyperpolarizing bipolar cells
function. Hipernormal ERG’s have been associated with cone distrophy in humans
as well as in mtDNA Ant1-deficient mice. On the other hand, there have been no
previous reports of such vitelliform macular lesion occurring in association with
MELAS syndrome.
Commercial Relationships: Fernanda B. Porto, None; Juliana GurgelGiannetti, None; Shirley A. Sampaio, None
Support: None
Program Number: 941 Poster Board Number: D985
Presentation Time: 11:15 AM - 1:00 PM
Persistent Fetal Vasculature Syndrome: Unilateral or Bilateral?
Jackson F. Lever1, Caesar Luo2, Annahita Amireskandari2, Kimberly Drenser2.
1
Beaumont Eye Institute, William Beaumont Hospital, Royal Oak, MI; 2Associated
Retinal Consultants, Royal Oak, MI.
Purpose: Describe the contralateral findings in presumed unilateral persistent fetal
vasculature syndrome (PFVS) through clinical examination and fluorescein
angiography in one institution.
Methods: Retrospective case series of patients presenting to a single institution
between 2007-2010 with PFVS as final diagnosis. Outcomes included patient
demographics, clinical findings in both eyes, and fluorescein angiographic
interpretations in both eyes.
Results: All patients referred to Associated Retinal Consultants with the diagnosis
of PFVS were analyzed. 41 patients were identified. 25 (61%) were male and 16
(39%) were female. The average age was 11.6 months, with a range from 3 days to
8 years. 12 patients (29.3%) demonstrated bilateral PFVS and were excluded. Of
the remaining 29 patients with unilateral PFVS, 11 patients underwent bilateral
fluorescein angiography. Of these 11 patients, all uninvolved eyes were reported by
clinical exam to be normal. 6 of these patients (54.5%) showed abnormal
fluorescein angiographic findings, including abnormal foveal avascular zone with
blunted capillary buds (n=4), incomplete peripheral vascularization or capillary
dropout (n=4), and peripheral arteriovenous shunting (n=1).
Conclusions: PFVS has been regarded as primarily unilateral in approximately
90% of patients. Our series demonstrates that bilateral angiographically evident
abnormalities may be higher than previously reported. Long term clinical relevance
of these findings remains to be seen. This series may also serve to further enhance
the normative database of fluorescein angiography and elucidate pathologic vs.
normal developmental angiographic changes.
Commercial Relationships: Jackson F. Lever, None; Caesar Luo,
None; Annahita Amireskandari, None; Kimberly Drenser, None
Support: None
Program Number: 942 Poster Board Number: D986
Presentation Time: 11:15 AM - 1:00 PM
Photoreceptor Cell Death in Low Light Retinal Exposure
Maria A. Contin, Milagros Arietti, Mario E. Guido. Biological ChemistryCIQUIBIC, Univ Nacional de Cordoba, Cordoba, Argentina.
Purpose: Retinal degenerations, including Retinitis Pigmentosa (RP) and vitamin
A deficiencies, exhibit progressive death of rod and cone photoreceptors with
subsequent loss of vision. Typical symptoms are night blindness, decreases in
visual field and eventually blindness. In some types of RP as well as vitamin A
deficiencies, photoreceptor death is due to constitutive activation of the
phototransduction pathway, but the biochemical events underlying apoptosis are
presently unknown. To answer this question, we are studying the molecular
mechanisms involved in retinal degeneration in Wistar rats kept in moderate light
(200 lux) to activate phototransduction continuously for different periods of time.
Methods: Wistar rats were exposed to constant illumination with cool white
fluorescent light (LL) of 200 lux for 1 to 10 days and compared with controls kept
in the dark (DD) or exposed to a regular 12:12 h (LD) cycle. One eye from each rat
was used for inmunohitochemical and quantitative morphometric analysis and the
other for biochemical assays (western blot, Flow Cytometry Caspasa-3 assay).
Results: Histological analysis showed a significant reduction of the outer nuclear
layer (ONL) after 4 days of LL as compared with LD or DD controls. Retinal
analysis by flow cytometry showed apoptosis in light-exposed rats. Moreover there
was a progressive collapse of the outer segments (OS) and inner localization of
rhodopsin immunoreactivity in the photoreceptor somas during LL exposure. The
study of activated caspasa-3 by western blot and enzymatic kit assay demonstrated
a caspase 3-independent mechanism.
Conclusions: These findings strongly indicate that low LL exposure induced
retinal damage involving an apoptotic, caspase-3 independent mechanism as
compared with LD controls, with a significant reduction of the photoreceptor cell
layer and mislocalization of rhodopsin after 4 days of treatment. The understanding
of the molecular mechanism leading to the low light intensity damage in albino rats
can provide valuable insights for the first time about signal photoreceptor death
through the activation of downstream signal phototransduction processes.
Commercial Relationships: Maria A. Contin, None; Milagros Arietti,
None; Mario E. Guido, None
Support: None
Copyright 2012 by the Association for Research in Vision and Ophthalmology, Inc., all rights reserved. For permission to reproduce any abstract, contact the ARVO Office at pubs@arvo.org.
ARVO 2012 Annual Meeting Abstracts by Scientific Section/Group – Biochemistry/Molecular Biology (BI)
Program Number: 943 Poster Board Number: D987
Presentation Time: 11:15 AM - 1:00 PM
Intravitreal Ranibizumab For Choroidal Neovascularisation In Fundus
Flavimaculatus
Sorinela Roata, Belynda Tita, Mounir Drief, Pierre Bonicel. Ophtalmology
Department, Central Regional Hospital Orleans, Orleans, France.
Purpose: We present a case-based study of late-onset fundus flavimaculatus
complicated with choroidal neovascularisation.A treatment with intravitreal
ranibizumab was performed.
Methods: Our patient, a 65 years old woman, has been previously diagnosed with
late onset Stargardt disease upon complete ophtalmologic examination, including
IVFA,EOG and multifocal ERG.We documented juxtafoveolar choroidal
neovascularisation using IVFA and OCT.
A treatment with intravitreal ranibizumab was performed.
Results: We noted the resorbtion of the subretinal fluid and an increase in visual
acuity with disparition of metamorphopsias.
Conclusions: Late age of onset has been reported in 20% of Stargardt cases.The
lipoproteic scrap deposits could induce alterations of the pigmentary epithelium
and Bruch membrane rupture followed by choroidal neovascularisation.This entity
has a slower progression and a better visual prognosis. Treatment by intravitreal
ranibizumab induced total regression of the choroidal neovascularisation.
Commercial Relationships: Sorinela Roata, None; Belynda Tita,
None; Mounir Drief, None; Pierre Bonicel, None
Support: None
Program Number: 944 Poster Board Number: D988
Presentation Time: 11:15 AM - 1:00 PM
Longitudinal Changes Of Retinal Nerve Fiber Layer Thickness In Retinal
Vein Occlusion
kyung sup shin, jung yeul kim, kiyup nam, dong won heo. ophthalmology, Chung
nam national university hospital, Daejeon, Republic of Korea.
Purpose: To analyze longitudinal changes of retinal nerve fiber layer thickness in
retinal vein occlusion using optical coherence tomography.
Methods: The 32 eyes of 32 patients who were diagnosed as branch retinal vein
occlusion and central retinal vein occlusion and followed more than one year were
analyzed. The thickness of retinal nerve fiber layer of normal eye and occluded eye
was measured at the time of first diagnosis, 3 month, 6 month and 12 month using
optical coherence tomography. We compared the changes of the occluded eye
through the follow up period and the differences between the occluded eye and the
normal eye at each period. We also analyzed the counter area of the occluded area.
Results: The thickness of retinal nerve fiber layer in the retinal vein occlusion
decreased significantly at the 1 month, 3 month, 6 month, 12 month compared to
the initial thickness (p<0.05). Also the thickness of retinal nerve fiber layer in the
retinal vein occlusion at 3 and 6 month was not statistically significant between
normal eye and occluded eye, but at 12 month, there was statistically significant
thinning in the occluded eye(p<0.05). Analyzing the counter area of branch retinal
vein occlusion, there was no significant change during the follow up period and no
differences between the occluded eye and the normal eye(p>0.05).
Conclusions: There was significant decrease of retinal nerve fiber layer thickness
over time in the retinal vein occlusion and significant thinning at the 12 month
period compared to the normal eye. Therefore, the finding of thinning area of
retinal nerve fiber layer needs differentiation with glaucoma or associated systemic
disease but should also be considered as natural course after retinal vein
occlusion.
Commercial Relationships: kyung sup shin, None; jung yeul kim, None; kiyup
nam, None; dong won heo, None
Support: None
Program Number: 945 Poster Board Number: D989
Presentation Time: 11:15 AM - 1:00 PM
Comparison Of Histopathological Findings Between Idiopathic And
Secondary Epiretinal Membranes
Mari Ueki1A, Takuji Kurimoto1A, Takaki Sato1A, Eisuke Ishizaki1A, Tsunehiko
Ikeda1B, Yuro Shibayama1C. AOphthalmology, BDepartment of Ophthalmology,
C
Pathology, 1Osaka Medical College, Takatsuki, Japan.
Purpose: Recent studies have shown that Müller glial cells express nestin and
some cell-proliferation factors in monkey and human retinas, thus indicating the
existence of retinal stem cells (Sugiyama et al., 2006, Bhatia et al., 2009). The
expression of nestin is also known to be up-regulated under ischemic and traumatic
pathological conditions of the retina (Xue et al., 2011, Goldenberg et al., 2011).
The purpose of this present study was to examine the possibility that retinal stem
cells contribute to the pathological condition of epiretinal membranes (ERMs). To
test this possibility, immunohistochemistry with nestin, Ki-67, CD34, and glial
fibrillary acidic protein (GFAP) antibodies was performed using idiopathic and
secondary ERM specimens.
Methods: This study involved 10 cases of idiopathic ERMs and 3 cases of
secondary ERMs including 2 eyes that underwent vitrectomy for retinal detachment
(RD)
and 1 eye that underwent vitrectomy for proliferative diabetic retinopathy (PDR).
ERM specimens were obtained during pars plana vitrectomy and immediately fixed
in 10% formalin. Paraffin sections were stained with hematoxylin eosin (HE) and
immunohistochemical analysis was performed with nestin, Ki-67, CD34, and
GFAP antibodies.
Results: HE staining showed that some of the idiopathic ERM specimens consisted
of internal limiting membrane. In contrast, numerous invasive cells were observed
in the specimens of secondary ERMs compared to those of idiopathic ERMs. The
PDR specimen consisted of endothelial cells forming a microvascular cavity.
Immunohistochemical analysis revealed GFAP- positive cells in 4 of the 10
idiopathic ERMs cases and no nestin, Ki-67, or CD34 positive cells in those
10cases. In contrast, CD34-positive cells were observed in all 3 secondary ERMs
cases, yet nestin, Ki-67, and GFAP positive cells were observed only in the 1 case
that underwent vitrectomy for RD. Immunoreactivity in the nestin positive cells
was well matched with that of the Ki-67 positive cells.
Conclusions: The findings of this study indicate that there are different histological
characteristics between idiopathic and secondary ERMs. Immature cells of either
CD34 or nestin positive cells in the retina might be related to secondary ERM
formation.
Commercial Relationships: Mari Ueki, None; Takuji Kurimoto, None; Takaki
Sato, None; Eisuke Ishizaki, None; Tsunehiko Ikeda, None; Yuro Shibayama,
None
Support: None
Program Number: 946 Poster Board Number: D990
Presentation Time: 11:15 AM - 1:00 PM
Changes In Implicit Times of 30 Hz Flicker Electroretinograms After
Photocoagulation In Eyes With Central Retinal Vein Occlusion
Shu Kachi, Shunsuke Yasuda, Hiroaki Ushida, Ruka Uetani, Mineo Kondo, Hiroko
Terasaki. Ophthalmology, Nagoya University, Nagoya, Japan.
Purpose: Neovascular glaucoma (NVG) is a vision-threatening complication of
central retinal vein occlusion (CRVO). The ischemia caused by CRVO leads to an
increase of vascular endothelial growth factor (VEGF) resulting in
neovascularization. Photocoagulation (PC) is performed to prevent the NVG by
reducing the ischemia. The implicit times of 30 Hz flicker electroretinograms
(ERGs) have been shown to be significantly correlated with the ocular VEGF level.
The aim of this study was to determine whether there is any change in the implicit
times of the 30 Hz flicker ERGs after PC in eyes with a CRVO.
Methods: The medical records of 29 consecutive patients with macular edema
secondary to CRVO and had received an intravitreal injection of bevacizumab at
the Nagoya University Hospital from December of 2008 to December of 2010 were
reviewed. The 30 Hz flicker ERGs were recorded and the aqueous humor was
collected just before the injection of bevacizumab. The VEGF concentration in the
aqueous humor was measured by ELISA, and the correlations between the
difference in implicit time of the affected eye and the fellow eye and the VEGF
concentration was calculated. The 30 Hz flicker ERGs were recorded in 9 of 29
patients after PC. For these patients, the implicit times before and after the PC were
compared.
No patient developed neovascularization in the iris or angle.
Results: The mean VEGF concentration of the affected eyes was 620 pg/ml, and
the implicit time of affected eye was 3.40 msec longer than that of the fellow eye in
30 CRVO patients (P <0.0001; Wilcoxon signed rank test). The VEGF
concentration was significantly correlated with difference of the implicit times (p =
0.02; ρ = 0.44; Spearman Rank Correlation coefficient). The mean VEGF
concentration of the affected eyes was 667 pg/ml in 9 patients that the ERGs were
recorded after PC, and the difference of the implicit times between the affected and
fellow eye changed from 4.68 to 1.48 after PC (P = 0.02; Wilcoxon signed rank
test).
Conclusions: The implicit time of 30 Hz ERG was longer in affected eyes
compared with the fellow eyes in CRVO patients, however the difference decreased
by PC treatment. The efficacy of PC for CRVO patients might be evaluated by
determining the implicit times of the 30 Hz ERG.
Copyright 2012 by the Association for Research in Vision and Ophthalmology, Inc., all rights reserved. For permission to reproduce any abstract, contact the ARVO Office at pubs@arvo.org.
ARVO 2012 Annual Meeting Abstracts by Scientific Section/Group – Biochemistry/Molecular Biology (BI)
Commercial Relationships: Shu Kachi, None; Shunsuke Yasuda,
None; Hiroaki Ushida, None; Ruka Uetani, None; Mineo Kondo, None; Hiroko
Terasaki, None
Support: Grant-in Aid 23592563 from the Ministry of Education, Science, Sports
and Culture, Japan
Program Number: 947 Poster Board Number: D991
Presentation Time: 11:15 AM - 1:00 PM
The Phase III MIVI-TRUST Clinical Trial Data: Subgroup Responder
Analysis of a Single Intravitreal Injection of Ocriplasmin in patients with Full
Thickness Macular Hole
Dante J. Pieramici1, David S. Boyer2. 1California Retina Consultants and Research
Foundation, Santa Barbara, CA; 2Ophthalmology, Retina Vitreous Assoc Med
Group, Los Angeles, CA.
Purpose: The purpose of the MIVI-TRUST Phase III program was to investigate
the effect of a single intravitreal injection of ocriplasmin for the resolution of
symptomatic vitreomacular adhesion (VMA). An important secondary endpoint
included non-surgical closure of full thickness macular hole (FTMH). The
pathogenesis of which has been related to the progression of tractional forces
caused by unresolved vitreomacular adhesion.
Methods: 153 of a total 652 treated eyes had FTMH at baseline. Of these, 106 eyes
were randomized to receive a single intravitreal injection of ocriplasmin 125µg
(100µl) and 47 eyes received placebo (100µl). Assessments included best corrected
visual acuity (ETDRS letters), optical coherence tomography and review of adverse
events.
Results: VMA resolution was achieved in 50.0% of ocriplasmin-treated eyes,
compared with 25.5% of placebo-treated eyes (p=0.006). At day 28, 40.6% of the
ocriplasmin-treated eyes demonstrated nonsurgical FTMH closure as compared to
10.6% (p 250 µm, was 58.3% and 24.6%, respectively. Visual acuity improvements
of ≥2 and ≥3 lines in ocriplasmin-treated patients with nonsurgical FTMH-closure
were 76.7% and 51.2%, respectively, at month 6. A majority of adverse events
occurred within the first 7 days of treatment. For example, the incidence of floaters
was 12.9% in the first week and 3.9% between one week and study end at 6
months. No cases of endophthalmitis were observed.
Conclusions: A single intravitreal dose of 125 µg of ocriplasmin achieved FTMH
closure in approximately 40% of patients. Pharmacologic resolution of this
anatomic defect resulted in clinically significant visual acuity benefit in patients
with FTMH. Treatment was well tolerated by patients. Ocriplasmin could provide a
minimally invasive pharmacologic approach to treat patients with FTMH.
Commercial Relationships: Dante J. Pieramici, Alimera (C, R), Allergan (F),
Genentech (F, C, R), Regeneron (F), Thrombogenics (F, C, R); David S. Boyer,
Alcon (F, C, R), Allergan (F, C, R), Genentech (C, R), Genetech (F), iCo (F),
Neurotech (C), Novartis (R), Novartis/QLT (C), Pfizer (R), Regeneron (F, C, R)
Support: None
Clinical Trial: http://www.clinicaltrials.gov, NCT00798317
Program Number: 948 Poster Board Number: D992
Presentation Time: 11:15 AM - 1:00 PM
En-face Imaging With Spectral Domain Optical Coherence Tomography Of
The Intraretinal Cystoid Spaces In Type 2 Idiopathic Macular Telangiectasia,
Diabetic Macular Edema, And Retinal Vein Occlusion
Jaeryung Oh, Jong-Hyun Oh, Seong-Woo Kim, Chungkwon Yoo, Kuhl Huh.
Ophthalmology, Korea Univ College of Medicine, Seoul, Republic of Korea.
Purpose: To compare the morphologic characteristics of the intraretinal cystoid
spaces on en-face images with spectral domain optical coherence tomography (SDOCT) of eyes with type 2 idiopathic macular telangiectasia (MacTel type 2) with
those of diabetic macular edema (DME) and retinal vein occlusion (RVO).
Methods: We obtained en-face images of eyes with MacTel type 2, DME, and
RVO from SD-OCT database. After processing an en-face image with cystoid
spaces into ImageJ, boundary of the cystoid space was determined. Using ImageJ
software, the circularity was measured to represent the boundary shape of the
cystoid space and the mean gray value was measured to represent the reflectivity.
Circularity and mean gray value within the cystoid space were compared between
groups. In eyes with MacTel type 2, cystoid spaces of en-face OCT imaging were
matched on the fluorescein angiography.
Results: Sixteen eyes with MacTel type 2, 21 with DME, and 20 with RVO were
included for analysis. The circularity of the cystoid spaces of MacTel type 2 (mean,
0.491) was lower than those of RVO (0.7333, P<0.001) or DME (0.747, P<0.001).
Mean gray value ratio of the cystoid spaces of MacTel type 2 (12.21) and RVO
(12.74) was lower than one of DME (20.25, P=0.004, P=0.008). In eyes with
MacTel type 2, cystoid spaces were located in foveal center or parafoveal area. All
foveolar cystoid spaces did not have a similar location with the angiographic
leakage.
Conclusions: En-face imaging with SD-OCT showed topographic characteristics
of the cystoid spaces in the eye with MacTel type 2, which was different from those
of RVO or DME.
Commercial Relationships: Jaeryung Oh, None; Jong-Hyun Oh, None; SeongWoo Kim, None; Chungkwon Yoo, None; Kuhl Huh, None
Support: the Korean Health Technology R&D Project, Ministry for Health,
Welfare & Family Affairs, Republic of Korea (A102024)
Program Number: 949 Poster Board Number: D993
Presentation Time: 11:15 AM - 1:00 PM
Experience With Intravitreal Bevacizumab In Pediatric Retinal Disorders
Johnathan D. Warminski, Yu-Guang He. Ophthalmology, UT Southwestern
Medical Center, Dallas, TX.
Purpose: The use of intravitreal bevacizumab (Avastin, Genentech)has expanded
significantly for the treatment of multiple choroidal and retinal diseases in adults,
leading to early use in pediatric patients. Evaluated is the experience with this
medication in pediatric patients for both safety and efficacy
Methods: Review of injections of intravitreal bevacizumab injections at Children's
Medical Center, Dallas, TX and James W. Aston Ambulatory Care Center at UT
Southwestern Medical Center in pediatric patients from 2007 to present. 7 eyes in 5
patients were identified who underwent a total of 39 intravitreal injections.
Injections were performed with 1.25mg (0.05mL of 25 mg/mL) of bevacizumab
intravitreally.
Results: After the injections there was observable clinical improvement in visual
acuity and clinical appearance. Additionally, there were no associated
complications from the procedures and no apparent toxicity of the medication was
observed during follow up assessment
Conclusions: This series of 39 injections adds to the body of evidence that
supports intravitreal bevacizumab as a safe and effective therapy,extends follow-up
intervals, adds additional data to previous case series and describes an additional
use for intravitreal bevacizumab
Commercial Relationships: Johnathan D. Warminski, None; Yu-Guang He,
None
Support: None
Program Number: 950 Poster Board Number: D994
Presentation Time: 11:15 AM - 1:00 PM
Visual Cycle Modulators (VCMs) as Inhibitors of Retinal Neovascularization
Susan H. Henry, Ewa Budzynski, Christine Diamond, Todd Haight, Olena Iatsenko,
Kuo Lee Lieu, Andriy Pashko, Kyoko Mitts, Claes Bavik, Ryo Kubota. Biology,
Acucela Inc, Bothell, WA.
Purpose: To test the efficacy of VCMs as inhibitors of retinal neovascularization
in a mouse model of oxygen-induced retinopathy (OIR) .
Methods: Seven-day-old 129S2/SvPasCrl pups were placed in high oxygen (75%
O2) for 5 days. On day 12, the animals were then placed in room air and dosed
intraperitoneally with ACU-4429 (3mg/kg ), ACU-4935 (0.3mg/kg), positive
control (ruboxistaurin, 10mg/kg), or vehicle daily for 5 additional days. Two hours
after dosing with VCM or vehicle, the pups were bleached with 10 minutes of 5
klux white light. On P17, the animals were euthanized and the eyes were removed
for analysis. Retinas from right eyes were dissected for flat mounts and stained
with isolectin B4. The neovascular area was measured for each animal. The left
eyes were paraffin-embedded, sectioned, and stained with H&E. The average
number of neovascular nuclei was counted for each animal. Differences between
treatment groups were analyzed with one-way ANOVA followed by Tukey’s
Multiple Comparison Test.
Results: Treatment with either one of the VCMs significantly reduced neovascular
area compared to treatment with vehicle. Retinal neovascular area was reduced by
32% with ACU-4429, 23% with ACU-4935, and 29% with ruboxistaurin (positive
control); the mean reduction was significantly (p<0.05), greater with either of the
VCMs than with vehicle and did not differ significantly (p>0.05) between
ruboxistaurin and either of the VCMs.
Conclusions: VCMs seemed to inhibit retinal neovascularization in a mouse model
of OIR and are a promising potential treatment for ischemic retina
neovascularizations such as diabetic retinopathy.
Commercial Relationships: Susan H. Henry, Acucela Inc. (E); Ewa
Budzynski, Acucela Inc. (E); Christine Diamond, Acucela Inc. (E); Todd
Haight, Acucela Inc. (E); Olena Iatsenko, Acucela Inc. (E); Kuo Lee Lieu,
Acucela Inc. (E); Andriy Pashko, Acucela Inc. (E); Kyoko Mitts, Acucela Inc.
(E); Claes Bavik, Acucela Inc. (E); Ryo Kubota, Acucela Inc. (E)
Support: None
Program Number: 951 Poster Board Number: D995
Presentation Time: 11:15 AM - 1:00 PM
Retinal Macroaneurysms - Presentation, Comorbidities, Complications, And
Management
Mihai Mititelu1, Jonathan Naysan1, Ronni M. Lieberman2. 1Ophthalmology,
Hofstra North Shore - LIJ School of Medicine, Great Neck, NY; 2Ophthalmology,
Mount Sinai School of Medicine, New York, NY.
Purpose: Macroaneurysms (MA) are acquired, pathologic dilations of large retinal
arterioles. They may be complicated by macular edema and hemorrhage, which in
turn lead to visual loss. We investigated the impact on vision and the relationship to
systemic and ocular comorbidities in a series of consecutive patients with
macroaneurysms.
Copyright 2012 by the Association for Research in Vision and Ophthalmology, Inc., all rights reserved. For permission to reproduce any abstract, contact the ARVO Office at pubs@arvo.org.
ARVO 2012 Annual Meeting Abstracts by Scientific Section/Group – Biochemistry/Molecular Biology (BI)
Methods: The medical records of patients seen on the Retina service of a large
inner city eye clinic between January 2008 and September 2011 were searched for
the diagnosis of MA. Ten patients (12 eyes) diagnosed with at least one retinal MA
were identified, and the charts analyzed for best corrected Snellen visual acuity
(BCVA) converted to logMar, location of MA, complications, laser treatment, as
well as ocular and systemic comorbidities.
Results: The cohort included six women and four men with an average age of 67.5
years (range 42 - 87 years). Nine eyes had good BCVA at presentation (defined as
20/40 or better). The right eye was more commonly affected (8 eyes), with macular
involvement in 75% of the eyes. The MA was located within 2 disc diameters of
the superotemporal arcade in eight eyes. Eight patients (seven with a diagnosis of
hypertension) suffered complications including clinically significant macular
edema (5 eyes), vitreous hemorrhage (2 eyes) and enlargement of the MA (1 eye).
In three eyes, complications were diagnosed at presentation, while the remainder
developed during follow-up. Out of the seven eyes that were treated with barrier
laser, five were followed-up for an average of 31 months and they all maintained
their initial visual acuity (20/40 or better). Ten of eleven eyes with both
hypertension and MA had ocular vascular comorbidities, most importantly diabetic
retinopathy and retinal vein occlusion.
Conclusions: This pilot study suggests that although macroaneurysms may present
with good BCVA at baseline, they may be associated with significant ocular and
systemic comorbidities. We noted a strong correlation with hypertension, right eye
involvement and superotemporal location. Since less than half of the eyes presented
with one of the potential MA complications at baseline, long term follow-up and
careful attention to the presence of comorbidities and development of
complications of such patients is important. The findings of this study suggest that
early treatment may be useful in preserving vision, especially in eyes at risk for
developing immediate complications threatening vision (clinically significant
macular edema, persistent enlargement and vitreous hemorrhage).
Commercial Relationships: Mihai Mititelu, None; Jonathan Naysan,
None; Ronni M. Lieberman, None
Support: None
Program Number: 952 Poster Board Number: D996
Presentation Time: 11:15 AM - 1:00 PM
0.5 Mg Versus 2.0 Mg Ranibizumab For Macular Edema Due To CRVO
Melvin Rabena, Dante Pieramici, Ma'an Nasir, Alessandro Castellarin, Robert See,
Stephen Couvillion, Nathan Steinle, Robert Avery. California Retina Consultants
and Research Foundation, Santa Barbara, CA.
Purpose: To evaluate the safety and efficacy of 0.5 mg versus 2.0 mg intravitreal
ranibizumab in treatment naïve eyes with macular edema secondary to perfused
central retinal vein occlusion.
Methods: Twenty patients (20 eyes) met eligibility criteria for this prospective
investigator sponsored trial. Eligible eyes were randomized 1:1 to receive 3 initial
monthly injections of either 0.5 mg or 2.0 mg ranibizumab followed by PRN
retreatment was based on evidence of disease activity documented on spectral
domain optical coherence tomography (SDOCT) (e.g., intraretinal fluid, subretinal
fluid and/or cystic changes). The primary outcome measure was mean change in
best-corrected visual acuity using the Early Treatment of Diabetic Retinopathy
Study standardized and refracted visual acuity protocol. Secondary outcome
measures include change in central subfield retinal thickness and number of
treatments. Treating and evaluating physicians were masked to the treatment dose.
Follow up period is 24 months with monthly SDOCT scans and quarterly
fluorescein angiograms.
Results: At baseline, the mean visual acuity score was 49 letters and 56 letters and
the mean central 1mm retinal thickness was 739 microns and 654 microns in the
0.5 mg and 2.0 mg groups respectively. After 3 months follow up, the mean visual
acuity letter score increased from baseline by +23 letters and +19 letters; mean
central subfield thickness decreased by -390 microns and -392 microns in the 0.5
mg and 2.0 mg groups respectively. At month 3, 50% (5/10) of the eyes in the 0.5
mg group required treatment compared to none in the 2.0 mg group. Between
months 3 and 4, the mean change in visual acuity at month 4 was -9 letters and -8
letters; the mean change in central subfield retinal thickness increased by +111
microns and +252 microns in the 0.5 mg and 2.0 mg groups respectively. At Month
4, 80% (8/10) in the 0.5 mg group required treatment and 60% (6/10) needed
additional injections in the 2.0 mg group. No drug-related serious systemic or
ocular events were observed.
Conclusions: Following initial treatment with 0.5 mg or 2.0 mg intravitreal
ranibizumab there were similar visual and anatomical changes in patients with
macular edema due to CRVO. Fewer injections with 2.0 mg ranibizumab were
needed during the retreatment period compared to 0.5 mg ranibizumab. However,
both groups experienced decreased visual acuity and increased retinal thickening
during the PRN retreatment period. Further studies and long-term follow up is
needed to compare injection frequency between doses.
Commercial Relationships: Melvin Rabena, None; Dante Pieramici, Alcon (F),
Alimera (C), Genentech (F, C, R), Thrombogenics (F, C, R); Ma'an Nasir,
Genentech (F); Alessandro Castellarin, Alcon (I), Allergan (R), Genentech (F, R);
Robert See, Genentech (F); Stephen Couvillion, Genentech (F); Nathan Steinle,
Genentech (F); Robert Avery, Alcon (C), Allergan (F, C), Genentech (F, C, R),
Neovista (C), Notal Vision (C), Novartis OSI/Eyetech (C), Ophthotech (F, C),
Pfizer (C), QLT (C)
Support: None
Clinical Trial: http://www.clinicaltrials.gov, NCT01028248
Program Number: 953 Poster Board Number: D997
Presentation Time: 11:15 AM - 1:00 PM
Assessment of Retinal Structural Changes Responsible for Visual Acuity
Worsening in Eyes with Epiretinal Membranes
Iren Szalai1, Erika Tatrai1, Janos Nemeth1, Delia DeBuc2, Gabor M. Somfai1.
1
Department of Ophthalmology, Semmelweis University, Budapest, Hungary;
2
Bascom Palmer Eye Institute, University of Miami Miller School of Medicine,
Miami, FL.
Purpose: To evaluate macular morphological changes associated with poor visual
acuity in eyes with idiopathic epiretinal membrane (ERM) using optical coherence
tomography (OCT) image segmentation.
Methods: Twenty-two patients with idiopathic ERM were enrolled in this study.
Ten eyes had best corrected visual acuity (BCVA) of 0.5 or worse (group A) and
12 eyes had 1.0 BCVA (group B). Twelve eyes of 12 age-matched healthy subjects
served as controls (group C). "Macular thickness map" protocol was obtained by
Stratus OCT in each eye, with subsequent segmentation analysis performed using
OCTRIMA software. The thickness of the intraretinal layers was calculated for the
central ETDRS region, the pericentral and peripheral ETDRS rings. All measured
thickness values were compared among the groups using one-way ANOVA with
Newman-Keuls post-hoc analysis. The correlation between LogMAR BCVA and
the thickness values was assessed using linear correlation.
Results: In the central region, the thickness of the outer nuclear layer (ONL) and
the entire retina was significantly increased in group A and B compared to group C,
and also in group A compared to group B (p<0.01 for all comparisons). The
thickness of each intraretinal layer except the pigment epithelium was significantly
increased in group A compared to both groups B and C in the peripheral and also in
the pericentral rings (p<0.001 for all comparisons). There was also a significant
increase in the thickness of the retinal nerve fiber layer, the inner nuclear layer and
the total retina in group B compared to group C in both the peripheral and
pericentral rings (p<0.01 for all comparisons). The strongest positive correlation
was between logMAR BCVA and the thickness of the ONL and the total retina in
the central region; and the thickness of the ganglion cell layer and inner nuclear
layer complex in the pericentral ring (r=0.84 and p<0.001 for all cases).
Conclusions: Up to now, the photoreceptor inner and outer segment (IS/OS)
junction abnormalities were supposed to play the main role in the process of vision
loss in idiopathic ERM formation; however, our results suggest that the
intermediate layers including the second and third neurons also appear to be
involved. Further studies are needed to approve this theory.
Commercial Relationships: Iren Szalai, None; Erika Tatrai, None; Janos
Nemeth, None; Delia DeBuc, US 61/139,082 (P); Gabor M. Somfai, None
Support: NIH/NEI-EY020607; JDRF 2007-727, NIH Center Core Grant
P30EY014801, Research to Prevent Blindness Unrestricted Grant, Department of
Defense (DOD- Grant#W81XWH-09-1-0675)
Program Number: 954 Poster Board Number: D998
Presentation Time: 11:15 AM - 1:00 PM
Mobile Testing of Visual Function to Refine the "Treat and Extend″ Dosing
Regimen for Anti-Vascular Endothelial Growth Factor Therapy
Sarah Mrejen, K Bailey Freund. ophthalmology, Vitreous Retina Macula
Consultants NY, New-York, NY.
Purpose: To demonstrate how mobile testing of visual acuity and contrast
sensitivity can help to refine the "treat and extend" dosing regimen for anti-vascular
endothelial growth factor (anti-VEGF) therapy in a variety of retinal disorders.
Methods: Patients with retinal fluid on spectral-domain optical coherence
tomography (SD-OCT) following their last anti-VEGF treatment were asked to test
their vision and contrast sensitivity twice daily using a web-based system that
allows for mobile vision testing on an iPhone, iPad or iPod via a downloadable
App. Patients included had macular exudation from neovascular age-related
macular degeneration, diabetic macular edema, or retinal vein occlusion. As the
system updates data in real-time, patients could be recalled prior to their next
scheduled visit if negative changes in visual acuity and/or contrast sensitivity were
detected. Further refinements in the dosing interval were made in order to
determine the "fluid-free" interval between injections.
Results: Visual acuity and contrast sensitivity as measured via the device
correlated well with the presence or absence of fluid on SD-OCT. Patients found
the device easy to use and appreciated that they were empowered to play an active
role in preserving their vision.
Conclusions: Mobile testing of visual acuity and contrast sensitivity may help
determine the "fluid-free" interval between injections of anti-VEGF agents and
refine the "treat and extend" dosing regimen in eyes developing recurrent exudation
between treatments.
Commercial Relationships: Sarah Mrejen, None; K Bailey Freund, Digisight,
Genentech, Regeneron, Alimera (C), Genentech (F)
Copyright 2012 by the Association for Research in Vision and Ophthalmology, Inc., all rights reserved. For permission to reproduce any abstract, contact the ARVO Office at pubs@arvo.org.
ARVO 2012 Annual Meeting Abstracts by Scientific Section/Group – Biochemistry/Molecular Biology (BI)
Support: None
Program Number: 955 Poster Board Number: D999
Presentation Time: 11:15 AM - 1:00 PM
Assessment Of The Spontaneous Closure Of Macular Holes By Spectraldomain Optical Coherence Tomography
Yuko miwa, Sotaro Ooto, Masanori Hangai, Nagahisa Yoshimura. opthalmology,
kyoto univercity, kyoto, Japan.
Purpose: To investigate the retinal microstructures associated with the spontaneous
closure of idiopathic macular holes (MH) using spectral-domain optical coherence
tomography .
Methods: The present study included 61 patients (61 eyes; 27 men and 34 women;
mean age: 64.8 years) with idiopathic MH but without any other macular
abnormality, who visited the Kyoto University Hospital, Kyoto, Japan, between
July 2009 and July 2011. All the patients underwent comprehensive
ophthalmologic examinations, including SD-OCT, before and after closure of the
MH.
Results: The MH closed spontaneously in 9 eyes (15%) and surgically in 52 eyes
(85%). The MH of all stages closed spontaneously (stage 1b: n = 5, stage 2: n = 1,
stage 3: n = 1, stage 4: n = 2). The MH minimum diameter was smaller in eyes with
spontaneously closed MH (52.9 ± 71.3 µm, range 5-182 µm) than in eyes with
surgically closed MH (233.8 ± 179.4 µm) (P < 0.001); however, no significant
differences in the MH basal diameter and MH height were observed between the 2
groups (P = 0.132 and 0.167 respectively). In eyes with spontaneously closed MH,
foveal detachment was observed in 4 eyes (44.4%) at 1 month after MH closure;
however, this detachment disappeared in all eyes at the last visit. The ELM
remained intact throughout the follow-up period after MH closure in all eyes with
spontaneously closed MH. At the last visit, photoreceptor inner/ outer segment
junction (IS/OS) disruption was observed in 3 (33.3%) eyes with spontaneous
closed MH; however, it was smaller (141.7 ± 55.8µm) than that observed in eyes
with surgically closed MH. The mean log-MAR visual acuity improved to 0.086 ±
0.314 after spontaneous closure, compared with that observed before the MH
closure (0.387 ± 0.282) (P = 0.008).
Conclusions: MH with a small minimum diameter may close spontaneously.
Although foveal detachment is observed after spontaneous closure, the
photoreceptor layer structure can be gradually restored.
Commercial Relationships: Yuko miwa, None; Sotaro Ooto, None; Masanori
Hangai, None; Nagahisa Yoshimura, None
Support: None
Program Number: 956 Poster Board Number: D1000
Presentation Time: 11:15 AM - 1:00 PM
Retinal Complications Of Occlusion And Carotid Stenosis
Achraf khabou1A, Nadine Manasseh1A, Benjamin Wolff1A, Mickael Obadia1B, Jose
Alain Sahel1A, Michel Paques1A. ARetina, BNeurology, 1Rothschild Foundation,
Paris, France.
Purpose: The incidence of ophthalmological complications of carotid occlusions is
not known. Recent progress in retinal imaging could allow for a better detection of
early signs of chronic ischemia. Here we documented the incidence of
ophthalmological complications by fundus photographs and optical coherence
tomography (OCT) in patients with severe carotid stenosis or occlusion.
Methods: We prospectively studied patients referred for ophthalmological work-up
of symptomatic occlusion or carotid stenosis (>70%). Fundus examination and high
resolution OCT, cerebral imaging data including magnetic resonance angiogram
imaging (MRA) and transcranial Doppler ultrasonography were reviewed.
Results: 30 patients (10 women and 20 men, mean age 60 +/- 11 years) diagnosed
with carotid occlusion (17 cases) and severe stenosis >70% (13 cases) were
included. A venous stasis retinopathy was found in 2 eyes. OCT depicted atrophy
of the inner nuclear layer in 2 eyes. Angiography (n=7) revealed a major delay in
the filling of retinal vessels in one eye and a blood retinal barrier breakdown in 3
eyes. One eye presented with a retinal cholesterol emboli.
Conclusions: Chronic ocular hypoperfusion related to carotid occlusion is well
tolerated even in the presence of neurological symptoms. Infraclinical
abnormalities such as inner nuclear atrophy and/or blood-retinal barrier breakdown
can be detected despite a normal eye fundus. These signs may therefore be early
indicators of a bad metabolic tolerance to chronic ischemia. Ocular workup of
carotid artery occlusion should therefore incorporate high resolution OCT.
Commercial Relationships: Achraf khabou, None; Nadine Manasseh,
None; Benjamin Wolff, None; Mickael Obadia, None; Jose Alain Sahel,
None; Michel Paques, None
Support: None
Program Number: 957 Poster Board Number: D1001
Presentation Time: 11:15 AM - 1:00 PM
Optic Disc Pits: Clinical Characteristics And Outcomes Of Cases Managed By
Surgery Versus Observation
Jonathan Tzu, Harry W. Flynn, Jr.. Bascom Palmer Eye Institute, Miami, FL.
Purpose: To evaluate a series of patients with optic pit maculopathy in terms of
their clinical characteristics, management strategies, and clinical outcomes.
Methods: A consecutive case series of patients with a diagnosis of optic disc pit at
Bascom Palmer Eye Institute between the years of 2001 and 2011. Data harvested
from the medical record was entered into a computerized database. Patients were
divided into two main groups: 1) patients with optic pit maculopathy that were
observed, and 2) patients with optic pit maculopathy that received surgical
intervention. Main outcome measures included visual acuity and OCT findings.
Other data including age, gender, eye, age of onset, length of follow up, location of
optic pit, and location of fluid by OCT were also recorded.
Results: 18 eyes with an optic disc pit were identified, and of those, 78 percent
(14/18 eyes) had macular involvement. 10/18 optic pits were located
inferotemporally, 6/18 optic pits were located temporally, and 2/18 optic pits were
located inferiorly. Of the optic pits with maculopathy, 71% of the eyes had schisislike cavities, and 29% had only subretinal fluid. 6/14 eyes who were observed had
initial visual acuity 20/80 or better, and 5/14 of observed patients had a final acuity
of 20/80 or better. 4/14 patients received surgery, which included pars plana
vitrectomy, gas tamponade, laser, and subretinal drainage in some cases. 3 of the 4
patients continued to have some persistent retinal fluid after surgery. All patients
undergoing surgery had initial visual acuity worse than 20/100. 1 of the 4 patients
achieved a final visual acuity of better than 20/100 after surgery.
Conclusions: In the current study, patients with good initial visual acuity were
generally observed and remained stable during follow up. Surgical intervention in
eyes with reduced vision produced variable outcomes, with persistent
intraretinal/subretinal fluid being a common occurrence.
Commercial Relationships: Jonathan Tzu, None; Harry W. Flynn, Jr., None
Support: None
Program Number: 958 Poster Board Number: D1002
Presentation Time: 11:15 AM - 1:00 PM
Rebound Effect After Intravitreal Dexamathasone Implant For The
Treatment Of Macular Edema Secondary To Central Retinal Vein Occlusion
Umberto De Benedetto1, Maurizio B. Parodi1, Pierluigi Iacono2, Matteo Prati1,
Fabrizio Scotti1, Giacinto Triolo1, Francesco Bandello1. 1Department of
Ophthalmology, University Scientific Institute San Raffaele, Milano, Italy; 2Eye
Clinic, Fondazione GB Bietti, Rome, Gorizia, Italy.
Purpose: To report on the rebound effect of macular edema (ME) following
dexamathasone implant for the treatment of non-ischemic central retinal vein
occlusion (CRVO).
Methods: Twenty-one patients affected by ME secondary to CRO underwent
intravitreal implant of dexamethasone (700micrograms) on compassionate use
program. The patients were followed up monthly. ETDRS best corrected visual
acuity (BCVA), central foveal thickness (CFT) on OCT, and intraocular pressure
were monthly registered.
Results: BCVA improved in all the cases as well as CRT at months 1, and 2.
Interestingly, CFT turned out to be double with respect to the baseline value at the
month-3 examination visit in 1 case, and another 2 cases at month-4 examination
visit. Visual acuity reduced accordingly to the worsened CFT values. Additional
treatment with intravitreal dexamethasone implant allowed both visual acuity
recovery, and CFT reduction.
Conclusions: Rebound effect can develop after intravitreal dexamethasone implant
for the treatment of ME related to CRVO. Rebound effect does not affect functional
or anatomical recovery when re-treatment is provided. Re-treatment rate with
intravitreal desamethasone implant should be customized according to the patient’s
response.
Commercial Relationships: Umberto De Benedetto, None; Maurizio B.
Parodi, None; Pierluigi Iacono, None; Matteo Prati, None; Fabrizio Scotti,
None; Giacinto Triolo, None; Francesco Bandello, alcon (C), Alimera (C),
allergan (C), bausch & lomb (C), bayer (C), genentech (C), novartis (C), pfizer (C),
theà (C)
Support: None
Program Number: 959 Poster Board Number: D1003
Presentation Time: 11:15 AM - 1:00 PM
Response of Foveal Cysts to Carbonic Anhydrase Inhibitors in X-Linked
Retinoschisis
Syed A. Ali1A, Rajeev K. Seth1B. ADepartment of Medicine, BDepartment of
Ophthalmology and Visual Sciences, 1University of Arizona, Tucson, AZ.
Purpose: To describe the response of foveal cysts to carbonic anhydrase inhibitors
in X-Linked Retinoschisis.
Methods: A 54 year old monocular female with a family history of consanguinity
and X-linked retinoschisis in her son and several other relatives was referred to the
retina clinic after her vision failed to
improve in her left eye after cataract surgery. Her visual acuity was 20/70 on
presentation. X-linked retinoschisis was diagnosed after exam revealed stellate
maculopathy with foveal cysts confirmed by OCT (Image 1), peripheral
retinoschisis, FA revealing no late leakage, and ERG showing loss of B wave
amplitude.
Copyright 2012 by the Association for Research in Vision and Ophthalmology, Inc., all rights reserved. For permission to reproduce any abstract, contact the ARVO Office at pubs@arvo.org.
ARVO 2012 Annual Meeting Abstracts by Scientific Section/Group – Biochemistry/Molecular Biology (BI)
Results: One month after a trial of oral acetazolamide 500mg BID, she noted
subjective visual improvement with acuity of 20/70 ,and the OCT showed
significant improvement in her foveal cyst (Image 2). She was then switched to
topical dorzolamide, and nine months after initiation, her vision remained stable
with no recurrence of the foveal cyst.
Conclusions: Carbonic anhydrase inhibitors can be efficacious in treating the cysts
associated with X-Linked Retinoschisis. Further trials are warranted to ascertain the
efficacy of carbonic anhydrase inhibitors in XLRS.
Commercial Relationships: Syed A. Ali, None; Rajeev K. Seth, None
Support: None
Program Number: 960 Poster Board Number: D1004
Presentation Time: 11:15 AM - 1:00 PM
Glycemic Control And Laser Photocoagulation Outcomes In Diabetic Macular
Edema
Esther S. Lee1, James E. Kempton1, Chengqing Alan Wu2, Armand J. Daccache3,
Ron A. Adelman1, John J. Huang1. 1Dept of Ophthalmology & Visual Sciences,
Yale University School of Medicine, New Haven, CT; 2Celgene Corporation,
Summit, NJ; 3Department of Surgery/ Ophthalmology, VA Connecticut Healthcare
System, West Haven, CT.
Purpose: The leading cause of vision loss in patients with diabetic retinopathy is
diabetic macular edema (DME), and the predominant therapy has been laser
photocoagulation. It is well known that better systemic glucose control, as
measured by hemoglobin A1c (HbA1c), is associated with a reduced risk of
developing DME. However, the potential role of HbA1c level in treatment
outcomes has never been explored.
Methods: Participants underwent laser photocoagulation for DME at the Veterans
Affairs Medical Center (VAMC) in West Haven, CT between October 2004 and
October 2008. Patients were stratified into 3 categories based on their most recent
HbA1c level (within 3 months of laser treatment): good control (HbA1c <7.0%),
moderate control (HbA1c= 7.0-9.0%), and poor control (HbA1c >9.0%). These
HbA1c categories were based on the former Diabetes Control and Complications
Trial. Each treatment session was considered an independent outcome. Visual
acuity (VA) was assessed prior to and then 2-3 months after treatment, with change
in VA defined as the difference in lines of vision on a Snellen chart. VA was
converted to a decimal for calculation purposes then re-converted to standard
Snellen notation. All statistical analysis was performed using SAS 9.2. Statistical
significance was defined as P <0.05.
Results: A total of 282 focal/grid laser therapies were provided to 171 eyes in 125
patients. The average age at the time of treatment was 65.4 ±8.6 years. There were
an average of 1.6 treatments per eye (range 1-7), with a majority of eyes
undergoing just one treatment (n=110). The overall mean change in VA 2-3 months
after treatment was -0.003 ±0.1659 lines, or worsening by 20/7326 ±20/121. There
was no VA change for many treatment sessions (n=97). Change in VA was directly
correlated with patient age at the time of treatment with a correlation coefficient of
0.162 (P=0.0067).
128 treatment sessions were associated with moderate glycemic control, 83 with
good control, and 57 with poor control. HbA1c level and change in VA were found
to be inversely related. The average VA change in the group with good glycemic
control was 0.0126 ±0.16 lines, moderate control was 0.0021 ±0.17 lines, and poor
control was -0.0358 ±0.16 lines. The difference in VA change between good versus
poor glycemic control reached near statistical significance (P=0.0904). However,
treating VA change as a categorical variable showed no significant difference in
VA change among the three glycemic control groups based on Chi-square analysis
(P=0.2188).
Conclusions: Although there was no statistically significant difference in VA
change 2-3 months after laser treatment among patients with DME in the three
glycemic control groups, there was a trend of improved VA in patients with a lower
HbA1c level.
Commercial Relationships: Esther S. Lee, None; James E. Kempton,
None; Chengqing Alan Wu, None; Armand J. Daccache, None; Ron A.
Adelman, None; John J. Huang, None
Support: None
Program Number: 961 Poster Board Number: D1005
Presentation Time: 11:15 AM - 1:00 PM
The Effect Of Bevacizumab On Retinal Ischemia In Central Retinal Vein
Occlusion
Paola A. Salvetti, Laura de Polo, Alessandra Acquistapace, Giovanni Staurenghi.
Dpt of Clinical Science, Eye Clinic Sacco Hospital, Milano, Italy.
Purpose: to evaluate the effect of intravitreal injection of bevacizumab on the onset
and progression of retinal ischemia in central retinal vein occlusion (CRVO)
compared to the natural history of the disease.
Methods: retrospective analysis of fluorescein angiography( FA) images of 16
eyes of 16 consecutive patients with diagnosis of CRVO. Intravitreal injection of
bevacizumab (IVB) was performed in case of macular edema and hemorrhages
persistence and/or patients lost of 3 or more ETDRS lines in visual acuity. The IVB
were performed at the onset or within 3 months diagnosis. We excluded patients
presenting at the onset ischemia or wide hemorrhages hiding ischemic areas and
ischemia related to other retinopathy causes. FA images were analyzed by two
retina specialists (LdP, PS) in order to identify the non-perfusion progression at
baseline and at 1 year follow-up. Agreement by two different operators was
calculated with Cohen’s K test. The progression rate of retinal ischemia during 13month follow-up was analyzed.
According to literature, CRVO was defined ischemic when more than 10 optic disc
areas of retinal capillary non-perfusion were detected. Finally the number of
ETDRS fields involved in the ischemic patient group was analyzed.
Results: the mean number of IVB performed was 2.5 (range 1-5). At 13 month
follow-up 50% of eyes (8/16) developed ischemia in more than 10 optic discs
confluent areas. Besides, the natural history of the disease shows that 27% of
patients develop retinal ischemia after 13 months. The strenght of agreement
between operators was 0.80 = substantial, according to the classification of Landis
and Coch. When considering the subgroup analysis we observed that 13 % (2/16)
of eyes developed mild ischemia (4-5 ETDRS fields involved), 25% (4/16) of eyes
developed ischemia in the entire periphery, 13% (2/16) of eyes developed ischemia
in the entire periphery and in the macula.
Conclusions: in this study the percentage of patients developing retinal ischemia
after IVB was higher compared to the percentage observed in the natural history of
the disease. This may suggest a role of bevacizumab in increasing retinal ischemia.
Further clinical study are needed to evaluate a larger number of patients.
Commercial Relationships: Paola A. Salvetti, None; Laura de Polo,
None; Alessandra Acquistapace, None; Giovanni Staurenghi, Heidelberg
Engineering (C)
Support: None
Program Number: 962 Poster Board Number: D1006
Presentation Time: 11:15 AM - 1:00 PM
Treatment Of Recurrent Macular Edema Secondary To Branch Retinal Vein
Occlusion: A Pilot Study Comparing Subthreshold Grid Laser Treatment And
Intravitreal Bevacizumab
Gianluigi Bolognesi1, Maurizio B. Parodi1, Pierluigi Iacono2, Umberto De
Benedetto1, Alessandro Papayannis3, Matteo Prati1, Francesco Bandello1.
1
Department of Ophthalmology, University Scientific Institute San Raffaele,
Milano, Italy; 2Eye Clinic, Fondazione GB Bietti, Rome, Gorizia, Italy;
3
Department of Ophthalmology, University of Udine, Udine, Italy.
Purpose: Aim of the study is to compare the effects of subthreshold grid laser
treatment (SGLT) and intravitreal bevacizumab injection (IVBI) for the treatment
of recurrent macular edema (ME) secondary to branch retinal vein occlusion
(BRVO).
Methods: Prospective, randomized clinical trial registered at UMIN registry
(number UMIN000005014). Thirty-five eyes of 35 patients were enrolled and
randomly treated with micropulse diode laser (SGLT subgroup) or IVBI (IVBI
subgroup) IVBI (1.25 mg) was given at baseline and then on a pre-re-nata regimen
according to the presence of ME on optical coherence tomography (OCT)
examination performed in scheduled monthly visits over a12-month follow-up.
SGLT was administered once over the follow-up. Main Outcome Measures:
Copyright 2012 by the Association for Research in Vision and Ophthalmology, Inc., all rights reserved. For permission to reproduce any abstract, contact the ARVO Office at pubs@arvo.org.
ARVO 2012 Annual Meeting Abstracts by Scientific Section/Group – Biochemistry/Molecular Biology (BI)
Primary outcome measure was the decrease in mean central foveal thickness (CFT)
on OCT during a 1-year follow-up. Secondary outcomes were the mean BCVA
changes and the proportion of eyes that gained at least 15 letters (approximately 3
lines) at the 12-month examination.
Results: Eighteen and 17 patients were assigned to SGLT and to IVBI subgroups,
respectively. At baseline, the two subgroups were similar with regard to mean
duration of ME, BCVA, and CFT. At month 12, the mean CFT significantly
improved from 484µm to 271µm in the IVBI subgroup, whereas it was unchanged
in the SGLT subgroup. Mean BCVA changed from 0.92±0.3 (LogMAR) to
0.99±0.2 in the SGLT subgroup; in the IVBI subgroup, the mean BCVA showed a
statistically significant improvement from 0.94±0.3 to 0.72±0.2. Ten patients in the
IVBI subgroup (58%) and no patient in the SGLT subgroup gained at least 3 lines
at the end of the follow-up. At the last examination, persistent ME was detected in
all the eyes treated with SGLT, and in 5 eyes (29%) in the IVBI subgroup.
Conclusions: At 1-year follow-up, IVBI resulted in a significant functional and
anatomical improvement whereas the SGLT failed to demonstrate a beneficial
effects. The IVBI could represent a useful approach for the therapy of recurrent ME
secondary to BRVO. However, studies with long-term follow-up are mandatory to
confirm the preliminary results of the current pilot study.
Commercial Relationships: Gianluigi Bolognesi, None; Maurizio B. Parodi,
None; Pierluigi Iacono, None; Umberto De Benedetto, None; Alessandro
Papayannis, None; Matteo Prati, None; Francesco Bandello, Alcon (C), Alimera
(C), Allergan (C), Bausch & Lomb (C), Bayer (C), Genentech (C), Novartis (C),
Pfizer (C), Theà (C)
Support: None
Clinical Trial: UMIN registry, UMIN000005014
Program Number: 963 Poster Board Number: D1007
Presentation Time: 11:15 AM - 1:00 PM
Retinal Ganglion Cell Hypertrophy Demonstrated by Optical Coherence
Tomography in Neimann-Pick Disease
Danielle S. Rudich1A, Christine A. Curcio2, Melissa Wasserstein1B, Scott E.
Brodie1A. ADepartment of Ophthalmology, BDepartment of Genetics and Genomic
Sciences, 1Mount Sinai Medical Center, New York, NY; 2Ophthalmology, Univ of
Alabama at Birmingham, Birmingham, AL.
Purpose: Neimann-Pick disease is a lysosomal storage disease which leads to
multi-organ failure and death at an early age in severe cases. The “cherry red spot”
is the classic retinal finding in patients with Neimann-Pick disease. These retinal
changes are actually annular zones of whitening of the inner retina adjacent to the
fovea, called “macular haloes.” It is believed that the accumulation of undigested
lipid material within retinal ganglion cells leads to hypertrophy and loss of
transparency resulting in the characteristic halo. We have attempted to demonstrate
this ganglion cell hypertrophy by optical coherence tomography imaging (OCT).
Methods: A retrospective case series. Three patients diagnosed with Neimann-Pick
disease who underwent thorough ophthalmologic examination, including spectral
mode OCT (Heidelberg Spectralis) between 2008-2011 at our instititution are
presented.
Results: The first patient was examined at age 34. A striking macular halo was
present. Extensive hypertrophy of the retinal ganglion cell layer was seen by OCT
at the shoulders of the foveal pit, extending centrally. The other two patients were
brothers, examined at ages 5 and 10. The first brother initially presented with subtle
clouding of the perimacular region, a forme fruste of macular halo. This was not
seen at follow up examination 3 years later. His younger brother presented with
perimacular clouding at age 5. In both brothers, a subtle intensification of the
innermost retinal layer was seen in the perifoveal region on OCT.
Conclusions: Optical coherence tomography provides evidence that the clinical
observation of macular haloes corresponds to ganglion cell hypertrophy in patients
with Neimann-Pick disease.
Commercial Relationships: Danielle S. Rudich, None; Christine A. Curcio,
None; Melissa Wasserstein, None; Scott E. Brodie, None
Support: None
Program Number: 964 Poster Board Number: D1008
Presentation Time: 11:15 AM - 1:00 PM
Combination Therapy for Perfused Central Retinal Vein Occlusion (CVO)
Using Intravitreal Ranibizumab and Laser-induced Anastomosis
Brian C. Leonard, Stuart G. Coupland. Eye Institute, University of Ottawa Eye
Institute, Ottawa, ON, Canada.
Purpose: CVO reperfusion following successful laser-induced anastomosis occurs
after a prolonged interval of vascular remodeling, during which an irreversible
pigmentary maculopathy frequently occurs prior to the eventual reversal of macular
edema. We examined the potential for intravitreal ranibizumab to control CVO
macular edema during this evolution interval, and thereby inhibit or limit
pigmentary maculopathy.
Methods: Consecutive cases with macular edema from perfused CVO that were
managed with various combinations of intravitreal ranibizumab and laser-induced
anastomosis, were reviewed retrospectively.
Results: Twenty three eyes of 23 patients were studied. Following multiple
attempts, at least one functioning anastomosis site was eventually present in each
eye. No major hemorrhagic or neovascular treatment complications were
encountered. All eyes retained perfused CVO status. Reversal of macular edema
with mild or no pigmentary maculopathy occurred in 18 eyes.
Conclusions: In this small study, intravitreal ranibizumab was useful in
minimizing the pigmentary maculopathy frequently associated with successful
laser-induced anastomosis reperfusion therapy. Intravitreal ranibizumab appeared
to modulate the extent and duration of CVO macular edema during the evolution of
the reperfusion anastomosis and did not appear to inhibit the angiogenic growth
factors required for anastomosis formation.
Commercial Relationships: Brian C. Leonard, None; Stuart G. Coupland,
None
Support: None
Program Number: 965 Poster Board Number: D1009
Presentation Time: 11:15 AM - 1:00 PM
Retinopathy In Patients With Sickle Cell Disease
Ankur N. Mehta1, Wendewessen Amde2, Ayham Skaf3, Asheesh Tewari2.
1
Ophthalmology, Kresge Eye Inst/Wayne State Univ, Detroit, MI; 2Ophthalmology,
Kresge Eye Institute, Detroit, MI; 3Ophthalmology, Kresge Eye Inst/Wayne State
Univ, Royal Oak, MI.
Purpose: To compare the effect of hemoglobin and hematocrit levels on the
severity of sickle cell retinopathy (SSR).
Methods: Retrospective study of patients with SSR. Data was collected between
January 2005 to January 2010. Collected data included patient demographics,
sickle cell genotype (SS/SC/Other), hemoglobin (Hgb) and hematrocrit (Hct)
levels, and severity of retinopathy based on the Goldberg staging criteria at initial
presentation. Patients with SSR were divided into two groups based on their
severity of retinopathy: Group A included patients with retinopathy of stage 3 or
above (neovascularization) and Group B included patients with less than stage 3
retinopathy. Patients were excluded from this study if they had any other
retinopathy due to other causes. All data was analyzed using STATA 11 software.
Results:
Seventy nine patients were included in this study (40 males, 39 females). Mean age
was 33 years. 30 patients were found to have Hgb SC, 36 patients with Hgb SS, and
13 with other Hbg genotypes. 40 patients met the staging requirements for Group A
and had 39 patients were included in Group B. The average Hgb level in Group A
was 10.95 gm/dl and in Group B was 9.14 gm/dl (p=0.0002). The average Hct level
in Group A was 31.45% and in Group B was 26.07% (p<0.0001). Subgroup
analysis comparing the two major Hbg genotypes showed the average Hbg level in
Hgb SS patients was 8.97 gm/dl and in Hgb SC patients was 11.56 gm/dl
(p<0.0001).
Conclusions: A significant difference was found between the two group’s
hemoglobin and hematocrit levels. We found that the group with less severe
retinopathy (less than stage 3 retinopathy) has lower Hgb and Hct levels and the
group with more severe retinopathy has higher Hgb and Hct levels which was
statistically significant. This study shows that low Hbg and Hct levels may have a
protective effect on the progression of sickle cell retinopathy. Perhaps higher Hgb
and Hct levels may be associated with increased blood viscosity in sickle cell
patients causing occlusion of peripheral capillaries which may exacerbate
retinopathy. Further, larger powered multi-centered studies will be needed to
further elucidate these findings.
Commercial Relationships: Ankur N. Mehta, None; Wendewessen Amde,
None; Ayham Skaf, None; Asheesh Tewari, None
Support: None
Program Number: 966 Poster Board Number: D1010
Presentation Time: 11:15 AM - 1:00 PM
Intravitreal Anti-VEGF Therapy For Retinal Macroaneurysm
Sandrine A. Zweifel1, Magdalena Toenz2, Lukas Pfenninger3, Matthias D. Becker4,
Stephan Michels4. 1Department of Ophthalmology, University Hospital Zurich,
Zurich, Switzerland; 2Department of Ophthalmology, Cantonal Hospital Lucerne,
Lucerne, Switzerland; 3Department of Ophthalmology, Kantonsspital Winterthur,
Winterthur, Switzerland; 4Department of Ophthalmology, Triemli Hospital Zurich,
Zurich, Switzerland.
Purpose: To evaluate the effect of intravitreal anti-vascular endothelial growth
factor (VEGF) therapy using bevacizumab or ranibizumab for retinal
macroaneurysms with macular exudation.
Methods: In a retrospective interventional case series patients with
macroaneurysms were treated with either 1.25mg intravitreal bevacizumab or
0.5mg ranibizumab as first line therapy. Patients were imaged by fluorescein
angiography and optical coherence tomography (OCT). Retreatment was performed
in case of persistent intraretinal or subretinal fluid in OCT.
Results: Ten patients (10 eyes) with macroaneurysm involving the macula were
treated with an average of 3.0 intravitreal anti-VEGF injections. Mean best
corrected visual acuity (BCVA) of all patients improved by 17 letters from baseline
to last follow-up visit. In 7 out of 10 patients, the fovea was affected by the
secondary edema. In cases with foveal involvement, central retinal thickness
Copyright 2012 by the Association for Research in Vision and Ophthalmology, Inc., all rights reserved. For permission to reproduce any abstract, contact the ARVO Office at pubs@arvo.org.
ARVO 2012 Annual Meeting Abstracts by Scientific Section/Group – Biochemistry/Molecular Biology (BI)
decreased from 366µm at baseline to 266µm at last follow-up visit. In the course of
treatment 8 out of 10 patients showed evidence of closure of the macroaneurysm.
Conclusions: Intravitreal anti-VEGF therapy appears to be a promising treatment
alternative to laser treatment in cases of retinal macroaneurysms with macular
exudation.
Commercial Relationships: Sandrine A. Zweifel, None; Magdalena Toenz,
None; Lukas Pfenninger, None; Matthias D. Becker, None; Stephan Michels,
None
Support: None
Program Number: 967 Poster Board Number: D1011
Presentation Time: 11:15 AM - 1:00 PM
Changes In Retinal Arteriovenous Diameters After Intravitreal Anti-VEGF
Antibody Injection
Steffany Straight, Robert N. Frank. Ophthalmology, Kresge Eye Institue, Detroit,
MI.
Purpose: To determine the effect of intravitreal anti-VEGF antibody injection on
the retinal arteriovenous diameter ratio (AVR) in diabetic macular edema (DME)
and age-related macular degeneration (AMD), and its relationship to macular
thickness in these diseases.
Methods: We chose from our institution’s digitized retinal photographic and
spectral domain optical coherence tomographic (OCT) image file subjects with
neovascular AMD or DME, with no previous anti-VEGF treatment and, in the past
6 mos., no laser therapy, and who had immediate pre-injection retinal photographs
and OCT images repeated within 3 mos. following injection. We measured macular
thickness in the central 1 mm zone. We determined retinal arteriolar and venular
diameters, and AVR, using the method of Hubbard, et al. (Ophthalmology
1999;106:2269-80).
Results: 21 patients met our criteria. For AMD patients, 7 showed an increased
AVR with time after intravitreal anti-VEGF injection, while 6 had a decreased
AVR ratio and 2 had no change. However for patients with DME, 5 had an
increased AVR ratio with time and only 1 had a decreased ratio. When AVR was
plotted as a function of central macular thickness in AMD, 9 patients had an
increased AVR with increased central macular thickness, while 6 had decreased
AVR when macular thickness increased. Conversely in patients with DME, 4 had
increased AVR when central macular thickness decreased, while 2 showed
decreased AVR when macular thickness increased.
Conclusions: Most patients with DME had increased arteriolar relative to venular
caliber following anti-VEGF injection, and increased AVR concurrent with
decreased macular thickness. We also found, conversely, in AMD patients that
AVR increased more frequently with increasing macular thickness, while in fewer
AMD patients, AVR decreased with increasing macular thickness. The variability
of the results for DME and AMD patients suggests the changes in AVR as a result
of anti-VEGF therapy are complex and may not be easily reconciled with a single
mechanism.
Commercial Relationships: Steffany Straight, None; Robert N. Frank, None
Support: Supported by a departmental unrestricted grant from Research to Prevent
Blindness.
Program Number: 968 Poster Board Number: D1012
Presentation Time: 11:15 AM - 1:00 PM
Outcomes of Purtschers-like Retinopathy secondary to Adult Onset Stills at
Wills Eye Institute
Rajiv E. Shah, Alok Bansal, Amanda Mathews, Arunan Silvalingam.
Ophthalmology, Wills Eye Institute, Philadelphia, PA.
Purpose: Adult Onset Stills Disease (AOSD) is a rare systemic inflammatory
disorder which may present with a Purtschers-like Retinopathy. There were no
long-term or large series identified in the literature which address visual outcomes
or optimal treatment strategies.
Methods: Retrospective case series of all identified cases of Purtschers-like
Retinopathy as a result of AOSD at Wills Eye Institute.
Results: 2 cases were identified with an age range of 23-28 years old (average age
25.5 years). The visual acuity at evaluation ranged from 20/25 to Counting Fingers
(CF). In one case, the patient required intensive care unit (ICU) admission, but his
AOSD was successfully treated with high dose corticosteroids. By 8 months
follow-up, the vision remained CF similar to his initial evaluation. Angiography
revealed resolving microangiopathy and macular ischemia and macular atrophy.
There were no signs of neovascularization. In the other case, the patient suffered
acute renal failure and pulmonary edema requiring an extended (4 month) ICU
admission. Her visual acuity rapidly deteriorated from 20/25 to hand motions (HM)
concurrent with the worsening of her systemic disease within the first few days of
evaluation. She was eventually diagnosed with AOSD with concurrent macrophage
activation syndrome, which was resistant to high dose steroids. Plasmapheresis and
intravenous Immunoglobulin failed to halt a progression of her systemic disease.
Anakinra and Cyclosporine eventually controlled the systemic autoimmune disease.
By 6 months follow-up, she remained HM vision in both eyes. Angiography
demonstrated severe macular and retinal ischemia with neovascularization of the
posterior and anterior segment in both eyes. She had early neovascular glaucoma in
the left eye, and this required pan-retinal photocoagulation and intraocular
bevacizumab therapy.
Conclusions: Purtscher-like Retinopathy secondary to AOSD has a poor visual
prognosis related to irreversible macular ischemia. High dose steroids are a
mainstay of initial therapy, but in the setting of concurrent macrophage activation
syndrome, steroid sparing therapy may be necessary. Severe ischemia from retinal
arteriole and choroidal occlusion may give rise neovascularization which requires
treatment.
Commercial Relationships: Rajiv E. Shah, None; Alok Bansal, None; Amanda
Mathews, None; Arunan Silvalingam, None
Support: None
Program Number: 969 Poster Board Number: D1013
Presentation Time: 11:15 AM - 1:00 PM
Clinical And SD-OCT Pattern Of Retinal Venous Occlusion With Cystoid
Macular Edema Treated With Ozurdex
Vincent Fortoul, Philippe Denis, Laurent Kodjikian. ophtalmology, Croix-Rousse
University Hospital of LYON, LYON, France.
Purpose: To report our experience with sustained-release dexamethasone 0.7 mg
intravitreal implants (Ozurdex®; Allergan, Inc., Irvine, CA) in first-line treatment
of retinal vein occlusion with macular edema.
Methods: A prospective study of 67 patients with recent (less than 3 months,
n=17) and less recent (more than 3 months, n=12) retinal vein occlusion with
macular edema treated with sustained-release dexamethasone 0.7 mg intravitreal
implant was performed. 29 patients with a minimum follow-up time of 6 months
(CRVO n=15, BRVO n=14) make up our study. Complete ophthalmic examination
including visual acuity, fundus biomicroscopy, fundus photography, fluorescein
angiography and spectral domain optical coherence tomography (Cirrus SD-OCT ;
Carl Zeiss Meditec, CA) was performed at baseline and follow-up (1 week, 1
month, 2 months, 3 months, 4 months, 5 months and 6 months) and tolerance of the
implant was assessed.
Results: Twenty-nine eyes of 29 consecutive patients treated with a total of 29
sustained-release dexamethasone 0.7 mg intravitreal implants for macular edema
associated with retinal vein occlusion were included. Thirty-three percent of
patients gained at least 3 lines of best-corrected visual acuity (BCVA) at 2 months.
Forty-four percent of eyes showed SD-OCT significative decrease of the edema
following implant placement at 1 week (p<0.05). All eyes showed decrease of
serous detachment of the neurosensory retina (not present in 26/29 cases at 1
month). Despite an increase of the macular edema in 57% of the eyes at 4 months,
the final best-corrected visual acuity (BCVA) was still better at 6 months than
BCVA at baseline. The safety profile was consistent with the results of a previous
phase III trial of Ozurdex, and no serious ocular or systemic adverse events was
observed during the follow-up period. High intraocular pressure (IOP) was mostly
controlled with only one medication after OZURDEX. The peak of IOP was noted
in 26% of the eyes at 2 months.
Conclusions: Sustained-release dexamethasone 0.7 mg intravitreal implant may be
an effective treatment option to control macular edema in patients with retinal vein
occlusion. Anatomical and functional benefits of OZURDEX are better when the
treatment is done at an early stage.
Commercial Relationships: Vincent Fortoul, None; Philippe Denis,
None; Laurent Kodjikian, None
Support: None
Program Number: 970 Poster Board Number: D1014
Presentation Time: 11:15 AM - 1:00 PM
Optical Coherence Tomography Findings In Acute And Chronic Retinal
Artery Occlusion
Giacomo Panozzo1, Stefano Casati2, Elena Gusson3. 1Fondazione Theia per
l'Oftalmologia, Verona, Italy; 2Neuroscience, University of Verona, Verona, Italy;
3
Clinica Oculistica, Universita di Verona, Verona, Italy.
Purpose: To report spectral domain optical coherence tomography (SD-OCT)
findings in acute and chronic retinal artery occlusions (RAO), and to compare these
findings with other causes of inner retinal atrophy.
Methods: Two cases of central retinal artery occlusion (CRAO) with perfused
cilio-retinal artery and one case of cilio-retinal artery occlusion were observed in
the acute phase and then followed for four months with SD-OCT. Other 4 cases of
chronic central and branch RAO were also evaluated. SD-OCT images of different
causes of inner retinal atrophy (advanced glaucoma and ischemic optic neuropathy)
are reported and compared.
Results: In the acute phase of RAO, SD-OCT discloses thickening and increased
reflectivity of the inner retinal layers with shadowing effect on outer structures, and
sharp demarcation between perfused and non-perfused retina. In the chronic phase,
SD-OCT reveals severe and complete inner retinal atrophy and homogeneous intraretinal structure, while outer nuclear layer and IS-OS/RPE hyper-reflective lines
remain intact. On the contrary, in advanced glaucoma and optic neuropathy the
inner retinal structure although reduced remains clearly detectable.
Conclusions: SD-OCT in acute-CRAO demonstrates swelling of the inner retinal
layers and sharp demarcation of the affected. In the chronic phases the
Copyright 2012 by the Association for Research in Vision and Ophthalmology, Inc., all rights reserved. For permission to reproduce any abstract, contact the ARVO Office at pubs@arvo.org.
ARVO 2012 Annual Meeting Abstracts by Scientific Section/Group – Biochemistry/Molecular Biology (BI)
homogeneous inner atrophy with absence of identifiable retinal layers represents a
distinctive marker of RAO compared with other causes of inner retinal atrophy.
Commercial Relationships: Giacomo Panozzo, None; Stefano Casati,
None; Elena Gusson, None
Support: None
Program Number: 971 Poster Board Number: D1015
Presentation Time: 11:15 AM - 1:00 PM
Early Detection of Functional Changes Using Microperimetry on Patients with
Subclinical Hydroxychloroquine Toxicity
Renu V. Jivrajka1, Mohamed A. Genead2, J. Jason McAnany1, Clement C. Chow1,
Gerald A. Fishman2, William F. Mieler1. 1Ophthalmology & Visual Sciences,
University of Illinois at Chicago, Chicago, IL; 2Ophthalmology, The Chicago
Lighthouse, Chicago, IL.
Purpose: The currently accepted screening standards for hydroxycholoroquine
(Plaquenil) toxicity include the 10-2 Humphrey visual field (HVF), spectraldomain optical coherence tomography (SD-OCT), fundus autofluorescence (FAF),
and multifocal electroretinogram (mfERG). However, each technique has its own
unique advantages and disadvantages and each of these methodologies may fail to
identify toxicity in some patients. The purpose of this study was to determine if
microperimetry could detect functional loss in patients on Plaquenil who did not
have evidence of retinopathy as assessed by recommended screening standards.
Methods: Participants included eleven patients being treated with 200 or 400
mg/day of Plaquenil for more than 5 years, without visual complaints (visual acuity
20/25 or better), and without a history of diabetes or macular disease. These
patients underwent a complete ophthalmic examination that included medical
history, best-corrected visual acuity, slit lamp biomicroscopy, funduscopic exam,
color vision, SD-OCT, 10-2 HVF, FAF, mfERG, and microperimetry that cover the
central 12o centered on the fovea.
Results: The average age of the study cohort was of 55 years (SD = 11). The
average total cumulative Plaquenil dose and average daily dose were 1,377 ± 1200
grams and 4.1 ± 1.67 mg/kg/day, respectively. All patients had normal anterior
segment and funduscopic exams, full HVFs, and normal FAF. The median retinal
sensitivity, as assessed by microperimetery, was 15.3 dB (OD) and 14.4 dB (OS).
Given that median sensitivity of the two eyes did not differ significantly (MannWhitney Rank Sum Test, p = 0.22), the sensitivity data from the left and right eyes
were averaged and compared to the sensitivity values of 32 visually normal
subjects. The median sensitivity of the patients (15.5 dB) was significantly lower
(Mann-Whitney Rank Sum Test, p < 0.001) than that of the visually normal
subjects (17.0 dB).
Conclusions: Plaquenil patients without clinical evidence of retinal toxicity
showed reduced retinal sensitivity within the central 12o of the macula, as assessed
by microperimetry, suggestive of early functional loss. The sensitivity differences
between the patients and controls, while small, suggest that microperimetry may be
an additional useful technique for identifying Plaquenil toxicity.
Commercial Relationships: Renu V. Jivrajka, None; Mohamed A. Genead,
None; J. Jason McAnany, None; Clement C. Chow, None; Gerald A. Fishman,
None; William F. Mieler, None
Support: Foundation Fighting Blindness, Columbia, Maryland; Pangere
Corporation; Grant Healthcare Foundation, Lake Forest, Illinois; NIH core grant
EY01792; NIH research grant R00 EY019510 (JM)
Program Number: 972 Poster Board Number: D1016
Presentation Time: 11:15 AM - 1:00 PM
Comparative Analysis Of The Distribution Of The Choroidal Thickness In
Central Serous Chorioretinopathy On Spectral Domain Optical Coherence
Tomography
So Hyun Bae1, Joonhee Cho1, Jae Ryong Han2, Woo Ho Nam1, Ha Kyoung Kim1.
1
Ophthalmology, Kangnam Sacred Heart Hospital, Seoul, Republic of Korea;
2
Ophthalmology, Hangan Sacred Heart Hospital, Seoul, Republic of Korea.
Purpose: to assess the distribution of choroidal thickness of central serous
chorioretinopathy (CSC) using spectral domain optical coherence tomography (SD
OCT) in comparison with changes of retinal pigment epithelium (RPE) on
fluorescein angiography (FA)
Methods: A total of 50 eyes were enrolled including 23 eyes with CSC and 27
normal eyes. Choroidal thickness was measured by Cirrus OCT at 9 points beneath
the fovea and at 1 or 2.25mm away from the fovea on superior, nasal, inferior and
temporal direction. If the RPE leakage on FA was on the same direction from the
fovea with choroidal thickness measurement point, the value of choroidal thickness
was categorized as ‘same location’ subgroup and vice versa, ‘opposite location’.
Results: The choroidal thickness in CSC was significantly thicker than that of
normal eyes at each measurement point (P<0.01). The subfoveal choroidal
thickness was thickest in CSC group. The difference of nasal choroidal thickness
between eyes with CSC and normal eyes was greater than those of other
measurement points (P<0.01). The choroidal thickness at the ‘same location’ with
RPE leakage was significantly thicker than that at the ‘opposite location’ (P<0.01).
Conclusions: The choroidal thickness in CSC was significantly thicker than that of
normal eyes. In CSC, the capacity of choroidal expansion differs over the choroid,
resulting in greater increment of nasal choroidal thickness. Comparisons between
the distribution of choroidal thickness and RPE leakage, revealed that the choroidal
thickness was thicker near RPE leakage.
Commercial Relationships: So Hyun Bae, None; Joonhee Cho, None; Jae
Ryong Han, None; Woo Ho Nam, None; Ha Kyoung Kim, None
Support: None
Program Number: 973 Poster Board Number: D1017
Presentation Time: 11:15 AM - 1:00 PM
Electrophysiological and Structural Assessment in Retinal Vein Occlusion
with Macular Edema Following Repeated Intravitreal Bevacizumab Injection
Chan Hee Moon, Young-Hoon Ohn, Tae Kwann Park. Ophthalmology,
Soonchunhyang University Hospital, Bucheon, Republic of Korea.
Purpose: To investigate electrophysiological and structural response after repeated
intravitreal injections of bevacizumab for macular edema attributable to retinal vein
occlusion, prospectively.
Methods: Thirty-six eyes of 36 patients with macular edema attributable to central
retinal vein occlusion (CRVO) in 19 patients and branch retinal vein occlusion
(BRVO) in 22 patients received three times of intravitreal injections of
bevacizumab 1.25mg at 6-week intervals. Complete ophthalmic examinations
including full-filed electroretinography (ffERG) and optical coherence tomography
(OCT) were conducted before treatment and 4 weeks after each injections. Pretreatment measurements of affected eyes were compared with that of unaffected
fellow eyes with paired samples T-test. The differences between pre-treatment
measurements and each post-treatment measurement of affected eyes were
analyzed with repeated-measures ANOVA test. Post-hoc analysis was conducted
via Bonferroni test.
Results: LogMAR visual acuity (VA), central retinal thickness (CRT) and ffERG
parameters were worse significantly in affected eyes compared to unaffected eyes.
VA was improved significantly from 0.96 ± 0.20 before treatment to 0.48 ± 0.39
after the 1st injection (P=0.031). Though, VA was continually improved to 0.39 ±
0.13 and 0.25 ± 0.07 after the 2nd and 3rd injections respectively, the differences did
not reach statistical significance. CRT was decreased significantly from 640.85 ±
53.99µm before treatment to 333.85 ± 67.91µm after the 1st injection (P=0.000).
After the 2nd and 3rd injections, CRT was 288.57 ± 38.30µm and 314.57 ± 40.30µm
and the differences were not significant. None of the scotopic or photopic ERG
parameters were evidenced significant changes between before and after the
treatments. There was no significant difference in subgroup analysis between
BRVO and CRVO.
Conclusions: Three repeated injections of bevacizumab appear to result in
significant improvement of VA and macular edema secondary to retinal vein
occlusion. However, repeated injections of bevacizumab do not affect the
electrophysiological retinal function.
Commercial Relationships: Chan Hee Moon, None; Young-Hoon Ohn,
None; Tae Kwann Park, None
Support: None
Program Number: 974 Poster Board Number: D1018
Presentation Time: 11:15 AM - 1:00 PM
Visual Prognostic Value of the Photopic Negative Response and Optical
Coherence Tomography in Retinal Vein Occlusion Following Intravitreal
Bevacizumab Injection
Tae Kwann Park, Chan Hee Moon, Young-Hoon Ohn. Ophthalmology,
Soonchunhyang Univ Hospital, Bucheon-si, Republic of Korea.
Purpose: To investigate the potential of the photopic negative response (PhNR)
and optical coherence tomography (OCT) for predicting visual outcomes in retinal
vein occlusion (RVO) with macular edema following intravitreal injection of
bevacizumab, prospectively.
Methods: A total of thirty-six eyes of 36 consecutive patients with macular edema
due to unilateral central retinal vein occlusion in 19 patients, and branch retinal
vein occlusion in 17 patients were studied before and 4 weeks after intravitreal
injection of bevacizumab with complete ophthalmic examination, PhNR and OCT.
Pre-treatment measurements of affected eyes were compared with that of
unaffected fellow eyes and post-treatment measurements of affected eyes with
paired samples T-test. Pearson’s correlation and linear regression analyses were
conducted to assess the relationship between PhNR, central subfield thickness
(CST) measured by OCT before treatment and Log MAR visual acuity (VA) after
treatment.
Results: VA, PhNR and CST were worse significantly in affected eyes compared
to unaffected eyes. VA was improved significantly from 0.72±0.48 before
treatment to 0.35±0.33 after treatment. CST was reduced significantly from
626.70±197.88µm before treatment to 315.23±115.73µm after treatment. PhNR
parameters did not show any changes in amplitude and implicit time following
intravitreal injection of bevacizumab. Pre-treatment measurements of PhNR
amplitude (R=-0.406, R2=0.165, P=0.029) and implicit time (R=0.416, R2=0.173,
P=0.025) were correlated significantly with post-treatment VA. The implicit time
showed a stronger correlation than the amplitude. Pre-treatment CST (R=0.461,
R2=0.213, P=0.006) was also correlated significantly with post-treatment VA.
Copyright 2012 by the Association for Research in Vision and Ophthalmology, Inc., all rights reserved. For permission to reproduce any abstract, contact the ARVO Office at pubs@arvo.org.
ARVO 2012 Annual Meeting Abstracts by Scientific Section/Group – Biochemistry/Molecular Biology (BI)
Conclusions: An eye with the better amplitude and implicit time of PhNR and CST
were associated with the better visual outcome after intravitreal injection of
bevacizumab. PhNR and OCT could be a useful prognostic indicator in the pretreatment evaluation of RVO with macular edema.
Commercial Relationships: Tae Kwann Park, None; Chan Hee Moon,
None; Young-Hoon Ohn, None
Support: None
Program Number: 975 Poster Board Number: D1019
Presentation Time: 11:15 AM - 1:00 PM
Circadien Cycle And Chronic Idiopathic Central Serous Chorioretinopathy
Treated With Low Dose Verteporfin
Elodie Setrouk, Tony Garcia, Alain Ducasse, carl Arndt. Ophthalmology, Hospital
Robert Debre, Reims, France.
Purpose: Chronic Central Serous Chorioretinopathie(CRSC) is a multifocal
disease. Photodynamic therapy(PDT)with vertepofin (3mg/m2) is a symptomatic
treatment. A further reduction to 1,5mg/m2 could reduce potential side and thus
improve safety of this off label treatment. The present study was designed to
evaluate circadian disturbance and corticosteroid in patients treated with chronic
CRSC in an ongoing trial comparing the effect of 3mg/m2 verteporfin with
1,5mg/m2.
Methods: In all patients with chronic CRSC between 01/01/2009 to 11/31/2011, a
history of corticosteroid treatment, sleep disturbance and irregular working hours
was noted. If visual acuity was less than 20/40 for more than three months without
any tendency of improvement,PDT was performed. The patients were randomly
assigned to either treatment group,3mg/m2 or 1,5mg/m2. A mesure of visual
acuity, an optical coherence tomography (OCT), angiography(fluorescein and
indocyanine green) was performed at baseline, with evaluation at 12 months.
Results: During the period of inclusion,43 patients were examined, 19 were trated
with PDT. 11 patients completed a follow-up of 12 months, 3 patients (27%) had a
history of corticosteroid, 5 patients (45%) had sleep disturbances and 6 (54%)
worked at night.
On case of improvement of visual acuity >5 ETDRS letters was observed in group
1 against 2 in group 2. The macular thickness was reduced > 100 microns in two
patients in group 2,no such improvement were observed in group 1.
Conclusions: On this preliminary study of photodynamic therapy with chonic
CRSC, functional and morphological improvement is inconstant. It is likely that
other factors such as existance of a corticosteroid treatment or a disruption of the
circadian cycle is involved in the spontaneous evolution or the reponse to
treatment.
Commercial Relationships: Elodie Setrouk, None; Tony Garcia, None; Alain
Ducasse, None; carl Arndt, None
Support: None
Program Number: 976 Poster Board Number: D1020
Presentation Time: 11:15 AM - 1:00 PM
The Utility of Ultra-wide-field Imaging in a Spontaneous and Progressive
Submacular Hemorrhage Due to Hereditary Prothrombin Deficiency
Anjum Cheema1, Vandana R. Minnal1, Irena Tsui1,2. 1Ophthalmology, Montefiore
Med Ctr-Albert Einstein COM, New York City, NY; 2Jules Stein Eye Institute
UCLA, Los Angeles, CA.
Purpose: To report a case of progressive, submacular hemorrhage due to a rare
hereditary prothrombin deficiency that was spontaneous and isolated.
Methods: Retrospective case report including ultra-wide-angle fundus imaging
(Optos, Marlborough, MA), clinical course, and pathology results.
Results: A 55-year-old woman with a past medical history of hereditary
prothrombin deficiency presented with sudden onset of photopsias in her left eye.
Examination revealed a small submacular hemorrhage. Fluorescein angiogram
showed no detectable underlying vascular abnormality in either eye. Coagulation
panel was within normal limits. Despite receiving 14 units of fresh frozen plasma
the hemorrhage progressed to involve the suprachoroidal space. Intraocular surgical
drainage with gas tamponade was attempted without success. Two weeks later, an
evisceration of the left eye was performed due to pain from intractable intraocular
pressure elevation in the blind eye. Pathologic examination of the eye to detect any
predisposing lesion was limited and revealed corneal blood staining only. Six
months later, the patient was doing well with an ocular prosthesis and no systemic
complications.
Conclusions: To our knowledge, this is the first reported case of a spontaneous and
progressive submacular hemorrhage in a hemophiliac that was not associated with
systemic bleeding. Ultra-wide-field fluorescein angiography was useful to confirm
the absence of underlying retina vascular
abnormalities.
Commercial Relationships: Anjum Cheema, None; Vandana R. Minnal,
None; Irena Tsui, None
Support: Montefiore is a recipient of an unrestricted grant from research to prevent
blindness
Program Number: 977 Poster Board Number: D1021
Presentation Time: 11:15 AM - 1:00 PM
Duchenne Muscular Dystrophy-associated Proliferative Retinal Vasculopathy
Successfully Treated With Panretinal Laser Photocoagulation
Phoebe Lin, Paul Hahn, Sharon Fekrat. Ophthalmology, Duke University,
Durham, NC.
Purpose: To report a case of a patient with Duchenne's muscular dystrophy (DMD)
and retinal vasculopathy that regressed with panretinal photocoagulation (PRP).
Methods: Retrospective interventional case report.
Results: A 23 year old Caucasian male with advanced DMD presented with a 3
week history of floaters and visual acuity of 20/20 OU. The anterior segment
examination was unremarkable without neovascularization. Ophthalmoscopy
(Fig.A-B) demonstrated extensive retinal arteriolar aneurysmal dilatations and
venous beading OU (Fig. B, inset). Fluorescein angiography (Fig. C-D) highlighted
the diffuse aneurysmal dilatations (Fig. C, inset), peripheral capillary non-perfusion
(Fig. D, inset), and leaking hyperfluorescence consistent with neovascularization
OU. Both eyes were promptly treated with PRP, resulting in regression of
neovascularization and resolution of aneurysmal dilatations in both eyes (Fig E-F,
insets).
Conclusions: Proliferative retinal vasculopathy from DMD can be successfully
treated with PRP preventing the rapid progression of retinopathy that has been
previously reported in the
Copyright 2012 by the Association for Research in Vision and Ophthalmology, Inc., all rights reserved. For permission to reproduce any abstract, contact the ARVO Office at pubs@arvo.org.
ARVO 2012 Annual Meeting Abstracts by Scientific Section/Group – Biochemistry/Molecular Biology (BI)
literature.
Commercial Relationships: Phoebe Lin, None; Paul Hahn, None; Sharon
Fekrat, None
Support: Ronald G. Michels Fellowship
Program Number: 978 Poster Board Number: D1022
Presentation Time: 11:15 AM - 1:00 PM
Visual Outcome Of Early Vitrectomy And Gas Tamponade In The
Management Of Ruptured Retinal Arterial Macroaneurysm
Jan Heckmann1, Stefan O. Koinzer2, Jost Hillenkamp1, Johann Roider3.
1
Ophthalmology, University of Kiel Germany, Kiel, Germany; 2Ophthalmology,
Kiel University, Kiel, Germany; 3Klinik fur Ophthalmologie, University of Kiel,
Kiel, Germany.
Purpose: Retinal arterial macroaneurysm (RAMA) may cause vision loss due to
hemorrhagic macular complications. Macular hemorrhage occurs sub-internal
limiting membrane (ILM), intra- or subretinally
Methods: Single center retrospective chart review from 2008 to 2011. 14 eyes of
14 consecutive patients with macular hemorrhage due to ruptured RAMA were
treated with vitrectomy and gas tamponade for sub-ILM, intra- or subretinal
macular hemorrhage. Vitrectomy with ILM peeling was performed in 8 of 14 eyes
and recombinant tissue plasminogen activator (rtPA) was injected intravitreally in 2
of 14 eyes and subretinally in 5 of 14 eyes. Duration of symptoms, pre- and
postoperative best corrected logMAR visual acuity (BCVA) and complications
were recorded
Results: Vitrectomy was performed within 3.1±4.0 days [mean, standard deviation
(SD)] after onset of symptoms. Preoperative BCVA was 1.6±0.8, light perception
to 0.4 (mean, SD, range). 7 of 14 eyes had additional intravitreal hemorrhage and 9
of 14 eyes additional subhyaloid hemorrhage. Macular hemorrhage was
successfully displaced in 10 of 14 eyes. 2 macular holes were found
intraoperatively. Postoperatively, subretinal hemorrhage recurred in one eye and
retinal detachments occurred in 3 eyes. Follow up was 16±24, 2 to 95 months
(mean, SD, range). BCVA at last follow-up was 0.9±1.1, light perception to 0
(mean, SD, range) while 8 of 14 eyes achieved reading ability (BCVA 0.4 or
better).
Conclusions: Vitrectomy is an effective treatment of ruptured RAMA with
macular hemorrhage with satisfactory outcome in most eyes. Secondary macular
hole caused by subretinal hemorrhage and postoperative retinal detachment may
limit final function.
Commercial Relationships: Jan Heckmann, None; Stefan O. Koinzer,
None; Jost Hillenkamp, None; Johann Roider, None
Support: None
Presentation Time: 11:15 AM - 1:00 PM
Atypical Posterior Multifocal Epithelitis: 2 Case Reports
Yamelys Adasme, Aristides J. Mendoza, Mónica A. Garay, José V. Sarabia. Clinica
de Especialidades Oftalmologicas, PORLAMAR, Venezuela.
Purpose: To describe an unusual choroidopathy resembling acute posterior
multifocal placoid pigment epitheliopathy (APMPPE) and serpiginous choroiditis.
Methods: We studied 2 patients, aged 57 and 73 years, exhibiting this unusual
entity, they were evaluated clinically and complementary exams were performed
(laboratory, fluorescein angiography and optical coherence tomography) through
the patology course.
Results: Clinically and fluorescein angiography findings to the acute retinal lesions
in both patients were similar to those of APMPPE or serpiginous choroiditis.
However, the clinical course, number of lesions, location and resolution of these
lesions were atypical. Growth of subacute lesions and the appearance of new
lesions continued, at least for one of the cases, during 6 months after the initial
examination. Relapses and subretinal cicatrization compromised the final visual
acuity.
Conclusions: These cases had clinical features similar to APMPPE and serpiginous
choroiditis with a prolonged progressive clinical course, widespread distribution
and atypical resolution of the lesions. It may represent a variant of serpiginous
choroiditis or may be a new entity.
Commercial Relationships: Yamelys Adasme, None; Aristides J. Mendoza,
None; Mónica A. Garay, None; José V. Sarabia, None
Support: None
Program Number: 980 Poster Board Number: D1024
Presentation Time: 11:15 AM - 1:00 PM
Regional Defects Of Rpe-Pigmentation And Abnormal Vecp Amplitude Shift
In A Patient With Prader Willi-Syndrome Indicate An Atypical Form Of
Incomplete Albinism
Melanie Timmermann, Heinrich Gerding. Augenzentrum Klinik Pallas, Olten,
Switzerland.
Purpose: To analyze and classify atypical fundus findings in a 20-year old male
with Prader Willi-syndrome.
Methods: In addition to basic ophthalmological examinations the following
methods were applied: SD-OCT, standard and near-infrared autofluorescence,
fluorescein and ICG-angiography, colour perception, standardized ERG and visual
evoked potential recording, topographic analysis of VECP amplitudes, and MRI
imaging of the orbit and cerebrum.
Results: Best corrected visual acuity was 20/50 OD and 20/80 OS. Anterior
segments did not present any abnormalities. Pupillary reactions, ocular motility and
orthoptic status were normal. Funduscopic findings were: minor nasal prominence
of the optic discs, relatively hypopigmented tabulated fundus, fine-structured RPEirregularities of the fovea, and small parafoveal depigmented areas mainly in
superior position. Fundus near-infrared and standard autofluorescence presented
multiple intramacular hypofluorescent spots approximately 50-300 µm in diameter.
These spots were transiently hyperfluorescent in angiography. In SD-OCT scans
local irregularities and hyperreflective structures were identified on the level of the
RPE-photoreceptor junction. The P100-latency of visual evoked potentials was 107
(OD) and 105 msec (OS). Topographic analysis of VECP amplitudes showed an
atypical shift resembling findings in albino carriers. ERG a- and b-wave amplitudes
were relatively high and implicit times relatively short. Nuclear magnetic resonance
tomography revealed a hypolastic corpus callosum.
Conclusions: The association of reduced visual acuity, regionally fundus
hypopigmentation, and electrophysiological findings observed in this case indicate
an atypical form of incomplete albinism so far not reported in Prader Willisyndrome.
Commercial Relationships: Melanie Timmermann, None; Heinrich Gerding,
None
Support: None
144 Retinal Disease Mechanisms and Treatment Modalities
Sunday, May 6, 2012, 3:15 PM - 5:00 PM
Hall B/C Poster Session
Program #/Board # Range: 1209-1226/D1025-D1042
Organizing Section: Biochemistry/Molecular Biology
Contributing Section(s): Genetics Group
Program Number: 1209 Poster Board Number: D1025
Presentation Time: 3:15 PM - 5:00 PM
A Targeted Next-Generation Sequencing Approach for Identification of the Xlinked RP23 Gene
David A. Parfitt1, Tom R. Webb1, Jessica C. Gardner1, Jacob Ressa1, Marina
Apergi1, Naheed Kanuga1, Ariadna Martinez2, Michael E. Cheetham1, Michael B.
Gorin2, Alison J. Hardcastle1. 1UCL Institute of Ophthalmology, London, United
Kingdom; 2Dept of Ophthalmology, Jules Stein Eye Institute - UCLA, Los
Angeles, CA.
Program Number: 979 Poster Board Number: D1023
Copyright 2012 by the Association for Research in Vision and Ophthalmology, Inc., all rights reserved. For permission to reproduce any abstract, contact the ARVO Office at pubs@arvo.org.
ARVO 2012 Annual Meeting Abstracts by Scientific Section/Group – Biochemistry/Molecular Biology (BI)
Purpose: We previously mapped a locus for a severe form of X-linked retinitis
pigmentosa, RP23, to a 10.56 Mb interval on Xp22 which contains approximately
700 exons in 62 known and predicted genes. Conventional candidate gene
screening did not identify the causative mutation, so we adopted a targeted nextgeneration sequencing (NGS) approach to determine the underlying molecular
cause of RP23.
Methods: We used a 2.1M Custom Array from Nimblegen to capture 19.2 Mb of
the X-chromosome including known X-linked RP genes RPGR and RP2 and the
entire RP23 genomic interval from DXS1223 and DXS7161 (10.56 Mb). In
addition to an RP23 affected male, we also sequenced 2 control male samples.
Sequence data were generated using 100 bp paired-end sequencing on an Illumina
Genome Analyzer. Variants identified were filtered against common variants found
in dbSNP and 1000 genomes.
Results: NGS data confirmed the lack of RP2 and RPGR mutation. These genes
were included to exclude sequence variation outside of the coding exons. We
achieved mean depth of coverage of between 98-102 reads per base and sequence
coverage between 83-88%. Within the RP23 interval we detected 6,827 variants.
After filtering out known SNPs and low quality calls we identified 242 novel
variants of which 119 were intragenic. The first GC rich exons of 3 genes were not
captured and sequenced using this strategy.
Conclusions: The NGS strategy confirmed our earlier candidate gene screening
data, as no potentially pathogenic coding sequence variant was identified in
previously screened genes. We are currently analysing the novel sequence variants
that lie within or near annotated genes to evaluate their potential pathogenicity.
Furthermore, RP2 and RPGR mutation negative X-linked families have been
recruited for genetic mapping to identify additional RP23 families which may
refine the locus and confirm potential pathogenicity of gene specific variants within
the RP23 interval.
Commercial Relationships: David A. Parfitt, None; Tom R. Webb,
None; Jessica C. Gardner, None; Jacob Ressa, None; Marina Apergi,
None; Naheed Kanuga, None; Ariadna Martinez, None; Michael E. Cheetham,
None; Michael B. Gorin, None; Alison J. Hardcastle, None
Support: RP fighting blindness, British RP society UK
Program Number: 1210 Poster Board Number: D1026
Presentation Time: 3:15 PM - 5:00 PM
Metabolic Stress and Loss of Vision in Chronically Hypoglycemic Mice
Yumiko Umino1, Nicolas Cuenca2, Drew Everhart1, Laura Fernandez-Sanchez2,
Robert Barlow1, Eduardo Solessio1. 1Department of Ophthalmology, Center for
Vision Research and SUNY Eye Institute, SUNY Upstate Medical University,
Syracuse, NY; 2Physiology, Genetics and Microbiology, University of Alicante,
Alicante, Spain.
Purpose: Mice rendered hypoglycemic by a null mutation in the glucagon receptor
gene, Gcgr, display late-onset retinal degeneration and loss of retinal sensitivity.
Our goals were: 1) To establish if long-term administration of high dietary glucose
rescues retinal function and circuit connectivity in aged Gcgr-/- mice, 2) To
determine if loss of vision is associated with systemic and/ or retinal stress.
Methods: Gcgr-/- mice were administered a carbohydrate-rich diet starting at 12
months of age. Following one month of treatment retinal function and structure
were evaluated using electroretinographic recordings (ERGs) and
immunohistochemistry. Visual function was assessed with by monitoring the
optomotor response to moving gratings. Plasma levels of corticosterone and growth
hormone were determined by radioimmunoassay.
Results: Gcgr-/- retinas have 20% fewer synaptic pairings than Gcgr+/- retinas.
Remarkably, most of the lost synapses were located farthest from the bipolar cell
body, near the distal boundary of the outer plexiform layer, suggesting that apical
synapses are most vulnerable to chronic hypoglycemia. Loss of retinal and visual
functions was closely associated with increased plasma levels of the stress
hormones corticosterone and growth factor, as well as activation of AMPK in the
retina. AMPK is a metabolic sensor that regulates the distribution of energetic
resources in cells. While treatment with the carbohydrate-rich diet raised blood
glucose levels, restored retinal function and reduced stress, it did not restore the
synaptic contacts lost between rods and bipolar cells.
Conclusions: Prolonged exposure to diet-induced euglycemia rescues retinal
function but cannot reestablish synaptic contacts lost by chronic hypoglycemia. Our
results suggest that retinal neurons possess a homeostatic mechanism that integrates
energetic status over prolonged periods of time and allows them to recover
functionality despite synaptic loss.
Commercial Relationships: Yumiko Umino, None; Nicolas Cuenca,
None; Drew Everhart, None; Laura Fernandez-Sanchez, None; Robert Barlow,
None; Eduardo Solessio, None
Support: NIH 2R56EY000667, F32 EY017246, Research to Prevent Blindness,
Lions of Central New York
Program Number: 1211 Poster Board Number: D1027
Presentation Time: 3:15 PM - 5:00 PM
Recombinant Pentraxin-2 (rPTX-2) Shifts Macrophage Phenotype, Suppresses
Subretinal NV, and Reduces Associated Vascular Leakage and Collagen
Deposition Deposition
Raquel Formica1, Jikui Shen1, Christopher P. Seidel1, Sean F. Hackett1, Michael S.
Kramer2, Mark L. Lupher Jr.2, Peter A. Campochiaro1. 1Ophthalmology, Johns
Hopkins Wilmer Eye Inst, Baltimore, MD; 2Promedior, Inc, Malvern, PA.
Purpose: Pentraxin-2 (PTX-2) or serum amyloid P (SAP) is a circulating 125 kD
member of the pentraxin family and a soluble pattern recognition receptor. We
previously showed that rPTX-2 reduces the number of macrophages in the eye and
suppresses retinal and choroidal NV. In this study, we tested the effect of rPTX-2
on leakage, collagen deposition, macrophage markers, and expression of mRNA for
IL-10.
Methods: Leakage from choroidal NV was assessed by fluorescein angiography
and collagen deposition was assessed by measurement of the area of Trichrome
staining on serial ocular sections through entire NV lesions. Leakage from
subretinal NV in rho/VEGF transgenic mice was assessed by immunohistochemical
staining for albumin. The level of IL-10 mRNA was measured by quantitative real
time RT-PCR. Macrophage populations were assessed by immunofluorescent
staining for F4/80, CXCR4, CCR2, and CX3CR1.
Results: Compared to intraocular injection of vehicle after laser-induced rupture of
Bruch’s membrane, there was significant reduction in the mean area of NV after
injection of 2 (40%), 5 (43%) or 20µg (50%) of rPTX-2, but not 0.2µg. Seven days
after rupture of Bruch’s membrane and injection of 2µg of rPTX-2 or vehicle,
fluorescein angiography showed reduced fluorescein leakage from choroidal NV in
rPTX-2-injected compared to vehicle-injected eyes. Treatment with rPTX-2 also
reduced the area of collagen staining associated with choroidal NV lesions.
Rhodopsin/VEGF transgenic mice were given intraocular injections of vehicle or
20µg of rPTX-2 at P14 and P17. At P21, the area of albumin staining per retina was
0.0128mm2 in rPTX-2-injected eyes compared to 0.0361mm2 in vehicle injected
eyes (p=0.0003). Compared to eyes injected with vehicle, those injected with
rPTX-2 had a significant increase in IL10 mRNA. Mice with ischemia-induced
retinal NV treated with rPTX-2 had significantly fewer CXCR4+, CCR2+ and
F4/80+ cells in the retina compared to controls, but no difference in CX3CR1+
cells.
Conclusions: PTX-2 reduces total macrophage number in ischemic retina and
causes a relative increase in CX3CR1+ cells versus those positive for CXCR4,
CCR2 and F4/80. This and the increase in IL-10 mRNA suggest an increase in
MREG/M1(ratio). This change in macrophage number and phenotype is associated
with suppression of NV and reduced leakage and collagen deposition.
Commercial Relationships: Raquel Formica, None; Jikui Shen,
None; Christopher P. Seidel, None; Sean F. Hackett, None; Michael S. Kramer,
Promedior, Inc. (E); Mark L. Lupher Jr., Promedior, Inc. (E); Peter A.
Campochiaro, None
Support: EY012609
Program Number: 1212 Poster Board Number: D1028
Presentation Time: 3:15 PM - 5:00 PM
Protective role of microRNA 146a and 155 in experimental autoimmune
uveitis
Sindhu Saraswathy, Narsing A. Rao. Ophthalmology, Doheny Eye Institute, Los
Angeles, CA.
Purpose: MicroRNAs, the small non-coding RNAs, regulate gene expression
involved in immune responses and apoptosis and play a significant role in the
pathogenesis of disease states. Our previous findings have shown that microRNAs,
mir146a and 155 were significantly upregulated by αA crystallin treatment in
experimental autoimmune uveitis (EAU). Furthermore, treatment with these
microRNAs ameliorated EAU. In this study, we investigated modulation of
adaptive immune response and apoptosis by the treatment of microRNA 146a and
155 in EAU
Methods: EAU was induced in three groups of B10RIII mice and was treated by
intravenous injection of miRIDIAN microRNA mimics for mmu-miR-146a
(UGAGAACUGAAUUCCAUGGGUU) and mmu-miR-155
(UUAAUGCUAAUUGUGAUAGGGGU). Control group mice were injected with
miRIDIAN microRNA negative control mimics. Enucleated eyes were analyzed by
qPCR for Th1/Th2/Th17- related cytokines. Cytokine protein expression was
assayed by MultiAnalyte Elisarray kit. TUNEL assay was used to detect apoptosis
Results: On postimmunization day 21, Th1 cytokines TNF-α and IL-12 and Th17
cytokine IL-17 were significantly upregulated in the retinas of EAU mice treated
with scrambled microRNA sequences, whereas the levels of these cytokines were
significantly reduced in the mice treated with the microRNA mimics 146a and 155.
The Th17 cytokines Il-6, Il-17 and Il-23 and TGF-β were also downregulated,
whereas the Th2 cytokine IL-10 was elevated in these treatment groups. Treatment
with mir146a and mir155 prevented apoptosis of photoreceptor cells in EAU,
whereas there was significant apoptotic cells in the scrambled microRNA-treated
mice.
Conclusions: Treatment of EAU by miR-146a and miR-155 suppressed the local
immune response by downregulating the Th1- and Th17-related cytokines in the
retina. Mir-146a and mir-155 treatment may prevent photoreceptor degeneration by
modulating innate and adaptive immune responses and the apoptosis pathway.
Copyright 2012 by the Association for Research in Vision and Ophthalmology, Inc., all rights reserved. For permission to reproduce any abstract, contact the ARVO Office at pubs@arvo.org.
ARVO 2012 Annual Meeting Abstracts by Scientific Section/Group – Biochemistry/Molecular Biology (BI)
Thus, systemic microRNA-based treatment may offer a novel approach for
suppressing uveitis and preventing the accompanying photoreceptor damage
Commercial Relationships: Sindhu Saraswathy, None; Narsing A. Rao, None
Support: NIH grants: EY017347, EY019506, EY03040 and RPB.
Program Number: 1213 Poster Board Number: D1029
Presentation Time: 3:15 PM - 5:00 PM
Baseline Fundus Autofluorescence (FAF) in Subjects with Retinitis
Pigmentosa (RP) Due To LRAT Mutations
Sulaiman Alhumaid1, Huanan Ren1, Amer Omar2, Radwan Ajlan1, Mahshad
Darvish-Zargar1, Ayesha Khan1, Robert K. Koenekoop1. 1McGill Ocular Genetics
Laboratory, McGill University Health Centre, Montreal, QC, Canada;
2
Ophthalmology, McGill University, Montreal, QC, Canada.
Purpose: Fundus autofluorescence (FAF) is a measure of lipofuscin accumulation
in the retina, which reflects the activity of both the retinoid cycle and the ability of
the retinal pigment epithelial (RPE) to phagocytose the photoreceptor (PR) outer
segments. Our purpose was to determine the baseline characteristics of FAF in
blind patients with retinitis pigmentosa (RP) due to LRAT mutations. FAF is
potentially a useful measure of viability of the PR-RPE interface and clinical
response to gene replacement or drug therapy in currently ongoing LCA and RP
treatment trials. Previously FAF has not been shown in patients with LRAT
mutations.
Methods: RP patients with LRAT mutations were tested for FAF and OCT by the
Heidelberg Spectralis, using the 488 nm blue light stimulus. Genotyping was done
by Sanger sequencing and confirmed by a CLIA lab. Patients were age-matched
and best corrected ETDRS visual acuities and Goldmann visual fields were
measured. Correlations were made between baseline FAF patterns, VA, VF, age,
genotypes and OCT results.
Results: Patients with RP due to LRAT mutations were tested. Unlike previous
studies, we found that RP patients with LRAT mutations maintain some FAF
signals, albeit abnormal. We found two very different patterns of autofluorescence,
including 1. A perifoveal band of FAF surrounding an absent center of FAF; 2. A
peripheral macular stippling pattern of FAF. In this ongoing study, we are currently
correlating these patterns with age, OCT parameters, genotype, mutation severity,
visual fields and acuities.
Conclusions: We here report cases of RP due to LRAT mutations showing
remaining FAF patterns. This is the first report of FAF patterns in RP patients with
LRAT mutations. Despite the fact that LRAT mutations cause a block in the retinoid
cycle, and prevent the formation of 11-cis retinal, we document lipofuscin
accumulation, suggesting a low level of retinoid cycle activity. These FAF patterns
may be helpful at baseline to determine efficacy and safety of drug or gene
treatments, and identify progression patterns for RP due LRAT mutations.
Commercial Relationships: Sulaiman Alhumaid, None; Huanan Ren,
None; Amer Omar, None; Radwan Ajlan, None; Mahshad Darvish-Zargar,
None; Ayesha Khan, None; Robert K. Koenekoop, QLT Inc (C)
Support: NIH, CIHR, FFB-Canada, FRSQ, Reseau Vision, Heidelberg
Engineering, QLT Inc
Program Number: 1214 Poster Board Number: D1030
Presentation Time: 3:15 PM - 5:00 PM
Phenotype Variation In A Swedish Family With Enhanced S Cone Syndrome
Ingemar C. Gustafsson1, Sten Andreasson2, Patrik S. Schatz2. 1Ophthalmology,
Skane University Hospital, Lund, Sweden; 2Ophthalmology, Lund University
Hospital, Lund, Sweden.
Purpose: To describe the phenotype variation in a Swedish family with enhanced S
cone syndrome (ESCS).
Methods: The male proband, his and five siblings and their mother were
investigated with full-field ERG, multifocal ERG (mfERG), optical coherence
tomography (OCT) and fundus autofluorescence photography (FAF). Molecular
genetic analysis of NR2E3 was performed.
Results: The male proband age 24 was diagnosed with ESCS ten years ago. The
heterozygous mutation p.E121K was identified in NR2E3 in the proband. This
mutation has been associated with ECSC previously. The proband harboured
atypical nummular deep pigmentation throughout the peripheral fundi. Full-field
ERG demonstrated reduced rod, rod-cone and 30 Hz flicker cone responses (<50%
of lower range of normal for all), and there was no demonstrable progression
during 10 years of follow-up. MfERG demonstrated preserved central function and
peripheral reduction. OCT demonstrated epiretinal fibrosis and microcystic changes
in the inner retinal layers. Visual fields were normal by Goldmann object V:4,
however for object I:4 there was a progression from 70 degrees temporally to 30
degrees during 10 year follow-up.
The mother had widespread confluent peripheral atrophic areas reminiscent of
gyrate atrophy, and barely measurable rod and cone function by full-field ERG
already at presentation at age 40 years. Visual fields by Goldmann object I:4 were
reduced to <10 degrees temporally.
All siblings had normal visual fields and full-field ERGs.
Conclusions: The phenotypes varied widely within this family with ESCS. Visual
fields were progressively constricted for objects I:4 in affected individuals. In
addition, central retinal structural alterations were demonstrated, with relative
preservation of function.
Commercial Relationships: Ingemar C. Gustafsson, None; Sten Andreasson,
None; Patrik S. Schatz, None
Support: Ögonfonden, Dag Lenards fond, Stiftelsen för synskadade i f d
Malmöhus län,Stiftelsen Kronprincessan Margaretas arbetsnämnd för synskadade.
Program Number: 1215 Poster Board Number: D1031
Presentation Time: 3:15 PM - 5:00 PM
Role of 20-Hydroxyeicosatetraenoic Acid in a Rat Model of Oxygen-induced
Retinopathy
Mohamed G. Qaddoumi1, Anna Polosa2, Sylvain Chemtob3, Pierre Lachapelle2.
1
Applied Therapeutics, Kuwait University School of Pharmacy, Kuwait, Kuwait;
2
Ophthal/Neurol-Neurosurgery, McGill Univ/Montreal Children's Hosp, Montreal,
QC, Canada; 3Pediatrics & Pharmacology, Research Ctr/Hosp Ste Justine,
Montreal, QC, Canada.
Purpose: 20-Hydroxyeicosatetraenoic Acid (20-HETE), an arachidonic acid
metabolite, is a vasoconstrictor eicasanoid shown previously to induce both
ischemia and oxidative stress in brain and coronary vasculature, both of which were
reversed using an inhibitor of 20-HETE. The purpose of this study was to
investigate if inhibition of 20-HETE could alleviate the functional and structural
abnormalities observed in a rat model of oxygen-induced retinopathy.
Methods: Normal and oxygen-induced retinopathy (exposed to 80% oxygen)
Sprague-Dawley (SD) juvenile rats were chronically injected intraperitoneally with
either 2 mg/kg HET0016 (20-HETE inhibitor) or vehicle (DMSO) from P6-14. The
effects of HET0016 on retinal function were evaluated via scotopic (intensity: -6.3
to 0.6 log cd.sec.m-2; 12 hours dark adaptation) and photopic (intensity: 0.9 log
cd.sec.m-2; background: 30 cd.m-2) electroretinography (ERG) in both P30 and P60.
The effect of HET0016 on retinal structure was evaluated using whole retina
histology on both P30 and P60.
Results: Intraperitoneal injection of HET0016 to hyperoxic rats did not
significantly affect the scotopic a- and b-wave amplitudes compared to hyperoxic
rats injected with DMSO. However, both cohorts of hyperoxic rats had diminished
scotopic and photopic b-wave amplitudes (averaging at 40% and 57% less for both)
compared to control rats exposed to normal air at both P30 and P60. Photopic bwave amplitudes of hyperoxic rats injected with HET0016 were higher at both P30
(17% higher) and P60 (15.5%) than in their hyperoxic cohorts injected with
DMSO, though this was not significant enough. When comparing the ratio of
scotopic b-wave amplitudes of HET0016 injected rats versus DMSO injected rats
in both normoxic (0.81 and 0.90) and hyperoxic (1.00 and 1.06) cohort rats in both
P30 and P60, a noticeable increase of 19% and 17% is seen in favor of HET0016
injected hyperoxic rats, respectively. A similar observation was noticeable with
photopic b-wave amplitudes as well.
Conclusions: Our findings suggest that inhibition of 20-HETE may have some
minor protective effects on retinal function in hyperoxic rats by attenuating the
decrease in both the scotopic and photopic b-wave amplitudes. Whether these
findings are due to the vasodilator and anti-oxidant properties of HET0016 on the
ischemic phase of retinopathy or its anti-angiogenic effects on the
neovascularization phase of retinopathy remain to be elucidated. It would be
interesting to observe if inhibition of 20-HETE has any beneficial effects on other
models of retinopathy, such as light-induced or diabetic retinopathy, and
whether this protective effects could be of greater impact if the drug was delivered
topically or intravitreally.
Commercial Relationships: Mohamed G. Qaddoumi, None; Anna Polosa,
None; Sylvain Chemtob, None; Pierre Lachapelle, None
Support: Reseau Vision AND NSERC
Program Number: 1216 Poster Board Number: D1032
Presentation Time: 3:15 PM - 5:00 PM
Screening Potential Drug Therapies For Retinitis Pigmentosa Using
Transgenic X. Laevis
Orson L. Moritz1A, Zusheng Zong1A, Beatrice M. Tam1B, Cheryl Y. GregoryEvans1C, Joanne A. Matsubara1D, Kevin Gregory-Evans1E. AOphthalmology &
Visual Sciences, BOphthalmology and Visual Sciences, COphthalmology, DOphthal
& Visual Science, EOphthal & Visual Sciences, 1University of British Columbia,
Vancouver, BC, Canada.
Purpose: The rhodopsin P23H mutation is the most common cause of autosomal
dominant RP in North America, and causes instability of opsin in the biosynthetic
pathway. Using X. laevis models of retinitis pigmentosa (RP), we have previously
demonstrated that retinal degeneration caused by human P23H rhodopsin can be
partially rescued by dark rearing due to stabilization of the protein by the 11-cis
retinal chromophore; this effect is detectable in tadpoles as soon as two weeks
following fertilization. Our purpose is to use this animal model as a mediumthroughput screening tool to identify potential drug therapies for RP, including
therapies based on pharmacological chaperones, which we hypothesize should
demonstrate an effect comparable to dark rearing.
Methods: Heterozygous transgenic animals are mated with wildtype animals to
generate a population of 50% transgenic animals. Drugs are initially screened for
Copyright 2012 by the Association for Research in Vision and Ophthalmology, Inc., all rights reserved. For permission to reproduce any abstract, contact the ARVO Office at pubs@arvo.org.
ARVO 2012 Annual Meeting Abstracts by Scientific Section/Group – Biochemistry/Molecular Biology (BI)
toxicity on X. laevis embryos in order to identify a suitable range for dosing. Mixed
groups of transgenic and WT tadpoles are then treated with a half-log dilution
series of drug beginning 5 days after fertilization, and concluding 14 days after
fertilization, under conditions of either cyclic light or constant darkness. Tadpoles
are subsequently processed for PCR-based genotyping and dot blot assay for total
rhodopsin. A reduction in total rhodopsin is indicative of retinal degeneration,
which can be confirmed by confocal microscopy of the contralateral eye.
Results: As proof-of-principle we tested several small molecule drugs. We found
that one researcher was able to complete an entire dose-response experiment with
up to 150 individual data points within a four week time frame, including all
histology and data analysis. This was significantly faster than testing in mammalian
model systems, which took up to 6 months in a comparable experiment involving
125 data points. Because we can monitor the quantity and intracellular localization
of transgenic rhodopsin, it is possible to obtain information on both efficacy and
mechanism of action.
Conclusions: Transgenic X. laevis provide a mechanistically informative system
for rapidly screening potential RP treatments. “Hits” can be further examined in
more complex experiments involving mammalian models of RP.
Commercial Relationships: Orson L. Moritz, None; Zusheng Zong,
None; Beatrice M. Tam, None; Cheryl Y. Gregory-Evans, None; Joanne A.
Matsubara, None; Kevin Gregory-Evans, None
Support: CIHR222728, Foundation Fighting Blindness - Canada.
photoreceptors, ONL, OPL and the INL. Fluorescein angiography shows leakage
suggesting neovascularization and hemorrhage in CYP27A1-/-CYP46A1-/- as
compared to WT mice. Staining with filipin shows deposition of unesterified
cholesterol in the choroidal blood vessels as well as in Bruch’s membrane and subretinal space. Furthermore, Oil Red O stain for neutral lipids shows enhanced
staining within Bruch’s membrane. Evaluation by ERG shows a statistically
significant decrease in the amplitude of scotopic a-wave and photopic b-wave in 6month CYP27A1-/-CYP46A1-/- males and females as compared to WT mice
suggesting an abnormal visual function.
Conclusions: Combined deficiency in CYP27A1 and CYP46A1 leads to profound
changes in retinal structure as well as abnormal lipid deposition and vascularization
with severe hemorrhages. Profiling of genes involved in lipoprotein signaling,
cholesterol metabolism and angiogenesis is underway.
Commercial Relationships: Aicha Saadane, None; Saida Omarova,
None; Casey Charvet, None; Wenchao Zheng, None; Irina A. Pikuleva, None
Support: NIH RO1 Grant EY018383
Program Number: 1217 Poster Board Number: D1033
Presentation Time: 3:15 PM - 5:00 PM
Clinical response to intravitreal Rapamycin in a retinal neovascularization
model
Lucia Rivera Sanchez1, Alejandra Ruiz Franco2, Juan Abel Ramirez Estudillo2A,
Victor Manuel Bautista de Lucio3. 1Ophthalmology Institute "Fundacion Hospital
Nuestra Senora de la Luz" I.A.P., Mexico, Mexico; ADept. Retina, 2Ophthalmology
Institute "Hospital Fundacion Nuestra Senora de la Luz" I.A.P., Mexico, Mexico;
3
Microbiology and Ocular Proteomics, Ophthalmology Institute "Fundacion Conde
de Valenciana" I.A.P., Mexico, Mexico.
Purpose: To describe the clinical and fluorangiography response to intravitreal
Rapamycin in a retinal neovascularization model induced with vascular endothelial
growth factor (VEGF165).
Methods: We performed a retinal neovascularization model in three New Zealand
rabbits by intravitreal application of VEGF (8µg/0.1ml). Once neovascularization
was developed, two rabbits where treated with 333µg/0.1ml of intravitreal
Rapamycin. Rabbit without treatment was used as control. Clinical and
fluorangiographyc follow was done at seventh and fourthteen day.
Results: At third day after VEGF was applied, neovascularization of anterior
segment was evidenced in all rabbits. At first week, retinal neovascularization was
clinical and fluorangiography demonstrable. One rabbit developed a fibrovascular
proliferation and small pre-retinal hemorrhage. Indirect ophthalmoscopy and
fluorangiography showed partial regression of the neovascularization seven days
after Rapamycin treatment, this regression continued until day fourthteen, where no
clinical evidence of neovascularization was observed, and neither hiperfluorescence
phenomenon. Likewise, there was partial regression of fibrovascular proliferation
without retinal detachment.
Conclusions: Intravitreal Rapamycin at 333µg/0.1ml concentration caused clinical
and fluorangiographyc regression of retinal neovascularization in an experimental
model induced by VEGF165.
Commercial Relationships: Lucia Rivera Sanchez, None; Alejandra Ruiz
Franco, None; Juan Abel Ramirez Estudillo, None; Victor Manuel Bautista de
Lucio, None
Support: None
Program Number: 1219 Poster Board Number: D1035
Presentation Time: 3:15 PM - 5:00 PM
First Report of Molecular Genetic Analysis of Stargardt Disease in Mexican
Population
Oscar F. Chacon-Camacho1, Juan C. Zenteno-Ruiz2. 1Genetics, Institute of
Ophthalmology, Mexico City, Mexico; 2Genetics, Institute of Ophthalmology
"Conde de Valenciana", Mexico City, Mexico.
Purpose: Stargardt disease (STGD; OMIM # 248200) is an autosomal recessive
retinal dystrophy occurring in 1 in 8,000-10,000 and recognized as the most
common cause of inherited juvenile macular dystrophy. Typically initiates early in
childhood or in adolescence with a fast, gradual and bilateral visual acuity decrease,
central scotomas, discromatopsia, photophobia and development of yellow-orange
flecks around the macula and/or midretinal periphery. It is caused by mutations on
the ABCA4 gene localized on 1p13-p2. This gene is composed by 50 exons that
encode a protein belonging to the ABC transporter family critical for photoreceptor
metabolism. To date, more than 600 STGD-associated ABCA4 genetic variants has
been reported worldwide. In this work, we describe the first molecular analysis of
the ABCA4 gene on Mexican subjects with STGD.
Methods: Fourteen sporadic and 8 familial STGD cases of Mexican origin were
included in the study. Probands underwent full ophthalmologic examination
including fundus examination, FAG and ERG. Blood samples were obtained by
venopuncture and genomic DNA was extracted. PCR amplification of the 50 exons
and the intron-exon junctions of the ABCA4 gene was achieved using pairs of
primers derived from the ABCA4 sequence. PCR products were purified and
directly sequenced using the dideoxy chain terminators (BigDye) method. DNA
from a total of 100 control individuals was analyzed to validate novel ABCA4
mutations.
Results: Twenty out of 22 probands carried at least one ABCA4 mutation: 8
patients carried homozygous changes, 5 were compound heterozygotes and 7
carried heterozygous ABCA4 pathogenic mutation. Of 30 likely pathogenic
sequence changes, 28 were missense mutations, including 6 novel, one novel
frameshift mutation, and one novel nonsense mutation.
Conclusions: This study represents the first report of ABCA4 mutations in Latin
American patients with Stargardt disease. A number of novel and previously
reported ABCA4 mutations were recognized. Our results expand the mutational
spectrum of STGD- related mutations by demonstrating 8 novel mutations in the
ABCA4 gene.
Commercial Relationships: Oscar F. Chacon-Camacho, None; Juan C.
Zenteno-Ruiz, None
Support: None
Program Number: 1218 Poster Board Number: D1034
Presentation Time: 3:15 PM - 5:00 PM
Combined Deficiency In Cholesterol-metabolizing Cyp27A1 And Cyp46A1
Leads To Neovascularization And Lipids Accumulation In Mouse Retina
Aicha Saadane1A, Saida Omarova1A, Casey Charvet1A, Wenchao Zheng1A, Irina A.
Pikuleva1B. AOphthalmology and Visual Science, BOphthalmology and Visual
Sciences, 1Case Western Reserve University, Cleveland, OH.
Purpose: To characterize the retinal phenotype of CYP27A1-/-CYP46A1-/ - mice
with aberrant enzyme-mediated cholesterol removal.
Methods: Knockout (KO) and wild-type (WT) mouse retinas were evaluated in
vivo by high-resolution spectral-domain optical coherence tomography (SD-OCT),
fluorescein angiography (FA), histological staining for morphologic changes and
electroretinography (ERG) for visual function.
Results: Starting at the age of 6 weeks, OCT revealed multiple small hyperreflective structures distributed throughout the inferior retina as well as surrounding
the optic nerve of CYP27A1-/-CYP46A1-/- mice. Histological staining with H&E
showed pronounced structural retinal abnormalities including formation of multiple
rosettes affecting several layers; outer nuclear layer (ONL), outer plexiform layer
(OPL) and inner nuclear layer (INL). The pattern of these lesions varies, with some
lesions starting at the choroid and protruding upward affecting the RPE,
Program Number: 1220 Poster Board Number: D1036
Presentation Time: 3:15 PM - 5:00 PM
Amelioration Of Retinal Degeneration In A X. Laevis Model Of RP By
Treatment With Valproic Acid
Beatrice M. Tam1A, Zusheng Zong1A, Shalesh Kaushal2, Orson L. Moritz1B.
A
Ophthalmology and Visual Sciences, BOphthalmology & Visual Sciences,
1
University of British Columbia, Vancouver, BC, Canada; 2Ophthalmology, UMass
Medical School, Worcester, MA.
Purpose: The rhodopsin P23H mutation is the most common cause of autosomal
dominant RP in North America, and causes instability of opsin in the biosynthetic
pathway. Using X. laevis models of retinitis pigmentosa (RP), we have previously
demonstrated that retinal degeneration caused by P23H rhodopsin can be partially
rescued by dark rearing due to stabilization of the protein by the 11-cis retinal
chromophore. In this study, we treated X. laevis tadpoles expressing P23H
rhodopsin with the drug valproic acid (VPA), a proposed therapy for RP, to
examine its efficacy and mechanism of action.
Methods: Transgenic tadpoles expressing human P23H rhodopsin were treated
with varying concentrations of VPA beginning 5 days after fertilization, and
concluding 14 days after fertilization, under conditions of either cyclic light or
constant darkness. Tadpole eyes were subsequently processed for dot blot assay for
Copyright 2012 by the Association for Research in Vision and Ophthalmology, Inc., all rights reserved. For permission to reproduce any abstract, contact the ARVO Office at pubs@arvo.org.
ARVO 2012 Annual Meeting Abstracts by Scientific Section/Group – Biochemistry/Molecular Biology (BI)
total rhodopsin and confocal microscopy.
Results: We observed highly significant rescue of P23H rhodopsin-induced retinal
degeneration by VPA. This rescue was dose dependent, but never complete. We
further investigated the effect of combined dark rearing and VPA treatment. We
found that VPA treatment + dark rearing did not result in significantly greater
rescue than VPA treatment alone, suggesting a common mechanism of action of
these two therapies. Confocal microscopy further indicated that both dark rearing
and VPA treatment result in a reduction in the quantity of full length P23H
rhodopsin present in rod inner segments.
Conclusions: Our results indicate that VPA treatment is effective in at least one
animal model of RP. Furthermore, rescue of retinal degeneration by dark-rearing
and VPA treatment likely share a common mechanism. However, our results also
suggest at least two mechanisms underlie retinal degeneration in this model of RP,
one of which is not addressed by either dark rearing or VPA treatment.
Commercial Relationships: Beatrice M. Tam, None; Zusheng Zong,
None; Shalesh Kaushal, None; Orson L. Moritz, None
Support: CIHR222728, Foundation Fighting Blindness - Canada
Program Number: 1221 Poster Board Number: D1037
Presentation Time: 3:15 PM - 5:00 PM
Evaluating the Efficacy of DNA Nanoparticles and Plasmid DNA in Treating
RPE Based Diseases
Adarsha Koirala1, Rasha S. Makkia1, Mark J. Cooper2, Muna I. Naash1. 1Cell
Biology, Univ of OK Health Sciences Ctr, Oklahoma City, OK; 2Coperncus
Therapeutics, Inc, Cleveland, OH.
Purpose: In this study, we evaluated the ability of compacted DNA nanoparticles
(NPs) and plasmid DNA to generate efficient and stable transgene expression in
mouse retinal pigment epithelial (RPE) cells. Our goal is to develop a non-viral
gene delivery system that would be clinically relevant in treating RPE-associated
ocular diseases such as Leber congenital Amaurosis (LCA).
Methods: We constructed two plasmid vectors containing eGFP and hRPE65
cDNAs driven by human vitelliform macular dystrophy-2 (VMD2) promoter- i)
VMD2-eGFP-S/MAR and ii) VMD2-hRPE65-S/MAR. Both vectors were
compacted with CK30PEG10K into rod-like DNA NPs (diameter <8-11 nm). NPs
or uncompacted DNA (4.3µg/µl) and saline (vehicle) were injected into the
subretinal space of 30 day old BALB/c mice or 16 day old RPE65-/- mice. eGFP
and hRPE65 expression levels and localization were evaluated by qRT-PCR and
immunohistochemistry (IHC). Quantification of eGFP expressing cells was
performed on RPE flatmounts to evaluate the distribution of transgene expression.
Fundus imaging was performed to show live imaging of DNA distribution as well
as eGFP expression. Electroretinography (ERG) was performed to analyze visual
rescue and structural maintenance was analyzed by light and electron microscopy
(EM) on RPE65-/- mice.
Results: qRT-PCR and IHC of retinal whole mounts and cross sections showed
high levels of eGFP expression from PI-2 days up to PI-2 years (the longest
timepoint tested). ~50-60 % cells throughout the RPE exhibited eGFP expression at
2 years PI. IHC showed eGFP and hRPE65 expression localized specifically to the
RPE. At PI-180 days, qRT-PCR for hRPE65 expression showed ~50% of
endogenous RPE65 expression for both naked DNA and NP injects. Treated
RPE65-/- mice exhibited maintained cone ERGs compared to saline injected
cohorts. At PI-180 days, ultrastructural analysis showed fewer or no lipid droplets
in the RPE cells of treated mice compared to uninjected controls suggesting
reduction in retinyl ester accumulation.
Conclusions: Both NPs and naked DNA were able to drive highly efficient and
sustained therapeutic gene expression in the RPE. These results suggest that both
DNA nanoparticles and naked DNA carrying S/MAR vectors have significant
clinical potential for treating RPE-based diseases.
Commercial Relationships: Adarsha Koirala, None; Rasha S. Makkia, None;
Mark J. Cooper, Copernicus Therapeutics, Inc. (S); Muna I. Naash, None
Support: National Institutes of Health [EY10609 (M.I.N.), EY018656
(M.I.N.),Core Grant for Vision Research EY12190 (M.I.N.), the Foundation
Fighting Blindness (M.I.N.)
Program Number: 1222 Poster Board Number: D1038
Presentation Time: 3:15 PM - 5:00 PM
Inhibition of Ocular Tumor Cell Growth With RTEF-1 Peptide Fragment
Bissan A. Ahmed1, Andrew Stempel1, Trevor McFarland1, Bruce Ksander2, Binoy
Appukuttan1, Tim Stout1. 1Casey Eye Institute, OHSU, Portland, OR; 2Scepens Eye
Research Institute, Harvard Medical School, Boston, MA.
Purpose: Transcriptional enhancer factor 1-related (RTEF-1) is a member of the
TEA DNA binding domain gene family. RTEF-1 is expressed within ocular
vascular endothelial cells and has been shown to play a role in the control of VEGF
expression. Ocular melanoma (OM) is the most common primary ocular tumor in
adults , while Retinoblastoma (Rb) is a rapidly developing cancer of retina usually
affecting children under the age of four. We previously identified a 651bp RTEF-1
isoform that can inhibit VEGF expression.
The purpose of this study is to test whether a short peptide fragment derived from a
functional domain of the 651bp RTEF-1 isoform can inhibit ocular tumor cell
proliferation.
Methods: A 26 amino acid sequence corresponding to a Ser-Thr-Tyr domain
within RTEF-1 linked to a 10 amino acid cell importation signal (RMR) was
synthesized (GenScript U.S InC). Human ocular melanoma cells (Mel 202) (a kind
gift from Dr Bryan Ksander) and Y79 retinoblasmotma cells (ATTC) were plated
into a 96 well plate and cultured for 24 h. The STY-RMR peptide was added to the
cell culture media at various concentrations (0.1 to 30 ug /100ul). Cell proliferation
was assessed at 72 hours using a colorimetric XTT assay Cell proliferation was
expressed as a percentage of the negative controls (n = 6). The amount of VEGF
within media was determined by VEGF ELISA and compared between STY-RMR
treated and controls (n = 6). Cellular apoptosis was assessed by terminal
deoxynucleotidyl transferase-mediated dUTP nick end-labeling (TUNEL) and by
apoptosis ELISA .
Results: Significant inhibition of ocular melanoma cell proliferation was obtained
with 30ug/100ul of STY-RMR treatment (83%) (P < 0.01). A dose dependent
response was also observed. Greater than 50% inhibition in cell proliferation was
observed in the retinoblasmotma Y79 cells using the same dose (P < 0.01). A none
significat increase in apoptosis of about (20%) could be detected in treated human
ocular melanoma 24h after treatment.
The optimum dose to obtain significant therapeutic effect varied depending on
tumor type.
Conclusions: Using functional short peptide domains derived from the 651 RTEF1 isoform may prove to be useful for treatment of ocular tumors.
Commercial Relationships: Bissan A. Ahmed, None; Andrew Stempel,
None; Trevor McFarland, None; Bruce Ksander, None; Binoy Appukuttan,
None; Tim Stout, None
Support: the Clayton Foundation for Research; Research to Prevent Blindness,
Collins Medical Trust and NIH:NEI:R01 EY019042
Program Number: 1223 Poster Board Number: D1039
Presentation Time: 3:15 PM - 5:00 PM
Trafficking of an Adeno-Associated Virus Variant in the Retina
Kenton T. Woodard1A, Takeshi Iwase2, Luk H. Vandenberghe3A, Ping Jie Xiao1B,
Josh C. Grieger1C, Albert M. Maguire3B, Katharine J. Liang1A, Jean Bennett3B,
Peter A. Campochiaro4, R. Jude Samulski1B. AGene Therapy, Neurobiology, BGene
Therapy, CJoint Vector Core, 1University of North Carolina at Chapel Hill, Chapel
Hill, NC; 2Ophthalmology, Johns Hopkins Hospital, Baltimore, MD; AGene
Therapy, BF.M. Kirby Center for Molecular Ophthalmology, 3University of
Pennsylvania, Philadelphia, PA; 4Ophthalmology and Neuroscience, Johns Hopkins
Wilmer Eye Inst, Baltimore, MD.
Purpose: We recently engineered a variant of AAV2, called AAV2.5, which
demonstrated enhanced gene delivery in muscle, and tested the retinal tropism of
this virus. Although both AAV2 and its variant have the same heparin binding
profiles, AAV2.5 showed enhanced transduction of multiple retinal layers when
delivered intravitreally (IVit) into normal rodent and pig eyes. The focus of this
study is to better understand the molecular mechanism of AAV vector trafficking in
the retina after IVit delivery.
Methods: We integrated single-particle fluorescence imaging with 3D deconvolution, isosurface rendering and quantification as well as Fundus, histology
and DNA in situ hybridization to examine viral distribution and dynamics in retina
of mice, pigs, and primates at the single particle level.
Results: In both rodent and pig models, AAV2.5 transduced multiple retinal layers,
distinguishing this capsid from AAV2. Fundus showed global expression of
AAV2.5. However, in studies with primates, no transduction was observed,
suggesting a striking difference in retinal barriers between these models. Further
analysis using DNA in situ demonstrated a lack of detectable genomes in primate
retinas. Infectious virions were still present in primate vitreous at 1 month postadministration. Vitreous from primates showed no inhibition of AAV transduction
in an in vitro neutralizing assay.
Conclusions: Recently, we uncovered a rate-limiting step during cytosol-to-nuclear
transport of virions in the first 8hrs post-infection. Further, we also observed that
following intramuscular injection, AAV spread progressively across muscle tissues
through endomysium between myofibers instead of traversing through target cells.
We were interested in the diffusion kinetics of IVit delivered AAV2.5. Kinetic
studies in the pig eyes revealed AAV2.5 does not penetrate the retina until after
6.5hrs post-administration. Taken together, we anticipate that ongoing studies will
help elucidate the mechanism(s) underlying the lack of diffusion or penetration in
the primate retina. Our results highlight important cross-species differences in the
diffusional properties of AAV capsids within the vitreous.
Commercial Relationships: Kenton T. Woodard, None; Takeshi Iwase,
None; Luk H. Vandenberghe, None; Ping Jie Xiao, None; Josh C. Grieger,
None; Albert M. Maguire, None; Katharine J. Liang, None; Jean Bennett,
None; Peter A. Campochiaro, None; R. Jude Samulski, None
Support: NEI Grant EY0199555-01, Foundation Fighting Blindness
Program Number: 1224 Poster Board Number: D1040
Presentation Time: 3:15 PM - 5:00 PM
Copyright 2012 by the Association for Research in Vision and Ophthalmology, Inc., all rights reserved. For permission to reproduce any abstract, contact the ARVO Office at pubs@arvo.org.
ARVO 2012 Annual Meeting Abstracts by Scientific Section/Group – Biochemistry/Molecular Biology (BI)
TFIIH-XPD Co-Activator Protein in Photoreceptor and Retinal Pigment
Epithelial Gene Transcription and Disease
Shiming Chen, Xiaodong Zhang. Ophthalmology and Visual Sciences, Washington
University School of Medicine, St. Louis, MO.
Purpose: The general transcription factor complex TFIIH plays an important role
in DNA repair and transcription. Mutations in XPD, a subunit of TFIIH, cause
autosomal recessive syndromes with retinal and other ocular defects. Using yeast
two-hybrid assays, we initially identified XPD as an interacting partner of NR2E3,
a nuclear receptor required for rod differentiation. The goal of this research was to
determine the role of TFIIH-XPD in photoreceptor and RPE gene transcription and
associated retinal disease.
Methods: Co-immunoprecipitation, chromatin immunoprecipitation (ChIP) and cotransfection assays investigated XPD interactions with NR2E3 and other
photoreceptor transcription factors (PhTFs). Changes in retinal and RPE gene
expression in XpdTTD mice carrying a hypomorph mutation of XPD were assessed
by immunocytohistochemistry and qRT-PCR.
Results: XPD protein is present in the nucleus of all mouse retinal and RPE cell
types, including photoreceptors and their precursors. Co-immunoprecipitation
showed that XPD interacts not only with NR2E3, but also the cone-rod homeobox
CRX and bZIP factor NRL. Each PhTF interacts with XPD via its regulatory
domain. In transfected NIH3T3 cells, recombinant XPD enhanced the activation of
the rhodopsin promoter by PhTFs, while shRNA-mediated XPD knockdown
blocked transcriptional activation. ChIP assays on P14 wild-type mouse retinas
showed that XPD and other components of TFIIH bind to promoter and coding
regions of each opsin gene along with PhTFs. XPD target binding is reduced in
mutant retinas lacking each PhTF, suggesting that XPD is a PhTF co-activator. The
importance of TFIIH-XPD was further revealed by photoreceptor defects in XpdTTD
mice: Reduced amplitudes of dark and light adapted ERG “a” and “b” waves in
young adults, consistent with decreased transcription of PhTF target genes as
measured by qRT-PCR. Expression of several RPE-specific genes were also
reduced in XpdTTD mice.
Conclusions: TFIIH-XPD co-activator complex is essential for photoreceptor and
RPE gene transcription and function. The cellular and molecular mechanisms by
which XPD mutations cause retina/RPE defects are under investigation.
Commercial Relationships: Shiming Chen, None; Xiaodong Zhang, None
Support: NIH grants EY12543 (to SC) and EY02687 (to WU-DOVS), RBP Lew
R. Wasserman Award (to SC) and unrestricted fund (to WU-DOVS)
Program Number: 1225 Poster Board Number: D1041
Presentation Time: 3:15 PM - 5:00 PM
GWAS Mapping and Evaluation of a Modifier Locus for the Age of Onset in
Canine RPGRIP1−/− Cone-Rod Dystrophy
Keiko Miyadera1, Kumiko Kato2, Cathryn S. Mellersh3, David R. Sargan4, Gregory
M. Acland5, Gustavo D. Aguirre1. 1School of Veterinary Medicine, University of
Pennsylvania, Philadelphia, PA; 2Dept of Veterinary Medical Science, University
of Tokyo, Tokyo, Japan; 3Animal Health Trust, Newmarket, United Kingdom;
4
Dept of Veterinary Medicine, University of Cambridge, Cambridge, United
Kingdom; 5James A Baker Institute, Cornell University, Ithaca, NY.
Purpose: A naturally-occurring recessive cone-rod dystrophy (CRD) in Miniature
longhaired dachshund (MLHD) dogs has been studied in an inbred research colony.
The disease is characterized by lack of cone ERG response as early as 6 weeks,
progressing into blindness by 2 years of age. A whole genome scan has led to the
identification of a 44bp insertion in exon 2 of RPGRIP1 and predicted to cause a
premature stop codon. The homozygous mutation (RPGRIP1−/−) segregated
completely with early-onset CRD. However, in the wider MLHD pet population, a
much broader age of clinical onset (0.3-16 years) occurs; as well, some
RPGRIP1−/− dogs appears to be unaffected. Our aim was to identify genetic
modifiers underlying the variability in the age of onset in dogs with the
RPGRIP1−/− background.
Methods: GWAS was performed using Illumina canine SNP chips (22,362 SNPs)
in 31 early-onset (0-4 years), 15 late-onset (5-16 years), and 34 normal (4-14 years)
MLHDs that were all RPGRIP1−/−. Once a locus was mapped, positional candidate
genes were sequenced by Sanger sequencing. Subsequently, the entire interval of
association was sequenced by targeted capture and next-generation sequencing.
Expression of positional candidate genes was examined by RT-PCR in canine
retinas with different genotypes at the second locus.
Results: Comparing the early-onset cases against the controls (late-onset and
normal dogs combined), a single strong association was found on canine
chromosome 15, ~40Mb from RPGRIP1 (p=5.05x10-13). Haplotype analysis
defined a 1.49-Mb interval of homozygosity which corresponded highly to the
early-onset phenotype in RPGRIP1−/− dogs. Sequencing of positional candidate
genes and intergenic regions identified numerous polymorphisms. RNA expression
levels of five positional candidate genes (CTSO, GUCY1A3, GUCY1B3, LRAT,
MAP9) did not show experssion changes between the dogs with different second
locus genotype as examined by RT-PCR.
Conclusions: We have established a unique model of canine CRD involving two
distinct genetic loci; concomitant homozygosity at RPGRIP1 and the newly
mapped second locus leads to early-onset blindness whereas the onset is delayed or
remains subclinical in dogs with RPGRIP1−/− alone. The positional candidate genes
examined to date may be provisionally excluded, yet further study is under way to
confirm the modifier mutation.
Commercial Relationships: Keiko Miyadera, None; Kumiko Kato,
None; Cathryn S. Mellersh, None; David R. Sargan, None; Gregory M. Acland,
None; Gustavo D. Aguirre, None
Support: Kennel Club Charitable Trust, Fitzwilliam College, University of
Cambridge, Foundation Fighting Blindness, NIH-EY 06855, 17549, Van Sloun
Fund, Hope for Vision
Program Number: 1226 Poster Board Number: D1042
Presentation Time: 3:15 PM - 5:00 PM
An Unusual Autosomal Dominant Retinal Dystrophy Combining Inner
Retinal Dysfunction And Progressive Cone Dystrophy Is Associated With A
Novel Gene Defect
Isabelle S. Audo1,2, Kinga M. Bujakowska1, Mélanie Letexier3, Jean-Paul Saraiva3,
Saddek Mohand-Saïd1, Botond Roska4, Thierry Léveillard1, Shomi S.
Bhattacharya1,2, José-Alain Sahel1,2, Christina Zeitz1. 1Department of Genetics,
Institut de la Vision/INSERM/UPMC Univ Paris 06/CNRS/CIC503 CHNO, Paris,
France; 2Institute of Ophthalmology, London, United Kingdom; 3IntegraGen SA,
Evry, France; 4Neural Circuit Laboratories, Friedrich Miescher Institute for
Biomedical Research, Basel, Switzerland.
Purpose: To phenotypically and genetically characterize an autosomal dominant
retinal dystrophy with inner retinal dysfunction and progressive cone dystrophy.
Methods: Detailed phenotypic characterization was performed on 9 affected family
members spanning 2 generations including precise family history, best corrected
visual acuity, slit lamp examination, kinetic and static perimetry, full field and
multifocal ERG according to ISCEV standards, fundus autofluorescence imaging
and spectral domain OCT. Known gene defects underlying autosomal dominant
inner retinal dysfunction were studied with Sanger sequencing and targeted next
generation sequencing (NGS). Subsequently, whole exome sequencing was applied
on two affected and one unaffected family members.
Results: Onset of symptoms in this family appears in the mid to late thirties with
progressive bilateral decreased vision and photophobia. All affected members
initially display an electronegative bright flash scotopic ERG response with
subsequent decrease in photopic responses. Fundus autofluorescence imaging was
normal at onset of symptoms before showing atypical autofluorescence changes in
the macular region. These changes were associated with peculiar reflectance
features within the foveal region followed by progressive thinning of the outer
nuclear layer on spectral domain OCT. After exclusion of known gene defects
underlying autosomal dominant inner retinal dysfunction and targeted NGS, whole
exome sequencing identified variants in different novel candidate genes, of which
only one co-segregated with the phenotype. Transcriptomic and proteomic
databases were indicative for cone photoreceptor and inner retinal expression.
Conclusions: This family is presenting with an unusual autosomal dominant
phenotype associating both an inner retinal dysfunction with progressive cone
degeneration and structural retinal abnormalities never reported before. State-ofthe-Art sequencing and database analysis suggest that this family is associated with
a novel gene defect. Expression studies and functional assays will give further
insight on the role of this gene in retinal pathophysiology.
Commercial Relationships: Isabelle S. Audo, None; Kinga M. Bujakowska,
None; Mélanie Letexier, Intergagen SA (E); Jean-Paul Saraiva, Intergagen SA
(E); Saddek Mohand-Saïd, None; Botond Roska, None; Thierry Léveillard,
None; Shomi S. Bhattacharya, None; José-Alain Sahel, None; Christina Zeitz,
None
Support: IA: CDA from the FFB Grant CD-CL-0808-0466-CHNO; CZ (Fondation
Voir et Entendre); CIC 503 (FFB Center); Retina France for the 100 exome project
231 RPE/Retina Biochemistry and Molecular Biology
Monday, May 7, 2012, 8:30 AM - 10:15 AM
Hall B/C Poster Session
Program #/Board # Range: 1582-1619/A535-A572
Organizing Section: Biochemistry/Molecular Biology
Program Number: 1582 Poster Board Number: A535
Presentation Time: 8:30 AM - 10:15 AM
A Potential Role for BBS5 in Regulating Light-Driven Arrestin Translocation
in Rod Photoreceptors
W Clay Smith1, Benjamin Spitzbarth2, Tyler S. Smith1, Susan N. Bolch1, Jian Li1, J.
Hugh McDowell1, Uwe Wolfrum2. 1Ophthalmology, University of Florida,
Gainesville, FL; 2Inst of Zoology, Cell & Matrix Biology, Johannes Gutenberg
Univ of Mainz, Mainz, Germany.
Purpose: Light-driven translocation of arrestin1 in rod photoreceptors is initiated
by rhodopsin through a phospholipase C/protein kinase C (PKC) signaling cascade.
The purpose of this project is to identify potential PKC substrates and identify their
contribution to regulating arrestin translocation.
Methods: Dark-adapted, adult Xenopus eye cups were incubated with 32PlabeledATP, followed by stimulation of PKC with 0.1 mM phorbol ester. Labeled proteins
were excised after SDS-PAGE separation and identified by in gel tryptic digestion
Copyright 2012 by the Association for Research in Vision and Ophthalmology, Inc., all rights reserved. For permission to reproduce any abstract, contact the ARVO Office at pubs@arvo.org.
ARVO 2012 Annual Meeting Abstracts by Scientific Section/Group – Biochemistry/Molecular Biology (BI)
coupled with liquid chromatography-tandem mass spectrometry (LC-MS/MS).
Transgenic Xenopus tadpoles expressing GFP-tagged arrestin1 were used to
correlate arrestin1 translocation via fluorescence confocal microscopy with target
protein phosphorylation. Arrestin1 and BBS5 localization were determined under
different lighting conditions via immunocytochemical labeling of frozen sections
prepared from Xenopus retinas.
Results: Eye cups from adult Xenopus were incubated with 32P-ATP and then
stimulated with 0.1 mM phorbol ester. Autoradiography of samples separated on 416% SDS-PAGE revealed two prominent bands at 40 kD and 65 kD. These bands
were excised and identified by LC-MS/MS as BBS5 (Bardet-Biedl Syndrome
protein 5) and protein kinase C, respectively. Quantification of arrestin
translocation under threshold conditions with increasing intensities of light showed
that the initiation of arrestin1 translocation to the outer segments correlated with
BBS5 phosphorylation. Immunolocalization of BBS5 revealed that BBS5 was
found most abundantly at the base of the cilium and along the entire axonemal
structure. This localization of BBS5 was coincident with arrestin1 along the
axoneme in dark-adapted rods.
Conclusions: BBS5 is phosphorylated in response to either light adaptation or
activation of PKC by phorbol ester. The correlation of BBS5 phosphorylation with
arrestin1 translocation and its localization along the axoneme of rod photoreceptors
suggest that BBS5 may be an important regulator of arrestin1 mobility through the
connecting cilia during light-driven translocation.
Commercial Relationships: W Clay Smith, None; Benjamin Spitzbarth,
None; Tyler S. Smith, None; Susan N. Bolch, None; Jian Li, None; J. Hugh
McDowell, None; Uwe Wolfrum, None
Support: RPB, NIH Grants EY014864, EY06225, and EY08571
Program Number: 1583 Poster Board Number: A536
Presentation Time: 8:30 AM - 10:15 AM
Modeling A Ciliopathy: Ttc26 Is Required For Ciliogeneses In Photoreceptor
And Kidney Epithelial Cells
Qi Zhang1, Qin Liu1, Chrissy Austin2, Iain Drummond2, Eric Pierce1. 1Ocular
Genomic Institute, Massachusetts Eye and Ear Infirmary, Harvard Medical School,
Boston, MA; 2Renal Unit, Massachusetts General Hospital, Harvard Medical
School, Boston, MA.
Purpose: Mutations in genes that encode cilia proteins are increasingly recognized
as common causes of disease. Cilia defects are also seen as the underlying cause of
a number of inherited disorders which affect multiple organ systems, known as
ciliopathies such as Bardet-Biedl syndrome, (BBS), in which RP is found in
association with multiple cilia-related disorders, including cystic renal disease,
polydactyly, mental retardation, obesity and diabetes, gonadal malformations, and
situs inversus. Using both in vitro and in vivo approaches, we modeled a ciliopathy
by knocking down the novel cilia gene TTC26 and characterizing the resultant
phenotypes in renal epithelial cells, zebrafish eyes and pronephoric kidneys.
Methods: Mouse Ttc26 was cloned in a V5-N-terminal fusion expression vector
which was transfected in mIMCD3 cells and the location was revealed by anti-V5
tag antibody. Fusion protein location in rodent photoreceptor cells was detected by
in vivo electrophoration in neonatal rat and followed by immunocytochemistry.
Phenotypes of ttc26-morpholino knockdown zebrafish were characterized by
histology and EM.
Results: Ttc26 localized to the transition zone of photoreceptor cells and the
transition zone and cilia in cultured mIMCD3 renal cells. Knockdown of Ttc26 in
mIMCD3 cell produced shortened and defect primary cilia, revealed by
immunofluorescence and scanning EM respectively. To study its function in
sensory cilia in vivo, we utilized a vertebrate model of zebrafish with morphalino
knockdown. We observed a motile cilia defect in the pronephric kidney at 27 hpf
and a kidney cyst formation with edema at later stages. In the eyes, retinal
lamination in the morphants was normal at P5, but photoreceptor outer segments
were shortened or absent, indicating that the loss of ttc26 function disrupts
ciliogenesis in photoreceptor cells.
Conclusions: These data indicate TTC26 is a component of photoreceptor and
renal cilia, and suggest that TTC26 is required for normal cilia development and
differentiation in the retina and pronephros. These results support screening the
TTC26 gene for mutations in human ciliopathies.
Commercial Relationships: Qi Zhang, None; Qin Liu, None; Chrissy Austin,
None; Iain Drummond, None; Eric Pierce, None
Support: This work is supported by NIH grant EY12910 and FFB
Program Number: 1584 Poster Board Number: A537
Presentation Time: 8:30 AM - 10:15 AM
The Molecular Chaperone BiP Maintains Rod Opsin Mobility in the
Endoplasmic Reticulum
Dimitra Athanasiou1, Maria Kosmaoglou1, Naheed Kanuga1, Sergey Novoselov1,
Adrienne W. Paton2, James C. Paton2, Paul Chapple3, Michael E. Cheetham1.
1
Ocular Biology and Therapeutics, UCL, Institute of Ophthalmology, London,
United Kingdom; 2Research Centre for Infectious Diseases, University of Adelaide,
Adelaide, Australia; 3William Harvey Research Institute, Barts and the London
School of Medicine and Dentistry, Queen Mary University of London, London,
United Kingdom.
Purpose: Molecular chaperones, the facilitators of proper protein folding are
important for photoreceptor function. Overexpression of BiP can alleviate the toxic
effects of misfolded rod opsin in the retina (Gorbatyuk et al., 2010). In this study,
we investigated the role of BiP on wild-type (WT) and mutant (P23H) rod opsin
biogenesis by manipulating the BiP levels in a cell culture model of rod opsin
processing.
Methods: The localisation of WT and P23H rod opsin was investigated in the
presence of the subtilase cytotoxin SubAB or with overexpression of WT BiP and
mutant (T37G) BiP in SK-N-SH neurobastoma cells. Co-immunoprecipitation
studies were performed on either transfected cell lysates or porcine retina lysates.
Rod opsin ubiquitylation status was monitored by co-localisation and coimmunoprecipitation. Rod opsin mobility in the ER was investigated using
fluorescence recovery after photobleaching (FRAP).
Results: BiP levels were specifically depleted to less than 10% of control by
treatment with the subtilase cytotoxin SubAB. BiP depletion resulted in ER
retention of WT rod opsin and reduced traffic to the plasma membrane. Coimmunoprecipitation studies in cells and retinal lysates revealed a weak but specific
interaction between BiP and WT rod opsin. SubAB mediated ER retention of WT
rod opsin led to an increase in rod opsin ubiquitylation. Investigation of rod opsin
mobility by FRAP revealed that treatment with SubAB, or co-expression of a BiP
ATPase mutant, BiP(T37G), compromised the WT rod opsin mobility.
Interestingly, WT rod opsin mobility was reduced to below the mobility of the
misfolded P23H rod opsin, which is retained in the ER and forms ubiquitylated
inclusions in the cytoplasm. SubAB treatment of cells expressing P23H rod opsin
decreased the mobility of the mutant protein further and led to ubiquitylation
throughout the ER. Interestingly, overexpression of WT but not T37G BiP
improved the mobility of P23H-GFP in the ER.
Conclusions: BiP is important for rod opsin biogenesis. Inhibition of BiP function
results in aggregation of WT rod opsin in the ER and suggests that BiP might be
important for maintaining the solubility of both WT and mutant rod opsin in the
ER. Furthermore, BiP overexpression might be used to reduce P23H rod opsin
aggregation.
Commercial Relationships: Dimitra Athanasiou, None; Maria Kosmaoglou,
None; Naheed Kanuga, None; Sergey Novoselov, None; Adrienne W. Paton,
None; James C. Paton, None; Paul Chapple, None; Michael E. Cheetham, None
Support: Fight for Sight, NIHR Biomedical Research Centre for Ophthalmology
and The Wellcome Trust
Program Number: 1585 Poster Board Number: A538
Presentation Time: 8:30 AM - 10:15 AM
Rab11 Is A Component Of Rhodopsin Trafficking In Mouse Retina Through
Interaction With Rhodopsin C-terminus
Xiaogang Cheng1A, Nicholas J. Reish1B, Alecia K. Gross1A,1B. AVision Sciences,
B
Neurobiology, 1Univ of Alabama at Birmingham, Birmingham, AL.
Purpose: Mislocalization of rhodopsin in patients with retinitis pigmentosa is often
due to mutations in the C-terminus of the protein that disrupt the interaction of
rhodopsin with its trafficking components. To identify proteins that mediate proper
transport, we have conducted protein pull-down experiments on rhodopsin from
wild type (WT) and rhodopsin C-terminus mutant knock-in mouse retina. We have
identified rab11 as a binding partner of rhodopsin in mouse retina. To confirm this
interaction and investigate its possible role in cells, we utilized a GST-rab11 fusion
protein in pull-down assays from mouse retinal extracts containing either WT
rhodopsin, rhodopsin Q344ter or rhodopsin-EGFP. We also prepared transgenic
Xenopus. laevis tadpoles expressing WT and mutant rab11 to monitor protein
localization in rod cells.
Methods: Rhodopsin protein affinity chromatography was used to isolate potential
rhodopsin binding proteins from mouse retinal rod outer segment preparations.
Synthetic peptides specific to regions on the cytoplasmic surface of rhodopsin were
employed to competitively elute bound proteins from N-terminal tethered mouse
rhodopsin, and identities of eluted proteins were revealed using in-gel trypsin
digestion and LC-tandem mass spectrometry. Immunoprecipitation was used to
confirm the interactions among newly identified proteins and rhodopsin. GST fused
rab11 was expressed and purified to examine and confirm the interaction between
rab11 and rhodopsin. X. laevis tadpoles carrying transgenic wild type, dominant
negative and constitutively active rab11 were generated, and monitored for
rhodopsin localization.
Results: Rab11 was identified as a rhodopsin binding protein in mammalian
retinas. Reciprocal pull-down experiments confirmed the interaction of rab11 with
WT rhodopsin, but not rhodopsin C-terminal rhodopsin mutants from homozygous
knock-in Q344Ter or rhodopsin-EGFP mice. GST-rab11 pull down experiments
indicated that the active (GTP bound) form of rab11 is required for its binding to
rhodopsin. Expression of a dominant-negative mutant rab11 mutation, S25N, in X.
laevis rods did not cause significant rhodopsin mislocalization or retinal
degeneration but we found S25N rab11 was mislocalized to the inner segment
plasma membrane and the outer segment.
Conclusions: We found that Rab11 interacts with rhodopsin in preparations from
WT mouse retina. This interaction was abolished in two different mouse lines with
Copyright 2012 by the Association for Research in Vision and Ophthalmology, Inc., all rights reserved. For permission to reproduce any abstract, contact the ARVO Office at pubs@arvo.org.
ARVO 2012 Annual Meeting Abstracts by Scientific Section/Group – Biochemistry/Molecular Biology (BI)
rhodopsin carboxy-terminal mutations, indicating that the presence and
accessibility of this region of the protein is essential for rab11-dependent
trafficking. The binding between rab11 and rhodopsin is mediated by the active
form of rab11.
Commercial Relationships: Xiaogang Cheng, None; Nicholas J. Reish,
None; Alecia K. Gross, None
Support: NIH R01EY019311, Karl Kirchgessner Foundation, E. Matilda Ziegler
Foundation
Program Number: 1586 Poster Board Number: A539
Presentation Time: 8:30 AM - 10:15 AM
Mechanisms Of Protein Retention Within The Cone Photoreceptor Sensory
Cilium
Ivayla I. Geneva1A, Cherry G. Ignacio1B, Barry E. Knox1C, Peter D. Calvert1D.
A
Biochemistry and Molecular Biology, Ophthalmology, BBiochemistry and
Molecular Biology, CNeuroscience and Physiology, SUNY Eye Institute,
D
Ophthalmology, Biochemistry and Molecular Biology, Neuroscience and
Physiology, SUNY Eye Institute, 1State University of New York - Upstate,
Syracuse, NY.
Purpose: In rod outer segments (OS), localization and retention of transduction
proteins is thought to be mediated by targeted, active transport and association with
OS disc membranes that are physically separate from the plasma membrane.
Targeting and retention of signaling proteins within cone OSs is not understood.
Unlike rods, cone OS discs are contiguous with the plasma membrane. Therefore
retention of membrane-associated proteins appears to require diffusion barriers
either at the cilium base, as has been suggested for primary cilia, or at the disc rims.
We examined a putative cone opsin OS targeting signal that is analogous to that on
rod opsin, and the possibility of diffusion barriers at the ciliary transition zone and
disc rims, as possible mechanisms for protein localization and retention in the cone
OS.
Methods: Transgenic X. laevis that express EGFP fused with lipidation motifs, red
cone opsin (XRCOP), or a putative XRCOP OS localization sequence, in cones
under the Xenopus red cone opsin (XRCOP) promoter, were created using the
REMI method. Confocal and multiphoton imaging of live cones in retinal slices
were used to study protein localization and dynamics.
Results: Lipidated-EGFP was found in both of the major photoreceptor
compartments, while XRCOP-GFP was localized to the OS. EGFP fused to the Cterminus of XRCOP failed to localize to the OS. Although both integral and
peripheral membrane proteins diffused laterally and axially in the OS, diffusion of
opsin-GFP between discs was significantly retarded relative to lipidated-EGFP.
Conclusions: Our results are consistent with cone opsin retention in the OS being
mediated by a diffusion barrier at the ciliary transition zone. There appears to be a
sieving mechanism at the disc rims that impedes the movement of integral
membranes proteins between discs to a greater extent than peripheral membrane
proteins. The fact that lipidated GFPs are found in both IS and OS compartments
suggests either that the barrier at the ciliary transition zone is selective for intrinsic
membrane proteins, or that lipidated GFPs dissociate from membranes and
equilibrate between these compartments. Unlike rod opsin, addition of the Cterminal 40 amino acids of XRCOP was not sufficient to localize EGFP to the OS,
possibly due to the absence of palmitoylation sites in the cone opsin sequence.
Commercial Relationships: Ivayla I. Geneva, None; Cherry G. Ignacio,
None; Barry E. Knox, None; Peter D. Calvert, None
Support: NIH Grant EY018421, EY012975, Research To Prevent Blindness
Program Number: 1587 Poster Board Number: A540
Presentation Time: 8:30 AM - 10:15 AM
Ciliary Targeting Of Rhodopsin Through Sequential Interactions With
ASAP1-associated Complexes
Dusanka Deretic, Jing Wang. Surgery, Univ of New Mexico Sch of Med,
Albuquerque, NM.
Purpose: A ciliary targeting complex comprised of GTP-binding proteins Arf4 and
Rab11a, an Arf-GAP ASAP1, and the Arf/Rab11 effector FIP3 regulates ciliary
targeting of rhodopsin (Mazelova et al., 2009). In this study we examined the role
of ASAP1 in organizing the events that link rhodopsin's recognition to its ciliary
and ROS destination.
Methods: Wild type and mutant rhodopsin-eGFP-VxPx constructs were expressed
in IMCD-3 epithelial cells and the delivery to the cilia was examined by confocal
microscopy. Protein complexes generated during rhodopsin trafficking in
photoreceptor cells were analyzed by immunoprecipitation and pull down
experiments.
Results: Our data show that the initial event in rhodopsin sorting at the
photoreceptor Golgi/TGN is its formation of a tripartite complex with Arf4GTP
and the Arf-GAP ASAP1, which recognize the VxPx and the FR ciliary targeting
motifs of rhodopsin, respectively. We find that rhodopsin binds to the BAR domain
of ASAP1, responsible for its oligomerization and membrane curvature-inducing
activity. The Arf/Rab11 effector FIP3, which also binds the BAR domain and
stimulates the Arf GAP activity of ASAP1, substantially competes the binding of
60 nM rhodopsin to ASAP1. Similarly, rhodopsin competes the binding of 15 nM
FIP3 to ASAP1, suggesting that the binding sites of rhodopsin and FIP3 on ASAP1
are at least partially overlapping. FIP3 displaces rhodopsin from the tripartite
complex with ASAP1 and Arf4GTP, but has negligible effect on the binding of 180
nM Arf4GTP to ASAP1. Therefore, rhodopsin displacement is likely coupled to
FIP3-stimulated GTP hydrolysis on Arf4 by ASAP1. We find that ASAP1 next
serves as a platform that brings together the proteins necessary for transport to the
cilia including the two G-proteins of the Rab family-- Rab11a and Rab8--linked by
the Rab8 guanine nucleotide exchange factor Rabin8. Ciliary localization of
rhodopsin-GFP-VxPx expressed in epithelial cells is lost upon siRNA-mediated
knockdown of ASAP1. Mutant [FR-AA]rhodopsin-GFP-VxPx, defective in
ASAP1 binding, does not engage Rab8, fails to translocate across the periciliary
diffusion barrier and reach the cilia.
Conclusions: Our study identifies the Arf/Rab11 effector FIP3 as a candidate
factor for the displacement of rhodopsin from ASAP1-associated complexes that
control its targeting. In addition, we show the essential role of ASAP1 in linking
ciliary cargo, such as rhodopsin, with the Rab11a-Rabin8-Rab8 ciliogenesis
module that also controls the ability of rhodopsin to enter the primary cilia and,
consequentially, the ROS.
Commercial Relationships: Dusanka Deretic, None; Jing Wang, None
Support: EY 12421
Program Number: 1588 Poster Board Number: A541
Presentation Time: 8:30 AM - 10:15 AM
Curcumin (Diferuloylmethane) Alters H2O2-induced Expression Profiles of
MicroRNAs in Human ARPE-19 Cells
Jennifer C. Howell, Eugene Chun, Hana Kim, P Michael Iuvone, Rashidul Haque.
Ophthalmology, Emory University, Atlanta, GA.
Purpose: Oxidative stress (OS) has been implicated in many ocular diseases in
which the RPE is considered a primary target. Several studies have shown that
miRNAs play roles in a broad range of biological processes, including AMD,
retinitis pigmentosa, retinoblastoma, and diabetic retinopathy. Alterations in
miRNA expression may occur following exposure to stress-inducing agents,
including H2O2. This study has attempted to unravel whether curcumin, a
polyphenolic compound with many biological activities, alters H2O2-induced
expression profiles of miRNAs in ARPE-19 cells.
Methods: The effect of curcumin on the H2O2-induced miRNA expression profile
was assessed in ARPE-19 cells, which were treated with curcumin (20 µM) for 6 h
prior to H2O2 (200 µM) for 18 h. Control cells with or without H2O2 and curcumin
treatments were also maintained. miRNA expression profiling was carried out
through real-time PCR array (Qiagen). The array contains a panel of 88 miRNAs,
plus four housekeeping genes. Also, the effect of curcumin on the expression levels
of selected antioxidant genes and proteins was tested by qRT-PCR and western
blotting, respectively.
Results: Given individually, curcumin and H2O2 significantly downregulated 20
and 18 miRNAs, and upregulated 6 and 29 miRNAs (p<0.05 compared with
controls; fold change >2.0), respectively. Furthermore, curcumin pretreatment in
cells exposed to H2O2 significantly reduced the expression of 17 H2O2-induced
miRNAs. The members of the miR-30 family that are putative regulators of the
antioxidant defense system were found to be reduced by curcumin. As determined
by qRT-PCR and western blotting, curcumin increased the expression of catalase,
GPx1, and GPx4 at the mRNA and protein levels, respectively.
Conclusions: The results demonstrated that curcumin can modulate the expression
of H2O2-induced miRNAs that are putative regulators of the antioxidant defense
system, as well as other genes that have been reported to be linked to ocular
diseases.
Commercial Relationships: Jennifer C. Howell, None; Eugene Chun,
None; Hana Kim, None; P Michael Iuvone, None; Rashidul Haque, None
Support: RPB,EY004864,EY006360
Program Number: 1589 Poster Board Number: A542
Presentation Time: 8:30 AM - 10:15 AM
Mapping The Differential Distribution Of Proteoglycan Core Proteins In The
Human Retina And Choroid
Tiarnan D. Keenan1A, Simon J. Clark1B, Richard D. Unwin2, Liam A. Ridge1B,
Anthony J. Day1B, Paul N. Bishop1A. AFaculty of Medical & Human Sciences,
B
Faculty of Life Sciences, 1University of Manchester, Manchester, United
Kingdom; 2Centre for Advanced Discovery and Experimental Therapeutics,
Manchester Academic Health Sciences Centre, Manchester, United Kingdom.
Purpose: Proteoglycans (PGs) play crucial roles in development, homeostasis and
disease in many tissues. The aim of this study was to investigate the presence and
distribution of PG core proteins in the human retina and choroid by proteomics and
immunohistochemistry.
Methods: Postmortem human ocular tissue was obtained from consenting adult eye
donors without known retinal disease. Retinal tissue was dissected, and PGs were
extracted and partially purified by anion exchange chromatography. Trypsinized
peptides were analyzed by tandem mass spectrometry and were identified by
database search; the presence of a PG in retinal tissue was confirmed by Western
blotting. PG core proteins were detected by immunohistochemistry and
Copyright 2012 by the Association for Research in Vision and Ophthalmology, Inc., all rights reserved. For permission to reproduce any abstract, contact the ARVO Office at pubs@arvo.org.
ARVO 2012 Annual Meeting Abstracts by Scientific Section/Group – Biochemistry/Molecular Biology (BI)
fluorescence microscopy in frozen human macular tissue sections, where secondary
antibodies were labeled with FITC.
Results: The heparan sulfate PGs perlecan, agrin and collagen-XVIII were
identified in the human retina, and were present in the internal limiting membrane
(ILM), the basement membrane of retinal and choroidal blood vessels, and in
Bruch’s membrane. For the first time to our knowledge, the hyalectans versican
and aggrecan were found in the human retina. Versican was present in Bruch’s
membrane, while aggrecan was distributed abundantly throughout the neurosensory
retina and choroidal stroma. The small leucine-rich repeat PGs decorin, biglycan,
lumican, mimecan and prolargin were present, each with distinct distributions in
the neurosensory retina, Bruch’s membrane and choroid.
Conclusions: The combination of proteomics, Western blot and
immunohistochemistry approaches has provided for the first time a comprehensive
analysis of the presence and distribution of PG core proteins throughout the adult
human retina, choroid and sclera. This complements our knowledge of
glycosaminoglycan chain distribution in the human eye (Clark et al. 2011 IOVS 52,
6511-21), and has important implications for understanding the structure and
functional regulation of the eye in health and disease.
Commercial Relationships: Tiarnan D. Keenan, None; Simon J. Clark,
None; Richard D. Unwin, None; Liam A. Ridge, None; Anthony J. Day,
None; Paul N. Bishop, None
Support: Fight For Sight Grant R112408
Program Number: 1590 Poster Board Number: A543
Presentation Time: 8:30 AM - 10:15 AM
Investigating the Role of Protein-Tyrosine Sulfation in the Function of Fibulin
2
Yogita Kanan, Robert A. Hamilton, Muayyad R. Al-Ubaidi. Dept of Cell Biology,
Univ of Oklahoma Hlth Sci Ctr, Oklahoma City, OK.
Purpose: Fibulin 2, an extracellular protein present in elastic and basement
membranes, has been shown to exhibit tumor suppressive and anti-angiogenic
properties. The purpose of this study is to investigate the role of tyrosine-Osulfation (sulfation) in the function of fibulin 2 and its relevance to vision.
Methods: An affinity column generated with an anti-sulfotyrosine antibody was
used to isolate sulfated proteins from bovine retinal and RPE extracts. The identity
of the sulfated protein was determined by MS/MS mass spectrometric analysis.
Sulfation of identified proteins was confirmed by either non-radioactive methods
involving the immunoprecipitation of the protein of interest, SDS-PAGE and
immunoblotting with the anti-sulfotyrosine antibody or by radioactive method. The
latter process included transfecting HEK cells with the gene of interest, metabolic
labeling with radioactive sodium sulfate followed by barium hydroxide hydrolysis
and thin layer electrophoresis. Identity of the sulfotyrosine residues was done by
site-directed mutagenesis followed by transfection of the wild-type fibulin 2 and
mutant clones followed by immunoprecipitation and immunoblotting with the antisulfotyrosine antibody.
Results: Fibulin 2 was a major sulfated protein identified from the retina and RPE
by the immunoaffinity column. Immunoprecipitation, western analysis and
radioactive sodium sulfate incorporation showed that the protein was sulfated invitro and in-vivo. Their tyrosine sulfated status was further confirmed by barium
hydroxide hydrolysis and thin layer electrophoresis. Site directed mutagenesis
identified tyrosines 192, 196 and 198 as sulfotyrosines.
Conclusions: We have identified fibulin 2 as a sulfated protein in the RPE and
retina. The role of sulfation in fibulin 2 in the retina and RPE will be studied by
anti-angiogenic assays and the generation of knockin mice that express unsulfated
forms of the protein.
Commercial Relationships: Yogita Kanan, None; Robert A. Hamilton,
None; Muayyad R. Al-Ubaidi, None
Support: OCAST HR10-069, R01 EY018137, FFB, NRCC P20RR017703 and
NEI P30EY021725
Program Number: 1591 Poster Board Number: A544
Presentation Time: 8:30 AM - 10:15 AM
Identification of Protein Biomarkers in Vitreous Humor Following Laser
Exposure
Rachida Bouhenni1, Jeffrey Dunmire1, Hiroshi Nakamura1, Deepak P. Edward2,3.
1
Ophthalmology, Summa-Health System, Akron, OH; 2Ophthalmology, Johns
Hopkins University, Baltimore, MD; 3Ophthalmology, King Khaled Eye Specialist
Hospital, Riyadh, Saudi Arabia.
Purpose: To identify protein changes in the vitreous humor (VH) following laser
induced retinal injury in rabbits.
Methods: Using a continuous 532 nm laser, fifty laser spots producing minimally
visible lesions (mild laser retinal injury) were applied to the retina in one eye of
each animal (n=3). VH was collected from both laser treated and contralateral
control eyes 24hrs after laser exposure. Samples were analyzed by Liquid
Chromatography/Tandem Mass Spectrometry (LC-MS/MS) and relative protein
abundances were determined by spectral counting. G test followed by post-hoc
Holm Sidak for correction was used for statistical analyses to determine
significance in the differential expression of proteins between treated and untreated
groups.
Results: Analysis of VH from laser treated eyes using LC-MS/MS revealed
significant differences in protein composition. Proteins from the crystallin family;
Alpha crystallin A chain, Alpha crystallin B chain, Beta crystallin B1 and Beta
crystallin A4 were 4-14 times more abundant in VH from treated compared to
control eyes (P<0.05).
Conclusions: Protein changes were detectable in VH following retinal laser injury.
This suggests that proteins are upregulated in the lasered retina and that these
proteins may leak into the VH from the damaged tissue. These proteins that enter
the vitreous can be detected using a proteomic approach and may be used as
biomarkers for laser induced retinal injuries.
Commercial Relationships: Rachida Bouhenni, None; Jeffrey Dunmire,
None; Hiroshi Nakamura, None; Deepak P. Edward, None
Support: Department of Defense (DoD)
Program Number: 1592 Poster Board Number: A545
Presentation Time: 8:30 AM - 10:15 AM
Interphotoreceptor Retinoid Binding Protein (IRBP) - a Thiol Based
Antioxidant in the Subretinal Space
Dongjin Sung1,2, Molly Sprada1,2, Karen Haswell3, Debashis Ghosh3, Federico
Gonzalez-Fernandez1,2. 1Ophthalmology & Pathology and Anatomic Sciences,
University at Buffalo/SUNY and SUNY Eye Institute, Buffalo, NY; 2Research
Service, VAWNYHS, Amherst, NY; 3Pharmacology, SUNY Upstate Medical
University, Syracuse, NY.
Purpose: IRBP, the major protein component of the interphotoreceptor matrix can
preserve the isomeric and oxidative state of retinol by an unknown mechanism
(Crouch et al., Photochem. Photobiol. 1992). While attempting to concentrate IRBP
for crystallography trials, we found that molar excesses of thiol-based reducing
agent, DTT is required to concentrate bovine IRBP (bIRBP) above ~3 mg/ml in a
soluble, stable and functional form. IRBP is known to have 10 cysteines, 8 of
which are free thiols. Our hypothesis is that IRBP is a thiol-dependent antioxidant.
Methods: We examined the effect of modifying IRBP’s free thiols on its
antioxidant activity, and ability to bind all-trans retinol. Native bIRBP was
extracted from the soluble interphotoreceptor matrix, and purified by Con-A, ion
exchange and S-300 size exclusion chromatography in the presence of 0.5 mM
DTT. The concentration of purified bIRBP was determined by absorbance
spectroscopy and amino acid analysis. bIRBP was incubated with Nethylamalimide (NEM), which covalently modifies thiols, at a molar ratio of 10:2,
10:5 and 10:10 cysteines:NEM. LC-MS/MS with coverage of 80-90% was used to
identify modified thiols. Retinol binding was evaluated by monitoring its
fluorescence enhancement, and tryptophan quenching. Antioxidant activity was
assayed by monitoring the formation of radical cation of 2,2'-azinobis(3ethylbenzothiazoline-6-sulfonic acid) (ABTS°+). Thioredoxin, trolox and
ovalbumin were used as controls. Oxidation of retinol was monitored by
absorbance at 330 nm.
Results: bIRBP showed a concentration-dependent reduction of ABTS°+. This
activity was greater than that of thioredoxin or trolox. Ovalbumin, NEM, and saline
had no antioxidant activity. Cysteine modified bIRBP (10:5, 10:10 cysteines:NEM)
was less active in reducing ABTS°+ compared to bIRBP. Cysteine modification
also inhibited IRBPs ability to protect retinol from oxidation. However, it had no
effect on its retinol binding ability by fluorescence spectroscopy. LC-MS/MS
showed the modified residues were Cys40, Cys304, Cys1051 and Cys1173.
Conclusions: Our data indicates that IRBP has robust antioxidant activity. This
activity appears to rely on a thiol dependent mechanism. Preserving the oxidative
state of visual cycle retinoids may be an important role of IRBP. As the most
abundant soluble protein in the interphotoreceptor matrix, IRBP may have a more
general role in protecting the outer retina from oxidative stress.
Commercial Relationships: Dongjin Sung, None; Molly Sprada, None; Karen
Haswell, None; Debashis Ghosh, None; Federico Gonzalez-Fernandez, None
Support: Affairs R&D grant I01BX007080, NIH/NEI grant EY09412, and an
Unrestricted Grant to the SUNY Ross Eye Institute from Research to Prevent
Blindness, Inc., New York, NY
Program Number: 1593 Poster Board Number: A546
Presentation Time: 8:30 AM - 10:15 AM
Dual Pathogenic Basis For The Retinitis Pigmentosa-Associated IRBP
Zhihui Yang, Songhua Li, Minghao Jin. Ophthalmology & Neuroscience, LSU
Health Sciences Center, New Orleans, LA.
Purpose: Interphotoreceptor retinoid-binding protein (IRBP) secreted by the
photoreceptors has been considered essential for normal function and survival of
photoreceptors. Recently, a homozygous missense mutation (D1080N) in the IRBP
gene has been identified in patients with retinitis pigmentosa (RP), a genetically
heterogeneous group of inherited retinal degenerations. The molecular mechanisms
by which the mutation causes RP are poorly understood. In this study we aimed to
define the pathogenic basis of the D1080N mutation.
Methods: Wild-type and the RP-associated IRBPs were expressed in 661w cells, a
mouse photoreceptor-derived cell line, and the 293T-LC cells by transient
transfection. Secretion of IRBP was monitored by immunoblot analysis of the
Copyright 2012 by the Association for Research in Vision and Ophthalmology, Inc., all rights reserved. For permission to reproduce any abstract, contact the ARVO Office at pubs@arvo.org.
ARVO 2012 Annual Meeting Abstracts by Scientific Section/Group – Biochemistry/Molecular Biology (BI)
culture media from the cells treated with varying temperatures or with a varying
concentration of chemical chaperones. Intermolecular and intramolecular disulfide
formation in IRBP was determined by immunoblot analysis in the presence or
absent of reducing reagents. Triton X-100 soluble and non-soluble fractions of cells
were prepared by ultracentrifugation. Protein subcellular localization was analyzed
by confocal immunofluorescence microscopy. Protein interactions were determined
by immunoprecipitation.
Results: Wild-type IRBP, but not the RP-associated IRBP, was secreted into media
from both 661W and 293T-LC cells, indicating that the D1080N mutation
abolished secretion of IRBP. The non-secreted mutant IRBP formed high molecular
aggregation in the cells. This mutated IRBP was mainly presented in non-soluble
fraction and the aggregation involved abnormal intermolecular and intramolecular
disulfide formation. Such non-secretory IRBP also partially inhibited the secretion
of normal IRBP by interaction with IRBP. The mutated IRBP was not allowed to
be transported to Golgi apparatus, instead retained in the endoplasmic reticulum
(ER) and induced up-regulation of CHOP, a response to ER stress. The mutant
IRBP was preferential bound to ER chaperons including binding immunoglobulin
protein and protein disulfide isomerase and degraded by ubiquitin-proteasome
system. Treatment of cells with 4-phenylbutyrate (PBA) or low temperature
promoted secretion of mutant IRBP and normalized cell morphology.
Conclusions: Our results demonstrate that loss of normal function (non-secretion)
and gain of cytotoxic function (ER stress) are involved in the disease mechanisms
for the RP-associated IRBP. Our data also indicate that PBA is a promising
candidate for treating or preventing the RP caused by the IRBP mutation.
Commercial Relationships: Zhihui Yang, None; Songhua Li, None; Minghao
Jin, None
Support: EY021208
Program Number: 1594 Poster Board Number: A547
Presentation Time: 8:30 AM - 10:15 AM
Mitochondria-Nucleus Communication by Shuttle Proteome in the RPE under
Oxidative Stress
Ji-Yeon Um1, Srinivas R. Sripathi1, Folami Lamoke2, Rissa McDonough1, Sydney
Bruetle1, Trevor Moser1, Rachelle DeBenedetti1, Weilue He1, Manuela Bartoli2,
Wan Jin Jahng1. 1Biological Sciences, Michigan Technological University,
Houghton, MI; 2Ophthalmology, Medical College of Georgia, Augusta, GA.
Purpose: Constant crosstalk between mitochondria and the nucleus is essential to
control cellular biochemical pathways under altered oxygen environment.
Mitochondria-generated signals, including reactive oxygen species play a key role
in early downstream network of caspase dependant reactions, and they trigger
chromatin condensation and DNA degradation as nuclear apoptosis. Despite
extensive efforts to understand RPE cell death, the mechanisms underlying
mitochondria-nucleus communication are still elusive. Comprehensive
identifications of protein-protein/protein-lipid interactions, including posttranslational, binding affinity changes, may disclose a new rate-determining step in
RPE apoptosis. Our proteomic approach to understand protein translocalization
between mitochondria and nuclei may suggest subcellular communication
mechanism in aging and diabetic.
Methods: Mitochondria and nuclear proteins were extracted and fractioned by
differential centrifugation from ARPE-19 cells. Interacting proteins were resolved
by Co-immunoprecipitation and separated by 2D electrophoresis. Western blotting
and immunocytochemical analysis were performed to visualize the protein
translocalization. Proteomic data from aging and diabetic rat model were compared
to age-matching control. The functional role of shuttle proteome was further
studied using protein-lipid interaction assay.
Results: Previously, we demonstrated that prohibitin shuttles from mitochondria to
the nucleus as cardiolipin chaperon, transcription coactivator, and anti-apoptotic
protein. Our current study shows that prohibitin interacts with optic atrophy 3
(OPA3), small heat shock proteins (HSPC072), and palmitoyltransferase
(ZDHHC18) in mitochondria as well as p53 and Rb in the nucleus. In addition,
series of protein-protein interaction assays demonstrated that prohibitin may
interact with RNA polymerase II transcription factor SIII A3 and BCL2-binding
protein. Prohibitin-lipid binding switch mediated by cardiolipin and
phosphotadylinositol seems to control dynamic translocalization of prohibitin
between mitochondria and the nucleus.
Conclusions: Our protein-protein/protein-lipid interaction map provides an
overview of mitochondrial and nuclear binding partners with prohibitin in response
to oxidative stress. Prohibitin may act as an anti-apoptotic chaperone as the default
function in mitochondria, whereas it becomes a transcriptional co-activator with
p53/Rb under prolonged or repeated stress conditions. Apoptotic/transcriptional
dual function of prohibitin might be the crucial mechanism for controlling
apoptotic signaling as a cell death determinant from uncontrolled proliferation.
Commercial Relationships: Ji-Yeon Um, None; Srinivas R. Sripathi,
None; Folami Lamoke, None; Rissa McDonough, None; Sydney Bruetle,
None; Trevor Moser, None; Rachelle DeBenedetti, None; Weilue He,
None; Manuela Bartoli, None; Wan Jin Jahng, None
Support: Research Excellence Fund
Program Number: 1595 Poster Board Number: A548
Presentation Time: 8:30 AM - 10:15 AM
Albumin Diffusion Across Human Bruch’s Membrane: Modulation By
Ginseng Compounds
Min Young Kang1, Cheul Muu Sim2, Jae Hwan Seok1, Yong Dol Shin3, Hyeon Jae
Shim4, Yun Hee Lee1, Ali Hussain5. 1GBioMix Institute, Jeonju, Republic of Korea;
2
Korean Atomic Energy Research Institute, Dae Jeon, Republic of Korea; 3JeonBuk
University, Jeonju, Republic of Korea; 4GBioMix, Jeonju, Republic of Korea;
5
Division of Molecular Therapy, UCL Institute of Ophthalmology, London, United
Kingdom.
Purpose: Most metals, vitamins and lipids are carried across Bruch’s membrane
bound to protein carriers similar in size to the albumin molecule. Ageing is
associated with a decline in macromolecular transport with the reduction in vitamin
A transport leading to diminished scotopic thresholds in the elderly. A more severe
reduction is observed in age-related macular degeneration (AMD) contributing to
the pathological stress in this disease. The potential use of ginseng compounds with
their anti-oxidative and ‘detergent’-like properties to improve the macromolecular
transport pathway has been assessed.
Methods: Bruch’s-choroid preparations (from nine donors aged 56-92 years) were
mounted in Ussing chambers (6mm diameter aperture) and the Bruch’s-facing halfcompartment filled with 1.0mls of 0.1mM FITC-albumin (MW 65kDa) made in
Tris-HCL buffer. Other half chamber was filled with Tris-HCl. After an incubation
period of 24hours at 37oC, solutions were removed and the amount of FITCalbumin diffusing across was determined by measuring absorbance at 490nm and a
calibration curve. After thorough washing, chambers were filled with either TrisHCL buffer (control), butanol extract of ginseng (10mg/ml), or 10% ginseng (in
Tris-HCl). Following a 24-hour incubation, the diffusional study with FITCalbumin was repeated. Basal diffusional rates were designated 1.0 and effect of the
various incubations expressed as -fold change of basal.
Results: In the control Tris-HCl incubations, there was a small reduction in
diffusional transport (0.86±0.05-fold, Mean ± SD). The butanol-extract treated
samples did not show significant alterations in diffusion of albumin (1.24 ±0.34).
Incubation with 10% ginseng considerably improved the diffusion of FITCalbumin by 1.74±0.04-fold Mean ± SD, p<0.001.
Conclusions: Ginseng considerably improved the trafficking of carrier sized
protein molecules across Bruch’s membrane. Oral ginseng supplementation of the
AREDS formulation may serve to improve the diffusional status of ageing Bruch’s
membrane to address the problems of vitamin A transport in the elderly and in
AMD to slow the degenerative changes.
Commercial Relationships: Min Young Kang, GBioMix (E); Cheul Muu Sim,
None; Jae Hwan Seok, GBioMix (E); Yong Dol Shin, None; Hyeon Jae Shim,
GBioMix (E); Yun Hee Lee, None; Ali Hussain, None
Support: None
Program Number: 1596 Poster Board Number: A549
Presentation Time: 8:30 AM - 10:15 AM
Transition in Oxygen Stoichiometry Determines Vimentin/PP2A NitrationPhosphorylation Signaling Through Nitric Oxide
Wan Jin Jahng1A, Megan Frost1B, Weilue He1B, Ji-Yeon Um1A, Rissa McDonough1A,
Sydney Bruestle1A, Trevor Moser1A, Srinivas R. Sripathi1A. ABiological Sciences,
B
Biomedical Engineering, 1Michigan Technological University, Houghton, MI.
Purpose: How much nitric oxide (NO) is produced and what duration is needed for
protein nitration in the RPE? We directly measured NO production from RPE cells
exposed to different stresses, including light/dark cycles, continuous illumination,
different light intensities (200-7000 lux) and oxidative stress. We aimed to
establish therapeutic levels of NO that induces up-regulation of protecting
molecules by delivering precisely controlled surface fluxes of NO to cultured cells
using a novel NO-generating polymer. This will establish an in vitro model to
allow the systematic study of RPE damage caused by hypoxia, hyperoxia, bright
light and constant light and both the protective and pathological roles that NO plays
in retinal degeneration.
Methods: The levels of NO produced by RPE cells were directly measured under
different levels of light or oxygen concentration (1, 5, 10, 21, 50% O2). NO damage
to RPE cells was examined by delivering precisely controlled surface fluxes of NO
to the cells in vitro. We have quantitatively established what level and duration of
NO account for its neuroprotective or cytotoxic properties and at what level NO
becomes pathological in RPE cell death. These measurements were made using a
Sievers’ 280i Nitric Oxide Analyzer and BODIPY compound.
Results: Nitric oxide was generated oxygen-dependent manner in RPE cells under
stress conditions. Inducible and endothelial nitric oxide synthase (iNOS, eNOS)
were confirmed by Western blot. Excess nitric oxide synthesized peroxynitrite and
accelerated PP2A nitration. PP2A modulates cell proliferation directly or indirectly
through MAPK, p-53, NF-κB by phosphorylation levels. Accumulation of
phosphorylated vimentin by inactive PP2A was positively correlated with an
apoptotic marker, BAK. Elevated levels of iNOS under oxidative stress at 12, 36,
48 hrs were observed. PP2A dephosphorylated vimentin at Ser38 site whereas
phosphorylation of PP2A-Cα/β at Tyr307 decreased under oxidative stress.
Increased p-vimentin and decreased BAK were confirmed by okadaic acid. Bcl-xL
signaling was regulated by substrate (Arg) and a competitive inhibitor (L-NAME)
Copyright 2012 by the Association for Research in Vision and Ophthalmology, Inc., all rights reserved. For permission to reproduce any abstract, contact the ARVO Office at pubs@arvo.org.
ARVO 2012 Annual Meeting Abstracts by Scientific Section/Group – Biochemistry/Molecular Biology (BI)
of NOS.
Conclusions: Upregulated phosphorylation of Bcl-xL and PP2A inhibition may
suggest that the apoptotic connection between PP2A activity and RPE cell death.
Combinatorial network of modifications, including phosphorylation, nitration, and
methylation of PP2A is the determinant of the activity and turnover rate. Our data
suggests that nitric oxide plays a key role in dephosphorylation signaling through
PP2A phosphorylation-nitration. We propose that nitric oxide is a neuroprotective
or cytotoxic second messenger based on its local concentration.
Commercial Relationships: Wan Jin Jahng, None; Megan Frost, None; Weilue
He, None; Ji-Yeon Um, None; Rissa McDonough, None; Sydney Bruestle,
None; Trevor Moser, None; Srinivas R. Sripathi, None
Support: Research Excellence Fund
Program Number: 1597 Poster Board Number: A550
Presentation Time: 8:30 AM - 10:15 AM
Phosphoproteome and Lipid Network in RPE Apoptosis under Oxidative
Stress
Srinivas R. Sripathi1, Ji-Yeon Um1, Rissa McDonough1, Sydney Bruestle1, Trevor
Moser1, Jian-xing Ma2, Paul S. Bernstein3, Wan Jin Jahng1. 1Biological Sciences,
Michigan Technological University, Houghton, MI; 2Physiology, University of
Oklahoma Health Sciences Center, Oklahoma City, OK; 3Ophthalmology and
Visual Sciences, Moran Eye Center, University of Utah School of Medicine, Salt
Lake City, UT.
Purpose: Phosphoproteomic alterations and lipid composition changes during
elevated oxidative stress in AMD remain elusive. Previous studies suggest that
early events of senescence-associated protein phosphorylation and lipid oxidation
are the crucial reactions of RPE apoptosis under oxidative stress. AMD involves
progressive cell death of post mitotic RPE and loss of photoreceptors. Oxidative
stress-induced cytoskeletal reorganization,disrupted communication between
mitochondria-nucleus, and crystalline aggregation may contribute towards the
apoptotic process in the RPE. Our quantitative phosphoproteome analysis provides
a powerful strategy that may unveil the specific target and the molecular
mechanisms of AMD pathogenesis.
Methods: Phosphoproteins and lipids from ARPE-19 cells and RPE cells from
both normal and AMD eyes were enriched and analyzed by using Gallium
chromatography and MALDI-TOF, ESI-MS/MS. Serine, threonine and tyrosine
phosphorylations at different disease stages were visualized by phospho-western
blot and site-specific phosphorylation analysis.Scanning electron microscopy and
immunocytochemistry were performed.
Results: Our preliminary data demonstrates that cytoskeletal phosphorylations,
crystalline aggregation, and mitochondrial signaling may contribute to AMD
pathogenesis. Altered phosphorylations of mitochondrial heat shock protein
mtHsp70, αA/αB crystalline, vimentin, and ATP synthase were observed in RPE
cell death under oxidative stress. Previous data demonstrated that Hsp70 (c-Jun Nterminal kinase), crystallins (Akt), and the increased expression of VDAC might be
involved in AMD progression. We observed altered lipid compositions that include
increased carbon number of fatty acids, double bond saturation, higher cholesterol,
and phosphatidylcholine, whereas cardiolipin levels decreased.
Conclusions: Understanding quantitative phosphorylation signaling and lipid
composition may describe the biochemical mechanisms that promote the early
stages of AMD. Changes in phospholipids, long chain fatty acids at sn-2 in
phosphotidylcholine increased from 16 carbons to 24/26 carbons as well as
cholesteryl esters were observed under oxidative stress, which may accelerate the
soft drusen formation during AMD progression. In addition, oxidized lipoproteins
and cholesterol may trigger the complement activation. Our phosphoproteomic and
lipidomic approach may suggest new evidence that connects the pathophysiology
of RPE cell death and AMD through protein aggregation,lipid oxidation, protein
phosphorylation,and inflammation switch mechanism.
Commercial Relationships: Srinivas R. Sripathi, None; Ji-Yeon Um,
None; Rissa McDonough, None; Sydney Bruestle, None; Trevor Moser,
None; Jian-xing Ma, None; Paul S. Bernstein, None; Wan Jin Jahng, None
Support: Research Excellence Fund
Program Number: 1598 Poster Board Number: A551
Presentation Time: 8:30 AM - 10:15 AM
PRCD Is A Secreted Protein Which Interacts With Other Retinal
Degeneration Causative Proteins
Tamar Ben-Yosef, Lital Remez, Ben Cohen, Judith M. Nevet. Genetics Dept Faculty of Med, Technion, Haifa, Israel.
Purpose: PRCD mutations are associated with retinitis pigmentosa (RP) in both
dogs and humans. PRCD encodes for a small protein (54 amino acids) of unknown
function. The purpose of this work is to characterize PRCD’s retinal function.
Methods: Myc-tagged PRCD expression construct was made and transfected into
cultured cells to test for protein secretion. The p.C2Y mutation was inserted by sitedirected mutagenesis. To identify PRCD-binding proteins we used the RasRecruitment system. Identified interactions were confirmed by coimmunoprecipitation (co-IP).
Results: The first 20 amino acids of PRCD appear to encode for a signal peptide,
suggesting that PRCD is a secreted protein. To test this hypothesis we expressed a
myc-tagged PRCD in cultured cells and used western blot analysis to test for the
presence of the protein in both cell extracts and conditioned media. PRCD was
found in both. Moreover, the p.C2Y mutation, which was found in both dogs and a
human patient with RP, eliminated the secretion of PRCD from cells. Using the
Ras-Recruitment system we identified two putative PRCD-binding proteins,
including one which is involved in retinal degeneration and is important for the
function of the retinal pigmented epithelium (RPE).
Conclusions: Our data suggest that PRCD functions in the retina as a secreted
protein, since a mutation which eliminates its secretion leads to severe retinal
degeneration. The identified PRCD-binding partner indicates that both proteins
may act in a common pathway associated with RPE correct function. These
findings shed a new light on PRCD function and the etiology of RP.
Commercial Relationships: Tamar Ben-Yosef, None; Lital Remez, None; Ben
Cohen, None; Judith M. Nevet, None
Support: ROSETREES TRUST
Program Number: 1599 Poster Board Number: A552
Presentation Time: 8:30 AM - 10:15 AM
Characterization Of Phosphoinositides In The Light- And Dark-adapted
Mouse Retina
Feng HE, Melina A. Agosto, Theodore G. Wensel. Biochemistry, Baylor College of
Medicine, Houston, TX.
Purpose: The enzymatic components needed for phosphoinositide-based signaling
are known to be present in rod cells, but the roles of phosphoinositides in vertebrate
phototransduction remain unclear. In our previous studies, reconstitution of
phosphodiesterase 6 (PDE6) and activated transducin on the surface of large
unilamellar vesicles containing PI(4,5)P2 resulted in PDE activity nearly 4-fold
above the level observed with vesicles containing no phosphoinositides. In this
study, the effect of light adaptation on phosphoinositide levels in mouse rod outer
segments (ROS) was investigated.
Methods: Wild-type C57BL/6 mice were adapted to dark or room light conditions
for ≥12 hours, after which ROS were purified by sucrose gradient centrifugation.
Phosphoinositides were extracted from the purified ROS and quantified using a
modified ELISA assay. PI(3)P, PI(4)P, PI(3,4)P2, PI(4,5)P2, and PI(3,4,5)P3 were
detected by binding of purified recombinant 1D4-tagged pleckstrin homology (PH)
domains from hepatocyte growth factor-regulated tyrosine kinase substrate, PI(4)P
adaptor protein-1, tandem PH domain-containing protein 1, phospholipase C delta,
and general receptor for phosphoinositides 1, respectively, followed by incubation
with anti-1D4 monoclonal antibody, horseradish peroxidase-conjugated secondary
antibody, and a fluorescent substrate.
Results: We developed a sensitive method for detection of phosphoinositides in
mouse ROS. The detection limit was approximately 0.05-0.1 pmol of
phosphoinositide. Specificity of the purified recombinant PH domains for their
target phosphoinositides was verified using a panel of synthetic phosphoinositides.
ROS from light-adapted mice were found to contain much higher levels of
PI(4,5)P2 and PI(3)P than ROS from dark-adapted mice, whereas PI(4)P was
present at similar levels in both. PI(3,4)P2 and PI(3,4,5)P3 were not detectable in
ROS from either light- or dark-adapted mice.
Conclusions: Levels of PI(3)P and PI(4,5)P2 are significantly different in light- and
dark adapted mice, suggesting activation of PI-4 kinases or PI-5 kinases, inhibition
of degradatory enzymes, or both. The elevation of PI(3)P while PI(3,4,5)P3 remains
undetectable implies that the previously-reported light activation of Type I PI-3
kinase is not involved in PI(3)P increases.
Commercial Relationships: Feng He, None; Melina A. Agosto,
None; Theodore G. Wensel, None
Support: RO1-BY07981 and F32-EY020067
Program Number: 1600 Poster Board Number: A553
Presentation Time: 8:30 AM - 10:15 AM
Expression of Oxytocin Receptor Transcripts in the Retina
De-Ann M. Pillers, Wenxiang Luo, Patrick Halbach, Bikash Pattnaik. Department
of Pediatrics, University of Wisconsin-Madison, Madison, WI.
Purpose: The retina is crucial for visual transduction and is actively supported by
the retinal pigment epithelium (RPE). The RPE maintains retinal ionic homeostasis,
and renews the photoreceptor disc membrane through daily phagocytosis and reisomerization of retinol. RPE phagocytosis is under circadian regulation suggesting
active retina-RPE cross-talk. It has been previously reported that the neuropeptide
oxytocin localizes to the posterior retina and that its level in the retina shows
circadian regulation. We sought to determine if the oxytocin receptor is also present
in the retina.
Methods: Donor eyes within 12 hrs of death were procured from the Lions Eye
Bank of Wisconsin. Macaca mulatta eyes were obtained from the Wisconsin
National Primate Research Center (Madison, USA) within 30 minutes of
euthanization. After removing the anterior segment, the retina was carefully
separated and the RPE cells were isolated by enzymatic digestion. Tissue was snapfrozen in liquid nitrogen and was processed using the RNeasy Mini Kit (Qiagen,
USA). The isolated RNA was transcribed with Superscript III kit (Invitrogen, CA,
Copyright 2012 by the Association for Research in Vision and Ophthalmology, Inc., all rights reserved. For permission to reproduce any abstract, contact the ARVO Office at pubs@arvo.org.
ARVO 2012 Annual Meeting Abstracts by Scientific Section/Group – Biochemistry/Molecular Biology (BI)
USA). Standard PCR was carried out using Immomix PCR mix (Bioline, MA,
USA). Results were resolved using agarose gel electrophoresis.
Results: A 256 bp PCR product was detected in human RPE, retina and muscle
samples. Appropriate controls showed no amplification of the oxytocin receptor
(OXTR) mRNA. These results were confirmed using three independent sets of nonhuman primate samples. To further ascertain the integrity of our results, hBest1
was detected in the RPE and to a lesser extent in retina, but not in the muscle
sample.
Conclusions: Although the neuropeptide hormone oxytocin has been shown to be
expressed in the eye, the localization of the oxytocin receptor within the RPE is a
novel finding. The observation that OXTR is expressed in retina suggests that it
plays an important role in the cellular signaling function of the retina.
Commercial Relationships: De-Ann M. Pillers, None; Wenxiang Luo,
None; Patrick Halbach, None; Bikash Pattnaik, None
Support: UW School of Medicine and the Department of Pediatrics, the Rebecca
Meyer Brown Professorship, and the Meriter Foundation.
Program Number: 1601 Poster Board Number: A554
Presentation Time: 8:30 AM - 10:15 AM
Relationships Between Pde6 Inhibition, Energy Metabolism And
Photoreceptor Degeneration
Jianhai Du1A, Andrei O. Chertov1A, Austin Rountree1B, Martin Sadilek1C, Ian R.
Sweet1B, James B. Hurley1A. ABiochemistry, BMedicine, CChemistry, 1University of
Washington, Seattle, WA.
Purpose: To understand the relationships between energy metabolism and retinal
degeneration, we identified metabolic changes induced by phosphodiesterase 6
(PDE6) inhibition and ways to rescue the photoreceptor cell death by restoring the
dysfunctional metabolism.
Methods: Mouse retina was isolated and cultured in Krebs-Ringer bicarbonate
buffer with glucose. Phosphodiesterase activity was inhibited by zaprinast. cGMP
was measured by EIA kit. Photoreceptor cell death was evaluated by propidium
iodide uptake in the photoreceptor layer of NRL-GFP mice by confocal
microscopy. Citric acid cycle intermediates and amino acids were measured by GCMS. ATP was determined by luciferase assay and the oxygen consumption was
measured by a perfusion apparatus.
Results: There were little cell death (<10 cells/field) in normal retinas within 4 h
incubation but PDE inhibition induced significant photoreceptor cell death at 2 h
(24 ± 4/field) and 4 h (4336 ± 354/field) in light-adapted retinas. At 2h, PDE
inhibition caused increases of pyruvate and aspartate and a dramatic decrease of
glutamate in both light and dark-adapted mice. Furthermore, PDE inhibition
repressed the mitochondrial oxygen consumption. However, the ATP concentration
slightly increased upon PDE inhibition. At 4 h, the glutamate remained extremely
low and the mitochondrial intermediates also decreased with PDE inhibition but the
ATP concentration still was comparable to the control. Supplementation with
glutamine (10 mM) brought glutamate and mitochondrial intermediates to normal
levels, improved mitochondrial oxygen consumption and partially rescued the
photoreceptor cell death caused by PDE inhibition.
Conclusions: Photoreceptor cell death induced by PDE inhibition may be caused
by depletion of glutamate and exhaustion of mitochondrial metabolites. Metabolite
supplementation may be a successful approach for treating certain types of retinal
degeneration.
Commercial Relationships: Jianhai Du, None; Andrei O. Chertov,
None; Austin Rountree, None; Martin Sadilek, None; Ian R. Sweet,
None; James B. Hurley, None
Support: NIH Grant EY017863
Program Number: 1602 Poster Board Number: A555
Presentation Time: 8:30 AM - 10:15 AM
Functional Principal Component Analyses of Mouse RPE Sheet Morphology
Give Discriminatory Categories
J M. Nickerson1, X Qi2, Micah A. Chrenek1, Christopher Gardner1, Qing Zhang1,
Hans E. Grossniklaus1, Yi Jiang2. 1Ophthalmology, Emory Univ, Atlanta, GA;
2
Mathematics, Georgia State University, Atlanta, GA.
Purpose: To test if RPE morphology changes during and after retinal degeneration
as a bystander effect. We compared the morphology of RPE cells from C57BL/6J
and congenic rd10 mouse eyes of various age groups. A novel functional principal
component analysis (FPCA) technique offers analysis of discrete samples measured
at irregular intervals, and allows classification of RPE sheets into major categories.
Methods: Cell borders of RPE/choroid flatmounts were stained with anti-ZO-1.
Photoshop CS2 was used to photomerge the images. Morphometric analysis of cell
shape, area, number of neighbors, etc was performed with CellProfiler. Density
curves of cell size and aspect ratio were estimated using the penalized likelihood
method. FPCA generated principal component (PC) scores, used to construct the
classification rule. Three classification methods, LDA (linear discriminant
analysis), QDA (quadratic discriminant analysis) and SVM (support vector
machine), were applied to the matrix of PC scores. Leave-one-out cross validation
was used to assess predictive accuracy.
Results: Using cell shape (as described by aspect ratio) and cell size (area), FPCA
segregates all RPE cell morphology into 4 distinct classes: young C57BL/6J, old
C57BL/6J, young rd10, and old rd10. P70 best segregates the age groups for both
genotypes into young and old. From 88 eye images, FPCA results in a 88 × 4
matrix of the first four PC scores, used to construct classification rules. The
predictive accuracies were 96.6% (85 are correctly classified among 88 mice),
95.5%, and 95.5% for LDA, QDA, and SVM, respectively.
Conclusions: In young wild type mice the RPE morphology resembles a regular
hexagonal array of cells of uniform size. Old wild-type eyes develop a
subpopulation of large cells. A clear disruption of the regular cell size and shape
appears in rd10 mutants. Aspect ratio and cell area together give rise to
discriminatory principal components that classify age and genotype. Here we
demonstrated the use of RPE sheet morphometrics as a clear indicator of retinal
disease stage despite age as a confound. These same analyses may be applied to
patients noninvasively with suitable imaging instruments.
Commercial Relationships: J. M. Nickerson, None; X. Qi, None; Micah A.
Chrenek, None; Christopher Gardner, None; Qing Zhang, None; Hans E.
Grossniklaus, None; Yi Jiang, None
Support: Research to Prevent Blindness, Foundation Fighting Blindness, Fight for
Sight, and the National Eye Institute (R01EY16470; R24EY017045; P30EY06360;
T32EY007092).
Program Number: 1603 Poster Board Number: A556
Presentation Time: 8:30 AM - 10:15 AM
Membrane Extraction of Heterologously Expressed Human Bestrophin-1
Under Native Conditions
Caroline Pasquay, Annabella Janise, Lufei Wang, Birgit Lorenz, Markus Preising.
Labor fuer Molekulare Ophthalmologie, Justus Liebig Universitaet Giessen,
Giessen, Germany.
Purpose: Bestrophin1 is part of an integral membrane protein complex located in
the basolateral membrane of the retinal pigment epithelium. The gene is mutated in
Best vitelliform macular dystrophy (VMD), an autosomal dominant macular
degeneration with highly variable expressivity and reduced penetrance. Up to now
the quaternary structure of the bestrophin-1 protein complexes remains unclear.
Sun et al. (PNAS 2002) argued for a tetrameric or heptameric structure whereas
Stanton et al (BBA 2006) suggested a dimeric quaternary structure.
We sought to extract the bestrophin-1 protein complex under native conditions to
investigate whether mutant bestrophin-1 subunits form complexes with wildtype
protein subunits to get further information about the function of mutant protein
complexes which is not well understood up to now.
Methods:
MDCK II cells were seeded on transwell filters and cultured in high glucose
DMEM supplemented with 10% FCS and 5 times penicillin/streptomycin at 37°C
and 5% CO2. Cells were transiently transfected with BEST1 cloned in a pcDNA3(-)
vector according to the manufacturers’ instructions at subconfluency. Vectors
applied contained wildtype or mutant BEST1 gene. Filters were washed in PBS and
lysis buffer was added for 30 min 24 h after transfection. After lysis cells were
harvested and protein extraction took place after a modified protocol according to
Bordier (JBC 1981). PAGE of the protein extracts was done under native
conditions applying different methods (BN-PAGE, CN-PAGE, Nataurodeoxycholate PAGE).
Results: Bestrophin-1 expressed in dimeric complexes in vivo disregard whether
mutant or wildtype gene was expressed. Higher molecular weight complexes of
unknown composition could be seen in addition to the dimers.
Conclusions: Up to now the quaternary structure of the human bestrophin1 protein
complex remains unclear. Our results support the structure predicted by Stanton et
al. Based on our results we will investigate the preference of mutant forms of
bestrophin-1 to form heterodimers or homodimers with the wildtype protein.
Commercial Relationships: Caroline Pasquay, None; Annabella Janise,
None; Lufei Wang, None; Birgit Lorenz, None; Markus Preising, None
Support: Portmann-Stiftung and Giessener Lichtblicke eV
Program Number: 1604 Poster Board Number: A557
Presentation Time: 8:30 AM - 10:15 AM
Polarized secretion of Cystatin C from human fetal retinal pigment epithelium
Paul Kay1, Yit C. Yang2, Luminita Paraoan1. 1Eye and Vision Science, University
of Liverpool, Liverpool, United Kingdom; 2Ophthalmology, Wolverhampton Med
Inst-New Cross, Wolverhampton, United Kingdom.
Purpose: Cystatin C is a cysteine protease inhibitor expressed by the retinal
pigment epithelium (RPE). The previously characterised variant B version of this
protein has been associated with an increased risk of developing exudative agerelated macular degeneration (AMD). The aim of this study was to optimize the
culture and manipulation of human fetal RPE (hfRPE) monolayers, in order to
analyze the secretion of the endogenous cystatin C, as well as eGFP fused wildtype and variant B cystatin C constructs.
Methods: hfRPE cells obtained from donors at 16 to 18 weeks of gestation (kindly
donated by S. Miller, NEI) were seeded onto extracellular matrix coated 1.12cm2
Copyright 2012 by the Association for Research in Vision and Ophthalmology, Inc., all rights reserved. For permission to reproduce any abstract, contact the ARVO Office at pubs@arvo.org.
ARVO 2012 Annual Meeting Abstracts by Scientific Section/Group – Biochemistry/Molecular Biology (BI)
transwell inserts and maintained in 5 % FCS containing media until monolayers
consisting of a hexagonal array of densely packed, pigmented cells were formed.
Fusion constructs containing the wild-type or variant B ORF fused to eGFP were
transfected into hfRPE cells using Fugene 6 at a 3:1 ratio. Transepithelial resistance
(TER) measurements across the monolayer were measured using an epithelial voltohmeter. The protein content of conditioned media collected from the apical and
basal facing chambers was analysed by Western blot. Average protein expression
was determined by densitometry, and differences between groups were analyzed by
paired T-test.
Results: 30 days after seeding, TER measurements across hfRPE cell sheets were
>200Ωcm2, indicating the presence of an impermeable, highly polarized
monolayer. Endogenous cystatin C was present in media harvested from both sides
of the monolayer, and was more abundant in the basal chamber, suggesting
preferential basolateral secretion. Transfections of the hfRPE cells were successful,
resulting in expression of the exogenous eGFP tagged versions of both wild-type
and variant B cystatin C. The secretion pattern of these fusion proteins was similar
to that of the endogenous protein. Pigment epithelium derived factor (PEDF) was
secreted from monolayers preferentially into the apical compartment, as previously
reported.
Conclusions: Our results validate the use of hfRPE cells to create monolayers that
closely resemble the physiological function of the native RPE, in relation to
secretion of cystatin C. We have demonstrated that these cells can be transfected to
express exogenous cDNA constructs, and that cystatin C is secreted in a polarized
fashion. These findings support the hypothesis of an extracellular function for
cystatin C, likely involving regulation of proteolytic activity and maintaining the
structure and function of the Bruch’s membrane/choroid. Impaired secretion of
cystatin C due to mutation (variant B), or age could therefore contribute to the
development of AMD.
Commercial Relationships: Paul Kay, None; Yit C. Yang, None; Luminita
Paraoan, None
Support: R&D Royal Wolverhampton Hospitals NHS Trust
Program Number: 1605 Poster Board Number: A558
Presentation Time: 8:30 AM - 10:15 AM
Human Modified Tyrosinase And Two Temperature-Sensitive Mutants Are
Soluble Active Enzymes
Monika B. Dolinska1, Elena Kovaleva2, Peter Backlundt3, Grzegorz Piszczek4, Paul
T. Wingfield5, Brian P. Brooks1, Yuri V. Sergeev1. 1OGVFB, National Eye Institute,
Bethesda, MD; 2Chesapeake PERL, Savage, MD; 3NICHD, Bethesda, MD;
4
NHLBI, Bethesda, MD; 5NIAMS, Bethesda, MD.
Purpose: Mutations in tyrosinase gene cause an autosomal recessive disorder,
oculocutaneous albinism Type 1 (OCA1). OCA1 is classified into a disorder with
complete absence of tyrosinase activity (OCA1A) and with residual tyrosinase
activity (OCA1B). Tyrosinase is a Type I membrane protein with a single transmembrane fragment located at C-terminus, which catalyzes the rate-limiting
conversions of tyrosine to L-DOPA and dopachrome in melanin production in the
skin and eye. Here we designed, expressed and purified human tyrosinase and two
temperature-sensitive mutants which were modified to remove a trans-membrane
fragment to avoid potential protein insolubility but to preserve all other functional
features of the enzyme.
Methods: Truncated human tyrosinase gene, hTyrCtr (residues 19 - 469 of the
native protein) and two mutants R404Q and R404W (subtype OCA1B in position
422) were engineered as synthetic codon optimized DNA comprising insect signal
sequence and C-terminal 6His-tag and cloned into baculovirus. Recombinant
proteins were produced in whole insect Trichoplusia ni and purified by
immobilized metal affinity and size-exclusion chromatographies.
Results: By using L-DOPA enzymatic reaction, SEC, sedimentation equilibrium
and dynamic light scattering we demonstrated that hTyrCtr is an active monomeric
enzyme with molecular weight of about 56 kDa and Km=0.88±0.13 mM. hTyrCtr is
N-glycosylated as shown by the PNGase de-glycosylation. Both temperaturesensitive mutants are enzymatically active at 37 oC: Km=0.24±0.03 mM (R404Q)
and Km=1.04±0.27 mM (R404W).
Conclusions: The hTyrCtr and temperature sensitive mutants are expressed and
purified as soluble active enzymes suggesting that they could be used as an in vitro
model for the characterization of the human tyrosinase function and molecular
perturbations caused by the OCA1B pathogenic changes. These observation
suggest that the defect in melanin production associated with these two
temperature-sensitive mutations are likely not due to intrinsic enzymatic activity of
tyrosinase.
Commercial Relationships: Monika B. Dolinska, None; Elena Kovaleva,
Chesapeake PERL (E); Peter Backlundt, None; Grzegorz Piszczek, None; Paul
T. Wingfield, None; Brian P. Brooks, None; Yuri V. Sergeev, None
Support: Z01-EY000476-01
Program Number: 1606 Poster Board Number: A559
Presentation Time: 8:30 AM - 10:15 AM
Dicer Dysregulation, Alu Rna Accumulation And Inflammasome Activation In
Human Ga Eye
Sami Dridi, Valeria Tarallo, Bradley Gelfand, Fowler Benjamin, Jayakrishna
Ambati. Ophthalmology & Visual Sciences, University of Kentucky, Lexington,
KY.
Purpose: Geographic atrophy (GA) is an important cause of vision loss in AMD.
We have previously shown that Dicer1 dysregulation induced Alu RNA
accumulation and thereby led to RPE cell degeneration. Here, we sought to
determine the downstream signaling pathways that might be involved.
Methods: In an unbiased fashion, we isolated, amplified, and cloned dsRNA
species from dsRNA-enriched preparations of RPE of normal and GA human donor
eyes. We quantified RNA abundance of Dicer1, Alu, inflammasome components
(NLRP3, PYCARD, Caspase-1, IL-18, IL-1β) by QPCR in age-matched normal
and diseased human eyes. We also measured protein levels and immunolocalization
of theses markers.
Results: As previously reported (Kaneko et al., 2011), Dicer1 mRNA and protein
levels were significantly decreased in RPE GA compared to normal eyes. Alu RNA
and NLRP3 mRNA abundance were dramatically increased in the RPE of human
eyes with GA compared to control eyes. Immunostaining and immunolocalization
studies showed that the expression of NLRP3, PYCARD and Caspase-1 proteins
were also increased. There was also a significant increase in IL-18 mRNA levels
and phosphorylation of IRAK1/4 in GA eyes indicative of MyD88 signal
transduction.
Conclusions: Collectively, our data revealed a role of Dicer1 dysregulation, Alu
RNA accumulation and NLRP3 inflammasome activation in GA disease.
Commercial Relationships: Sami Dridi, University of Kentucky (P); Valeria
Tarallo, University of Kentucky (P); Bradley Gelfand, University of Kentucky
(P); Fowler Benjamin, University of Kentucky (P); Jayakrishna Ambati, iVeenaE (P), University of Kentucky (P)
Support: NIH/NEI, Doris Duke Charitable Foundation, Burroughs Wellcome
Fund, RPB
Program Number: 1607 Poster Board Number: A560
Presentation Time: 8:30 AM - 10:15 AM
Docosahexaenoic Acid is Incorporated into ARPE-19 Cells and Involves
Modulation of Pro-and Anti-Apoptotic Proteins pMAPK, pAKT308, and BIM
Eric J. Knott1, William C. Gordon2A, Nicolas G. Bazan2B. 1Neuroscience Center,
Louisiana State Univ Hlth Sci Ctr, New Orleans, LA; AOphthalmology &
Neuroscience Center, BOphthal & Neuroscience, 2LSU Health Sciences Center,
New Orleans, LA.
Purpose: Docosahexaenoic acid (DHA) supplementation protects Neuro2A cells
from serum starvation or staurosporine treatment via Akt signaling pathways.
Highest concentrations of DHA are found in the rod photoreceptor outer segment
(ROS), and when ROS are phagocytized by RPE cells, neuroprotectin D1 (NPD1)
is synthesized. We have shown that DHA or NPD1 protect ARPE cells when
applied during and prior to oxidative stress (ARVO 2011). Thus, the purpose of this
study was to determine the mechanism by which DHA pretreatment protects
ARPE-19 cells from subsequent oxidative stress.
Methods: ARPE-19 cells where cultured for 72 h to achieve ~100% confluencey.
Cells were serum starved for 18 hours in 0.5% FCS, DMEM/F12 1:1 media. After
which 200nM DHA or ETOH (equal volume) was added to the media. After 6
hours of incubation in 200nM DHA or ETOH, media was replaced with fresh 0.5%
FCS, DMEM/F12 1:1 media for 24h. Cells were then challenged with increasing
concentrations of H2O2 for 6 and 16 hours. Cells were collected for protein and
lipid analysis. Cells also were fixed with neutral buffered formalin and stained with
Hoestch 33258 in 1% triton X100. Cell death was assessed via nuclear chromatin
condensation. (um2)
Results: Cells pretreated with 200 nM DHA for 6 h, 24 h prior to stress, exhibit
protection as demonstrated (IOVS Knott et al. 2011). Western blot analysis of
ARPE-19 cells treated with 200 nM DHA for 6h plus 24 hours DMEM/F12
resulted in a 2 fold increase in pMAPK, a 2 fold increase in pAKT, and a 3 fold
reduction in BIM when compared to controls. Also, hydrolyzed phospholipid mass
spectra analysis of deuterium labeled DHA demonstrates that 66% of supplemented
DHA is incorporated into phospholipids.
Conclusions: Our results demonstrate that DHA pretreatment elicits protection of
human-ARPE-19 cells, which involves increases pMAPK and pAKT ser 308; and a
decrease in BIM. This protection is also characterized by an incorporation of DHA
into phospholipids. This data further suggests protection via DHA-derived NPD1
synthesis, which is achieved via NPD1 mediated-PI3K/Akt signaling and
regulation of anti- apoptotic protein BCL-xl in a PP2 a dependent manner. Thus,
application of DHA/NPD1 could be used as a potential therapeutic mean for the
prevention or attenuation of the initiation or early progression of retinal
degenerative diseases.
Commercial Relationships: Eric J. Knott, None; William C. Gordon,
None; Nicolas G. Bazan, None
Support: Research to Prevent Blindness
Program Number: 1608 Poster Board Number: A561
Presentation Time: 8:30 AM - 10:15 AM
Copyright 2012 by the Association for Research in Vision and Ophthalmology, Inc., all rights reserved. For permission to reproduce any abstract, contact the ARVO Office at pubs@arvo.org.
ARVO 2012 Annual Meeting Abstracts by Scientific Section/Group – Biochemistry/Molecular Biology (BI)
Glutathione S-Transferase Pi Isoform (GSTP1) Expression in Murine Retina
Increases with Developmental Maturity
Pratibha M. Joshi, Rong Wen, Wen-Hsiang Lee. Ophthalmology, Bascom Palmer
Eye Institute, University of Miami Miller School of Medicine, Miami, FL.
Purpose: Glutathione S-transferase pi isoform (GSTP1) is an intracellular
detoxification enzyme that catalyzes reduction of chemically reactive electrophiles
and is a zeaxanthin-binding protein in the human macula. We have previously
demonstrated that GSTP1 levels are decreased in human age-related macular
degeneration (AMD) retina compared to normal controls. We also showed that
GSTP1 levels parallel survival of human retinal pigment epithelial (RPE) cells
exposed to UV light, and GSTP1 over-expression protects them against UV light
damage. In the present work, we determined the developmental time course of
GSTP1 expression in murine retina and in response to light challenge.
Methods: The eyes from BALB/c mice at post-natal day 20, 1 month, and 2
months of age were prepared for retinal protein extraction and for cryo sectioning,
and the GSTP1 levels in the retina were analyzed by Western blot and by
immunohistochemistry (IHC), respectively. Another group of BALB/c mice with
the same age ranges was exposed to 1000 lux of white fluorescent light for 24
hours, and their retinas were analyzed for GSTP1 expression by Western blot and
IHC in a similar manner.
Results: The GSTP1 levels in the murine retina increased in ascending order from
post-natal day 20, 1 month, and 2 months of age. Moreover, GSTP1 expression in
murine retina at post-natal day 20, 1 month, and 2 months of age increased in
response to brief light exposure compared to age-matched controls under normal
condition.
Conclusions: GSTP1 expression in retina increases with developmental age in
mice and accompanies murine retinal maturation. Brief exposure to light induces
GSTP1 expression in the murine retina across various developmental ages. GSTP1
induction may be a protective response to light-induced oxidative damage in the
murine retina.
Commercial Relationships: Pratibha M. Joshi, None; Rong Wen, None; WenHsiang Lee, None
Support: In part by: K08EY20864; R01EY018586; Hope for Vision; SanBio,
Inc.; P30EY14801; and an unrestricted grant from Research to Prevent Blindness.
Program Number: 1609 Poster Board Number: A562
Presentation Time: 8:30 AM - 10:15 AM
PTP1B Is A Novel Molecular Therapy Target For Retinitis Pigmentosa
Raju V. Rajala, Dustin T. Allen, Radhika Dighe, Ammaji Rajala. Ophthal/Dean
McGee Eye Inst, Univ of Oklahoma Hlth Sci Ctr, Oklahoma City, OK.
Purpose: Retinitis Pigmentosa (RP) is a type of inherited retinal degeneration and
it is currently untreatable and usually leads to blindness. Systemic administration of
insulin which activates the insulin receptor (IR) signaling has been shown to delay
the death of cone photoreceptors in a mouse model of RP. Unfortunately prolonged
treatment with insulin did not maintain the survival effect and this could be due to
the activation of an IR specific phosphatase, PTP1B that works to turn of the IR
signaling. We previously reported enhanced IR signaling in mice lacking PTP1B in
rods. We recently identified a rhodopsin-mediated novel signaling pathway that
inhibits PTP1B in the healthy retina by an adapter protein, Grb14. In this study we
examined the regulation of PTP1B in mouse model of both dominant and recessive
RP.
Methods: Rhodopsin mutant VPP-transgenic mice (a mouse model of dominant
RP), wild type, Grb14-/- and Rpe65-/- (account for ≈2% of cases of recessive RP)
mice were used to study the regulation of PTP1B activity. We measured the retinal
PTP1B activity in wild type, Grb14-/-, VPP-transgenic and Rpe65-/- mice. Grb14
and Src-kinase phosphorylation was examined in wild type, VPP-transgenic and
Rpe65-/- mice.
Results: We found that Grb14 competitively inhibits PTP1B activity in a
phosphorylation-regulated manner. We also found that rhodopsin-regulated Src
kinase activation in retina leads to the phosphorylation of Grb14. Further, ablation
of Grb14 resulted in significantly elevated retinal PTP1B activity in vivo. We found
that Src kinase activation and Grb14 phosphorylation is absent in VPP-transgenic
and Rpe65-/- mice compared to wild type mice. The results also indicate
significantly elevated levels of PTP1B activity in VPP-transgenic and Rpe65-/- mice
compared to wild type mice.
Conclusions: Our results provide the first evidence that enhanced PTP1B activity
in mouse models of RP is due to dysregulation of Src-mediated Grb14
phosphorylation. Activators of Src-kinase or PTP1B antagonists could be potential
therapeutic agents to treat RP.
Commercial Relationships: Raju V. Rajala, None; Dustin T. Allen,
None; Radhika Dighe, None; Ammaji Rajala, None
Support: NIH/NEI grant (EY016507, EY00871) and Research to Prevent
Blindness, Inc.
Program Number: 1610 Poster Board Number: A563
Presentation Time: 8:30 AM - 10:15 AM
Expression of the Human Retina Specific ABC Transporter, ABCA4, in VirusLike Particles
Esther E. Biswas-Fiss1,2, Stephanie Affet1, Subhasis B. Biswas2. 1Bioscience
Technologies, Thomas Jefferson University, Philadelphia, PA; 2Molecular Biology,
Univeristy of Medicine and Dentistry of New Jersey School of Osteopathic
Medicine, Stratford, NJ.
Purpose: Mutations in the ABCA4 gene cause a major proportion of autosomal
recessive retinal degenerations (RD) with macular involvement, including Stargardt
disease (STGD1), autosomal recessive retinitis pigmentosa (arRP) and cone-rod
dystrophy (CRD. Despite the biological role of ABCA4 and its relevance to serious
visual disorders, knowledge of the biochemical, structural, and functional
properties of this membrane protein remains limited. The purpose of this study was
to develop a platform for the analysis of the biochemical consequences of a given
mutation on ABCA4 function.
Methods: Full length human ABCA4 cDNA was cloned into a mammalian
expression vector under the control of a CMV promoter. The recombinant ABCA4
construct was co-transfected into HEK293T cell line harboring a plasmid
expressing the structural gag and pol proteins of murine leukemia virus (MLV).
MLV gag and pol proteins create virus-like particles (virions without viral RNA),
which are enriched with recombinant ABCA4 protein. Verification of expression
was carried out through analysis of isolated virus-like particles via Western
Blotting using ABCA4 domain specific antibodies. The isolated ABCA4
expressing virus-like particles were used for further structure function analysis.
Results: Analysis of the virus-like particle fraction harboring the ABCA4 plasmids
demonstrated the expression of a 230 kDa polypeptide that cross-reacted with
domain specific ABCA4 antibodies. No expression was observed in cells harboring
the control plasmid. The wild-type ABCA4 protein in isolated VLPs was
biologically active with respect to the ability to hydrolyze ATP and appeared to
display a uniform membrane topology.
Conclusions: We have successfully expressed the ABCA4 protein in virus-like
particles. ABCA4-VLPs represent a useful approach for the analysis of ABCA4mediated retinal transport and effects of genetic mutations on the transport process.
Commercial Relationships: Esther E. Biswas-Fiss, None; Stephanie Affet,
None; Subhasis B. Biswas, None
Support: NIH EY013113
Program Number: 1611 Poster Board Number: A564
Presentation Time: 8:30 AM - 10:15 AM
Transcriptome Analyses Identify Novel Exons In Known Inherited Retinal
Disease Genes
Michael H. Farkas1, Greg Grant2, Maria Sousa1, Eric A. Pierce1. 1Ocular
Genomics Institute, Massachusetts Eye and Ear Infirmary, Boston, MA;
2
University of Pennsylvania, Philadelphia, PA.
Purpose: Mutations in 186 genes have been identified to cause inherited retinal
degeneration (IRD), accounting for 50-60% of cases. With the advent of nextgeneration genomic sequencing, many resources are focused on identifying novel
mutations in the current annotation of coding sequence. However, RNA-seq
transcriptome analyses have demonstrated that the current annotations are greatly
under-representative and tissue-dependent. Here, we present the use of RNA-seq
transcriptome analyses of the normal human neural retina to better characterize the
coding sequence within known IRD genes.
Methods: Using RNA-seq, we generated approximately 100 million reads each
from three normal human neural retina transcriptomes. We aligned the reads and
analyzed the data using the RUM Unified Mapper (RUM) pipeline. The processed
data was uploaded to the UCSC Genome Browser and the 186 currently known
IRD genes were scanned to find novel exons. The frame of the novel exon was
determined and validated using RT-PCR.
Results: By analyzing 300 million reads, were able to obtain deep coverage of the
normal human neural retina transcriptome, identifying nearly 80% of all annotated
exons. This equates to full coverage of the expressed annotated human retinal
transcriptome. However, we were able to identify nearly 25,000 additional novel
exons. Within the set of known IRD genes, over 200 novel exons were identified in
99 genes. These novel exons represent alternate first and last exons, as well as
internal exons. Using RT-PCR and Sanger sequencing, we validated novel exons in
a subset of these transcripts including RP1 and MYO7A. All of the novel exons
were confirmed to be in the spliced transcript.
Conclusions: The addition of the novel exons in the IRD genes account for a
significant portion of all of the annotated exons in this set. Given that only 50-60%
of IRD cases have been characterized, this finding has implications for finding new
mutations that cause disease. On a larger scale, a better annotation of the current
transcriptome will add nearly a megabase of additional coding sequence for
screening of disease mutations in genes not previously characterized as diseasecausing.
Commercial Relationships: Michael H. Farkas, None; Greg Grant,
None; Maria Sousa, None; Eric A. Pierce, None
Support: NEI Grant EY2074702
Program Number: 1612 Poster Board Number: A565
Presentation Time: 8:30 AM - 10:15 AM
Characterization of HCN1 Trafficking in Rod Photoreceptors
Copyright 2012 by the Association for Research in Vision and Ophthalmology, Inc., all rights reserved. For permission to reproduce any abstract, contact the ARVO Office at pubs@arvo.org.
ARVO 2012 Annual Meeting Abstracts by Scientific Section/Group – Biochemistry/Molecular Biology (BI)
Yuan Pan, Joseph G. Laird, Sheila A. Baker. Biochemistry, University of Iowa,
Iowa City, IA.
Purpose: Hyperpolarization-activated cyclic nucleotide-gated channel 1 (HCN1) is
a non-selective cation channel that is expressed in retina, brain and heart. It
functions by shaping membrane potential and synaptic output. In photoreceptors,
HCN1 is exclusively localized in the membrane of inner segments and synaptic
termini. Failing to targeting HCN1 to its proper sub-cellular compartments will
prevent it from functioning. This might also lead to disease given that defects in
sorting and targeting of membrane proteins in photoreceptors are common causes
of retinal degeneration. Here in this study, our goal is to study HCN1 trafficking in
rods by identifying the targeting signal and testing if ankyrin-B is involved in this
process.
Methods: To identify a targeting signal, the C-terminus of HCN1 was attached to a
membrane reporter and expressed in transgenic Xenopus rods. Localization of the
transgenically expressed protein were visualized with confocal microscopy. To test
if there is an interaction between HCN1 and ankyrin-B, we used coimmunoprecipitation and a membrane recruitment assay in HEK293 cells.
Results: We found that the carboxyl terminus following the cyclic nucleotide
binding domain of HCN1 (601-890) is sufficient for its targeting. In addition, the
membrane recruitment assay and co-immunoprecipitation results do not support an
interaction between HCN1 and ankyrin-B.
Conclusions: Ankyrin-B is not directly involved in HCN1 targeting. And we
identified a novel region within the C-terminus of HCN1 that is sufficient for its
targeting in rods.
Commercial Relationships: Yuan Pan, None; Joseph G. Laird, None; Sheila A.
Baker, None
Support: EY020542
Program Number: 1613 Poster Board Number: A566
Presentation Time: 8:30 AM – 10:15 AM
Whirlin and Cav1.3α1 are Mutually Independent for Their Localization and
Expression in Photoreceptors
Junhuang Zou, J. Yang. John A Moran Eye Center, University of Utah, Salt Lake
City, UT.
Purpose: Usher syndrome is a condition characterized by retinitis pigmentosa and
deafness. Among its three clinical types, Usher syndrome type II (USH2) is the
most prevalent. Currently, usherin (USH2A), G-protein-coupled receptor 98
(GPR98), and whirlin have been identified responsible for USH2. Their proteins
are known to form a protein complex in vivo, and whirlin plays a role in the
organization of this complex. Recently, Cav1.3α1 (α1D) has been discovered to be
able to interact with whirlin in vitro, and these two proteins are localized to a
similar place in photoreceptors. Here, we further investigate the localization of
Cav1.3α1 in photoreceptors and reveal the relationship between whirlin and
Cav1.3α1 in vivo.
Methods: RT-PCR was utilized to examine the expression of Cav1.3α1 transcripts
in the retina. Western blotting, densitometry, statistical analysis,
immunofluorescent staining, and confocal laser scanning microscopy were
performed to compare the protein expression level and localization between wildtype and various mutant retinas.
Results: Different Cav1.3α1 splice isoforms exist in the retina. They were localized
to the multiple regions in photoreceptors. At the apical inner segment, Cav1.3α1
long isoform was in close proximity of whirlin, though their colocalization was
limited. Ablation of whirlin did not affect the Cav1.3α1 expression pattern and
level in the retina. Similarly, whirlin distribution and expression level were not
changed in the Cav1.3α1 deficient retina.
Conclusions: An L-type voltage-gated calcium channel may participate in the
biological function of the USH2 proteins complex in photoreceptors. This calcium
channel and the USH2 protein complex are mutually independent for their
localization and expression.
Commercial Relationships: Junhuang Zou, J. Yang, None
Support: None
Program Number: 1614 Poster Board Number: A567
Presentation Time: 8:30 AM - 10:15 AM
The Functional and Structural Differences between the Heteromeric and
Homomeric CNG Channel in Cone Photoreceptors
Xi-Qin Ding1, Jianhua Xu1, Arjun Thapa1, Lynsie Morris1, Hongwei Ma1, Jin-Shan
Wang2, Vladimir Kefalov2. 1Cell Biology, Univ Oklahoma Hlth Sciences Ctr,
Oklahoma City, OK; 2Department of Ophthalmology and Visual Sciences,
Washington University School of Medicine, Saint Louis, MO.
Purpose: Cone cyclic nucleotide-gated (CNG) channel is a heteromeric complex
comprising the subunits CNGA3 and CNGB3. Mutations in CNGB3 account for
over 50% of all known cases of achromatopsia. This work investigates the
functional and structural differences between the heteromeric and homomeric CNG
channels in cones using CNGB3-deficient mouse models.
Methods: As cones comprise only 2-3% of the total photoreceptor population in
the wild-type mouse retina, we generated the mouse line with CNGB3 deficiency
on a cone-dominant background, i.e., CNGB3-/-/Nrl-/- mice. Cone phototransduction
was evaluated by photopic electroretinographic (ERG), flicker ERG, and
transretinal ERG recordings. CNG channel complex assembly was analyzed by
chemical cross-linking and the channel complex stability was evaluated by trypsinTPCK digestion.
Results: CNGB3-/-/Nrl-/- mice showed a 40-50% reduction of the photopic ERG
response compared to the age-matched Nrl-/- mice (P30). The flicker ERG
responses under photopic conditions were significantly diminished in the CNGB3-//Nrl-/- mice. Transretinal ERG recordings showed that the cone sensitivity in
CNGB3-/- mice (P30) was about 0.5 log unit lower and the response recovery was
about 2.5-fold slower than these of age-matched wild-type mice. Though CNGA3
expression level was much reduced in CNGB3-deficient retina, CNGA3 was able
to form the homotetrameric complex in cones. However, the homomeric channel
complex was found to be more resistant to trypsin digestion in the experimental
conditions used.
Conclusions: In the absence of CNGB3, CNGA3 is able to form a functional
homomeric channel that maintains cone phototransduction. However, CNGB3
deficiency results in a reduced sensitivity, impaired temporal processing, and
slower recovery of the cone light response compared to phototransduction mediated
by CNGA3/CNGB3 heteromeric channels.
Commercial Relationships: Xi-Qin Ding, None; Jianhua Xu, None; Arjun
Thapa, None; Lynsie Morris, None; Hongwei Ma, None; Jin-Shan Wang,
None; Vladimir Kefalov, None
Support: This work was supported by grants from the National Center for
Research Resources (P20RR017703) and the National Eye Institute (EY12190,
EY019490, EY019312 and EY021126).
Program Number: 1615 Poster Board Number: A568
Presentation Time: 8:30 AM - 10:15 AM
Ocular Derived Tead4 Isoforms Differentially Bind Yap1
Trevor J. Mcfarland1A, Matthew Hartzell1A, Andrew Stempel1A, Yuzhen Pan1B,
Justine Smith1B, John T. Stout1A, Binoy Appukuttan1A. ARetina, BImmunology,
1
Casey Eye Institute-OHSU, Portland, OR.
Purpose: The TEAD family (TEAD 1-4) are cell specific transcription factors that
require essential cofactors such as Yes-associated protein (YAP1) to mediate gene
expression. YAP1 is involved in various cellular pathways, including proliferation,
apoptosis and organ growth. The activity of full-length TEAD4 (1305) is dependent
on binding to YAP1. We have previously identified human ocular derived isoforms
of TEAD4 (651 and 447) that can either enhance or repress VEGF-A promoter
activity. Whether TEAD4 isoform mediated gene regulation within ocular cells
requires YAP1 and/or other cell-specific cofactors is unknown. In order to test
whether these new isoforms of TEAD4 bind YAP1, computer modeling and ocular
cell derived protein pull-down assays were employed.
Methods: To test for the presence of TEAD4 and YAP1, RT-PCR was performed
on various ocular derived cells, including Muller (MIO-M1), RPE-19 and vascular
endothelial cells derived from primary human iris, choroid and retina. Prediction of
protein-protein binding efficiencies was obtained with computer modeling methods
(CN3D NCBI) using the 3D crystal structure of the human YAP1 and TEAD1
Complex (TEAD1 and TEAD4 share 89% identity). Expression vectors containing
the GFP gene fused to 1305, 651 or 447 TEAD4 isoforms were cotransfected with
a YAP1 expression vector into 293T cells. Cells were cultured for 36 hours,
washed in ice cold PBS and lysed using a non-denaturing buffer. Pull-down assays
were performed using the GFP-Trap Kit (Allele Biotechnology). Western blots
were probed with antibodies for both TEAD4 and YAP1 using samples obtained
from input, non-bound and bound pull-down fractions.
Results: All cell lines were RT-PCR positive for TEAD4 and YAP1, with the
exception of MIO-M1, which was positive for TEAD4 only. An additional isoform
of YAP was found in all endothelial cell types. 3D crystal structure analysis
revealed that the 1305 TEAD4 possesses 100% of the YAP1 binding domain, while
the 651 and 447 isoforms possess 57% and 5% of the binding domain, respectively.
Protein pull-down assays indicate that the 1305 and 651 bind to YAP1. It appeared
that the 447 isoform was incapable of binding YAP1 in this study.
Conclusions: Differential binding of TEAD4 isoforms to co-factors such as YAP1
may explain the disparity previously observed between isoforms and gene promoter
activity. How the 447 isoform is able to enhance VEGF promoter activity several
fold higher then the other TEAD4 isoforms without binding YAP1, a key cofactor,
is intriguing. The 447 isoform may require other ocular cell-specific cofactors to
function.
Commercial Relationships: Trevor J. Mcfarland, None; Matthew Hartzell,
None; Andrew Stempel, None; Yuzhen Pan, None; Justine Smith, None; John
T. Stout, None; Binoy Appukuttan, None
Support: NIH:NEI:RO1 EY019042
Program Number: 1616 Poster Board Number: A569
Presentation Time: 8:30 AM - 10:15 AM
Utilisation of Mouse Expression Data to Investigate the Molecular Genetic
Basis of Human Retinal Disease
Stephanie Halford1A, Richard Holt1A, Rachel Butler1A, Joel Beevers1A, Aarti
Jagannath1A, Stuart Peirson1A, Susan Downes1B. ANuffield Laboratory of
Copyright 2012 by the Association for Research in Vision and Ophthalmology, Inc., all rights reserved. For permission to reproduce any abstract, contact the ARVO Office at pubs@arvo.org.
ARVO 2012 Annual Meeting Abstracts by Scientific Section/Group – Biochemistry/Molecular Biology (BI)
Ophthalmology, BOxford University Hospitals, 1University of Oxford, Oxford,
United Kingdom.
Purpose: Inherited retinal dystrophies affect approximately 1 in 2500 people,
currently RetNet lists 204 retinal disease loci with the underlying gene identified in
161 of them. In the case of autosomal recessive retinitis pigmentosa (arRP) 39
susceptibility loci have been reported with the causal gene identified in 36 of these.
However, this only accounts for ~40% of arRP cases diagnosed in clinics.
Comparable situations exist for other forms of retinal dystrophy and hence there
remains a considerable proportion of disease genes to be identified. Dysfunction or
death of rod and cone photoreceptors is the primary cause of blindness in most
retinal degenerative diseases. Therefore, a catalogue of the specific gene expression
profiles of rods and cones will provide a comprehensive database of candidates for
retinal degenerations and provide a mechanistic basis for understanding
photoreceptor development, function and maintenance. It will also lead to an
investigation of cellular pathways and events that are currently undefined.
Methods: We have utilized our unique access to a mouse model lacking rod and/or
cone photoreceptors (rd/rd, cl/cl and rd/rd cl) coupled with our expertise in whole
genome expression profiling to identify genes expressed in photoreceptors. By
comparing RNA from the retinae of degenerate mice and congenic wildtype
controls, using Affymetrix Exon Arrays, we have identified genes that are
markedly down-regulated in mice lacking rod and/or cone photoreceptors.
Results: We have established a database of genes that are expressed in rods and/or
cones; and as well as identifying genes with a known role in the retina we have
identified a subset of novel genes with no previously known retinal function. We
are in the process of characterising these novel genes. We have also shown in the
case of arRP that alteration of expression of known causal genes differs
significantly from other genes within the same regions (P< 0.001). We are
currently utilising these data to select high priority candidate genes in regions
showing linkage to retinal dystrophy for mutation screening.
Conclusions: Using this entirely innovative strategy we have been able to identify
novel and known genes expressed in photoreceptors, which now need further
characterization. Understanding the role of photoreceptor-specific genes will enable
us to determine if mutations in these genes give rise to retinal disease, improving
patient screening and guiding future development of therapeutics for these
conditions.
Commercial Relationships: Stephanie Halford, None; Richard Holt,
None; Rachel Butler, None; Joel Beevers, None; Aarti Jagannath, None; Stuart
Peirson, None; Susan Downes, None
Support: RP Fighting Blindness GR571
Program Number: 1617 Poster Board Number: A570
Presentation Time: 8:30 AM - 10:15 AM
Expression Map Of Sumo And Ubiquitin Pathway Enzymes In The Mouse
Retina
Gemma Marfany, Mariona Esquerdo, Víctor Abad, Erica Millo, Silvia GarciaMonclus, Alejandro Garanto. Departament de Genetica, Universitat de Barcelona,
Barcelona, Spain.
Purpose: Many transcription factors and other proteins that control crucial fate
decisions, such as those occurring in the differentiation of specific retinal neuron
types, undergo SUMO and/or ubiquitin post-translational modifications. The aim of
this work is to analyze the expression of a battery of enzymes involved in the
SUMO and ubiquitin conjugation/deconjugation pathways in the mouse retina.
Methods: Wild-type retinas from C57BL/6J mice have been the source of material,
abiding to the ARVO statement for the use of animals in ophthalmic and vision
research. After RNA purification and cDNA obtention, the expression of the
battery of genes selected for the study has been analyzed by real-time RT-PCR, in
situ hybridization and immunohistochemistry on retinal sections.
Results: The genes of the SUMO and ubiquitin pathways analyzed have been
classified in categories, according to their level of transcription in the mouse retina.
In situ hybridizations performed on retinal sections have shown whether the
expression was basal and ubiquitous throughout the retinal cell layers, or whether a
specific pattern of expression is indicative of specific neuronal type function for
each gene. Those genes with a particularly interesting function or pattern of
expression have been further characterized by immunohistochemistry.
Conclusions: An expression map for the battery of selected genes encoding SUMO
and ubiquitin pathways has been drawn. A subset of genes show specific
expression patterns, with higher transcriptional levels in specific cell types, such as
the outer and inner plexiform, ganglion cell and photoreceptor cell layers. Future
work will focus on the search for specific substrates for the most relevant genes of
these two pathways.
Commercial Relationships: Gemma Marfany, None; Mariona Esquerdo,
None; Víctor Abad, None; Erica Millo, None; Silvia Garcia-Monclus,
None; Alejandro Garanto, None
Support: BFU2010-15656 (Ministerio de Educación y Ciencia) and 2009SGR1427 (Generalitat de Catalunya)
Program Number: 1618 Poster Board Number: A571
Presentation Time: 8:30 AM - 10:15 AM
FAM161A Produces Two Protein Isoforms with a Differential Retinal
Expression Pattern
Dror Sharon1, Alexey Obolensky1, Elia Shevach1, Eyal Banin1, Shahar Frenkel1,
Adi Inbal2, Dikla Bandah-Rozenfeld1. 1Department of Ophthalmology, HadassahHebrew Univ Medical Ctr, Jerusalem, Israel; 2Medical Neurobiology, IMRIC, The
Hebrew University-Hadassah Medical School, Jerusalem, Israel.
Purpose: We have previously reported that mutations in FAM161A are the major
cause of autosomal recessive retinitis pigmentosa in the Israeli population. In
addition, we reported that FAM161A produces two alternatively-spliced transcripts
in the retina. The more common transcript (#1) does not contain exon 4 while the
less common transcript (#2) contains all known exons. The purpose of the current
study is to verify the expression of the two transcripts at the protein level, to
determine the expression pattern of each isoform, and to characterize the effect of
blocking or reducing the expression of these isoforms in the zebrafish retina.
Methods: Polyclonal antibodies were raised against the C-terminal and the
alternatively-spliced and highly conserved exon 4 of FAM161A, using rabbit as the
host species. Immunohistochemistry was performed on mouse and human retinal
sections using a commercial antibody (HPA032119) as well as two costume-made
antibodies. Morpholino oligonucleotides that were designed to block translation or
splicing of FAM161A were injected into 1-4-cell zebrafish embryos.
Results: We raised antibodies against the C-terminal and the alternatively-spliced
and highly conserved exon 4 of FAM161A. In the mouse retina, all antibodies
yielded a similar expression pattern with a major signal in photoreceptor innersegments as well as a weaker staining in the outer plexiform layer. In the human
retina, a similar pattern of expression was obtained with antibodies that were
designed to recognize both isoforms, while the antibody designed to recognize
isoform #2 showed a cone-enriched staining. Double staining with a FAM161A
antibody and either PNA or S-cone opsin supported the cone-enriched expression
of this isoform. Aiming to gain a better understanding on the function of each
isoform, morpholinos were designed to block the expression of either all isoforms
or isoform #2 specifically. RT-PCR analysis of injected embryos indicated that the
splicing morpholino inhibit the expression of both transcripts. The effect of the
different morpholinos on retinal structure and function is currently being evaluated
and will be reported at the meeting.
Conclusions: We report here a unique expression pattern in which the same gene
produces two isoforms with a differential expression pattern in either rods or cones.
This phenomenon might be produced by retinal splicing factors that are expressed
exclusively in one photoreceptor type.
Commercial Relationships: Dror Sharon, None; Alexey Obolensky, None; Elia
Shevach, None; Eyal Banin, None; Shahar Frenkel, None; Adi Inbal,
None; Dikla Bandah-Rozenfeld, None
Support: Foundation Fighting Blindness (FFB- grant number BR-GE-0510-0490HUJ).
Program Number: 1619 Poster Board Number: A572
Presentation Time: 8:30 AM - 10:15 AM
The Components of the Ocular-Renal Disease Interactome Comprised of
RPGR, RPGRIP1α1 and NPHP4 Perform Complementary Roles in Its Exit
from the Endoplasmic Reticulum
Hemangi Patil, Paulo A. Ferreira. Ophthalmology, Duke University Medical
Center, Durham, NC.
Purpose: The Retinitis Pigmentosa GTPase Regulator Protein 1 (RPGRIP1) forms
a scaffolding complex with the Retinitis Pigmentosa GTPase Regulator (RPGR)
and nephrocystin-4 (NPHP4). Mutations affecting the RPGRIP1 interactome cause
syndromic retinal dystrophies, but the molecular and subcellular processes
mediated by this interactome are not understood. RPGR1-19 and RPGRORF15
isoforms determine the subcellular localization of RPGRIP1α1 to the endoplasmic
reticulum (ER) and cytosolic compartments, respectively (Patil, H. et al. 2011
Biology Open, in press). However, the role(s) of NPHP4 in these subcellular
targeting processes and the roles of RPGRIP1 and RPGR isoforms in allied NPHP4
function(s) are lacking. We seek to test the hypothesis that the interplay between
RPGR, RPGRIP1α1 and NPHP4, modulate their subcellular targeting and sorting.
Methods: We performed microscopy analysis of cultured cells ectopically
expressing RPGR, RPGRIP1α1 or NPHP4, singly or in combination, and with and
without disease mutations known to uncouple the formation of binary complexes,
to determine interdependent subcellular roles between wild-type and mutant
proteins.
Results: NPHP4 alone is targeted to the ER, where, like RPGR1-19, it interfaces
with restricted ER domains labeled with calreticulin. Co-expression of NPHP4 or
RPGR1-19 with RPGRIP1α1 promotes the clearance of intracellular deposits of
RPGRIP1α1 and its targeting and co-localization with NPHP4 or RPGR1-19 to the
ER. In contrast, RPGRORF15 promotes the exit of NPHP4 from the ER and its
dispersion and co-localization with RPGRORF15 throughout the cytosolic
compartment. Co-expression of RPGRORF15 with NPHP4 and RPGRIP1α1 has a
similar subcellular targeting effect on the triad complex. Co-expression of NPHP4
with mutant RPGRORF15 and wild-type RPGRIP1α1, wild-type RPGRORF15 and
mutant RPGRIP1α1 or mutant RPGRORF15 and mutant RPGRIP1α1 causes the
sequestration or buildup of the RPGRORF15-RPGRIP1α1-NPHP4 complex in the ER
with the double and single mutations having the strongest and weakest effects,
Copyright 2012 by the Association for Research in Vision and Ophthalmology, Inc., all rights reserved. For permission to reproduce any abstract, contact the ARVO Office at pubs@arvo.org.
ARVO 2012 Annual Meeting Abstracts by Scientific Section/Group – Biochemistry/Molecular Biology (BI)
respectively.
Conclusions: NPHP4 recruits RPGRIP1α1 to the ER, whereas RPGRORF15 retrieves
the NPHP4-RPGRIP1α1 complex from the ER. Mutations uncoupling RPGRORF15
from RPGRIP1α1 down-modulate synergisticaly the ability of RPGRORF15 to
promote the exit of the RPGRIP1 interactome from the ER. A model emerges in
which deficits in subcellular events priming the formation and exit of preciliary
complexes from the ER and mediated by the RPGRIP1 interactome impair the
tethering and targeting of such complexes to the cilium and the elaboration of outer
segments of photoreceptors.
Commercial Relationships: Hemangi Patil, None; Paulo A. Ferreira, None
Support: NIH grant support EY019492 & GM083165, RPB
232 Animal Models of Retinal Dystrophies
Monday, May 7, 2012, 8:30 AM - 10:15 AM
Hall B/C Poster Session
Program #/Board # Range: 1620-1640/A573-A593
Organizing Section: Biochemistry/Molecular Biology
Program Number: 1620 Poster Board Number: A573
Presentation Time: 8:30 AM - 10:15 AM
Cerkl Knockdown Murine Model Shows Mild Affectation Of The Retinal
Ganglion Cell Layer
Roser Gonzalez-Duarte1,2, Alejandro Garanto1,2, Javier Vicente-Tejedor3A, Marina
Riera1,2, Pedro de la Villa3A, Roman Blanco3B, Gemma Marfany1,2. 1Departament
de Genetica, Universitat de Barcelona, Barcelona, Spain; 2CIBERER, Instituto de
Salud Carlos III, Barcelona, Spain; ADepartament o de Fisiologia, BDepartamento
de Cirugia y Oftalmologia, 3Universidad de Alcala, Alcala de Henares, Spain.
Purpose: The function of CERKL, a RP/CRD causative gene, has remained elusive
since its identification in 2004. Mutations in this gene account for a large number
of cases in the Spanish population. We have recently shown that CERKL displays
an unexpected transcriptional complexity, which further hampers genotypephenotype correlations. In order to shed light on CERKL function and contribution
to retinal dystrophies, we generated and performed the initial characterization of a
novel Cerkl-/- mouse model.
Methods: The knockout model was generated by the cre-mediated excision of a 2.3
kb genomic region encompassing the proximal promoter, first exon and a segment
of the first intron in a C57BL/6J background. The Cerkl-/- retinas were
characterized at the transcriptional, morphological, immunohistological and
electroretinographic levels. Specific protein markers were used to assess retinal
disfunction and stress at the molecular level. All procedures were performed
according to the ARVO statement for the use of animals in ophthalmic and vision
research.
Results: The Cerkl-/- mice were viable and fertile. Although the deletion was
successful, some remnant Cerkl expression was unexpectedly driven by adjacent
and internal alternative promoters. This residual expression (35%) of Cerkl in the
KO was moderate in photoreceptors and weak in ganglion and inner nuclear layers
as supported by in situ hybridization and immunohistochemical analyses.
Morphological studies did not show any gross changes even at 12 moths of age or
after light damage. A significant decrease of the ganglion cell marker Brn3a, as
well as the increase of the retinal stress marker GFAP indicated alterations at the
molecular and cellular levels. Notably, the oscillatory potentials (OPs) were
significantly reduced in the electroretinographic recordings at all ages.
Conclusions: The targeted Cerkl deletion resulted in a knockdown rather than a
full knockout model, with retention of some Cerkl transcription (35%) from
alternative promoters. A mild retinal phenotype in the Cerkl-/- retinas was
supported by: i) the increase of the GFAP levels, ii) the decrease of Brn3a marker
levels and iii) the consistent non-progressive perturbation of the OPs in the ERGs,
although no gross morphological differences were observed. Taken together, these
results strongly point to a disfunction of the ganglion and/or amacrine rather than
photoreceptor cells, challenging the role of CERKL in human versus mouse retinas.
Commercial Relationships: Roser Gonzalez-Duarte, None; Alejandro
Garanto, None; Javier Vicente-Tejedor, None; Marina Riera, None; Pedro de
la Villa, None; Roman Blanco, None; Gemma Marfany, None
Support: SAF2009-08079 (MICINN), 2009SGR-1427, CIBERER (U718) to R.G.D; and SAF2010-21879 (MEC) to P. de la V., FIS PI11/00533 (Instituto de Salud
Carlos III) to R.B. and BFU2010-15656 (MICINN) to G. M.
Program Number: 1621 Poster Board Number: A574
Presentation Time: 8:30 AM - 10:15 AM
Gene Expression Alterations in Mouse Retina with Cone Cyclic Nucleotidegated Channel Deficiency
Hongwei Ma1, Lynsie Morris1, Jianhua Xu1, Mark B. Frank2, Melissa Bebak2, XiQin Ding1. 1Cell Biology, Univ of Oklahoma Health Sci Ctr, Oklahoma City, OK;
2
Oklahoma Medical Research Foundation, Oklahoma City, OK.
Purpose: Cone photoreceptor cyclic nucleotide-gated (CNG) channel is essential
for color perception and visual acuity. Naturally occurring mutations in the channel
subunits CNGA3 and CNGB3 are associated with achromatopsia, progressive cone
dystrophy, and some forms of maculopathies, with mutations in CNGB3 alone
accounting for over 50% of all known cases of achromatopsia. This work
investigates the gene expression profiles in mouse retina with CNGB3 deficiency.
Methods: Because cones comprise only 3-5% of the total photoreceptor population
in a wild-type mouse retina, we generated the mouse line with CNGB3 deficiency
on a cone-dominant background, i.e., CNGB3-/-/Nrl-/- mice. Retinal RNAs were
prepared from CNGB3-/-/Nrl-/- and Nrl-/- mice (at postnatal 30 days) and analyzed by
Illumina microarrays. The microarray data were analyzed using a 5% FDR and
functionally evaluated using Ingenuity IPA and iReporter software. QRT-PCR was
performed to confirm the microarray findings.
Results: We found that 330 genes were significantly altered, including 144 up- and
186 down-regulated genes, in the CNGB3-/-/Nrl-/- retina relative to Nrl-/- retina.
Eighty of these differentially expressed genes having ≥1.5-fold change were
grouped into 67 functional categories. These categories are associated with
phototransduction, cGMP- and cAMP-mediated signaling, G-protein coupled
receptor signaling, EIF2/EIF4 signaling and endoplasmic reticulum stress pathway,
cell growth and transcriptional regulation, and cellular transportation. Twenty
genes from these functional groups, including cone arrestin (Arr3), HMG-box
transcription factor 1 (HBP1), basic leucine zipper transcription factor 2 (BACH2),
dopamine receptor D4 (DRD4), histone deacetylase 5 (HDAC5), and kinesin
family member 3A (KIF3A) were selected and validated by QRT-PCR.
Conclusions: CNGB3 deficiency differentially regulates expression of a wide
range of retinal genes. Those that directly or indirectly affect cell processes such as
phototransduction, cellular survival, transcription regulation, and transportation
likely play a crucial role in the retinal adaptation to impaired cone
phototransduction resulting from CNG channel deficiency.
Commercial Relationships: Hongwei Ma, None; Lynsie Morris, None; Jianhua
Xu, None; Mark B. Frank, None; Melissa Bebak, None; Xi-Qin Ding, None
Support: This work was supported by grants from the National Center for
Research Resources (P20RR017703 and P30RR031152) and the National Eye
Institute (P30EY12190 and R01EY019490).
Program Number: 1622 Poster Board Number: A575
Presentation Time: 8:30 AM - 10:15 AM
Common Apoptosis-Related miRNA Expression During Chronic
Photoreceptor Cell Death in Canine Models
Sem Genini, Karina E. Guziewicz, William A. Beltran, Gustavo D. Aguirre. Clinical
Studies, University of Pennsylvania, Sch Veterinary Med, Philadelphia, PA.
Purpose: To quantify the expression of selected apoptomirs, apoptosis-related
miRNAs, in dogs affected with XLPRA2, rcd1, and erd. These non-allelic retinal
diseases are caused by mutations in RPGRORF15, PDE6B, and STK38L,
respectively.
Methods: qRT-PCR comparisons of 11 miRNAs (miR-9, -19a, -20, -21, -29b, 122, -129, -146a, -155, -183, -221) between mutant and normal retinas
(3/group/age) were performed using TaqMan assays. Ct values were normalized
with those of U43 small nuclear RNA, the ratio of mutant vs. control calculated
with the ddCt method, and differentially expressed (DE) miRNAs identified with
an unpaired t-test (p<0.05 and fold change >2).
Results: Minimal differences in miRNA expression were observed at early ages in
XLPRA2 and rcd1. At 7 wks, miR-155 was elevated in XLPRA2, rcd1, and erd,
while miR-21 was up-regulated in rcd1 and erd. At this age, additional up-regulated
miRNAs were disease-specific: miR-9, -146a, -221 in rcd1; -122 in XLPRA2; and 19a, -29b in erd. Notable results for these three early-onset diseases at 16 wks
included down-regulation of the pro-apoptotic miR-122 and -129, as well as upregulation of almost all anti-apoptotic miRNAs, excluding miR-183 whose
expression did not vary.
Conclusions: Our results indicate minimal expression differences of apoptomirs at
disease onset (3 wks). However, during the peak (5 or 7 wks) of photoreceptor cell
death there was only one apoptomir that was DE in common. This suggests that the
early (5-7 wks) miRNA expression patterns are likely to be disease-specific.
Furthermore, during the chronic cell degeneration phase (16 wks) there was a
common signature of miRNA regulation in the three different diseases, especially
between XLPRA2- and rcd1-mutants, and to a lesser extent for erd. This follows
the pattern of disease in XLPRA2 and rcd1 that is characterized by synchronized
photoreceptor cell death. In contrast, erd has a unique pattern of photoreceptor cell
death or proliferation that occurs in parallel in this time period.
Commercial Relationships: Sem Genini, None; Karina E. Guziewicz,
None; William A. Beltran, None; Gustavo D. Aguirre, None
Support: NIH-EY 06855, -17549, Foundation Fighting Blindness, Van Sloun
Fund, Hope for Vision
Program Number: 1623 Poster Board Number: A576
Presentation Time: 8:30 AM - 10:15 AM
The Hsp90 Inhibitor 17-AAG Prevents Aberrant Endocytosis Mediated By
The Rhodopsin Retinitis Pigmentosa R135L Mutation
Monica Aguila1,2, Caroline McCulley1, Nele Schwarz1, Pere Garriga2, Michael E.
Cheetham1. 1Ocular Biology and Therapeutics, Institute of Ophthalmology, UCL,
London, United Kingdom; 2Departament d'Enginyeria Quimica, Centre de
Biotecnologia Molecular, Universitat Politecnica de Catalunya, Terrassa, Spain.
Copyright 2012 by the Association for Research in Vision and Ophthalmology, Inc., all rights reserved. For permission to reproduce any abstract, contact the ARVO Office at pubs@arvo.org.
ARVO 2012 Annual Meeting Abstracts by Scientific Section/Group – Biochemistry/Molecular Biology (BI)
Purpose: Mutations in rhodopsin are the most common cause of autosomal
dominant Retinitis pigmentosa (RP) and over 200 mutations lead to RP. Amino
acid substitutions at the highly conserved Arginine 135 residue (e.g. R135L) lead to
a mutant rod opsin protein that is constitutively phosphorylated and binds to visual
arrestin, leading to disturbances in endocytic pathways (Chuang et al., 2004). It has
been previously shown that pharmacological intervention can improve folding and
improve traffic, or reduce protein aggregation of a rod opsin misfolding mutant
P23H. Here, we investigate the ability of these drugs to modulate R135L rod opsin
phenotype.
Methods: SK-N-SH neuroblastoma cells were transiently transfected with wildtype (WT)-GFP, P23H-GFP, R135L-GFP, Arrestin-FLAG or GRK1-FLAG. The
transfected cells were treated with a variety drugs (9-cis-retinal, 4-PBA and 17AAG) for 24 hours. Immunofluorescence was used to determine the incidence of
opsin intracellular vesicles or inclusions. The processing and expression of opsin
within the cell was analysed by immunofluorescence and western blotting.
Results: R135L-GFP behaved as previously described, recruiting arrestin and
disrupt endocytosis causing and accumulation of R135L positive intracellular
vesicles. Furthermore, R135L acted as a dominant negative to recruit WT rod opsin
to intracellular vesicles. Interestingly, pharmacological chaperones (9-cis-retinal)
enhanced R135L mediated endocytosis. 4-PBA had no effect on R135L. In
contrast, the Hsp90 inhibitor and molecular chaperone inducer, 17-AAG, reduced
the intracellular accumulation of R135L and abolished arrestin binding.
Importantly, this was due to a requirement for Hsp90 in rhodopsin kinase (GRK1)
stability function.
Conclusions: These data suggest that 17-AAG can protect against both class II and
class III rod opsin mutants, but by different mechanisms. Therefore, Hsp90
inhibition could be used as a potential therapeutic target for different types of
rhodopsin RP, although it may also affect visual function through the need for
Hsp90 chaperone function by components of the phototransduction machinery.
Commercial Relationships: Monica Aguila, None; Caroline McCulley,
None; Nele Schwarz, None; Pere Garriga, None; Michael E. Cheetham, None
Support: The Wellcome Trust, RP Fighting Blindness and Fight for Sight
Program Number: 1624 Poster Board Number: A577
Presentation Time: 8:30 AM - 10:15 AM
A Novel Animal Model Of RP And Cone-rod Dystrophy Associated With Aipl1
Hinge Mutation
Cristy A. Ku1A, Visvanathan Ramamurthy1B. AOphthalmology, Neuroscience,
B
Ophthalmology and Biochemistry, Center for Neuroscience, 1West Virginia
University, Morgantown, WV.
Purpose: Defects in Aipl1 (aryl hydrocarbon receptor interacting protein like-1) are
associated with autosomal recessive Leber congenital amaurosis (LCA), a severe
and rapid degeneration mimicked in the Aipl1 null mouse. Interestingly, Aipl1
defects are also linked to autosomal dominant juvenile retinitis pigmentosa and
cone-rod dystrophy. One such mutation is P351∆12, a 12-bp deletion in the primate
specific C-terminal hinge region. The main goal of this work is to understand the
mechanism behind Aipl1 defects leading to dominant disease and the importance of
the hinge region in function and survival of photoreceptor cells.
Methods: Transgenic mice were generated expressing either N-terminal Flag
tagged wildtype human AIPL1 (hAIPL1) or P351∆12 hAIPL1, under the control of
a 2.3 kb mouse Crx promoter, active beginning at E12.5 in both rod and cone
photoreceptors (Furukawa et al., 2002). Transgenic positive founders were
backcrossed with Aipl1 null mice. Transgene expression was examined by
immunoblotting with Flag and hAIPL1 antibodies. Photoreceptor function and
survival was assessed by electroretinography (ERG) and immunocytochemistry.
Results: Both mutant P351∆12 hAIPL1 and wildtype hAIPL1 expressed at similar
levels. However, ERG responses of P351∆12 hAIPL1 in an Aipl1-/- background
showed an early (P18) dramatic reduction in photopic responses and 50% decline
in scotopic responses. In contrast, wildtype hAIPL1 fully rescued rod and cone
vision in Aipl1-/- mice into late adulthood. Further biochemical and morphological
analyses are being conducted to examine the cause of ERG dysfunction.
Conclusions: This novel model of retinal degeneration associated with Aipl1
P351∆12 mutation, shows visual deficits and degeneration that is less drastic than
Aipl1 null mice. This indicates the greater treatment potential in patients with
mutations in this region as compared to the common nonsense W278X Aipl1
mutation. Mutant mice showed a greater detriment to cone photoreceptors, in
agreement with cone-rod dystrophy associated with this mutation. The deficits
observed in P351∆12 hAIPL1 mice demonstrate the importance of the primate
specific region in proper functioning of AIPL1 in photoreceptor cells.
Commercial Relationships: Cristy A. Ku, None; Visvanathan Ramamurthy,
None
Support: NIH Grant EY017035 (VR), West Virginia Lions Eye Bank, Research to
Prevent Blindness (RPB) challenge grant (WVU)
Program Number: 1625 Poster Board Number: A578
Presentation Time: 8:30 AM - 10:15 AM
Knockout or overexpression of Glutamic Acid Rich Protein 2 (GARP2)
adversely affects rod structure and function
Dibyendu Chakraborty1, Youwen Zhang2, Shanta Sarfare2, Steven J. Pittler2, Muna
I. Naash1. 1Dept of Cell Biology, Univ of Oklahoma Hlth Sci Ctr, Oklahoma City,
OK; 2Vision Sciences, Univ of Alabama at Birmingham, Birmingham, AL.
Purpose: The cyclic nucleotide gated (CNG) channel plays an important role in
visual transduction in rod and cone photoreceptors. The rod CNG channel consists
of three alpha subunits (CNGA1) and one extended beta subunit (CNGB1) which
contains a unique proline- and glutamic acid-rich N terminal extension domain
(GARP). It had been shown that both free GARP and CNGB1 can bind to the
photoreceptor-specific tetraspanin retinal degeneration slow (RDS) protein. RDS is
present in the rim region of rod and cone outer segments (OSs) with its
homologous binding partner ROM-1, and is required for photoreceptor OS
morphogenesis and stabilization. In the present study, we focus on the importance
of RDS-CNGB1 and RDS-GARP complexes in OS morphogenesis and stability.
Methods: GARP2-Tg transgenic and Cngb1-/- mice were crossed onto wild-type
(WT), Rds+/- and Rds-/- genetic backgrounds. Protein expression was verified by
Western blot. Morphological and functional assessments of transgenic and
knockout retinas were performed by light and electron microscopy and
electroretinography (ERG), respectively. Biochemical properties of RDS
complexes were evaluated by non-reducing velocity sedimentation.
Results: Significantly diminished scotopic a-wave amplitudes were observed in
Cngb1-/- on both the WT and Rds+/- backgrounds in comparison to WT and Rds+/controls. A-wave maximum amplitudes were also reduced in GARP2-Tg mice (on
the WT and Rds+/-) compared to non-transgenic controls although the reduction was
not as severe as that seen in the Cngb1-/-. Ultrastructural analysis showed that
Cngb1-/- and GARP2-Tg OSs are shorter than those in the WT.
Immunofluorescence and velocity sedimentation analyses revealed that neither
RDS/ROM-1 localization nor RDS/ROM-1 oligomerization were affected by the
absence of Cngb1 or overexpression of GARP2 protein.
Conclusions: Our results suggest that lack of Cngb1 and overexpression of GARP2
both act additively with RDS haploinsufficiency to decrease rod function.
However, this additive effect does not appear to be due to any destabilization or
inhibition of RDS higher-order complex formation in the absence of Cngb1 or in
the presence of excess GARP2. The precise role of RDS-GARP interactions is still
under investigation.
Commercial Relationships: Dibyendu Chakraborty, None; Youwen Zhang,
None; Shanta Sarfare, None; Steven J. Pittler, None; Muna I. Naash, None
Support: National Institutes of Health [EY10609 (M.I.N.),EY018656 (M.I.N.),EY
018143 (S.J.P.),and Core Grant for Vision Research EY12190 (M.I.N.),EY03039
(S.J.P) and the Foundation Fighting Blindness (M.I.N.)
Program Number: 1626 Poster Board Number: A579
Presentation Time: 8:30 AM - 10:15 AM
Comparative Study Of Post-natal Retinal Vascular Development In Mice
Models Of iPLA2 Inhibition And Plasmalogen Deficiency
Sarah Saab1, Bénédicte Buteau1, Laurent Leclère1, Catherine P. CreuzotGarcher2,1, Alain M. Bron2,1, Lionel Bretillon1, Niyazi Acar1. 1INRA, University of
Burgundy, Eye & Nutrition Research Group, Dijon, France; 2Ophthalmology,
University Hospital, Dijon, France.
Purpose: Plasmalogens are particular phospholipids characterized by the presence
of a vinyl-ether bond and of a polyunsaturated fatty acid (PUFA) at sn-1 and sn-2
positions of glycerol, respectively. Even if the plasmalogen content of organs and
tissues is well documented, their biological functions are still enigmatic.
Plasmalogen deficiency in DAPAT-/- mice leads to developmental abnormalities in
retinal vasculature (Acar et al, ARVO 2007 E-Abstract 2978) and to persistent
hyaloïd arteries. We hypothesize that plasmalogens regulate retinal vascular
development through the liberation of PUFA by a plasmalogen-specific calciumindependent phospholipase A2 (iPLA2). We have performed a comparative study
of the retinal vascular development in mouse models of iPLA2 inhibition in
comparison to total plasmalogen-deficiency.
Methods: Retinal vascular development was studied at P7, P14 and P21 on flat
mounted retina taken from DAPAT+/+ and DAPAT-/- mice and from C57BL/6
mice treated or not with the iPLA2 inhibitor, bromoenol lactone (BEL). Isolectin
B4 was used to stain retinal endothelial cells whereas the astrocyte network was
visualized after GFAP immunostaining. Pericytes and fibronectin influence on
vascular development was evaluated by anti-NG2 Chondroitin sulfate proteoglycan
and anti-fibronectin antibodies, respectively.
Results: Similar abnormalities in retinal vascular development were observed in
DAPAT-/- mice and C57BL/6 mice treated with BEL. These consisted in an
increased number of vessel ramifications and abnormal presence of glial cells in
retina at P14. We have observed an abnormal migration of glial cells from the optic
nerve at P21, and a large number of activated microglial cells in adult mice.
Conclusions: Our study consistently highlights the role of plasmalogen-specific
iPLA2, and subsequent release of PUFA from the sn-2 position of plasmalogens, in
the development of retinal vessels.
Commercial Relationships: Sarah Saab, None; Bénédicte Buteau,
None; Laurent Leclère, None; Catherine P. Creuzot-Garcher, None; Alain M.
Bron, None; Lionel Bretillon, None; Niyazi Acar, None
Support: INRA, France - Regional Council of Burgundy, France - Abbott
Laboratories, France
Copyright 2012 by the Association for Research in Vision and Ophthalmology, Inc., all rights reserved. For permission to reproduce any abstract, contact the ARVO Office at pubs@arvo.org.
ARVO 2012 Annual Meeting Abstracts by Scientific Section/Group – Biochemistry/Molecular Biology (BI)
Program Number: 1627 Poster Board Number: A580
Presentation Time: 8:30 AM - 10:15 AM
Rod Photoreceptor Expression of an N-terminal Truncated Cngb1a β-subunit
in Cngb1-X1 Knockout Mice Rescues Structure and Function
Steven J. Pittler, Alex S. McKeown, Timothy W. Kraft, Youwen Zhang. Vision
Sciences, Univ of Alabama at Birmingham, Birmingham, AL.
Purpose: The rod cGMP-gated cation channel β-subunit and associated soluble
GARP proteins are required for normal phototransduction, disk morphogenesis and
rod cell structural integrity, yet the function of these proteins in these processes is
not fully understood. We have generated several mouse models designed to dissect
the function of these proteins in the rod cell. Here we report on the rescue of
structure and function in a Cngb1 knockout mouse model expressing a truncated βsubunit.
Methods: Transgenic mice were generated on WT and photoreceptor null Cngb1X1 knockout backgrounds expressing opsin promoter-driven truncated β-subunit 23 fold above WT levels. Immunohistochemistry, Western, functional analysis by
ERG, and OCT were performed using established protocols.
Results: Two lines of mice were generated that contain the truncated β-subunit
transgene that expresses residues 370-1326 of the full-length β-subunit. The
transgene is devoid of any GARP2 sequence (1-291), and contains only 160 aa of
GARP1-related sequence. In WT mice, transgene expression was observed in
several layers of the retina and endogenous β-subunit levels were reduced, however
a- and b-wave ERG responses were comparable to WT mice without the transgene.
In 2 month old Cngb1-X1 knockout mice truncated beta subunit expression
restored the structural loss observed in the knockout mice and exhibited near
normal retina function by ERG analysis. At 7.5 months when knockout mice rods
have degenerated, truncated transgene mice exhibit some cell loss but near normal
rod structure and function.
Conclusions: Truncated β-subunit can partially substitute for full-length beta
subunit and GARP proteins in Cngb1-X1 knockout mice indicating that soluble
GARPs are not essential for rod structure and function until later ages. In WT mice
expressing the truncated β-subunit, transport is impaired or altered indicating that
sequence in the truncated N-terminal region may be necessary for proper transport
of the β-subunit to the outer segment.
Commercial Relationships: Steven J. Pittler, None; Alex S. McKeown,
None; Timothy W. Kraft, None; Youwen Zhang, None
Support: R01-EY018143, P30-EY03039
Program Number: 1628 Poster Board Number: A581
Presentation Time: 8:30 AM - 10:15 AM
Characterization Of NGF, trkANGFR And p75NTR Expression In Retina From
Mice Lacking Reelin Glycoprotein
Bijorn O. Balzamino1, Filippo Biamonte2, Graziana Esposito1, Ramona Marino2,
Flavio Keller2, Alessandra Micera1. 1Lab Ophthalmology, IRCCS GB Bietti Eye
Foundation, Rome, Italy; 2Lab. Developmental Neuroscience and Neural Plasticity,
University Campus BioMedico, Rome, Italy.
Purpose: Reelin is expressed in the retina as well as in injured cornea, in concert
with several growth factors such as NGF. Reelin absence leads to abnormal retinal
development (including migration, differentiation and plasticity) and loss of rod
Bipolar cells (RBPs). The aim of this study was to assess whether NGF pathway is
affected in reeler mice, by analyzing NGF and trkANGFR-p75NTR expression in all
retinal cells.
Methods: Reeler-L7-EGFP were obtained from B6C3Fe-a/a-rl X C57/BL6J that
were backcrossed to N[8] generation. C57/BL6J and L7-EGFP strains were used as
controls. Eyes were obtained from anaesthetised mice on postnatal day 21 and
processed for NGF, trkANGFR and p75NTR analysis. Reeler status was verified by
genotyping. Confocal images were acquired and mean fluorescence intensities were
recorded for statistical analysis. Real time PCR was carried out to evaluate
differences in molecular expression. Green fluorescent protein (GFP) was used to
identify RBPs in both reeler (rl/rl) and wild type (+/+) retinas.
Results: Retinas from both rl/rl and +/+ mice showed specific GFP fluorescence
localized in the dendrites, soma and axon terminals of RBPs. The typical
appearance of RBPs populating the inner neuronal layer was affected in rl/rl as
compared to +/+ mice. A reduced dendrite length and number of synapses were
detected in RBPs populating rl/rl retina, as compared to +/+ retina. A selective
increase of p75NTR expression was observed in most of RBPs, some Retinal
Ganglion Cells (RGCs) and amacrine cells, as compared to +/+, and validated by
real time PCR. trkANGFR expression was found slightly decreased. p75NTR/trkANGFR
ratio was markedly increased, indicating a selective shift to p75NTR expression in
the retina of reeler mice. Most rl/rl RGCs showed a specific NGF
immunoreactivity, in comparison to +/+.
Conclusions: Our study shows a decrease in dendritic length and a selective
p75NTR over-expression in RBPs, which might be interpreted as a tentative of cell
rescue. The selective NGFover-expression in RGC close-to RBP and amacrine cells
might be consistent with this hypothesis. From these studies, Reeler mice appear to
be a good model for exploring the cross-talk between NGF and Reelin in
development/maintenance of a normal retinal function. The complete
characterization of NGF pathway in reeler mice might provide further information
on RBP and RGC cross-talk during normal and pathological conditions.
Commercial Relationships: Bijorn O. Balzamino, None; Filippo Biamonte,
None; Graziana Esposito, None; Ramona Marino, None; Flavio Keller,
None; Alessandra Micera, None
Support: None
Program Number: 1629 Poster Board Number: A582
Presentation Time: 8:30 AM - 10:15 AM
A Constitutively Active G-alpha-i3 Corrects the Abnormal RPE Melanosomal
Phenotype in Oa1 Knockout mice
Alejandra Young1A, Meisheng Jiang1B, Novruz B. Ahmedli1A, Debora B. Farber1A.
A
Jules Stein Eye Institute, BThe Molecular Biology Institute and the Deparment of
Molecular and Medical Pharmacology, 1UCLA School of Medicine, Los Angeles,
CA.
Purpose: Ocular Albinism type 1 (OA1) is a disease caused by mutations in the
OA1 gene and characterized by macromelanosomes in the RPE and abnormal
crossing of the optic axons at the optic chiasm. We have shown that in the Oa1
signalling pathway this G-protein-coupled receptor activates specifically Gαi3. We
hypothesize that a constitutively active Gαi3 could by-pass the lack of Oa1 in the
RPE of Oa1 knockout (Oa1-/-) mice and keep the Oa1 signalling cascade going,
preventing in this way the formation of macromelanosomes. Therefore, we
introduced into the Oa1-/- RPE a constitutively active Gαi3 (Q>L). If rescue of the
abnormal RPE melanosomal phenotype of Oa1-/- mice occurred, it would be an invivo proof that Gαi3 is indeed the next step after Oa1 in the signalling cascade
controlling pigmentation of the RPE.
Methods: Transgenic mice carrying a constitutively active Gαi3 (Q>L) protein
were generated in the Oa1-/- background. Morphometrical analyses were
performed using light and electron microscopy to compare the size and number of
melanosomes per RPE area in putative Oa1-/-, Gαi3 (Q>L) transgenic mice with
those of wild type B6/NCrl and Oa1-/- mice.
Results: We found that there is a correlation between the presence of the transgene
and the rescue of the normal phenotype of RPE melanosomes in the Oa1-/- mice
carrying the constitutively active Gαi3. The Oa1-/-, Gαi3 (Q>L) transgenic mice
have a higher density of melanosomes per RPE area and a larger number of small
melanosomes than Oa1-/- mice and a similar RPE phenotype to that of wild type
mice.
Conclusions: Our results show that a constitutively active Gαi3 protein can bypass the lack of Oa1 in Oa1-/- mice and consequently rescue the normal RPE
melanosomal phenotype.
Commercial Relationships: Alejandra Young, None; Meisheng Jiang,
None; Novruz B. Ahmedli, None; Debora B. Farber, None
Support: The Vision of Children Foundation
Program Number: 1630 Poster Board Number: A583
Presentation Time: 8:30 AM - 10:15 AM
Zebrafish snow white as a model for Hermansky-Pudlak Syndrome
Christina M. Daly, Jeffrey M. Gross. Molecular, Cell & Developmental Biology,
University of Texas at Austin, Austin, TX.
Purpose: Defects in the formation or function of lysosome-related organelles
(LROs) are observed in several human albinism disorders, including ChediakHigashi Syndrome, Hermansky-Pudlak Syndrome and Griscelli Syndrome. While
much has been learned about the phenotypic characteristics and the genetic loci
involved in these disorders, the molecular and cellular mechanisms underlying
many of them remain to be elucidated. Melanosomes are a commonly studied LRO,
as they are easy to identify and their biogenesis has been well described. The
purpose of this study was to establish the zebrafish snow white (snw) mutant as a
model to study the molecular and cellular underpinnings of HPS.
Methods: Histology and transmission electron microscopy were utilized to
examine the morphological and ultrastructural defects in the snw eye. Total
melanin levels in whole snw and sibling embryos were biochemically quantified.
The density and size of melanosomes in the RPE was measured using ImageJ
software. Linkage mapping and candidate gene sequencing identified the possible
mutated locus in snw as Hermansky-Pudlak Syndrome 5 (hps5). A splice-blocking
morpholino oligonucleotide (MO) against Hps5 was injected into 1 cell stage
embryos to investigate gene knockdown effect. Phenotypic rescue by injection of
either hps5+/+ or hps5mut mRNA into 1 cell stage embryos was performed.
Formation of the Bloc2 protein complex (containing Hps5, Hps3, and Hps6) was
investigated via expression of hps5+/+ and hps5mut constructs in COS7 cells
followed by co-immunoprecipitation analyses.
Results: The snw eye is microphthalmic but morphologically normal, with
oculocutaneous hypopigmentation in both melanophores and iridophores by 2 days
post fertilization (dpf), continuing through 7 dpf. snw embryos show decreased
total melanin in both the eye and whole body, ranging from 60% to 37% of the
levels found in wild-type siblings. Further, both the number and size of
melanosomes is substantially decreased in snw embryos. The mutation was mapped
to chromosome 25 and candidate genes in the region were sequenced to identify the
mutated loci. A candidate mutation was identified in hps5, and MO knockdown
phenocopies the snw mutant. Injection of wildtype, but not mutant, hps5 mRNA
rescues pigmentation in snw mutants.
Copyright 2012 by the Association for Research in Vision and Ophthalmology, Inc., all rights reserved. For permission to reproduce any abstract, contact the ARVO Office at pubs@arvo.org.
ARVO 2012 Annual Meeting Abstracts by Scientific Section/Group – Biochemistry/Molecular Biology (BI)
Conclusions: The snw mutant posseses ocular defects similar to those observed in
human albinism patients displaying Hermansky-Pudlak Syndrome. We demonstrate
the usefulness of hps5 as a model to study melanosome biogenesis in the retinal
pigmented epithelium and more generally as model for the formation, trafficking
and function of lysosome-related organelles.
Commercial Relationships: Christina M. Daly, None; Jeffrey M. Gross, None
Support: NSF grant #10S – 0745782
Program Number: 1631 Poster Board Number: A584
Presentation Time: 8:30 AM - 10:15 AM
The Cfh-/-Abca4 -/- Double Knockout Mouse Model: Investigating The
Development Of Retinal Disease And Complement Regulation
Jessica Gomez, Zhichun Jiang, Jane Hu, Marcia Lloyd, Samer Habib, Steven
Nusinowitz, Roxana A. Radu. Ophthalmology, Jules Stein Eye Institute/ UCLA,
Los Angeles, CA.
Purpose: Chronic inflammation has been shown to underlie the pathogenesis of
age-related macular degeneration with one of the main contributors being activation
of complement. Activation can be induced by the accumulation of photo-oxidized
forms of A2E, a bis-retinoid pigment that aggregates as lipofuscin in retinal
pigmented epithelial (RPE) cells. Autofluorescent subretinal deposits, thought to be
evidence of A2E-lipofuscin accumulation in the RPE, have been shown to form in
certain mouse models including albino Abca4-/- and Cfh -/- mutants. In the current
study, we generated Cfh-/-Abca4 -/- double-knockout (DKO) mice to investigate
the pathogenic effects of losing both proteins.
Methods: Cfh-/-Abca4-/- (DKO), Cfh-/-, Abca4-/- and 129/Sv wild-type (WT)
mouse strains were used in this study. All strains were pigmented and on the rpe65Leu450 background. Retinas and RPE-containing eyecups were collected from agematched mice at different times. Levels of the negative complement-regulatory
protein (CRRY, CFH, CD59a, CD59b, DAF1, DAF2) mRNA’s were measured by
qRT-PCR. A2E-lipofuscin pigments were quantified by HPLC. Retina structure
was evaluated in vivo by optical coherence tomography (OCT) and fundus
photography. Retina histology was assessed by light microscopy. Autofluorescence
was quantified by confocal microscopy, and Bruch’s membrane thickness was
measured by electron microscopy.
Results: Fundus photography showed subretinal depigmentation in DKO mice
beginning at eight months. The DKO strain showed significantly higher A2Eprecursors in the RPE compared to the other strains at eight months. Consistently,
RPE autofluorescence was also higher in the DKO mice at eight months. Bruch's
membrane was significantly thickened in the DKO mice compared to the other
strains at 17-20 months. By OCT, retina thickness was decreased by 10% in DKO
versus WT mice at 13 months. Surprisingly, two-month-old DKO mice showed
significantly increased complement regulatory protein mRNA levels
(approximately two-fold increased CRRY and CD59a, and five-fold increased
CD59b) compared to age-matched WT mice, suggesting a compensatory
mechanisms due to loss of Cfh.
Conclusions: These data suggest that the combined loss of Cfh and Abca4 leads to
significant lipofuscin accumulation in the RPE compared to the single-mutant
models. Decreased retinal thickness by OCT suggests ongoing retinal degeneration
in the DKO mice. Increased expression of several complement regulatory genes
may indicate abnormal complement activation as a mechanism for the retinal and
RPE pathology in DKO mice.
Commercial Relationships: Jessica Gomez, None; Zhichun Jiang, None; Jane
Hu, None; Marcia Lloyd, None; Samer Habib, None; Steven Nusinowitz,
None; Roxana A. Radu, None
Support: None
Program Number: 1632 Poster Board Number: A585
Presentation Time: 8:30 AM - 10:15 AM
A Unique Approach To The Study Of The Function Of ROM-1 In The
Absence Of RDS
Shannon M. Conley, Dibyendu Chakraborty, Muna I. Naash. Dept of Cell Biology,
Univ of Oklahoma, Oklahoma City, OK.
Purpose: Rod outer segment membrane protein-1 (ROM-1) is a tetraspanin found
in the disc rims of rods and cones. ROM-1 interacts with its homolog retinal
degeneration slow (RDS) to promote outer segment (OS) morphogenesis, structural
maintenance and disc sizing. Due to the nearly undetectable levels of ROM-1 in the
absence of RDS (rds-/-), it has been very difficult to study its precise function which
is the goal of this project.
Methods: Two models were used; 1) the rhodopsin knockout (rho-/-) was bred into
the rds-/- background to create rho-/-/rds-/- double knockout mice, and 2) knock-in
mice were generated expressing a chimeric protein comprising the body of ROM-1
and the RDS C-terminus (RRCT) in the RDS genetic locus. Retinal structure and
function were analyzed by ERG, light and electron microscopy, and
immunofluorescence; while complex formation was analyzed by
immunoprecipitation and velocity sedimentation.
Results: In contrast to rds-/- retinas in which ROM-1 is not detectable, rho-/-/rds-/retinas exhibit significant levels of ROM-1. ROM-1 is found at the tip of the
connecting cilium and is not retained in the inner segment. Furthermore, it forms
tetramers but not higher-order oligomeric complexes. However, rho-/-/rds-/photoreceptors exhibit no signs of OS disc formation in contrast to the rho-/-/rds+/+
in which nascent discs/rims are seen although no mature discs are formed. In
contrast, in mice homozygous for the RRCT allele, (i.e. two ROM-1 alleles, two
RRCT alleles, zero wild-type RDS), overall retinal structure is better than the rho-/-,
rho-/-/rds-/-, and rds-/-. RRCT mice exhibit very small grossly abnormal OSs that are
nonetheless characterized by swirls of disc/rim membrane and some visual
function. Both RRCT and ROM-1 proteins are found properly localized to the OS
in RRCT knock-in mice.
Conclusions: These results demonstrate that ROM-1 is stable and can
independently traffic to the OS in the absence of RDS. We also show that the
RRCT protein but not ROM-1 is capable of initiating OS disc formation. This
suggests 1) that the RDS C-terminus is required for the initiation of disc formation
while the body of RDS and RDS oligomerization are required for proper disc
maturation, and 2) that ROM-1, which cannot form higher-order oligomers, can
promote neither of these steps.
Commercial Relationships: Shannon M. Conley, None; Dibyendu
Chakraborty, None; Muna I. Naash, None
Support: This work was supported by grants from the National Institutes of Health
[EY10609 (M.I.N.), EY018656 (M.I.N.) and EY018512 (S.M.C.)], Core Grant for
Vision Research EY12190 (M.I.N.), the Foundation Fi
Program Number: 1633 Poster Board Number: A586
Presentation Time: 8:30 AM - 10:15 AM
Identification Of Rp1 Interacting Proteins Using In Vivo Affinity Purification
Approaches
Qin Liu, Eric A. Pierce. Ophthalmology, Massachusetts Eye and Ear Infirmary,
Harvard Medical School, Boston, MA.
Purpose: Mutations in the RP1 gene cause both dominant and recessive RP. So far,
the function of RP1 protein and the mechanism by which mutations in RP1 lead to
photoreceptor death remain elusive. In attempting to fully understand the function
of the Rp1 protein, we generated lines of transgenic mice that express Rp1 proteins
with N- and C- affinity purification epitopes. We then used affinity purification
methods to identify proteins that interact with Rp1 in vivo.
Methods: Using a BAC clone containing mouse Rp1 genomic DNA, we fused a
SF-TAP (Strep-tag II-FLAG) tag to the N- or C-terminus of the Rp1 coding
sequence to generate transgenic mice that express epitope-tagged versions of the
full-length Rp1 protein, N-TAP-Rp1 and C-TAP-Rp1. Retinas from both transgenic
mice and non-transgenic controls were extracted and affinity purified using antiflag antibody. The purified protein complexes were subjected to mass spectrometry
analyses and the components of the complex from both lines were compared to
generate the list of candidate Rp1 interacting proteins.
Results: Our data indicate that the N-TAP-Rp1 and C-TAP-Rp1 proteins localize
correctly to the axonemes of photoreceptor cells and function normally. A total of
14 proteins were detected in both N-TAP-Rp1 and C-TAP-Rp1 retinas, but not in
the wild type controls. Of those, Rp1l1 was the most abundant protein detected in
the complex. Of particular interest, we found several chaperone and co-chaperone
proteins in the Rp1 protein complex, including three members of Hsp70 family and
two bcl-2-associated athanogene (BAG) proteins.
Conclusions: We have identified several interacting proteins of Rp1 by TAP
approaches. Rp1l1 was previously reported to co-localize and interact with Rp1.
However, function of Rp1l1 protein in photoreceptor cells is not understood.
Chaperone proteins are reported to be widely distributed in the cilia and flagella,
and are potentially related to axonemal protein dynamics. Further evaluation of the
significance of the interactions between Rp1 and the candidate interacting proteins
identified to date is in progress.
Commercial Relationships: Qin Liu, None; Eric A. Pierce, None
Support: NEI (EY12910), the Foundation Fighting Blindness (BR-GE-0808-0545UPA), Research to Prevent Blindness, the Rosanne Silbermann Foundation
Program Number: 1634 Poster Board Number: A587
Presentation Time: 8:30 AM - 10:15 AM
A Self-complementary Y733F Capsid Mutant of AAV8 Prevents
Photoreceptor Degeneration and Restores Retinal Function in the Rd6 Mouse
Model of Retinitis Pigmentosa
Astra Dinculescu, Qiuhong Li, Wen-Tao Deng, Seok-Hong Min, Jianwen Liu,
Issam McDoom, William W. Hauswirth. Ophthalmology, University of Florida,
Gainesville, FL.
Purpose: The rd6 mouse is a natural model of an RPE-based autosomal recessive
retinal degeneration caused by a 4bp deletion in a splice donor site in the
membrane-type frizzled related protein Mfrp gene. Our goal was to test the effects
of gene therapy on the retinal structure and function in rd6 mice using either a
tyrosine-capsid mutant of serotype AAV8 (Y733F) or AAV2 quadruple
(Y272,444,500,730F) viral vectors.
Methods: One microliter (109 total vector genomes) of either scAAV8 (Y733F) or
scAAV2 quadruple (Y272,444,500,730F) vector containing the small chicken βactin (smCBA) promoter driving the wild-type mouse Mfrp cDNA was delivered
subretinally to one eye of P14 rd6 mice, while contralateral eyes remained
Copyright 2012 by the Association for Research in Vision and Ophthalmology, Inc., all rights reserved. For permission to reproduce any abstract, contact the ARVO Office at pubs@arvo.org.
ARVO 2012 Annual Meeting Abstracts by Scientific Section/Group – Biochemistry/Molecular Biology (BI)
uninjected. Retinal function in treated rd6 mice was assessed by full-field
electroretinography (ERG) at 6 weeks post-injection under scotopic (dark-adapted)
or photopic conditions. For morphological analysis, treated 2 month-old rd6 and
control eyes were processed for paraffin embedding, and stained with hematoxylin
and eosin. MFRP expression in treated eyes was evaluated by
immunohistochemistry and Western blot analysis.
Results: Treatment employing the self-complementary fast-acting tyrosine-capsid
mutant AAV8 (Y733F) vector provided superior rescue effects compared to the
scAAV2 quadruple vector, with both a- and b-wave ERG maximum amplitudes
restored to levels similar to wild-type. Both AAV vectors led to robust MFRP
expression predominantly in its normal location within the RPE apical membrane
and the entire length of its microvilli. Western blot analysis showed the presence of
an immunoreactive MFRP band in treated eyes only. Moreover, AAV-treated rd6
retinas had a greater number photoreceptor nuclei, and long, well-organized outer
segments, in contrast to untreated eyes, in which the outer segments were
shortened. The characteristic accumulation of the abnormal phagocytic cells in the
subretinal space was also prevented following treatment.
Conclusions: Subretinal delivery of wild-type mouse Mfrp gene at postnatal day
P14 as mediated by a tyrosine-capsid mutant scAAV8 (Y733F) vector can prevent
retinal degeneration in the rd6 mouse model of retinitis pigmentosa (RP).
Moreover, treatment has led to a significant improvement in both rod and cone
photoreceptor function, as assessed by electroretinography. This study indicates
that the rd6 mouse model can be useful for future proof of concept experiments on
RP caused by mutations in the MFRP gene.
Commercial Relationships: Astra Dinculescu, None; Qiuhong Li, None; WenTao Deng, None; Seok-Hong Min, None; Jianwen Liu, None; Issam McDoom,
None; William W. Hauswirth, AGTC, Inc. (P)
Support: EY021721, Macular Vision Research Foundation, Foundation Fighting
Blindness, and Research to Prevent Blindness, Inc.
cassette in third intron of Crx. However, DNH yields a more severe dominant
retinopathy than DNL. Our goal was to determine the mechanisms that modulate
severity and pathology of retinal disease in the Crx DNH and DNL mice and how
that will impact the design of therapeutic strategies.
Methods: The phenotypes of Crx DNH and DNL mice were characterized by
morphology (histology, immunohistochemistry), retinal function
(Electroretinogram), and gene expression (QRT-PCR, Microarray, Western Blot).
Results: Crx DNH mice have severely impaired rod and cone function by one
month of age and undergo rapid cone, slow rod degeneration. In contrast, DNL
mice have moderately impaired cone function and slightly impaired rod function
and undergo slow cone but no rod degeneration. Crx DNH also causes a stronger
reduction in CRX target gene expression. Interestingly, Crx DNH causes
overexpression of both the WT and mutant Crx alleles, indicating Crx’s
transcriptional regulation is disrupted in these mice. Crx DNL mice, however, have
normal Crx expression.
Conclusions: Crx DNH and DNL represent two distinct mouse models for
dominant Crx disease. We have found that the same DN mutation can cause disease
of different severity and pathology which correlated with the level of Crx
expression. This finding identifies a novel target for therapeutic intervention and
could greatly affect the design of appropriate therapeutic strategies.
Commercial Relationships: Nicholas M. Tran, None; Shiming Chen, None
Support: NIH EY012543, EY012543-10S (to SC), EY02687 (to WU-DOVS),
2T32EY013360-11 (to WU) , RBP-Wasserman Award (to SC), FFB-Indiv. Invest.
(to SC), Hope for Vision-Visionary Award (to SC)
Program Number: 1635 Poster Board Number: A588
Presentation Time: 8:30 AM - 10:15 AM
Characterization of Podocalyxin Like Protein 2 (PODXL2) in the Mouse
Retina
Shane M. Lince, Xun Sun, Oleg Bulgakov, Tiansen Li. Neurobiol-Neurodegnrtn &
Repair, NEI, Bethesda, MD.
Purpose: PODXL2 (also known as Endoglycan) is a protein closely related to
CD34 and podocalyxin. Recent studies have implicated PODXL2 in leukocyte
functions, while our own protein association assays have indicated potential
interactions with retinal proteins involved in the development of Usher Syndrome.
Little is currently known about this protein’s role in healthy retinal function. This
study seeks to determine the tissue expression pattern of PODXL2 and eludicate its
role in retinal function and maintenance using genetic mouse models.
Methods: We developed mutant lines of mice with VelociGene’s predesigned
construct (#10133) from the KOMP. Expression of PODXL2 mRNA and protein
was evaluated by RT-PCR, Immunoblotting, Immunofluorescence, and by
following a lacZ reporter gene embedded in the gene targeting construct. Retinal
function in the PODXl2 mice was assessed by ERG recordings.
Results: The knockout construct integration has been confirmed in PODXL2 -/mice, with several regions of the brain and retinal ganglion cells staining positive
for the construct’s reporter lacZ sequence. PODXL2 +/- mice breeding has
suggested that while -/- mice do survive, they survive less often than PODXL2 +/or +/+ mice. No disparity in retinal functionality has been detected by noninvasive
ERG evaluations done in mice up to two months of age.
Conclusions: Further molecular characterization of our -/- mice is needed to
evaluate the importance of PODXL2 expression in the mouse retina, to identify
splice variations in the PODXL2 gene, and to find if other PODXL2 protein family
members are able to compensate for loss of PODXL2 in PODXL2 -/- mice. These
results will help elucidate how PODXL2 contributes to retinal function and
degeneration and what retinal pathologies it may influence.
Commercial Relationships: Shane M. Lince, None; Xun Sun, None; Oleg
Bulgakov, None; Tiansen Li, None
Support: None
Program Number: 1637 Poster Board Number: A590
Presentation Time: 8:30 AM - 10:15 AM
Assessment of Visual Function and Retinal Structure Following Acute Light
Exposure in the Light Sensitive T4R Rhodopsin Mutant Dogs Retina
Simone Iwabe, Gustavo D. Aguirre, William Beltran. Clinical Studies, University
of Pennsylvania, Philadelphia, PA.
Purpose: To evaluate the effect of acute exposure to various intensities of white
light on visual behavior and retinal structure in rhodopsin (T4R RHO) mutant dogs.
Methods: Three homozygous T4R RHO mutant dogs were used in this study.
Following overnight dark adaptation, acute light exposure (LE) to bright white light
was done in the left eye while the contralateral right eye was shielded. Each of the
3 T4R RHO dogs had a single unilateral LE to a different dose of white light
(corneal irradiances: 0.1 mW/cm2, 0.5 mW/cm2 or 1 mW/cm2 for 1min). Visual
function prior to LE and at 24 hours, 2 weeks and 33 weeks post exposure was
assessed by objective vision testing in a 3.6 m long obstacle course. Corneal shields
were used to occlude vision from one eye, and test vision from the contralateral
eye. Transit time was measured under 7 ambient white light intensities: 0.003;
0.009; 0.03; 0.2; 1; 10 and 65 lux. Morphological retinal changes were evaluated by
non-invasive in vivo cSLO/sdOCT imaging before, 2 weeks and 33 weeks after
light exposure; as well as by histologic examination at the end of the study.
Results: T4R mutant dogs were analyzed individually. The T4R retina exposed to
the lowest dose (0.1 mW/cm2 for 1 min) of white light showed no significant
changes in ONL thickness at 2 weeks, but a 25% decrease at 33 weeks post LE.
The T4R retinas that received medium (0.5 mW/cm2 for 1 min) and high (1
mW/cm2 for 1 min) doses showed an 88% and 91.8% decrease in ONL thickness,
respectively, by 2 weeks after LE. However, no differences in transit time through
the obstacle course were observed in any of the dogs at 2 weeks and 33 weeks post
LE under the 7 ambient light intensities.
Conclusions: A short single exposure to medium and high doses of white light
causes severe loss of ONL in the central/mid peripheral T4R RHO retina. However,
this severe loss of photoreceptors does not affect visual behavior probably because
intact peripheral photoreceptors are sufficient for visual function in the obstacle
course.. On-going studies are aimed at optimizing this light damage paradigm by
using brighter and longer light exposures. This could be useful to assess the
outcome of therapeutic intervention.
Commercial Relationships: Simone Iwabe, None; Gustavo D. Aguirre,
None; William Beltran, None
Support: NIH/NEI EY06855, EY17549, 2PNEY018241, R24EY021126, FFB
Program Number: 1636 Poster Board Number: A589
Presentation Time: 8:30 AM - 10:15 AM
Crx Overexpression Identified in a Knock-IN Mouse Model for Severe Forms
of Crx-Associated Disease
Nicholas M. Tran, Shiming Chen. Molecul Genetics & Genomics, Washington
Univ in St Louis, St Louis, MO.
Purpose: Mutations in the transcription factor CRX have been associated with
dominant retinal degeneration diseases of vastly different classification and severity
including Retinitis Pigmentosa (RP), Cone-Rod Dystrophy (CRD) and Leber’s
Congenital Amaurosis (LCA). To model distinct forms of disease, we have
established two Knock-IN Crx mutation mouse models, Dominant Negative Low
and High expression (DNL and DNH). DNL and DNH carry the same 2bp deletion
mutation that results in a truncated CRX protein that loses transactivation.
Genetically, DNL and DNH differ only in the presence or absence of a neomycin
Program Number: 1638 Poster Board Number: A591
Presentation Time: 8:30 AM - 10:15 AM
CrxRdy Cat: An Excellent Large Animal Model For Severe Dominant
Retinopathies Associated With CRX Mutations Based On Its Functional And
Structural Characterization
Laurence M. Occelli1, Nicholas M. Tran2, Freya M. Mowat1, Kara R. Gornik1,
Joshua T. Bartoe1, Andrea L. Minella1, Ashlee R. Bruewer1, Kristina Narfstrom3,
Shiming Chen2, Simon M. Petersen-Jones1. 1Small Animal Clinical Sciences,
Michigan State University, East Lansing, MI; 2Ophthalmology and Visual
Sciences, Washington University School of Medicine. St. Louis, St Louis, MO;
3
Dept of Vet Med & Surgery, University of Missouri-Columbia, Columbia, MO.
Purpose: CRX is a photoreceptor transcription factor essential for normal
photoreceptor development and survival. The CrxRdy cat model has a spontaneous
mutation in Crx resulting in dysfunction and degeneration of photoreceptors. The
Copyright 2012 by the Association for Research in Vision and Ophthalmology, Inc., all rights reserved. For permission to reproduce any abstract, contact the ARVO Office at pubs@arvo.org.
ARVO 2012 Annual Meeting Abstracts by Scientific Section/Group – Biochemistry/Molecular Biology (BI)
purpose of this study was to further investigate the phenotype of the CrxRdy cat at
the cellular and molecular levels.
Methods: Heterozygous CrxRdy cats were investigated by ophthalmic examination,
fundus photography, electroretinography (ERG) and optical coherence tomography
(OCT). Retinal gene expression changes were assessed by immunohistochemistry
(IHC) and QRT-PCR.
Results: Heterozygous CrxRdy kittens showed severe vision deficits, developed
ophthalmoscopically detectable changes in the area centralis by 7 weeks and
showed generalized retinal thinning and vascular attenuation by 12 weeks of age.
ERGs of the affected kittens were very reduced in amplitude and increased in
latency, and could not be recorded before 6 weeks of age and were extinguished by
about 20 weeks of age. OCT showed a progressive thinning of the outer nuclear
layer (ONL) and combined inner/outer segment layer (IS/OS). This was more
pronounced in the area centralis with an approximately 50% decrease in ONL and
IS/OS thickness compared to normal by 7 weeks of age. The inner segment/outer
segment junction was indistinct on OCT in the affected kittens. IHC at 6 weeks of
age showed that CrxRdy kittens had thinning of the ONL and stunting of the
photoreceptor inner and outer segments. QRT-PCR in 6-week and 20-week-old
CrxRdy kittens revealed significantly decreased expression of cone and rod opsins
with a more severe and earlier decrease in cone opsins. Interestingly, the expression
of Crx itself appeared to be elevated, similar to that observed in CrxDNH mouse
model (see abstract by Tran and Chen), suggesting a possible mechanism for
pathogenesis.
Conclusions: CrxRdy kittens have a severe cone-rod dystrophy characterized by
failure to develop normal photoreceptor structure and function followed by a rapid
photoreceptor degeneration. The CrxRdy cat represents a valuable model for the
severe dominant forms of human CRX retinal dystrophies.
Commercial Relationships: Laurence M. Occelli, None; Nicholas M. Tran,
None; Freya M. Mowat, None; Kara R. Gornik, None; Joshua T. Bartoe,
None; Andrea L. Minella, None; Ashlee R. Bruewer, None; Kristina Narfstrom,
None; Shiming Chen, None; Simon M. Petersen-Jones, None
Support: Myers-Dunlap Endowment, NIH EY012543 (to SC), EY02687 and T32
Pre-doctoral Training Grant (to WU) , RBP, FFB and Hope for Vision grants (to
SC)
Program Number: 1639 Poster Board Number: A592
Presentation Time: 8:30 AM - 10:15 AM
Targeted Disruption of Mouse Ortholog (Spata7) of LCA3 Gene Causes Outer
Segment Dysplasia, and Progressive Photoreceptor Degeneration Triggered by
Rhodopsin Mislocalization
Abuduaini Abulimiti1A, Qian Ding2, Huidan Xu1A, David Simons1B, Yalda MoayediEsfahani1C, Lin Gan2, Samuel Wu1B, David Williams3, Graeme Mardon1D, Rui
Chen1A. AHuman Genome Sequencing Ctr, BOphthalmology, CNeuroscience,
D
Pathology, 1Baylor College of Medicine, Houston, TX; 2School of Medicine and
Dentistry, University of Rochester, Rochester, NY; 3Jules Stein Eye Institute,
UCLA David Geffen School of Medicine, Los Angeles, CA.
Purpose: LCA is a set of inherited, early onset retinopathies that affect about 1 in
50,000 in the general U.S. population and accounts for more than 5% of all retinal
dystrophies. We recently identified the causative gene associated with the LCA3
locus, named SPATA7, which encodes a highly conserved but novel protein of
unknown function and for which no animal models have been established.
Interestingly, SPATA7 mutations are associated with both LCA and retinitis
pigmentosa (RP), suggesting that a detailed understanding of SPATA7 function
could have broad implications for our ability to diagnose, prevent, and treat human
retinal diseases. To characterize the function of SPATA7, we have generated
homozygous null alleles of mouse Spata7.
Methods: We have generated homozygous knock-out mice using Cre-LoxP system
Results: The phenotype of Spata7 mutant mice resembles the human LCA disease.
In Spata7 knockout mice, progressive photoreceptor degeneration is observed over
a period of 1 year due to cell apoptosis. Furthermore, light and electron
microscopic analysis reveals that the outer segment of rods and cones were
morphologically abnormal and disorganized in Spata7 mutant retina. Prior to
apoptosis, Rhodopsin is mislocalized in the inner segment and cell bodies of Spata7
mutant photoreceptors as demonstrated by immune EM assay and immunohistochemistry. Consistent with this observation, reduced rod Opsin expression
partially rescued the Spata7 mutant phenotype, as measured by retinal
morphometry, H&E staining and apoptosis assay.
Conclusions: Our findings suggest that Spata7 is likely to play an important role in
proper Rhodopsin transportation to the outer segment. Further studies of the
molecular mechanism of this process using Spata7 mutant mice as a model will
likely to provide important insights into LCA disease pathology, an essential step
for designing effective therapeutic approaches for this disease.
Commercial Relationships: Abuduaini Abulimiti, None; Qian Ding,
None; Huidan Xu, None; David Simons, None; Yalda Moayedi-Esfahani,
None; Lin Gan, None; Samuel Wu, None; David Williams, None; Graeme
Mardon, None; Rui Chen, None
Support: None
Program Number: 1640 Poster Board Number: A593
Presentation Time: 8:30 AM - 10:15 AM
Creation of a Macular Telangiectasia Rodent Model
Fakhra I. Khalid1, Leah C. Byrne2, Trevor Lee1, John G. Flannery1. 1Helen Wills
Neuroscience Institute, University of California, Berkeley, Berkeley, CA;
2
Neuroscience, UC Berkeley, Berkeley, CA.
Purpose: To create a rodent model for Type II Macular telangiectasia (MacTel), a
retinal disease characterized by vascular leakage, proliferation of blood vessels, the
formation of cavities and the loss of visual acuity. The disease pathogenesis is
poorly understood. We hypothesize that MacTel’s pathogenesis could involve the
demise of Müller cells, the primary glial cell type in the retina.
Methods: To test this hypothesis, we constructed a plasmid containing the
KillerRed gene downstream of a viral CAG promoter. KillerRed is a fluorescent
protein whose toxicity is inducible. We then packaged it into the ShH10-Y445F
adeno-associated virus, a novel variant of AAV6 with high infection specificity for
retinal Müller cells, and delivered it intravitreally to four mice, using ShH10
packaged with GFP as a control. After regulated sessions of irradiation with green
light, we compared the KillerRed-treated eye with the control using optical
coherence tomography (OCT), electroretinography (ERG), fluorescein
angiography, and visualization of retinal vasculature with a lipophilic carbocyanide
dye.
Results: When we transfected the KillerRed plasmid into Müller cell culture and
Hek293 T cell culture, irradiation with bright green light results in cell death after
twenty minutes, compared to no cell death when transfected with GFP. KillerRed
expression has been confirmed in rodents’ eyes with cryosectioning and histology.
In eyes injected with KillerRed, OCT data indicates retinal thinning and structural
damage, while ERG data suggests compromised light transduction.
Conclusions: Preliminary results indicate that eliminating Muller cells in the retina
results in damage to the retina’s structure and visual acuity. Further research is
needed to determine effects of KillerRed on the retina’s vasculature.
Commercial Relationships: Fakhra I. Khalid, None; Leah C. Byrne,
None; Trevor Lee, None; John G. Flannery, None
Support: NIH Grant EY016994, The Foundation for Fighting Blindness
253 Retinal Disease Genes
Monday, May 7, 2012, 1:45 PM - 3:30 PM
Palm A Paper Session
Program #/Board # Range: 1728-1734
Organizing Section: Biochemistry/Molecular Biology
Contributing Section(s): Genetics Group
Program Number: 1728
Presentation Time: 1:45 PM - 2:00 PM
Recurrent Mutation in IGFPB7 Causes Upregulation of Raf Ras MEK ERK
Pathway and Familial Retinal Artery Macroaneurysm
Leen J. Abu Safieh1A, Hisham Alkuraya1A, Emad Abboud1A, Hanan Shamseldin1A,
Shamsa Al-Enzi1A, Lama Al-Abdi1A, Mais Hashem1A, Dilek Colak1B, Abdullah
Jarallah2, Hala Ahmad1. ADepartment of Genetics, BDepartment of Biostatistics,
1
Rsch Ctr, MBC# 03, KFSH&RC, Riyadh, Saudi Arabia; 2American University of
Beirut, Beirut, Lebanon.
Purpose: Aim of this study is to identify the genetic defect that causes the novel
Familial Retinal Artery Macroaneurysm or FRAM.
Methods: Linkage analysis and homozygosity mapping using the 250K affymetrix
chip were used to map the loci for FRAM in 5 consanguineous families. Direct
sequencing of genes in the critical genetic interval resulted in identifying the
disease causing gene in the IGFBP7. Western blot analysis and insitu experiments
were further used to confirm the effect of the mutation on the proteint level and
establish the expression pattern of the gene in mouse emberyos.
Results: Splicing mutation in IGFBP7 is found to be cuasing the novel FRAM
phenotype.
Conclusions: Insulin-like growth factor binding proteins (IGFBP) play important
physiological functions through the modulation of IGF signaling as well as IGFindependent mechanisms. Despite the established role of IGFs in development, a
similar role by the seven known IGFBPs has not been established in humans. Here,
we show that an autosomal recessive syndrome that consists of progressive retinal
artery macroaneurysms and supravalvular pulmonic stenosis is caused by a
recurrent mutation in IGFBP7. Consistent with the recently established inhibitory
role of IGFBP7 on BRAF, these patients have upregulation of the
Ras/Raf/MEK/ERK pathway which may explain the overlapping cardiac phenotype
with other disorders characterized by germline mutations in this pathway. The
retinal phenotype appears to be mediated by a role in vascular endothelim where
IGFBP7 is highly expressed. This is the first established developmental disorder in
humans caused by mutation in an IGFBP.
Commercial Relationships: Leen J. Abu Safieh, None; Hisham Alkuraya,
None; Emad Abboud, None; Hanan Shamseldin, None; Shamsa Al-Enzi,
None; Lama Al-Abdi, None; Mais Hashem, None; Dilek Colak, None; Abdullah
Jarallah, None; Hala Ahmad, None
Support: None
Copyright 2012 by the Association for Research in Vision and Ophthalmology, Inc., all rights reserved. For permission to reproduce any abstract, contact the ARVO Office at pubs@arvo.org.
ARVO 2012 Annual Meeting Abstracts by Scientific Section/Group – Biochemistry/Molecular Biology (BI)
Program Number: 1729
Presentation Time: 2:00 PM - 2:15 PM
Mutations In A Novel Gene, GPR179 Lead To Autosomal Recessive Complete
Congenital Stationary Night Blindness
Christina Zeitz1, Kinga Bujakowska1, Elise Orhan1, Jose-Alain Sahel2,3, Shomi S.
Bhattacharya1,3, Isabelle Audo1,3, CSNB study group. 1Institut de la
Vision/INSERM/UPMC Univ Paris 06/CNRS/CHNO des Quinze-Vingts, Paris,
France; 2Institut de la Vision/INSERM/UPMC Univ Paris 06/CNRS/CHNO des
Quinze-Vingts, Fondation Ophtalmologique Adolphe de Rothschild, Académie des
Sciences Institut de France, Paris, France; 3Institute of Ophthalmology, University
College of London, London, United Kingdom.
Purpose: Mutations in the genes NYX, GRM6 and TRPM1, expressed in ONbipolar cells, lead to a disruption of the ON-bipolar response and subsequently
night blindness. This dysfunction is present in patients with complete congenital
stationary night blindness (cCSNB), a very significant human disease. Although
many cases of complete CSNB are caused by mutations in NYX, GRM6 and
TRPM1, in ~20% of the patients the genetic defects remain unknown. Here we
sought to identify disease-causing mutations in the remaining patients by whole
exome sequencing.
Methods: Whole exome sequencing was applied to two affected siblings and the
parents of one consanguineous autosomal recessive family and one simplex patient
with cCSNB previously excluded for mutations in NYX, GRM6 and TRPM1 by
Sanger sequencing. Transcriptomic, tissue specific and prediction databases were
used to define the most promising candidate gene. In addition, Sanger sequencing
in other CSNB patients was performed. Real time PCR, RNA in situ hybridization
and immunolocalization studies by confocal microscopy were used to localize the
respective transcript and protein. 3D-modelling was performed to predict the
pathogenic influence of the missense mutations.
Results: Whole exome sequencing led to the identification of a homozygous
missense mutation (c.1807C>T, p.His603Tyr) and a homozygous frameshift
mutation (c.278delC, p.Pro93Glnfs*57) in a novel gene, GPR179. Screening using
Sanger sequencing of 40 patients identified 3 additional cCSNB cases harboring
compound heterozygous mutations in this gene. The gene is predicted to code for a
G-protein coupled orphan receptor. The identified missense mutations may alter
ligand binding. GPR179 is expressed in the inner retina and the respective protein
is predominantly located in horizontal and Müller cells.
Conclusions: Our studies identified a novel gene, GPR179 that is associated with
cCSNB. Although, RNA in situ hybridization and immunohistological studies
revealed inner nuclear layer and outer plexiform layer localization of the respective
Gpr179 transcript and protein, it seems not to co-localize with specific ON-bipolar
markers, but with horizontal and Müller cells. The involvement of these cells in
cCSNB and the specific function of this novel gene remain to be elucidated.
Commercial Relationships: Christina Zeitz, None; Kinga Bujakowska,
None; Elise Orhan, None; Jose-Alain Sahel, None; Shomi S. Bhattacharya,
None; Isabelle Audo, None
Support: Retina France - 100 exomes, GIS-maladies rares, Fondation Voir et
Entendre
Program Number: 1730
Presentation Time: 2:15 PM - 2:30 PM
Mutations in C8orf37, Encoding a Ciliary Protein, are Associated with
Autosomal Recessive Cone-Rod Dystrophy and Retinitis Pigmentosa with
Early Macular Involvement
Alejandro Estrada Cuzcano1A, Kornelia Neveling1A, Susanne Kohl2, Dror Sharon3,
Ygal Rotenstreich4, Ronald Roepman1A, Hans Scheffer1A, Anneke I. Den
Hollander1B, B J. Klevering1B, Frans P. Cremers1A. ADepartment of Human
Genetics, BOphthalmology, 1Radboud Univ Nijmegen Med Ctr, Nijmegen, The
Netherlands; 2Institute for Ophthalmic Research, Molecular Genetics Laboratory,
Tuebingen, Germany; 3Department of Ophthalmology, Hadassah-Hebrew Univ
Medical Ctr, Jerusalem, Israel; 4Goldscheleger Eye Research Institute, Tel Aviv
University, Tel Hashomer, Israel.
Purpose: Cone-rod dystrophy (CRD) and retinitis pigmentosa (RP) are clinically
and genetically overlapping heterogeneous retinal dystrophies. The purpose of this
study was to identify the cause of autosomal recessive (ar) RP and CRD.
Methods: Whole-genome homozygosity mapping was conducted in an individual
with arRP from a consanguineous family, we identified three sizeable homozygous
regions - together encompassing 46 Mb - which were analysed by next-generation
sequencing for all exons, flanking intron sequences, microRNAs, and other highly
conserved genomic elements.
Results: Next-generation sequencing in these three regions revealed a homozygous
nonsense mutation (c.497T>A; p.Leu166*) in C8orf37, located on chromosome
8q22.1. This mutation was not present in 150 ethnically matched control
individuals, single nucleotide polymorphism databases or the 1000 Genomes
database. Immunohistochemical studies revealed C8orf37 localization at the base of
the primary cilium of human retinal pigment epithelium cells and at the base of
connecting cilia of mouse photoreceptors. C8orf37 sequence analysis of individuals
with retinal dystrophy which carried conspicuously large homozygous regions
encompassing C8orf37 revealed a homozygous splice site mutation (c.156-2A>G)
in two siblings of a consanguineous family, and homozygous missense mutations
(p.Arg177Trp and p.Gln182Arg) in siblings of two other consanguineous families.
The missense mutations affect highly conserved amino acids, and in silico analyses
predicted that both variants are likely pathogenic. Clinical assessment revealed
CRD in four individuals, and RP with early macular involvement in two
individuals. The two CRD siblings with the c.156-2A>G mutation also showed
unilateral postaxial polydactyly.
Conclusions: These results underline the importance of disrupted ciliary processes
in the pathogenesis of retinal dystrophies and demonstrate the power of nextgeneration sequencing combined with homozygosity mapping to identify new
disease genes.
Commercial Relationships: Alejandro Estrada Cuzcano, None; Kornelia
Neveling, None; Susanne Kohl, None; Dror Sharon, None; Ygal Rotenstreich,
None; Ronald Roepman, None; Hans Scheffer, None; Anneke I. Den Hollander,
None; B. J. Klevering, None; Frans P. Cremers, None
Support: Radboud Univ Nijmegen Med Centre, FP7/2007-2013 under grant
agreement n° 223143; ZonMW grants 917-66-363, 911-08-025; BR-GE-05100489-RAD; BR-GE-0510-0490-HUJ
Program Number: 1731
Presentation Time: 2:30 PM - 2:45 PM
Identification of a new gene for Autosomal Recessive Retinitis Pigmentosa
(arRP)
Razek Georges Coussa1A,1B, Huanan Ren1A,1B, Irma Lopez1A,1B, Vafa Keser1A,1B,
Jeremy Schwartzentruber2A,2B, Edgar A. Otto3, Heon-Yung Gee3, Jacek
Majewski2A,2C, Friedhelm Hildebrandt3, Robert K. Koenekoop1B,1A. ADepartment of
Ophthalmology and Human Genetics, BMcGill Ocular Genetics Laboratory,
1
McGill University Health Centre, Montreal, QC, Canada; ADepartment of Human
Genetics, BGenome Quebec Innovation Center, CQuebec Innovation Center,
2
McGill University, Montreal, QC, Canada; 3Department of Pediatrics, University
of Michigan, Ann Arbor, MI.
Purpose: Retinitis pigmentosa (RP) is a severe, clinically and genetically
heterogeneous retinal disease that inexorably leads to blindness. Mutations in over
50 genes currently explain ~50% of patients. Our goal is to identify the remaining
RP genes. We identified a consanguineous French-Canadian family with arRP and
aimed to identify the causal gene.
Methods: We performed APEX (Asper Ophthalmics) technology to exclude ~500
arRP mutations in ~20 genes. Homozygosity mapping (by SNP genotyping), next
generation sequencing and exome capture and Sanger sequencing were used to
identify all the genetic variations in the family. We then use a pipeline approach,
combining co-segregation, retinal expression, exclusion from 500 normal controls
and known SNP changes to narrow down the number of variants. We then screened
an additional 150 RP patients and 100 more severe ciliopathy patients. The
phenotype was investigated using best-corrected visual acuity (VA), Goldmann
visual fields (GVF), slit-lamp biomicroscopy, funduscopy, ERG (Diagnosys LLC),
in-vivo retinal architecture (Heidelberg engineering), renal ultrasound and
biochemical studies.
Results: Initially, we identified a novel mutation in WDR19, p.L710S, c.2129T>C,
which cosegregates perfectly in 2 families. The residue is strictly conserved down
to Caenorhabditis elegans. WDR19 is a ciliary protein. We then discovered that
most of the probands developed renal cysts with normal kidney function. We then
hypothesized that more severe WDR19 mutations may lead to more severe
ciliopathy phenotypes. We subsequently found nonsense, splice site, missense and
frameshift mutations in WDR19 in patients with Senior-Loken disease
(p.L214FfsX5, c.407-2A>G, p.T261LfsX18, p.A30P, p.E103G, p.R272C and
p.G109E).
Conclusions: We have successfully identified a new gene for arRP and a new gene
for Senior Loken disease. We are currently investigating the full extent of the
mutation spectrum and severity. Our findings are crucial in expanding the current
understanding of childhood blindness and identifying new causal genes, new
proteins and novel retinal pathways. This work suggests novel avenues for
therapeutic interventions.
Commercial Relationships: Razek Georges Coussa, None; Huanan Ren,
None; Irma Lopez, None; Vafa Keser, None; Jeremy Schwartzentruber,
None; Edgar A. Otto, None; Heon-Yung Gee, None; Jacek Majewski,
None; Friedhelm Hildebrandt, None; Robert K. Koenekoop, None
Support: FFB-Canada, CIHR, FRSQ, NIH, Reseau Vision
Program Number: 1732
Presentation Time: 2:45 PM - 3:00 PM
FAM161A, Associated With Autosomal Recessive Retinitis Pigmentosa,
Localizes At The Level Of The Photoreceptor Cilium And Interacts With
Proteins Involved In Ciliopathies
Silvio Alessandro Di Gioia1, Corinne Kostic2, Stef J.F. Letteboer3, Lisette
Hetterschijt3, Yvan Arsenijevic2, Ronald Roepman3, Carlo Rivolta1. 1Department of
Medical Genetics, University of Lausanne, Lausanne, Switzerland; 2Unit of Gene
Therapy & Stem Cell Biology, Jules-Gonin Eye Hospital, University of Lausanne,
Lausanne, Switzerland; 3Department of Human Genetics and Nijmegen Centre for
Copyright 2012 by the Association for Research in Vision and Ophthalmology, Inc., all rights reserved. For permission to reproduce any abstract, contact the ARVO Office at pubs@arvo.org.
ARVO 2012 Annual Meeting Abstracts by Scientific Section/Group – Biochemistry/Molecular Biology (BI)
Molecular Life Sciences, Radboud University Nijmegen Medical Center,
Nijmegen, The Netherlands.
Purpose: We have previously demonstrated that mutations in the FAM161A gene,
encoding a protein with unknown function and no similarities with other
characterized sequences, cause autosomal recessive retinitis pigmentosa (RP). The
purpose of this work is to investigate the functional role of FAM161A within the
retina and its relationship with other proteins involved in RP.
Methods: The subcellular localization of FAM161A in the retina was assessed by
immunohistochemistry of retinal sections and dissociated photoreceptors from
mice, which were stained using antibodies against FAM161A and antibodies
against cilium markers. The function of FAM161A was further assessed in ciliated
mammalian cell lines by expression of recombinant FAM161A with various fusion
tags. The binary interaction between FAM161A and a collection of ciliary and
ciliopathy-associated proteins was analyzed using a yeast two-hybrid assay. The
results obtained with this technique were validated using independent proteinprotein interaction assays (GST-pull downs, co-transfection and coimmunoprecipitation).
Results: Native FAM161A localized at the connecting cilium of photoreceptor
cells, as demonstrated by immunofluorescence in both dissociated photoreceptors
and retinal sections of mice. More specifically, co-staining with markers for ciliary
sub-structures (RPGRIP1L, Centrin, RP1, GT335) demonstrated that FAM161A
decorated the basal body and the very apical part of the connecting cilium. Upon
overexpression in ciliated cultured mammalian cells, FAM161A localized to the
ciliary basal body. Yeast two-hybrid analysis of the binary interaction of
FAM161A and an array of ciliary proteins revealed the direct interaction of
FAM161A with three proteins of which the cognate genes are mutated in retinal
ciliopathies. The confirmation of these interactions using different biochemical
assays is currently in progress.
Conclusions: FAM161A is a ciliary basal body protein of the photoreceptor
connecting cilium, rendering the associated RP as a novel retinal ciliopathy. The
confined expression of FAM161A in the retina and the direct interaction of
FAM161A with other retinal ciliopathy-associated proteins may explain the retinal
phenotype of this specific subset of mechanistically and phenotypically connected
retinal disorders.
Commercial Relationships: Silvio Alessandro Di Gioia, None; Corinne Kostic,
None; Stef J.F. Letteboer, None; Lisette Hetterschijt, None; Yvan Arsenijevic,
None; Ronald Roepman, None; Carlo Rivolta, None
Support: Swiss National Science Foundation (320030-121929) ; The European
Community's Seventh Framework Programme FP7/2009 under grant agreement no:
241955, SYSCILIA.
Program Number: 1733
Presentation Time: 3:00 PM - 3:15 PM
Mutations In Lca9 Cause Human Congenital Blindness Due To Leber
Congenital Amaurosis
Irma Lopez-Solache1, Robert K. Koenekoop1, Huanan Ren1, Vafa Keser1, Qing Fu1,
Mohamed A. Genead2, Gerry Fishman2, Elias I. Traboulsi3, Hui Wang4, Rui Chen4.
1
McGill Ocular Genetics Laboratory, McGill University Health Centre, Montreal,
QC, Canada; 2Ophthalmology and Visual Sciences, University of Illinois at
Chicago, Chicago, IL; 3Center for Genetic Eye Diseases, Cole Eye Institute,
Cleveland, OH; 4Molecular and Human Genetics, Baylor College of Medicine,
Houston, TX.
Purpose: Leber Congenital Amaurosis (LCA) represents the most severe form of
human inherited retinal dystrophies with photoreceptor neuron degeneration and
blindness with an incidence of ~1 in 80,000. Genetically and clinically
heterogeneous, 16 mutant genes are thus far implicated in LCA, explaining 70% of
patients, while their encoded proteins range in function from ciliary transport to
photoreceptor development. The goal of our studies are to identify novel
LCA disease genes underlying the 30% of unsettled LCA patients, which is likely
to provide important insights of the mechanisms of the disease.
Methods: A whole exome sequencing approach was used to sequence a collection
of 50 LCA patients. Candidate genes identified were then further confirmed by
disease segregation, additional patient cohort screen, comparing to matching
controls, and functional studies.
Results: Using exome sequencing, we identified mutations in LCA9 in 7 families
with LCA. Interestingly, in addition to the typical LCA phenotypes, all patients
shared macular colobomas, a developmental abnormality with an absent fovea (a
metabolically active tissue) and neurons, suggesting that LCA9 may be involved in
early foveal and retinal development. Follow up functional assays of the mutations
identified in our study indicated that these mutations impair the enzymatic activity
and/or destabilize the protein. In situ mutagenesis experiments of selected LCA9
mutations found in our patients revealed abnormal protein expression.
Conclusions: We have identified LCA9 as a novel LCA disease gene. LCA9 maps
to 1p36 and patients with LCA9 mutations share a similar phenotype with the
original LCA9 locus patients in the original linkage study by Keen et al, 2011 in a
large Pakistani family. Our findings not only provide insights into a new disease
mechanism for LCA but also establish the first link between LCA9 and a human
nervous system disease.
Commercial Relationships: Irma Lopez-Solache, None; Robert K. Koenekoop,
None; Huanan Ren, None; Vafa Keser, None; Qing Fu, None; Mohamed A.
Genead, None; Gerry Fishman, None; Elias I. Traboulsi, None; Hui Wang,
None; Rui Chen, None
Support: FFB-Canada, CIHR, FRSQ, NIH, Reseau Vision (RKK)
Program Number: 1734
Presentation Time: 3:15 PM - 3:30 PM
Polymorphic Variation In The Expression Of CNOT3 Determines The
Penetrance Of PRPF31 Mutations In Autosomal Dominant Retinitis
Pigmentosa
Giulia Venturini1, Shomi S. Bhattacharya2, Carlo Rivolta1. 1Department of Medical
Genetics, University of Lausanne, Lausanne, Switzerland; 2UCL Inst of
Ophthalmology, University College London, London, United Kingdom.
Purpose: Within the same family, mutations in the PRPF31 gene can cause typical
autosomal dominant retinitis pigmentosa (adRP) or otherwise produce no
symptoms at all. We have previously shown that this incomplete penetrance is
determined by at least one modifier gene, which has the power of increasing
PRPF31 mRNA expression and therefore protect some individuals from
developing the disease. Our aim is to identify the molecular nature of the most
effective of these modifiers, found by linkage analysis to lie on chromosome
19q13.4, and understand its mode of action.
Methods: We studied 15 members of a large family with adRP (AD5), which
segregates an 11-bp deletion in exon 11 of PRPF31. Gene expression analysis was
performed by qPCR. Silencing experiments were performed in HeLa and ARPE-19
cells by the use of synthetic siRNA. Chromatin immunoprecipitation was
performed on lymphoblastoid cell lines. Direct DNA sequencing was performed by
Next-Generation Sequencing.
Results: Gene expression analyses in all LCLs from controls, asymptomatic and
symptomatic carriers of PRPF31 mutations was performed for ten candidate genes
lying within the 19q13.4 interval. Statistical tests revealed that expression of only
one of them, CNOT3, encoding a subunit of the Ccr4-not transcription complex,
significantly (p=0.005) and inversely correlated with that of PRPF31. Silencing of
CNOT3 in two different laboratory cell lines showed an increase of PRPF31
transcription, confirming the repressive nature of the CNOT3 protein on PRPF31.
Chromatin immunoprecipitation analysis showed that CNOT3 could directly bind
to the PRPF31 promoter. We are currently sequencing the full CNOT3 gene in
symptomatic and asymptomatic carriers of mutations to identify the polymorphic
DNA element that would directly determine its variable expression.
Conclusions: We ascertained that in asymptomatic carriers of PRPF31 mutations
CNOT3 is expressed at low levels, allowing higher amounts of wild-type PRPF31
transcripts to be produced and preventing retinal degeneration to manifest in these
individuals. Through this simple and direct mechanism, which likely depends on
the presence of polymorphic DNA variants in its own sequence, CNOT3 could
therefore represent the main regulator for penetrance of PRPF31 mutations.
Commercial Relationships: Giulia Venturini, None; Shomi S. Bhattacharya,
None; Carlo Rivolta, None
Support: Swiss National Science Foundation (320030-121929)
272 Lipids, Carotenoids and Retinoids in RPE/Retina
Monday, May 7, 2012, 3:45 PM - 5:30 PM
Floridian BCD Paper Session
Program #/Board # Range: 2213-2219
Organizing Section: Biochemistry/Molecular Biology
Program Number: 2213
Presentation Time: 3:45 PM - 4:00 PM
Primary Amines Protect The Retina From Degeneration In Mouse Models:
Implications For Stargardt’S Disease And Age-related Macular Degeneration
Akiko Maeda1A, Marcin Golczak1B, Yu Chen1B, Hideo Kohno1B, Grazyna
Palczewska2, Tadao Maeda1A, Krzysztof Palczewski1B. AOphthalmology,
B
Pharmacology, 1Case Western Reserve Univ, Cleveland, OH; 2Polgenix Inc.,
Cleveland, OH.
Purpose: All-trans-retinal (atRAL) is a photo-bleached visual chromophore, that
constitutes one of the major intermediates in the visual cycle. Delayed clearance of
atRAL from the retina in mice mimics human retinal disorders, indicating a pivotal
role for this molecule in the pathogenesis of blinding diseases. We tested the
hypothesis that transient sequestration of atRAL by amine drugs, which produce
Schiff base adducts, can ameliorate retinal degenerative changes in mice.
Methods: Primary amine-containing FDA-approved drugs were administered to
Abca4-/-Rdh8-/- mice with delayed clearance of atRAL that display light-induced
and age-related retinal degeneration. The efficacy and metabolism of these drugs
were examined by morphological and biochemical techniques.
Results: More than 60% of tested amine drugs transiently lowered peak plasma
concentrations of free atRAL and reduced retinal degeneration, and more than 40%
did not affect chromophore regeneration in mice. Schiff base adducts between
atRAL and these amines identified by mass spectrometry were observed in mouse
eyes only when an experimental drug protected the retina from light-induced and
age-related degeneration.
Copyright 2012 by the Association for Research in Vision and Ophthalmology, Inc., all rights reserved. For permission to reproduce any abstract, contact the ARVO Office at pubs@arvo.org.
ARVO 2012 Annual Meeting Abstracts by Scientific Section/Group – Biochemistry/Molecular Biology (BI)
Conclusions: This study demonstrates the molecular basis of atRAL-induced
retinal pathology and identifies a group of FDA-approved compounds that protect
against this pathology in a mouse model that displays features of Stargardt’s and
age-related retinal degeneration.
Commercial Relationships: Akiko Maeda, None; Marcin Golczak, None; Yu
Chen, None; Hideo Kohno, None; Grazyna Palczewska, None; Tadao Maeda,
None; Krzysztof Palczewski, None
Support: EY009339, EY021126, EY019031, EY019880, EY11373
Program Number: 2214
Presentation Time: 4:00 PM - 4:15 PM
Leukotriene Receptor Antagonism Reduces Early Diabetic Retinopathy in the
Mouse
Rose A. Gubitosi-Klug, Ramaprasad Talahalli. Pediatrics, Rainbow Babies & Child
Hosp/CWRU, Cleveland, OH.
Purpose: Chronic inflammation and oxidative stress are critical components in the
pathogenic cascade leading to capillary degeneration, the hallmark feature of early
diabetic retinopathy. Our prior investigations implicate the pro-inflammatory
leukotrienes as key mediators of retinal inflammation and oxidative stress in the
diabetic mouse. Indeed, diabetic mice genetically-deficient in leukotriene
generation are protected from capillary degeneration, yet it is not known whether
pharmacologic inhibition of the leukotriene cascade is therapeutically beneficial in
diabetic retinopathy. In this current study, we investigated the effects of
montelukast, a leukotriene receptor antagonist, on capillary degeneration in diabetic
mice.
Methods: Immediately following induction of diabetes using streptozotocin,
diabetic mice were administered montelukast (5mg/kg/day dissolved in drinking
water). Montelukast-treated mice were compared to untreated diabetic and nondiabetic mice with regard to the following parameters 1) retinal superoxide
production, 2) nuclear localization of the pro-inflammatory transcription factor
NFkB (p65 subunit) in retinal cells, 3) vascular permeability, 4) serum cytokine
expression, and 5) capillary degeneration.
Results: Administration of montelukast to diabetic mice resulted in the suppression
of retinal superoxide generation (p < 0.0001) and a 60% reduction in nuclear NFkB
(p65 subunit) levels when compared to retinas from untreated diabetic mice. (p <
0.05) Retinal vascular permeability, as measured in vivo by retinal accumulation of
perfused Evans Blue Dye, was significantly increased in untreated diabetic mice
(1.04 0.19 ul/g/h) compared to montelukast-treated mice (0.53 0.05 ul/g/h) and
non-diabetic mice (0.32 0.05 ul/g/h). (p< 0.0001) Increased serum VEGF levels
were detected in untreated diabetic mice, but not in non-diabetic or monteluasttreated diabetic mice. The isolated retinal microvasculature from untreated diabetic
mice demonstrated a nearly 3-fold increase in
capillary degeneration compared to nondiabetic mice. Remarkably, the number of
degenerate retinal capillaries fell 75% with montelukast treatment. (p < 0.0001)
Conclusions: Pharmacologic inhibition of the leukotriene pathway holds potential
as a novel therapy for prevention of diabetic retinopathy.
Commercial Relationships: Rose A. Gubitosi-Klug, None; Ramaprasad
Talahalli, None
Support: NEI, R01EY021535
Program Number: 2215
Presentation Time: 4:15 PM - 4:30 PM
Changes in Sphingolipid metabolism in the Vitreous from Diabetic Patients
Louis C. Glazer1,2A, Todd A. Lydic2B, Kelly McSorley2B, Gavin E. Reid2C, Susanne
Mohr2B, Julia V. Busik2B. 1Vitreo-Retinal Associates, Grand Rapids, MI;
A
Ophthalmology, BPhysiology, CChemistry, 2Michigan State University, East
Lansing, MI.
Purpose: We have previously demonstrated in type 1 and type 2 diabetes animal
models that upregulation of the central enzyme of sphingolipid metabolism, Acid
Sphingomyelinase (ASM) plays an important role in the pathogenesis of diabetic
retinopathy. ASM was upregulated in the retinas of donors with diabetic
retinopathy compared to control. Moreover, we have shown a dramatic
downregulation of long chain fatty acid elongases Elovl2 and Elovl4 in diabetic
retina. Elovl4 has recently been shown to play a major role in production of very
long chain fatty acids and in very long chain (≥C28) ceramide production in the
skin. This study was designed to determine changes in the sphingolipid profile in
the vitreous of diabetic patients.
Methods: Vitrectomy samples were obtained from diabetic patients with active
proliferative retinopathy (either vitreous hemorrhage or traction retinal detachment)
or non-diabetic patients treated for macular hole. Vitreous sphingolipids were
extracted with alkaline hydrolysis of gycerolipids, and sphingolipid profiles were
determined by tandem mass spectrometry using precursor ion scanning of m/z 264
on a Thermo TSQ Vantage triple quadrupole mass spectrometer. Sphingolipid
abundances were quantitated against appropriate internal standards.
Results: Vitreous samples from the patients with diabetic retinopathy had
increased ceramide, hexosylceramide and lactsylceramide levels. Interestingly,
sphingomyelin levels were also increased in diabetic retinopathy vitreous samples.
Detailed species analysis revealed that the increase in ceramide and sphingomyelin
is mainly due to a dramatic upregulation of 24:0 species with concomitant down
regulation of 26:0 and 28:0 species.
Conclusions: Diabetes induced changes in retinal sphingomyelinases and fatty acid
elongases leads to dramatic upregulation of sphingolipids in the vitreous mainly
due to accumulation of 24:0 species. Overall, our study indicates that changes in
sphingolipid metabolism play a role in the development of diabetic retinopathy.
Commercial Relationships: Louis C. Glazer, None; Todd A. Lydic,
None; Kelly McSorley, None; Gavin E. Reid, None; Susanne Mohr, None; Julia
V. Busik, None
Support: None
Program Number: 2216
Presentation Time: 4:30 PM - 4:45 PM
Spatial Distribution Of Lipid Molecular Species In Photoreceptors And Other
Cells By Maldi Imaging Mass Spectrometry Of The Human Retina
Nicolas G. Bazan1, Karin Z. Berry2, William C. Gordon1, Eric J. Knott1, Cornelius
E. Regan, Jr1, Robert C. Murphy2, Bok Kyoo Jun1. 1Ophthal & Neuroscience, LSU
Health Sciences Center, New Orleans, LA; 2Pharmacology, University of Colorado
Denver, Aurora, CO.
Purpose: To identify lipid species and their distribution within the human macula
by direct raster-like scans of histological sections while collecting data at each
point by imaging matrix-assisted laser desorption/ionization mass spectrometry
(MALDI IMS) to generate images of the location of specific lipids.
Methods: Sections of horizontal strips containing optic nerve and macular region
from human eyes were obtained. Some were H&E stained for orientation. After
matrix deposition, a quadrupole-TOF tandem mass spectrometer with an
orthogonal MALDI source (QSTAR XL, Applied Biosystems/MDS Sciex)
acquired images. MALDI mass spectra were obtained. Plates were scanned at 12.75
mm/min (vertical 50 µm shift, lateral resolution 50µm). Data were processed by
Analyst software and images visualized with TissueView. Collisional ion activation
occurred after MALDI imaging on the same section. LC-MS/MS analysis was
performed on central and peripheral retina to identify very long chain
polyunsaturated fatty acyl groups (VLC-PUFAs).
Results: MALDI IMS analysis of histological sections revealed differential
distribution of lipid species among eye tissues (e.g., fatty support tissues,
TAG(52:2)+Na; optic nerve, SM(18:1/18:0)+Na, PS(18:0/18:1), PE(18:0p/22:6);
inner retina, PC(34:1)+Na, PE(18:0p/22:6); photoreceptors, PC(40:6)+Na, PE
(18:0/22:6); RPE, Cer(18:1/18:0)-H2O)) and stratification (e.g., inner retina,
PC(48:11)+Na; photoreceptors, PC(40:6 & 56:11)+Na). MS analysis revealed more
PC-VLC-PUFAs within the central region, with 2-3 times as much 56 & 58 acyl
carbons (10-12 double bonds) in phospholipid species.
Conclusions: MALDI IMS revealed lipid stratification among photoreceptor and
inner retina layers, and in optic nerve and fatty support tissues. Phosphatidyl
choline species, especially those enriched in LC- and VLC-PUFAs, localize to the
photoreceptor layer; were more abundant in central retina. We have further used
conventional LC-MS/MS- based lipidomic analysis to characterize lipid molecular
species in macula as a function of aging and in degenerative diseases. The ability to
localize specific lipids to the micrometer level in a retinal section will lead to
identification of regional differences in lipid populations in both healthy and
diseased retinas.
Commercial Relationships: Nicolas G. Bazan, None; Karin Z. Berry,
None; William C. Gordon, None; Eric J. Knott, None; Cornelius E. Regan, Jr,
None; Robert C. Murphy, None; Bok Kyoo Jun, None
Support: NEI EY005121; Research to Prevent Blindness, Inc (NGB) and the
National Institutes of Health (Lipid Maps, GM 069338) (RCM).
Program Number: 2217
Presentation Time: 4:45 PM - 5:00 PM
Macular Pigment Optical Density and Glaucoma
Estera J. Igras1, Matthew Ratzlaff1, James Loughman2, Colm O Brien1.
1
Ophthalmology, Mater M University Hospital, Dublin, Ireland; 2Optometry,
Dublin Institute of Technology, Dublin, Ireland.
Purpose: Macular pigment (MP), expressed as macular pigment optical density
(MPOD), plays an important role in visual function and is implicated in the
protection of the retina from oxidative damage. It is not known whether glaucoma,
a progressive neurodegenerative disease of the optic nerve, is associated with
alterations in MP. We sought to assess whether MPOD is affected by glaucoma and
if so, does it correlate to glaucoma severity as judged by the extent of subjects`
visual field defects?
Methods: 40 subjects with glaucoma were recruited from a glaucoma clinic and
underwent a comprehensive eye examination including assessment of visual fields
using SITA-fast. Caregivers and those attending with the subjects, with normal
visual acuity and no history of eye disease, were recruited as normal controls (NC),
(n=54). For subjects and NC, the eye chosen was selected randomly. MPOD, at
0.50 of retinal eccentricity, was determined using heterochromatic flicker
photometry, measured using the Macular DensitometerTM. Visual field defects were
recorded as both median deviation (MD) and pattern standard deviation (PSD).
Glaucoma severity was classified using MD, into mild glaucoma (MD < -6 dB), or
moderate to severe (any readings > -6dB). The data was tested for normality with
the Shapiro-Wilk test. Most of the data was normally distributed and was analysed
Copyright 2012 by the Association for Research in Vision and Ophthalmology, Inc., all rights reserved. For permission to reproduce any abstract, contact the ARVO Office at pubs@arvo.org.
ARVO 2012 Annual Meeting Abstracts by Scientific Section/Group – Biochemistry/Molecular Biology (BI)
using student t- tests. Non normal data was analysed using a Mann-Whitney U test.
The Pearson correlation coefficient was used to determine correlation between
MPOD and the visual field scores.
Results: The mean age +/- standard deviation (SD), of subjects with glaucoma was
69 +/- 11 years compared to 66 +/- 10 years for NC. Mean MPOD (SD) for patients
with glaucoma was 0.275 (+/-0.25). Median MPOD (Interquartile range, IQR) was
0.36 (0.44) for NC. The difference in MPOD between the glaucoma cases and NC
was significant, (z= -2.158, p =0.031). Mean MPOD for those classed as mild
glaucoma was 0.325 (SD +/-0.27), n=12, compared to 0.254 (SD +/-0.24) for the
moderate to severe group, n=28, although this difference was not statistically
significant.(p =0.42). The Pearson correlation coefficient showed a non-significant,
weak correlation between MPOD and both MD (r =-0.1, p=0.6) and PSD, (r=0.16,
p=0.43).
Conclusions: These findings suggest that MP is reduced in patients with glaucoma.
The severity of glaucoma, as judged by the MD of visual field scores, did not
significantly affect MPOD. This is confirmed by a weak correlation between
overall MPOD and the extent of visual field defects. The median MPOD for NC
was consistent with levels published elsewhere. Further investigation is needed to
determine the significance of MP change and to assess what role therapeutic
strategies aimed at increasing MP levels could have in the management of
glaucoma.
Commercial Relationships: Estera J. Igras, None; Matthew Ratzlaff,
None; James Loughman, None; Colm O Brien, None
Support: None
Program Number: 2218
Presentation Time: 5:00 PM - 5:15 PM
Identification of the Vitamin A Isomerase in Retinal Müller Cells
Joanna J. Kaylor1, Quan Yuan1, Jeremy D. Cook2, Jacob Makshanoff1, Anh Miu1,
Tongzhou Xu1, Gabriel H. Travis3. 1Ophthalmology, UCLA-Jules Stein Eye
Institute, Los Angeles, CA; 2Ophthalmology, Jules Stein Eye Institute, Los
Angeles, CA; 3Jules Stein Eye Institute, UCLA School of Medicine, Los Angeles,
CA.
Purpose: The regeneration of visual chromophore involves an enzyme pathway
called the visual cycle. The retinoid isomerase in this pathway (Rpe65) converts a
fatty-acyl ester of all-trans-retinol to 11-cis-retinol. This visual cycle for the
regeneration of rhodopsin is well defined in RPE cells. However, several lines of
evidence suggest that cones regenerate visual pigments by a mechanism
independent of the RPE that occurs in the Müller cells of the retina. Prior work
from our laboratory indicated the existence of an isomerase (distinct from Rpe65)
in cone-dominant chicken and ground squirrel retinas that catalyzes the direct
conversion of all-trans-retinol to 11-cis-retinol. The enzyme responsible for this
activity, "isomerase-2", has not been identified. The goal of this research was to
identify and study isomerase-2.
Methods: A normalized chicken retina cDNA library was created using a
mammalian expression vector. Library pools were transfected into HEK 293T cells
and screened for isomerase-2 activity by in vitro homogenate assays using alltrans-retinol as substrate. Retinoids were extracted from assays with hexane and
high performance liquid chromotography (HPLC) was used to identify the
production of 11-cis-retinol by comparison with standards. Once a single clone was
identified multiple experimental techniques were used to characterize the enzyme.
These include gene expression (qRT-PCR and Western), immunocytochemistry,
coimmunoprecipitation, etc... Modulation of isomerase-2 activity in the presence of
other known retinoid processing enzymes (ie. CRALBP) was studied by both
transient and stable transfection of HEK 293T cells.
Results: Desaturase 1 (DES1) isolated from chicken retina by expression screening
has isomerase-2 activity as shown by its ability to directly isomerize all-transretinol to 11-cis-retinol. DES1 was expressed in the retinas of every species tested
(mouse, chicken, bovine, and human). DES1 clones from other species (mouse and
human) also had isomerase-2 activity. DES1 catalytic activity produces a
thermodynamic equilibrium mixture of cis-retinol products (9/11/13) from alltrans-retinol substrate. Immunocytochemistry of mouse retina revealed co-labelling
of DES1 with CRALBP, which is present in the Müller cells of the retina. Coimmunoprecipitation of DES1 revealed binding with CRALBP, an 11-cis-specific
retinoid binding protein. DES1 enzymatic activity in the presence of CRALBP was
more 11-cis-retinol specific.
Conclusions: Desaturase 1 (DES1) is expressed in the retina of all species studied
and has the unprecedented ability to directly isomerize Vitamin A retinol.
Commercial Relationships: Joanna J. Kaylor, None; Quan Yuan,
None; Jeremy D. Cook, None; Jacob Makshanoff, None; Anh Miu,
None; Tongzhou Xu, None; Gabriel H. Travis, None
Support: NIH/NEI
Program Number: 2219
Presentation Time: 5:15 PM - 5:30 PM
Structure of the Ligand-Binding Domain Suggests Novel Functions for
Interphotoreceptor Retinoid-Binding Protein (IRBP) in the Zebrafish Retina
Federico Gonzalez-Fernandez1,2, Molly Sprada1,2, Debashis Ghosh3. 1Research
Service, VAWNYHS, Amherst, NY; 2Ophthalmology and Pathology & Anatomic
Sciences, University at Buffalo/SUNY and SUNY Eye Institute, Buffalo, NY;
3
Pharmacology, SUNY Upstate Medical University, Syracuse, NY.
Purpose: Retinoid binding by IRBP may be regulated by fatty acids (Wolf. G Nutr.
Rev., Vol. 56, 1998). This regulation may be mediated through IRBP’s unusual 4
module structure. To reduce the complexity of the system, we examined zebrafish
IRBP (zIRBP), which consists of only 2 modules. The IRBP single-module
structural fold is evolutionally related to the crotonase/C-terminal peptidase
(Cptase) family, which possesses enzymatic activity in diverse settings.
Methods: zIRBP was expressed in E coli using pET-30 Xa/LIC. zIRBP was
expressed and purified by Ni2+-affinity and anion-exchange chromatography. Alltrans retinol binding was characterized by fluorescence spectroscopy. zIRBP was
crystallized by sitting-drop vapor diffusion. Solutions of zIRBP including selenomethionine derivatives in the presence of molar excesses of all-trans retinol and
oleic acid were mixed with the reservoir solutions of 35-44% PEG in 100mM
Hepes containing 100mM NaBr in the 1:1, 2:1 and 3:1 volume ratios and vapor
diffused against the reservoir solutions. The diffraction data was collected at the
Advanced Photon Source, Argonne, IL.
Results: Amino acid analysis confirmed the authenticity of zIRBP. Ligand binding:
fluorescence enhancement, N = 1.01 ± 0.06, Kd = 0.12 ± 0.04 µM; quenching, N =
0.81 ± 0.22, Kd = 0.23 ± 0.14 µM. Data sets at the selenium absorption edge peak
and a remote point were collected at 1.90Å and that at the inflection point were
gathered at 2.30Å. The structure was determined and refined at 1.90Å. The R-factor
for all reflections is 0.24 and the R-free value is 0.27. zIRBP was cleaved, possibly
by autocatalysis, between the modules during the crystallization process, and only
module 1 crystallized. The structure of holo-zIRBP was compared to the apoXenopus IRBP module 2 structure. Superposition shows that although the
structures of these two IRBPs are homologous, their N- and C-terminal domains are
shifted from one another. The e-density within the cavity is consistent with oleic
acid having a mobile carboxylate end. Interestingly, the second site, housing
residues similar to the structural homolog Cptase catalytic triad, is situated at the
interface of the observed domain movement.
Conclusions: Our data supports mutatgenesis studies assigning the ligand-binding
site to a hydrophobic cavity (Gonzalez-Fernandez et al. IVOS, Vol. 50. 2009).
Under our experimental conditions, the site probably favors oleic acid binding. The
altered inter-domain orientation suggests allostery between the two possible ligand
sites. Potential protease-like activity at the second site is currently under study.
Commercial Relationships: Federico Gonzalez-Fernandez, None; Molly
Sprada, None; Debashis Ghosh, None
Support: NIH/NEI grant EY09412 (D.G./F.G-F.), Veterans Affairs R&D Merit
Review Award I01BX007080 (F.G.-F.), and an Unrestricted Grant to the SUNY
Ross Eye Institute from Research to Prevent Blindness, Inc., N
286 Diabetic Retinopathy Genetics, Biochemistry and Molecular Biology
Monday, May 7, 2012, 3:45 PM - 5:30 PM
Hall B/C Poster Session
Program #/Board # Range: 2407-2439/A502-A534
Organizing Section: Biochemistry/Molecular Biology
Program Number: 2407 Poster Board Number: A502
Presentation Time: 3:45 PM - 5:30 PM
Normalization of Fatty Acid Elongase ELOVL4 In Diabetic Retina Prevents
Vascular Degeneration and Inflammation Through Modification of
Sphingolipid Metabolism
Matthew S. Faber1A, Todd A. Lydic1A, Maria Tikhonenko1A, Svetlana N. Bozack1A,
Sergey S. Seregin1B, Andrea Amalfitano1B, Vince A. Chiodo2, Sanford L. Boye2,
William W. Hauswirth2, Julia V. Busik1A. APhysiology, BMicrobiology and
Molecular Genetics, 1Michigan State University, Lansing, MI; 2Ophthalmology and
Molecular Genetics and Retina Gene Therapy Group, University of Florida,
Gainesville, FL.
Purpose: Fatty acid elongase ELOVL4 is the most abundant elongase in the retina,
and it synthesizes ≥ C26 saturated and polyunsaturated fatty acids (PUFA). We
have previously shown that dramatic diabetes-induced downregulation of ELOVL4
was associated with retinal-specific changes in lipid metabolism, retinal
inflammation and blood-retina barrier breakdown. The goal of this study is to
determine whether restoration of retinal ELOVL4 levels is sufficient to prevent
early diabetes induced retinal vascular degeneration.
Methods: Human ELOVL4 was overexpressed in human retinal pigmented
epithelial (RPE) cells by an E1- and E3-deleted adenoviral vector. Cells were
challenged with 1 ng/ml IL-1β or vehicle for 48 hours. ELOVL4 and ICAM-1
mRNA were assessed by qPCR. Lipid extracts were analyzed by tandem mass
spectrometry. Streptozotocin (STZ) diabetic rats received intravitreal injection of
hELOVL4 packaged in adeno-associated virus type 2 containing four capsid Y-F
mutations (AAV2 mut quad), or vehicle. Retinal vascular permeability was
assessed by measuring extravasation of FITC-albumin after 8 weeks of diabetes,
compared to controls.
Results: Overexpression of ELOVL4 in RPE cells caused a 45 % decrease in IL-1β
induced ICAM-1 mRNA expression relative to control. Intravitreal delivery of
hELOVL4-AAV2 mut quad in STZ diabetic rats resulted in a 39 % reduction in
diabetes-induced vascular permeability after 8 weeks of diabetes. Lipidome
Copyright 2012 by the Association for Research in Vision and Ophthalmology, Inc., all rights reserved. For permission to reproduce any abstract, contact the ARVO Office at pubs@arvo.org.
ARVO 2012 Annual Meeting Abstracts by Scientific Section/Group – Biochemistry/Molecular Biology (BI)
analysis of ELOVL4-overexpressing cells revealed a 2.5-fold increase in 26:0
ceramide relative to controls, while 16:0 ceramide decreased 1.7-fold; no effect on
≥ C26 PUFAs was observed in any lipid class.
Conclusions: Normalization of retinal ELOVL4 expression mitigates retinal
inflammation and prevents early breakdown of the blood-retina barrier in diabetic
animals by modulating retinal sphingolipid metabolism. Retinal gene delivery of
ELOVL4 by capsid-modified AAV2 may represent a novel strategy for the
prevention of diabetic visual impairment.
Commercial Relationships: Matthew S. Faber, None; Todd A. Lydic,
None; Maria Tikhonenko, None; Svetlana N. Bozack, None; Sergey S. Seregin,
None; Andrea Amalfitano, None; Vince A. Chiodo, None; Sanford L. Boye,
None; William W. Hauswirth, None; Julia V. Busik, None
Support: NIH Grant (EY-016077 to J.V.B., RR-025386 to G.E.R. and J.V.B)
MEAS (MICL02163 to J.V.B.)
Program Number: 2408 Poster Board Number: A503
Presentation Time: 3:45 PM - 5:30 PM
Systems Biology Analysis Of Metabolic Memory In Diabetic Retinopathy
Willard M. Freeman1A, Heather D. VanGuilder Starkey1A, Georgina V. Bixler1A,
Brian M. Davidson1A, Wendy Dunton1B, Sarah K. Bronson1B. APharmacology,
B
Cellular and Molecular Physiology, 1Penn State College of Medicine, Hershey,
PA.
Purpose: Diabetic retinopathy (DR) is a leading cause of blindness in working age
adults, and approximately 95% of patients with Type 1 diabetes develop some
degree of retinopathy despite normalization of blood glucose by insulin therapy.
The goal of this study was to test the hypothesis that a period of hyperglycemia
and/or loss of insulin signaling leads to molecular and anatomical retinal alterations
that are not normalized with insulin replacement and establishment of
normoglycemia.
Methods: To investigate the effects of 12 weeks of diabetes and variable insulin
replacement on the retina, diabetes was induced in male Sprague Dawley rats by
intraperitoneal streptozotocin injection. Following confirmation of hyperglycemia
(>250mg/dL), diabetic rats were assigned to one of three insulin-replacement
paradigms: 1) uncontrolled (no insulin replacement); 2) good control (insulin
replacement initiated after one week of hyperglycemia); or 3) poor control (insulin
replacement initiated after six weeks of hyperglycemia). Biochemical and
anatomical correlates of retinal neuroinflammation, including mRNA, miRNA, and
protein expression, synapse populations, and glial activation, were compared to
nondiabetic controls.
Results: Insulin replacement in both the good control and poor control groups
normalized blood glucose and glycated hemoglobin levels, which remained
significantly elevated in uncontrolled diabetic rats compared to nondiabetic
controls. The majority of mRNA, miRNA and proteins dysregulated in
uncontrolled diabetics, including markers of acute neuroinflammation and glial
activation, were brought to nondiabetic control levels in all insulin-treated rats.
Decreased synapse populations and expression of a subset of neuroinflammationrelated gene and protein targets remained altered in the poor control diabetic group,
suggesting that these changes can be prevented with good control, but are resistant
to reversal once established.
Conclusions: These results demonstrate that the majority of diabetes-induced
molecular, biochemical, and anatomical retinal alterations are prevented when
blood glucose normalization through insulin replacement is initiated soon after
diabetes onset, and can be reversed with insulin replacement even after a period of
uncontrolled hyperglycemia. Those changes that are not prevented or reversed by
insulin therapy, such as synapse loss, may contribute to the metabolic memory
phenotype and increase the risk of complications development even after patients
undergoing insulin-replacement therapy establish well-controlled diabetes
management.
Commercial Relationships: Willard M. Freeman, None; Heather D.
VanGuilder Starkey, None; Georgina V. Bixler, None; Brian M. Davidson,
None; Wendy Dunton, None; Sarah K. Bronson, None
Support: 1R01EY021716-01
Program Number: 2409 Poster Board Number: A504
Presentation Time: 3:45 PM - 5:30 PM
Identification of Target mRNAs for Significantly Altered miRNAs in Diabetic
Retinopathy
Raj P. Kandpal1,2, Harsha Rajasimha2, Matthew Brooks2, Jacob Nellissery2, Inhan
Lee3, Jun Wan4, Jiang Qian4, Timothy S. Kern5, Anand Swaroop2. 1Basic Medical
Sciences, Western University of Health Sciences, Pomona, CA; 2Neurobiology,
Neurodegeneration and Repair Laboratory, National Eye Institute, Bethesda, MD;
3
miRcore, Ann Arbor, MI; 4Ophthalmology, Johns Hopkins University School of
Medicine, Baltimore, MD; 5Medicine, Pharmacology and Ophthalmology, Case
Western Reserve University School of Medicine, Cleveland, OH.
Purpose: It is predicted that miRNAs may regulate the expression of
approximately 2/3rd of the genes encoded in the human genome. Thus, miRNAs are
likely to regulate important pathways involved in etiologies of various diseases.
Our goal is to generate global miRNA profiles from retinas of nondiabetic and
diabetic mice, and to identify target mRNAs for miRNAs that are significantly
altered in diabetic mice.
Methods: Mice were made diabetic for eight months by injecting streptozotocin for
5 days, and retinas were harvested from nondiabetic and diabetic mice. Total RNA
was isolated, and cDNA libraries corresponding to miRNAs were constructed. The
libraries were sequenced using the Illumina platform. The alignment of miRNA
sequence reads was carried out by GERALD analysis using ELAND algorithm.
The data were normalized and differential expression was calculated as ratios of
two samples. Alternatively, we applied SAM (significance analysis of microarrays)
to RNA sequence reads to determine changes in the abundance of miRNAs. The
significantly altered miRNAs were defined by false discovery rate of less than 50%
and absolute fold change of greater than 1.5. Target mRNAs for significantly
altered miRNAs were identified by using miBridge and mirFilter algorithms.
Results: The analytical strategies resulted in two sets of miRNAs that were
significantly altered in retinas from diabetic animals, and contained several
common miRNAs. Notable among the common miRNAs were miR-31 and miR184. While the target prediction programs such as PICTAR, MICROCOSM and
MIRANDA yield a large number of mRNA targets for a specific miRNA,
miBridge, a proprietary database that takes advantage of novel complementarities
between mRNAs and miRNAs, predicts a set of mRNAs with a low likelihood of
false positives. mirFilter, on the other hand, allows selection of miRNAs based on
changes in the abundance of target mRNAs. Using miBridge and mirFilter, we
have identified Dock5, Egr1, Islr, Slc24a6, Timp3 and Wnt7b as mRNA targets for
significantly altered miRNAs such as miR-181b, miR-1948, miR-543, miR690 and
miR-877.
Conclusions: Our results indicate the advantages of miBridge and mirFilter
algorithms for identifying an accurate set of mRNAs targeted by specific miRNAs
that are significantly altered in diabetic retinopathy. These analytical tools appear to
decrease the numbers of false positive target mRNAs for specific miRNAs.
Commercial Relationships: Raj P. Kandpal, None; Harsha Rajasimha,
None; Matthew Brooks, None; Jacob Nellissery, None; Inhan Lee, miRcore
(E); Jun Wan, None; Jiang Qian, None; Timothy S. Kern, None; Anand
Swaroop, None
Support: NEI Intramural Program, EY00300, Veterans Affairs, OneSight
Foundation
Program Number: 2410 Poster Board Number: A505
Presentation Time: 3:45 PM - 5:30 PM
Macrophage-Derived TGFβ Induces BIGH3 Secretion and Promotes
Apoptosis of Human Retinal Endothelial Cells
Kalpana Parvathaneni1, Albert A. Mondragon1, Mary M. Navarro1, Chi F. Lee2,
Hong S. Kim2, Richard G. LeBaron1, Reto Asmis2, Jeffery Grigsby1, Andrew T.
Tsin1. 1University of Texas at San Antonio, San Antonio, TX; 2University of Texas
Health Science Center at San Antonio, San Antonio, TX.
Purpose: Diabetic retinopathy (DR) is accompanied by infiltration of activated
macrophages and their secretion of TGFβ. TGFβ upregulates the expression of
TGFβ - Induced Gene Human Clone 3 (BIGH3). BIGH3 is an extracellular matrix
molecule that causes apoptosis of retinal microvascular cells. Apoptosis of these
cells leads to leakage and vessel destruction leading to hypoxia which triggers
angiogenesis an important pathological event in DR.
Methods: Immunohistochemistry (IHC) was performed to compare levels of
BIGH3 in the eyes of healthy control and diabetic mice. We studied BIGH3
expression by qPCR and protein upregulation by Western blot using Rhesus retinal
endothelial cells (RhREC). This was studied in response to exogenous TGFβ and
conditioned media from macrophages cultured in either regular culture media
(MCM) or culture media containing high glucose and high LDL (dMCM).
Apoptosis of RhREC by recombinant BIGH3, exogenous TGFβ or dMCM were
measured using TUNEL assay.
Results: IHC showed increased macrophage infiltration and BIGH3 localization in
eyes from diabetic mice as compared with the eyes from normal mice. BIGH3
expression was increased in RhREC in response to dMCM and BIGH3 protein was
increased with TGFβ. Recombinant BIGH3 induced apoptosis in RhREC after 24
hrs. BIGH3 antibody was able to negate this effect. TGFβ and dMCM after 48 hrs
caused apoptosis.
Conclusions: We found that TGFβ upregulates BIGH3 expression and secretion by
RhREC, and that BIGH3 leads to increased apoptosis in an auto- and paracrine
manner. This mechanism may contribute to the initial microvascular damage that
occurs during the onset of DR.
Commercial Relationships: Kalpana Parvathaneni, None; Albert A.
Mondragon, None; Mary M. Navarro, None; Chi F. Lee, None; Hong S. Kim,
None; Richard G. LeBaron, None; Reto Asmis, None; Jeffery Grigsby,
None; Andrew T. Tsin, None
Support: San Antonio Life Sciences Institute
Program Number: 2411 Poster Board Number: A506
Presentation Time: 3:45 PM - 5:30 PM
BIGH3 Induced Apoptosis of Human Retinal Pericytes
Copyright 2012 by the Association for Research in Vision and Ophthalmology, Inc., all rights reserved. For permission to reproduce any abstract, contact the ARVO Office at pubs@arvo.org.
ARVO 2012 Annual Meeting Abstracts by Scientific Section/Group – Biochemistry/Molecular Biology (BI)
Albert A. Mondragon1, Kalpana Parvathaneni1, Mary Navarro1, Chi F. Lee2, Hong
S. Kim2, Richard G. LeBaron1, Reto Asmis1, Jeff G. Grigsby1, Andrew T. Tsin1.
1
University of Texas at San Antonio, San Antonio, TX; 2University of Texas
Health Science Center at San Antonio, San Antonio, TX.
Purpose: Diabetic retinopathy (DR) is the leading cause of blindness in America.
One of the earliest hallmarks of DR is the loss of retinal pericytes (RPC), which
help to maintain the integrity of the blood vessels. The cause is unknown, but RPC
dropout can lead to leakage, hypoxia, and angiogenesis seen in proliferative DR.
We propose a novel pathway where macrophage-derived TGFβ induces expression
of the pro-apoptotic protein TGFβ-Induced Gene Human Clone 3 (BIGH3), thereby
inducing RPC apoptosis.
Methods: Immunohistochemistry (IHC) was conducted using BIGH3 antibody and
fluorescence microscopy. RPCs were treated for 24 hours in conditioned media
from healthy macrophages (MCM) and macrophages cultured under diabetes-like
conditions (25 mM glucose and 100 ug/ml LDL) (dMCM). The conditioned media
of RPCs was probed for BIGH3 by Western blot analysis. RPCs were treated with
5 ng/mL TGFβ, and q-PCR and Western blot analysis were performed to analyze
BIGH3 expression in the RPCs and protein secretion into the growth medium. A
comparative apoptosis assay using BIGH3 was performed on Rhesus retinal
endothelial cells (RhREC) and RPCs.
Results: IHC showed BIGH3 localized in the extracellular spaces in the RPC
monolayer. Western blot analysis showed increased BIGH3 secretion by RPCs
treated with TGFβ and dMCM as compared to control cells. BIGH3 expression was
elevated 3.5-fold after TGFβ stimulation. 60% of the RPCs underwent apoptosis
induced by 5 µg/mL recombinant BIGH3, 24% by dMCM and 18% by exogenous
TGFβ. Importantly, BIGH3 antibody blocked TGFβ and dMCM induced apoptosis.
Additionally RPCs are more sensitive to BIGH3 induced apoptosis in comparison
to RhREC.
Conclusions: We found that TGFβ secreted by macrophages up-regulated BIGH3
expression and promoted BIGH3-dependent apoptosis in RPCs. This mechanism
may contribute to pericyte loss and microvascular damage in the initial stages of
diabetic retinopathy and may lead to better understanding of the disease
mechanism.
Commercial Relationships: Albert A. Mondragon, None; Kalpana
Parvathaneni, None; Mary Navarro, None; Chi F. Lee, None; Hong S. Kim,
None; Richard G. LeBaron, None; Reto Asmis, None; Jeff G. Grigsby,
None; Andrew T. Tsin, None
Support: San Antonio Life Sciences, Kronkosky Charitable Foundation
Program Number: 2412 Poster Board Number: A507
Presentation Time: 3:45 PM - 5:30 PM
Complement Mediated Retinal Pericyte Injury
Feng Lin1A, Dawn Smith1B, Qing Li1A, Ram Nagaraj1B, Timothy Kern1C, Yan Li1A.
A
Pathology, BOphthalmology, CMedicine, 1Case Westersn Reserve Univ,
Cleveland, OH.
Purpose: Loss of retinal pericytes is a hallmark of early stage diabetic retinopathy,
but the mechanisms underlying retinal pericytes loss in diabetes are unclear. Our
purpose was to test the hypotheses that complement activated by retinal pericytereactive autoantibodies leads to retinal pericytes cytotoxicity, and that inhibiting
complement activation by upregulating endogenous cell surface complement
regulators or by administering exogenous complement inhibitors is a novel
approach to protect retinal pericytes from autoantibodies-induced injury, and to
prevent the development of diabetic retinopathy
Methods: Human primary retinal pericytes were cultured in media containing
normal and high levels of glucose, then incubated with human sera in the presence
of a retinal pericyte-reactive antibody. Complement-mediated cellular injury was
assessed by a conventional BCECF leakage-based cytotoxicity assay. The presence
of intrinsic cell surface complement regulators on retinal pericytes was determined
by flow cytometry. The presence of CD38, a diabetes-associated cell surface
autoantigen, on retinal pericytes was examined by RT-PCR and flow cytometry. To
test the effectiveness of inhibiting complement activation for protecting retinal
pericytes, a CD55-expressing recombinant adenovirus was constructed and used to
transfect retinal pericytes, and an anti-C5 IgG was employed to inhibit membrane
attack complex (MAC) formation in the same cytotoxicity assays.
Results: In the presence of a retinal pericyte-reactive antibody, retinal pericytes
were injured by complement despite the presence of all three intrinsic cell surface
complement regulators, i.e., CD55, CD46 and CD59. CD38 was expressed by
primary retinal pericytes, and upregulated by TNFα/IFNγ, inflammatory cytokines
that are associated with the development of diabetic retinopathy. Hyperglycemic
culture conditions rendered retinal pericytes more susceptible to complement
mediated attack with minimal effects on expression levels of the cell surface
complement inhibitors. Upregulating CD55 expression levels on retinal pericytes,
or inhibiting MAC formation by an anti-C5 antibody protected retinal pericytes
from the autoantibodies-induced cellular injury.
Conclusions: The autoantibody- activated complement could be a mechanism
underlying the loss of retinal pericytes in diabetic patients. Inhibiting complement
activation by upregulating levels of intrinsic cell surface complement inhibitors, or
by administering exogenous complement inhibitors, could reduce the loss of retinal
pericytes, and help to prevent the development of diabetic retinopathy.
Commercial Relationships: Feng Lin, None; Dawn Smith, None; Qing Li,
None; Ram Nagaraj, None; Timothy Kern, None; Yan Li, None
Support: EY020956
Program Number: 2413 Poster Board Number: A508
Presentation Time: 3:45 PM - 5:30 PM
Erythropoietin and Interleukin 8 Levels in the Vitreous Fluid of Non-diabetic
Patients and Diabetic Patients with Progressive Stages of Diabetic Retinopathy
Nikolaos Trichopoulos1, Dip S. Jadav2, Neeru Kumar2, Randolph D. Glickman2.
1
Ophthalmology, High Country Macula, Retina, & Vitreous, PC, Albuquerque,
NM; 2Ophthalmology, University of Texas Health Science Center San Antonio,
San Antonio, TX.
Purpose: Erythropoietin (EPO) is reported to have angiogenic activity but its role
in retinal neovascularization is not completely understood. Chronic inflammation
also contributes to the complications of diabetes. The purpose of this study was to
evaluate whether the levels of EPO and pro-inflammatory cytokine interleukin 8
(IL-8) are elevated in the vitreous fluid of patients with diabetic retinopathy (DR).
Methods: Prospective analysis of undiluted vitreous samples was performed in
discarded vitreous fluid of 64 patients undergoing scheduled vitrectomies. Patients
with retinal vascular abnormalities other than DR (e.g. central retinal vein
occlusion) were excluded. Twenty patients were non-diabetics and 44 had diabetes
mellitus (DM). Ten of these 44 DM patients did not have DR, 7 had nonproliferative diabetic retinopathy (NPDR) and 27 had proliferative diabetic
retinopathy (PDR) with or without vitreous hemorrhage. All vitreous samples were
analyzed for EPO and IL-8 content using enzyme-linked immunosorbent assay kits.
Results: Average EPO levels were as follows: non-diabetics (n=20): 16.32 ± 16.25
mIU/ml; diabetics with NPDR or no DR (n=17): 32.91 ± 33.25mIU/ml; and
diabetics with PDR (n=27): 190.48 ± 138.21 mIU/ml. Average IL-8 levels were:
non-diabetics: 22.49 ± 23.77 pg/ml; diabetics with NPDR or no DR): 39.67 ± 69.95
pg/ml; and diabetics with PDR: 47.81 ± 54.01 pg/ml. A Mann-Whitney “U” test
was used to compare these differences. The EPO and IL-8 levels of the nondiabetics and the diabetics with NPDR or no DR did not differ significantly from
each other (p > 0.05). In contrast, there were significant differences between the
EPO and IL-8 levels of the diabetics with PDR and the diabetics with NPDR or no
DR (p ≤.001 for EPO and p ≤.04 for IL-8) and the non-diabetics (p ≤.001 for EPO
and p ≤.03 for IL-8).
Conclusions: Our findings suggest that EPO and IL-8 are increasingly elevated as
a consequence of the ischemia and inflammation induced by worsening stages of
DR. Further studies may elucidate the interaction between these two molecules to
show whether inhibition of EPO and IL-8 could provide a new therapeutic strategy
in precluding or arresting pathologic angiogenesis and disease progress in DR.
Commercial Relationships: Nikolaos Trichopoulos, None; Dip S. Jadav,
None; Neeru Kumar, None; Randolph D. Glickman, None
Support: Leonard and Shirley Sterling Endowment for Biochemistry Research in
the Department of Ophthalmology at the UTHSCSA
Program Number: 2414 Poster Board Number: A509
Presentation Time: 3:45 PM - 5:30 PM
Inhibition of Endoplasmic Reticulum Stress Delays Diabetic Cataract
Formation and Prevents Retinal Oxidative Stress and Apoptosis
Irina G. Obrosova1, Sergey Lupachyk1, Roman Stavniichuk1, Nikolai N. Veliky2,
Viktor R. Drel1, Azza B. El-Remessy3, Alexander Obrosov2. 1Pennington Biomed
Res Ctr, Louisiana State Univ, Baton Rouge, LA; 2Medicinal Biochemistry,
A.V.Palladin Institute of Biochemistry, Kiev, Ukraine; 3College of Pharmacy,
University of Georgia, Augusta, GA.
Purpose: Evidence for the important role for endoplasmic reticulum (ER) stress in
diabetes is emerging, but its contribution to diabetic complications is poorly
explored. This study evaluated the role for this phenomenon in diabetic cataract
formation and retinal oxidative stress and apoptosis using a pharmacological
approach with two chemical chaperones, trimethylamine-N-oxide (TMAO) and 4phenylbutyric acid (PBA).
Methods: Control and STZ-diabetic rats were maintained with or without TMAO
(110 mg kg-1d-1, in the drinking water) or PBA (100 mg kg-1d-1, i.p.), for 12 weeks
starting from induction of diabetes. Diabetic rats received suboptimal doses of
insulin to prevent ketoacidosis and weight loss. Lens clarity was evaluated by
indirect ophthalmoscopy and slit lamp examination on weekly basis. Cataracts were
scored (0 - clear lenses, 1-vacuoles, 2-opacities, 3-mature cataract). At the end of
the study, the rate of apoptosis was assessed by the number of TUNEL-positive
nuclei in the flat-mounted retinae. The expression of retinal ER stress variables
including total and phosphorylated PKR-like eukaryotic initiation factor 2A kinase
(PERK), total and phosphorylated inositol-requiring enzyme-1 (IRE1), and
CAAT/enhancer-binding protein homologous protein (CHOP), was measured by
Western blot analysis. The indices of oxidative-nitrosative stress, 4hydroxynonenal (HNE) adducts and nitrotyrosine (NT), were evaluated by ELISA.
Results: All the lenses were clear 2 wks after induction of diabetes. During the
next 6 wks, TMAO slightly delayed diabetic cataract formation, with significant
differences in cataract scores for the 5th wk only (0.667±0.114 vs 0.944±0.151 in
untreated diabetic group, p < 0.05). The anticataract effect of PBA was more
Copyright 2012 by the Association for Research in Vision and Ophthalmology, Inc., all rights reserved. For permission to reproduce any abstract, contact the ARVO Office at pubs@arvo.org.
ARVO 2012 Annual Meeting Abstracts by Scientific Section/Group – Biochemistry/Molecular Biology (BI)
potent, and was observed till the end of the study, with signifcant differences in the
cataract scores for the 10th, 11th, and 12th wks. Rats with 12-wk STZ-diabetes
displayed ER stress, manifest by reduced phospho-PERK/PERK ratios, with
unchanged phospho-IRE1/IRE1 ratio and CHOP expression. A chemical chaperone
treatment increased retinal phospho-PERK/PERK and phospho-IRE1/IRE1 ratios
and reduced CHOP expression, thus potentiating unfolded protein response and
counteracting ER stress. A 4.3-fold increase in retinal apoptosis in diabetes was
completely prevented by TMAO, and essentially prevented by PBA. Both chemical
chaperones counteracted diabetes-induced retinal HNE adduct and NT
accumulation.
Conclusions: ER stress is implicated in diabetes-induced cataract formation, and
retinal oxidative-nitrosative stress and apoptosis. The findings identify a new
therapeutic target for diabetic ocular complications.
Commercial Relationships: Irina G. Obrosova, None; Sergey Lupachyk,
None; Roman Stavniichuk, None; Nikolai N. Veliky, None; Viktor R. Drel,
None; Azza B. El-Remessy, None; Alexander Obrosov, None
Support: None
Program Number: 2415 Poster Board Number: A510
Presentation Time: 3:45 PM - 5:30 PM
Effects of High Glucose-Induced Cx43 Downregulation on Tight Junction
Protein Expression and Tight Junction Barrier Characteristics in Retinal
Endothelial Cells
Thomas Tien, Tetsuya Muto, Sayon Roy. Boston University School of Medicine,
Boston, MA.
Purpose: To investigate whether high glucose (HG) induced downregulation of
connexin 43 (Cx43), a gap junction protein, alters ZO-1 and occludin expression
and cell monolayer permeability.
Methods: Rat retinal endothelial cells (RRECs) were grown in normal medium (N;
5mM), high glucose medium (HG; 30 mM), HG transfected with Cx43 siRNA, or
HG transfected with scrambled siRNA. Western blot (WB) analysis was performed
to assess Cx43, occludin, and ZO-1 protein expression in the four groups of cells.
In parallel, cells grown in above conditions were subjected to in vitro permeability
(IVP) assay to assess cell monolayer permeability.
Results: Cx43 protein expression was significantly reduced in cells grown in HG
medium compared to cells grown in N medium as indicated by WB analysis
(76.1±13.4% of control). Cells grown in HG and transfected with Cx43 siRNA
showed significant reduction in Cx43 expression (61.5±5.0% of control), whereas
scrambled siRNA used as control showed no effect on Cx43 protein expression.
Interestingly, compared to cells grown in HG alone, cells grown in HG and
transfected with Cx43 siRNA showed further reduction in occludin and ZO-1
expression (79.6±5.6% of control, 80.81±13.3% of control, respectively vs.
72.0±7.3% of control, 41.2±8.0% of control, respectively). Similarly, IVP assay
showed increased permeability in cells grown in HG compared to cells grown in N
medium (116.8±4.8% of control). Importantly, compared to cells grown in HG
alone, cells grown in HG and transfected with Cx43 siRNA showed greater
increase in monolayer permeability (131.0±8.5% of control). Notably, cells grown
in N and transfected with Cx43 siRNA resulted in decreased ZO-1 expression
(70.5±13.9% of control) and increased cell monolayer permeability (113.1±7.9% of
control).
Conclusions: Findings from this study indicate that HG-induced downregulation of
Cx43 expression may influence tight junction protein expression and contribute to
increased vascular permeability associated with diabetic retinopathy.
Commercial Relationships: Thomas Tien, None; Tetsuya Muto, None; Sayon
Roy, None
Support: NIH, NEI 018218
Program Number: 2416 Poster Board Number: A511
Presentation Time: 3:45 PM - 5:30 PM
Loss Of Rod Sensitivity And Gene Expression Changes In The Retina Of
Fructose-fed Insulin-resistant Mice
Lionel Bretillon1, Emilie Simon1, Niyazi Acar1, Alain M. Bron2, Catherine P.
Garcher2. 1INRA, University of Burgundy, Eye & Nutrition Research Group,
Dijon, France; 2Ophthalmology, University Hospital, Dijon, France.
Purpose: Metabolic syndrome is of major concern in Western countries since it
predisposes individuals to the development of diabetes. Insulin resistance is one of
the biochemical features of the metabolic syndrome. Fructose feeding has been
used to elicit insulin resistance in rodents. Our purpose was to characterize the
functional and gene expression changes in the retina after long term feeding mice
with a fructose-enriched diet.
Methods: Control and ApoB100,LDLR-/- mice, a murine model of aging of the
human retina, were fed with a 60%-rich fructose diet for 8 months. Scotopic single
flash and Flicker electroretinograms were recorded to monitor the response of the
retina to flash stimuli. Fundus autofluorescence, as well as fluorescein and
indocyanin green angiography were assessed by using a confocal scanning laser
ophthalmoscope. Gene expression was analyzed in the neurosensory retina (NR)
and retinal pigment epithelium+choroid (RPE/Ch) by RT-qPCR, focusing on lipid
metabolism, nuclear receptors and VEGF.
Results: Under standard conditions of breeding, ABCG1, HTRA1 and VEGF
genes were up-regulated in the NR of ApoB100,LDLR-/- mice compared to wild type
animals. In RPE/Ch, ABCA1 was upregulated, ACAT1 and HMGCoA reductase
down-regulated in ApoB100,LDLR-/- mice compared to wild type mice. Fructose
feeding significantly up-regulated gene expression of ApoE, ABCA4, ABCG1, SRB1, CYP46A1, CYP27A1, LRP-1, LCAT, HMGcoA reductase, insig1, NFκB1,
NFκB2, LXRα, PPARδ, BAX, GFAP, hexokinase, HTRA1 and VEGF in the NR
from both strains of mice. LDL-receptor was up-regulated by fructose in the NR of
wild type mice. No similar effect was observed in RPE/Ch.
Fructose feeding significantly reduced a- and b-waves amplitude of the
electroretinograms and the sensitivity of rods to light stimulus by 0.3 log unit in
both strains of mice. No clinical signs of retinal vasculature abnormalities were
observed in fructose-fed mice. Our model of aging of the human retina did not
exhibit a greater reactivity to fructose feeding than wild type animals.
Conclusions: Our data demonstrate that, at early stages of insulin resistance and
metabolic syndrome, the function of the neurosensory retina is impaired and gene
expression is altered. These data outline several molecular lipid-associated
mechanisms that would predispose the retina to the consequences of metabolic
syndrome, including vascular changes.
Commercial Relationships: Lionel Bretillon, None; Emilie Simon,
None; Niyazi Acar, None; Alain M. Bron, None; Catherine P. Garcher, None
Support: Horus Pharma Laboratories/Regional Council of Burgundy
Program Number: 2417 Poster Board Number: A512
Presentation Time: 3:45 PM - 5:30 PM
Impact of Intravitreal Bevacizumab on Accumulation of Vascular Adhesion
Protein-1 in Proliferative Diabetic Retinopathy
Ryo Ando1A,1B, Kousuke Noda1A,1B, Miyuki Murata1A,1B, Shiho Nanba1A,1B, Satoshi
Kinoshita1A,1B, Junichi Fukuhara1A,1B, Zhenyu Dong1A,1B, Wataru Saito1A, Atsuhiro
Kanda1A,1B, Susumu Ishida1A,1B. ADepartment of Ophthalmology, BLaboratory of
Ocular Cell Biology and Visual Science, 1Hokkaido University, Sapporo, Japan.
Purpose: Vascular adhesion protein (VAP)-1, a multifunctional molecule with
adhesive and enzymatic properties, is expressed mainly in the vascular endothelial
cells of mammals. VAP-1 is known to generate hydrogen peroxide through the
enzymatic activity and in turn increase the oxidative stress. The aim of this study is
to investigate the effect of intravitreal bevacizumab (IVB), a humanized anti-VEGF
monoclonal antibody, on the accumulation of soluble form of VAP-1 (sVAP-1) and
oxidative stress in proliferative diabetic retinopathy (PDR).
Methods: Vitreous samples were collected from 37 eyes of 37 cases with PDR
(mean age, 58.8±1.4y/o), who underwent pars plana vitrectomy for prolonged
vitreous hemorrhage or tractional retinal detachment involving the macular region
at Hokkaido University Hospital from 2006 to 2011. This study was conducted in
accordance with the tenets of the Declaration of Helsinki and after receiving
approval from the institutional review committee of Hokkaido University Hospital.
Of 37 eyes, 14 eyes were received the preoperative IVB (IVB group, 10 male and 4
female, 56.1±2.0y/o) and 23 eyes were not received (non-IVB group, 12 male and
11 female, 60.5±1.8y/o). Protein levels of sVAP-1 and N epsilon-(hexanoyl) lysine
(HEL), a marker of oxidative stress, were measured in the vitreous samples by
enzyme-linked immunosorbent assay (ELISA).
Results: Vitreous level of sVAP-1 in IVB group was significantly lower
(5.5±1.2ng/ml) compared with that in non-IVB group (9.3±1.2ng/ml, p<0.05).
Similarly, the concentration of HEL in the vitreous was significantly reduced in
IVB group (4.7±0.6ng/ml) than in control group (8.5±0.9ng/ml, p<0.01).
Furthermore, protein concentration of sVAP-1 was positively correlated with HEL
in the samples (r=0.42, p<0.01).
Conclusions: Our data for the first time provide the evidence on the link between
VEGF and sVAP-1 in eyes with PDR. The current data suggest that VEGF
blockade decreases the concentration of vitreous sVAP-1 and thereby reduces the
oxidative stress in PDR eyes.
Commercial Relationships: Ryo Ando, None; Kousuke Noda, None; Miyuki
Murata, None; Shiho Nanba, None; Satoshi Kinoshita, None; Junichi
Fukuhara, None; Zhenyu Dong, None; Wataru Saito, None; Atsuhiro Kanda,
None; Susumu Ishida, None
Support: None
Program Number: 2418 Poster Board Number: A513
Presentation Time: 3:45 PM - 5:30 PM
Mechanism of Adenosine Signaling Dysfunction in Diabetic Retinopathy
Mohammad Naime1A, Saif Ahmad1A, Azza El-Remessy1B, Haroldo A. Toque1B,
Gregory I. Liou1A. AOphthalmology, BPharmacology and Toxicology, 1Georgia
Health Sciences University, Augusta, GA.
Purpose: Our goal is to develop an early therapeutic intervention against
inflammation in diabetic retinopathy (DR) before its progression is irreversible. We
have shown that Amadori-glycated albumin (AGA), a well-documented risk factor
in diabetes, induces microglia-mediated retinal endothelial inflammation,
suggesting that microglial activation causes DR, and may serve as a target for
therapeutic intervention. We have also shown that retinal inflammation in diabetes
is modulated by extracellular adenosine via adenosine receptor A2AAR-cAMP
Copyright 2012 by the Association for Research in Vision and Ophthalmology, Inc., all rights reserved. For permission to reproduce any abstract, contact the ARVO Office at pubs@arvo.org.
ARVO 2012 Annual Meeting Abstracts by Scientific Section/Group – Biochemistry/Molecular Biology (BI)
signaling, that A2AAR KO mice with diabetes have a detrimental phenotype, and
that A2AAR agonist protects against retinal inflammation. These results support our
central hypothesis: that adenosine is important in diabetes, and that abnormal
adenosine metabolism contributes to DR. Extracellular concentrations of adenosine
are regulated by interplay of nucleoside transporters with intracellular and
extracellular enzymes of adenosine metabolism. Released ATP is converted by 5’ectonucleotidase (CD73) to adenosine, which is catabolized to inosine by the
ubiquitous adenosine deaminase1 (ADA1) and the monocyte-macrophage-specific
ADA2, an enzyme that is identified in all vertebrates except rodents.
Methods: We used a porcine model of DR, which shares a similar immune system
with human, to study the mechanism that regulates the synthesis and degradation of
extracellular adenosine.
Results: Role of adenosine is understudied as ADA2 has not been identified in
mice. However, our preliminary data in human and porcine retinas have revealed
some clue about adenosine’s role in diabetes. In human and porcine retinas with
diabetes, there was an increased expression or activity of ADA2, but not ADA1 or
CD73. Treatment of porcine retinal microglial cells with AGA resulted in enhanced
ADA2 activity and TNF-α release, and these effects were reversed by A2AAR
agonist or ADA2-neutralizing antibody.
Conclusions: These results suggest that increased ADA2 activity causes retinal
inflammation in diabetes, and that ADA2 activity is up-regulated via an
inflammatory pathway.
Commercial Relationships: Mohammad Naime, None; Saif Ahmad,
None; Azza El-Remessy, None; Haroldo A. Toque, None; Gregory I. Liou,
None
Support: Vision Discovery Institute
Program Number: 2419 Poster Board Number: A514
Presentation Time: 3:45 PM - 5:30 PM
Mechanisms of Diabetic Retinopathy: Role of NOX2 in Retinal and Bone
Marrow-derived Cells
Modesto A. Rojas1A, Wenbo Zhang1A, Zhimin Xu1A, Phillip Chandler1B, Robert W.
Caldwell1C, Ruth B. Caldwell1A. AVascular Biology Center, BImmunotherapy
Center, CPharmacology and Toxicology,, 1Georgia Health Sciences University,
Augusta, GA.
Purpose: Diabetic retinopathy, the most common cause of blindness in US adults
of working age, is characterized by increased expression of VEGF, vascular
inflammation and increased permeability. Our previous studies have shown that
reactive oxygen species (ROS) produced by the superoxide generating enzyme
NOX2 NADPH oxidase play a crucial role in the vascular injury associated with
diabetic retinopathy. We have now investigated the specific cellular source(s) of the
damaging NOX2 activity by studies using bone marrow chimeric mice.
Methods: Bone marrow cells were collected from the femurs and tibias of healthy
wild type and NOX2-/- donor mice and a 200µl cell suspension (1 x 107 nucleated
cells) was injected intravenously into previously irradiated NOX2-/- and wild type
recipients. Three weeks after bone marrow transplantation diabetes was induced by
streptozotocin treatment. The following groups of bone marrow chimeras were
studied: non-diabetic WT→WT, diabetic WT→WT, diabetic WT→NOX2-/-,
diabetic NOX2-/- →WT. After 4 weeks of diabetes, retinopathy was assessed by
measuring formation of superoxide and nitric oxide (NO), expression of VEGF and
ICAM-1, leukocyte attachment to the vessel wall and vascular permeability.
Results: The retinas of the diabetic WT→WT chimeras showed significant
increases in superoxide formation and decreases in NO formation as compared with
the non-diabetic chimeras. These diabetes-induced alterations were correlated with
increases in expression of VEGF and ICAM-1, leukocyte adhesion and vascular
permeability. Each of these diabetes-induced alterations was significantly
attenuated in the diabetic WT→NOX2-/- and NOX2-/- →WT chimeras (p<0.05).
Conclusions: These results indicate that NOX2-generated ROS produced by both
BM-derived cells and resident retinal cells contribute importantly to retinal
vascular injury in diabetic retinopathy.Targeting NOX2 in either bone marrow or
retinal cells represents a novel therapeutic strategy for the treatment/ prevention of
diabetic retinopathy.
Commercial Relationships: Modesto A. Rojas, None; Wenbo Zhang,
None; Zhimin Xu, None; Phillip Chandler, None; Robert W. Caldwell,
None; Ruth B. Caldwell, None
Support: VA Merit Review Award, JDRF 10-2009-575, NIH Grants EY11766,
EY04618, HL70215
Program Number: 2420 Poster Board Number: A515
Presentation Time: 3:45 PM - 5:30 PM
Effects Of Glucose And Galactose On Comparative Changes Of Growth
Factors And Mapk Signaling Of Rat Retinal Capillary Cells.
Peter F. Kador1,2, Peng Zhang1. 1Pharmaceutical Sci, Coll of Pharm, Univ of
Nebraska Medical Ctr, Omaha, NE; 2Opthalmology, University of Nebraska
Medical Center, Omaha, NE.
Purpose: In rat lenses growth factor and signaling changes do not directly result
from the presence of diabetes or sorbitol/galactitol (polyol)
formation/accumulation, but from secondary osmotic changes associated with the
aldose reductase (AR) catalyzed polyol formation. While AR is present in both rat
pericytes and endothelial cells, significant polyol formation linked to apoptosis
only occurs in pericytes. The purpose of this study was to determine the effects of
high glucose/galactose media and polyol formation on growth factor and signaling
changes in the rat capillary cells.
Methods: Conditionally immortalized rat retinal pericyte (TR-rPCT) and
endothelial (TR-iBRB) cell lines were cultured on collagen type 1 coated dishes in
DMEM medium containing 5.5 mM glucose. After 24 hours of initial culture, the
medium was replaced with serum free medium containing 5.5, 25 or 50 mM
glucose or galactose with/without the aldose reductase inhibitors(ARIs) AL1576 or
tolrestat for periods of up to 48 hours. Growth factors and transduction pathways
were measured by Western blots using the antibodies against basic-FGF, IGF-1,
TGF-β, P-ERK1/2, P-SAPK/JNK, and P-Akt.
Results: Sorbitol accumulation was only observed in pericytes while galactitol was
present in both pericytes and endothelial cells. Pericytes cultured in high glucose
showed increased expression of basic-FGF, IGF-1, TGF-β, P-Akt, P-ERK1/2 and
P-SAPK/JNK compared to those cultured in 5.5 mM glucose and the presence of
ARIs reduced these expressions. Similar results were observed with galactose
media. In contrast, endothelial cells cultured in high glucose media showed
increased expression of basic-FGF, P-Akt, and P-SAPK/JNK which were not
normalized with ARIs. In galactose media endothelial cells showed increased
expression of basic-FGF, IGF-1, TGF-β, P-ERK1/2 and P-SAPK/JNK which were
only partially reduced by ARIs.
Conclusions: Growth factor (basic-FGF, IGF-1, TGF-β) and MAPK signaling (PAkt, P-ERK1/2, P-SAPK/JNK) expressions are linked to the presence of polyols.
Pericytes which readily accumulate sorbitol/galactitol that is inhibited by ARIs
showed expression changes similar to those observed in rat lenses. In contrast,
endothelial cells showed partial expression changes in b-FGF, IGF, TGF-β, PERK1/2 and P-SAPK/JNK linked to galactitol accumulation.
Commercial Relationships: Peter F. Kador, None; Peng Zhang, None
Support: EY016730
Program Number: 2421 Poster Board Number: A516
Presentation Time: 3:45 PM - 5:30 PM
Plasma, Aqueous and Vitreous Homocysteine Levels In Proliferative Diabetic
Retinopathy
Maung M. Win, Visvaraja Subrayan. Ophthalmology, University Malaya, Bkt
Antarabangsa,Ampang,Selangor, Malaysia.
Purpose: To compare homocysteine (Hcy) concentration in the blood plasma,
vitreous and aqueous of eyes of patients with proliferative diabetic retinopathy
(PDR) against those in a control group, and to investigate associations between Hcy
concentration in blood plasma with that of aqueous and vitreous in these two
groups.
Methods: Blood plasma, aqueous and vitreous samples were collected at the time
of combined cataract and pars plana vitrectomy from 20 eyes with PDR and 21
eyes of patients without diabetes mellitus. Hcy concentration in the samples was
determined by chemiluminescent microparticle immunoassay.
Results: The mean Hcy concentration (± standard deviation) of blood plasma,
vitreous and aqueous were 13.7± 2.2 µmol/l, 3.4±0.7 µmol/l and 1.6±0.3 µmol/l
respectively in the PDR group; in the control group, they were 10.4±1.1 µmol/l,
2.6±0.9 µmol/l and 1.2±0.2 µmol/l, respectively. The estimated geometric mean of
Hcy concentration of all three variables in the PDR group was about 30% higher
than those in the control group. In the PDR group, Hcy concentration between the
blood plasma and vitreous was significantly associated (ρ=0.71; p-value < 0.001),
as was that between the blood plasma and aqueous (ρ=0.68; p-value < 0.001). In
the control group, only Hcy concentration in the blood plasma and vitreous was
significantly associated (ρ=0.66; p-value = 0.001); that between the plasma and
aqueous was not (ρ=0.24; p-value = 0.30).
Conclusions: Patients with PDR had significantly higher Hcy concentration in
blood plasma, vitreous and aqueous compared to those in the control group. The
Hcy levels in blood plasma and vitreous were significantly associated in both
groups. However, Hcy levels in blood plasma and aqueous were significantly
associated only in the PDR group and not in the control group.
Commercial Relationships: Maung M. Win, None; Visvaraja Subrayan, None
Support: University of Malaya Research Grant (UMRG/RG180/10HTM)
Program Number: 2422 Poster Board Number: A517
Presentation Time: 3:45 PM - 5:30 PM
Correlation Of Complement Fragment C5a With Inflammatory Cytokines In
The Vitreous Of Patients With Proliferative Diabetic Retinopathy
Daisuke Muramatsu, Yoshihiro Wakabayashi, Yoshihiko Usui, Yoko Okunuki,
Takeshi Kezuka, Hiroshi Goto. Ophthalmology, Tokyo Medical University, Tokyo,
Japan.
Purpose: To determine the vitreous concentration of complement fragment C5a in
patients with proliferative diabetic retinopathy (PDR) and to elucidate the relation
between C5a and various inflammatory cytokines.
Methods: Vitreous and aqueous humor samples were obtained at the time of
vitrectomy from 20 eyes of 19 PDR patients and from 14 eyes of 14 patients with
Copyright 2012 by the Association for Research in Vision and Ophthalmology, Inc., all rights reserved. For permission to reproduce any abstract, contact the ARVO Office at pubs@arvo.org.
ARVO 2012 Annual Meeting Abstracts by Scientific Section/Group – Biochemistry/Molecular Biology (BI)
macular disease who has no history of diabetes as controls. Vitreous and aqueous
concentrations of human C5a, vascular endothelial growth factor (VEGF),
interferon-inducible protein-10 (IP-10), interleukin-8 (IL-8), monocyte chemotactic
protein-1 (MCP-1) and monokine induced by interferon-γ (Mig) were quantified
using FACS Caliber® flow cytometer.
Results: Aqueous and vitreous concentration of C5a increased significantly in
patients with PDR 303.8, 1,079.3pg/ml respectively compared with controls 53.4,
201.7 pg/ml. (P=0.02, P=0.01). Aqueous concentration of VEGF, IP-10, IL-8,
MCP-1, Mig were significantly higher in PDR patients 479.8, 251.9, 174.4, 2141.0,
72.3pg/ml compared with control patients (P=0.01, 0.01, 0.02, 0.01, 0.02). In PDR
patients, aqueous concentration of C5a correlated significantly with those of IP-10
(P<0.01) and IL-8 (P<0.01). Vitreous concentration of VEGF, IP-10, IL-8, MCP1, Mig were significantly higher in PDR patients 1082.7, 237.9, 80.6, 1553.8,
47.5pg/ml compared with control patients (P=0.001, 0.005, 0.01, 0.01, 0.03). In
PDR patients, vitreous concentration of C5a revealed positive correlation with
those of IP-10 (P<0.01), VEGF (P=0.05) and MCP-1 (P=0.01).
Conclusions: Our results suggest that C5a may play a role in the pathogenesis of
PDR and work in concert with inflammatory cytokines such as VEGF, MCP-1, IP10 and IL-8 in pathological angiogenesis.
Commercial Relationships: Daisuke Muramatsu, None; Yoshihiro
Wakabayashi, None; Yoshihiko Usui, None; Yoko Okunuki, None; Takeshi
Kezuka, None; Hiroshi Goto, None
Support: None
Program Number: 2423 Poster Board Number: A518
Presentation Time: 3:45 PM - 5:30 PM
Preventive Effect Of Topical Ethyl Pyruvate Against Diabetes-induced
Damage To The Mouse Retina
Kavita R. Hegde1, Shambhu D. Varma2. 1Natural Sciences, Coppin State
University, Baltimore, MD; 2Ophthal & Visual Sci & Biochem, Univ of Maryland
Sch of Med, Baltimore, MD.
Purpose: Oxidative stress is considered to be a highly significant factor in the
pathogenesis of diabetic retinopathy-a major cause of vision impairment and
blindness. Excessive generation of oxygen free radicals due to high glucose is
known to have deleterious effects on tissue structure and function by causing
oxidative modification of lipids, protein and nucleic acids. It is hypothesized that
pyruvate, a potent free radical scavenger, will prevent such stress to the retina in
diabetic mice. This hypothesis is based on our previous studies demonstrating the
protective effect of pyruvate against oxidative damage to the retina in vitro, and to
lens in vivo-evident by cataract prevention. Pyruvate also prevented the oxidative
stress induced inhibition of retinal glycolysis. The primary aim of this study is
hence to test further the effectiveness of pyruvate in preventing diabetes induced
changes in lipid peroxidation, glutathione (GSH) oxidation and protein glycation in
the mouse retina.
Methods: Diabetes was induced in C57Bl/6 mice by I.P. administration of
streptozotocin. Diabetic animals were then divided into two groups. One group was
treated with 3.5% ethyl pyruvate (EP) eye drops 6times/day and the other group
served as untreated controls. Retinas were harvested after 8 weeks of diabetes and
processed for measurements of GSH and malonaldehyde (MDA). Glycation was
studied by determining incorporation of 5-3H glucose in the retinal proteins in the
absence and presence of pyruvate.
Results: GSH concentration in the retinas of diabetic mice decreased to ~70% of
the normal. The level of MDA increased to 200% of the normal. The decrease in
GSH and increase in MDA both were completely prevented by treatment with EP
eye drops, their levels being close to the normal values in this group. Glycation was
also inhibited substantially (by 70%) in the presence of pyruvate.
Conclusions: The results demonstrate for the first time that treatment with EP eye
drops is significantly effective in preventing oxidative damage to the retina of
diabetic mice. It is therefore hypothesized that use of pyruvate could be medically
beneficial in ameliorating diabetic effects on the retina.
Commercial Relationships: Kavita R. Hegde, None; Shambhu D. Varma,
None
Support: None
Program Number: 2424 Poster Board Number: A519
Presentation Time: 3:45 PM - 5:30 PM
Human Umbilical Tissue-derived Cells (hUTC) Ameliorate Retinal Vascular
Leakage In A Diabetic Rat
Kimio Takeuchi, Cynthia Kamami-Levy, Demetrios G. Vavvas. Ophthalmology,
Massachusetts Eye and Ear Infirmary(MEEI), Boston, MA.
Purpose: Diabetic Retinopathy is the leading cause of visual impairment in adults
in the developed world. Increased vascular permeability and macular edema are key
features of diabetic retinopathy. Pigment Epithelial Derived Factor (PEDF) has
been shown to antagonize VEGF mediated vascular leakage. Human umbilical
tissue-derived cells (hUTC) are allogeneic progenitor cells from human umbilical
tissues that can secrete PEDF. The goal of this study is to assess efficacy of hUTC
in vascular leakage in the rat diabetic model.
Methods: Diabetes was induced in Long Evans rats via single intraperitoneal
administration of Streptozotocin. hUTC or vehicle control was given via subretinal
injection 2 months after induction of diabetes. One month later vascular leakage
was assessed with biotin-BSA assay. Expression of PEDF, VEGF, ICAM-1 and
Zo-1 was assed by Western blots. Retinal thickness was analyzed by animal
specific SD-OCT (Bioptigen)
Results: Subretinal Injection of hUTC lead to a significant reduction of vascular
leakage compared to control (hUTC = 13.3 +/- 14.6, n=10, P<0.05 vs. control = 42
+/- 15.4, n=15 P<0.05). There was significant upregulation of PEDF expression,
and inhibition of the diabetes induced ZO-1 downregulation, in the treated retinal
tissues.
Conclusions: Subretinal injection of hUTC can reduce retinal vascular leakage in
STZ induced diabetic rats and may become a novel therapeutic agent in patients
with diabetic retinopathy.
Commercial Relationships: Kimio Takeuchi, None; Cynthia Kamami-Levy,
None; Demetrios G. Vavvas, None
Support: None
Program Number: 2425 Poster Board Number: A520
Presentation Time: 3:45 PM - 5:30 PM
Effects Of Aldose Reductase Deletion On Diabetes -induced Retinal
Inflammation and Vascular Degeneration
Jie Tang1A, Mark Petrash2, Timothy S Kern1B. AMedicine and Center for Diabetes
Research, BMedicine and Center for diabetes Research, 1Case Western Reserve
Univ, Cleveland, OH; 2Ophthalmology, University of Colorado, Denver, CO.
Purpose: Aldose reductase (AR) and inflammation have been implicated in the
pathogenesis of diabetic retinopathy. The aim of this study was to investigate
effects of aldose reductase deletion on diabetes-induced inflammatory changes in
the retina, and on vascular pathology
Methods: Wild-type (C57BL/6J) and aldose reductase (AR) deficient mice were
made diabetic with streptozotocin. Mice were sacrificed at 2 mos and 10 mos of
study to evaluate retinal vascular histopathology (elastase digestion), as well as
parameters of oxidative stress (retinal superoxide) and inflammation (expression of
inflammatory proteins).
Results: Wild-type mice diabetic for 10 mos developed the expected degeneration
of retinal capillaries, and diabetes of 2 mos duration increased both superoxide
production and expression of iNOS and ICAM. Co-culture of endothelial cells with
leukocytes from wildtype diabetics killed more endothelial cells than did
leukocytes from nondiabetics. Deletion of AR resulted in total suppression of the
diabetes-induced increase in expression of iNOS and generation of retinal
superoxide, and partial inhibition of vascular histopathology. Neither leukocytemediated killing of endothelial cells or increased expression of ICAM, however,
were corrected in AR-deficient diabetic mice.
Conclusions: AR regulates the diabetes-induced increase in superoxide generation
by the retina, and regulate some, but not all, aspects of the diabetes-induced
inflammation and capillary degeneration.
Commercial Relationships: Jie Tang, None; Mark Petrash, None; Timothy S
Kern, None
Support: NIH Grant
Program Number: 2426 Poster Board Number: A521
Presentation Time: 3:45 PM - 5:30 PM
Changes in Retinal Neurochemistry in Hyperglycemic Zebrafish Retinas
Victoria P. Connaughton, Lynne S. Arneson. Biology, American University,
Washington, DC.
Purpose: To determine changes in levels of GABA, dopamine, glutamate, and
GFAP in zebrafish retinas exposed to alternating hyperglycemic conditions for up
to 2 months.
Methods: Adult, wildtype zebrafish were made hyperglycemic by alternating
exposure to 2% glucose/0% glucose solution every 24hr. Control fish were
alternately exposed to either 0% glucose/0% glucose every 24hr or 2%
mannitol/0% glucose every 24hr (osmotic control). After 4 and 8 weeks of
hyperglycemic conditions, retinas were removed and processed for
immunocytochemistry and Western Blot analysis to determine changes in
neurotransmitter distribution and content. For immunocytochemistry, retinal
cryostat sections were probed with antibodies to GABA, TOH, glutamate, and
GFAP; secondary antibodies were conjugated to TRITC or Cy-3. Labeled cryostat
sections were viewed to determine changes in the distribution of these
neurochemicals. Western Blots were used to quantify changes in these compounds.
Results: After 4 weeks, no changes were observed in GFAP levels, but after 8
weeks GFAP levels appear to increase. Glutamate labeling also appears to increase
during this time. In contrast, TOH levels appear to decrease; while GABA labeling
does not appear different from controls.
Conclusions: After 2 months of hyperglycemic conditions, increased glutamate
immunoreactivity and increased GFAP levels, but decreased TOH
immunoreactivity were observed. These findings are consistent with neurochemical
changes previously reported following hyperglycemia in diabetic models
suggesting zebrafish is a potential new model in which to study diabetic
retinopathy.
Copyright 2012 by the Association for Research in Vision and Ophthalmology, Inc., all rights reserved. For permission to reproduce any abstract, contact the ARVO Office at pubs@arvo.org.
ARVO 2012 Annual Meeting Abstracts by Scientific Section/Group – Biochemistry/Molecular Biology (BI)
Commercial Relationships: Victoria P. Connaughton, None; Lynne S.
Arneson, None
Support: American University Mellon Award
Program Number: 2427 Poster Board Number: A522
Presentation Time: 3:45 PM - 5:30 PM
Analysis of VEGF and PEDF Concentration in Aqueous humor, Vitreous
humor, and Plasma of Diabetic Retinopathy Patients
Gwang Ju Choi, Mu O Jung, Dae Hyun Kim. Ophthalmology, Chosun university
hospital, Gwangju, Republic of Korea.
Purpose: To analyze the levels of vascular endothelial growth factor(VEGF) and
pigment epithelium-derived factor(PEDF) in the aqueous humor, vitreous humor
and plasma of patients with diabetic retinopathy(DR).
Methods: 70 eyes of 66 patients with DR and 42 eyes of 40 patients with
nondiabetic ocular disease as control subjects were analyzed. DR patients were
divided into 3 groups including nonproliferative diabetic retinopathy(NPDR group,
n=21), posterior proliferative diabetic retinopathy(post. PDR group, n=38), and
anterior proliferative proliferative diabetic retinopathy(ant. PDR group, n=11).
Concentrations of VEGF and PEDF in the aqeous humor, vitreous humor and
plasma were measured by enzyme linked immunosorbent assay(ELISA).
Results: The aqeous level of VEGF was significantly higher in ant. PDR
group(P<0.05). The vitreous level of VEDF was significantly higher in post. PDR
group(P<0.05). The plama level of VEGF was higher in NPDR group(P<0.05). The
PEDF concentration didn’t show significant difference between groups in all 3
specimens (aqeous humor, vitreous humor, and plasma) statistically.
Conclusions: The VEGF concentration was higher in the region of ocular tissue
where it showed active neovascularization. In diabetic retinopathy, the VEGF
concentration was significantly correlated with the neovascularization. But the
PEDF concentration didn’t show significant correlation with the
neovascularization.
Commercial Relationships: Gwang Ju Choi, None; Mu O Jung, None; Dae
Hyun Kim, None
Support: None
Program Number: 2428 Poster Board Number: A523
Presentation Time: 3:45 PM - 5:30 PM
Fenofibrate Treatment Could Repress Retinal Adiponectin Expression In
Type 1 Diabetes Mellitus Rats
Ying-Jung Hsu1, Wei-Shiung Yang1, Chang-Hao Yang2. 1Graduate Institute of
Clinical Medicine, National Taiwan University, Taipei, Taiwan; 2Ophthalmology,
National Taiwan Univ Hospital, Taipei, Taiwan.
Purpose: Adiponectin is a polypeptide hormone exclusively secreted from
adipocytes. When it acts with its receptors, adipo R1 and R2, could stimulate AMPactivated protein kinase activity. Studies have showed that serum adiponectin were
found to be positively correlated with the severity of diabetic retinopathy.
Fenofibrate is a PPAR-α agonist. Recently FIELD and ACCORD eye Study
showed that fenofibrate could reduce the risk of microvascular complications and
development or progression of diabetic retinopathy. The purpose of this study is to
investigate the effect of fenofibrate on the expression of adiponectin and its
receptors in retina of rats with type 1 diabetes mellitus.
Methods: Type 1 diabetes mellitus was induced in Sprague-Dawley rats by
intravenous injection of streptozotocin (STZ). Rats were randomly divided into 4
groups : the control group (C), the diabetes group (DM), the diabetes group treated
with low-dosage fenofibrate (30 mg/kg/day), and the diabetes group treated with
high-dosage fenofibrate (100 mg/kg/day). After 2 months treatment, the expression
of adiponectin, adipo R1 and R2 in retina were determined by PCR, western blot
and immunofluorescent stain. Aqueous humor and plasma adiponectin were
determined by ELISA.
Results: The expression of mRNA and protein of adiponectin, adipoR1and R2 in
the diabetic group were significant higher than the control group. Treatment of
fenofibrate dose-dependently suppressed the expression of adiponectin,
adipoR1and R2 compared with the non-treatment group. The suppressive effect of
fenofibrate on adiponectin expression was confirmed by immunofluorescent stain.
Aqueous humor and plasma adiponectin levels also decreased after fenofibrate
treatment.
Conclusions: Treatment of fenofibrate could suppress the expression of
adiponectin , adipo R1and R2 in retina of diabetic rats. The beneficial effect of
fenofibrate on diabetic retina may be related its regulatory effect on adiponectin
and its receptors.
Commercial Relationships: Ying-Jung Hsu, None; Wei-Shiung Yang,
None; Chang-Hao Yang, None
Support: NSC 100-2314-B-002-060-MY3
Program Number: 2429 Poster Board Number: A524
Presentation Time: 3:45 PM - 5:30 PM
Autoantibodies Against Oxidized LDL In Diabetic Retinopathy
Satu Vavuli1A, Tuire Salonurmi1B, Sirpa Loukovaara2, Markku J. Savolainen1B,
Johanna Liinamaa1C. AInstitute of Clinical Medicine, BClinical Research Center,
Dept. of Internal Medicine, Institute of Clinical Medicine, CInstitute of Clinical
Medicine, Dept. of Ophthalmology, 1University of Oulu, Oulu, Finland; 2Dept. of
Ophthalmology, Helsinki University Central Hospital, Helsinki, Finland.
Purpose: Oxidized LDL (ox-LDL) has cytotoxic and immunogenic effects and
might therefore play a role in the development of diabetic retinopathy. The purpose
of this study was to investigate the role of oxidized LDL and autoantibodies against
ox-LDL in diabetic retinopathy.
Methods: The study population consisted of 229 diabetic patients with clinically
moderate to severe diabetic retinopathy (DR group) and 106 diabetic patients with
no clinical retinopathy (DC group). In addition, we had 139 non-diabetic patients
(C group) as controls. The diabetes duration was at least 10 years in the DC group.
Plasma samples were taken after an overnight fast and stored after centrifugation at
-70°C. Plasma IgG, IgM and IgA class autoantibody titers to copper oxidized LDL
(CuOx-LDL) and malonidialdehyde oxidized LDL (MDAOx-LDL) were measured
with chemiluminescence ELISA.
Results: The DR and DC groups did not differ in age, sex, diabetes type or diabetes
duration. The mean IgM titers for CuOx-LDL and MDAOx-LDL were lower for
diabetics, but did not differ significantly between DR and DC. The IgM(CuOxLDL) titers were 4277 (7191), 4152 (2952) and 6714 (10221) and IgM(MDAOxLDL) titers 3316 (4440), 3536 (2933) and 4258 (3577), for DR, DC and C groups,
respectively. IgG(CuOx-LDL) titers were 3476 (3721), 3667 (3361) and 3263
(3778), and IgG(MDAOx-LDL) titers 6827 (5397), 7177 (5056) and 7177 (5056),
for DR, DC and C groups, respectively. According to diabetes type the titers in DR
and DC were: IgM(CuOx-LDL) 3684 (3566) and 4613 (2910), respectively, for
type 1 (p=0.116) and 4796 (9250) and 3740 (2955), respectively, for type 2
(p=0.406). IgG(CuOx-LDL) titers were 3775(4197) and 3097 (2617) for type 1
(p=0.301) and 3296 (3363) and 4177 (3860) for type 2 (p=0.129) for DR and DC,
respectively. The effect on MDAOx-LDL titers was similar than for IgG titers. IgA
titers against both CuOx-LDL and MDA-LDL were very low.
Conclusions: IgG, IgA and IgM autoantibodies against ox-LDL did not differ
significantly between DR and DC. However, the diabetes type in DR has impact on
autoantibody titers, since in type 2 diabetics the IgM/IgG ratio was higher than in
type 1 diabetics.
Commercial Relationships: Satu Vavuli, None; Tuire Salonurmi, None; Sirpa
Loukovaara, None; Markku J. Savolainen, None; Johanna Liinamaa, None
Support: Finnish Eye Foundation
Program Number: 2430 Poster Board Number: A525
Presentation Time: 3:45 PM - 5:30 PM
Advanced Glycation End Products Upregulate CD40 in Endothelial Cells and
Muller Cells and Promote CD40-dependent Pro-inflammatory Responses
Jose-Andres C. Portillo1A, Jennifer A. Greene1A, Ram H. Nagaraj1B, Carlos
Subauste2. AMedicine/Infectious Diseases, BOphthalmology and Visual Sciences,
1
Case Western Reserve University, Cleveland, OH; 2Medicine, Case Western
Reserve Univ Sch of Med, Cleveland, OH.
Purpose: Advanced glycation end products (AGEs) play an important role in the
pathogenesis of vascular complications of diabetes. These disorders have an
important inflammatory component. CD40 is a member of the TNF receptor
superfamily that promotes various pro-inflammatory responses. We examined the
effects of AGEs on CD40 expression on endothelial cells and Muller cells as well
as on CD40-mediated pro-inflammatory responses.
Methods: Human primary endothelial cells and Muller cells were incubated with
methyl glyoxal (MGO)-modified fibronectin, MGO-modified human serum
albumin or appropriate controls. CD40 expression was assessed by flow cytometry.
Control or AGE-treated cells were incubated with or without CD154 (CD40
ligand). Expression of ICAM-1 and MCP-1 were examined by flow cytometry or
ELISA respectively.
Results: Incubation with MGO induced expression of AGEs in fibronectin as
assessed by immunofluorescence using anti-antibodies against hydroimidazolone or
argpyrimidine. MGO-modified fibronectin as well as MGO-modified human serum
albumin upregulated CD40 on primary human retinal endothelial cells, aortic
endothelial cells and Muller cells. CD40 upregulation was of functional relevance.
Compared to endothelial cells incubated with control fibronectin, endothelial cells
incubated with MGO-modified fibronectin exhibited higher upregulation of ICAM1 and MCP-1 production in response to CD154. Similarly, Muller cells incubated
with MGO-modified fibronectin produced higher amounts of MCP-1 and expressed
higher levels of ICAM-1 after CD154 stimulation.
Conclusions: These studies revealed that AGEs are modulators of CD40
expression in endothelial cells and Muller cells and enhance CD40-dependent proinflammatory responses.
Commercial Relationships: Jose-Andres C. Portillo, None; Jennifer A.
Greene, None; Ram H. Nagaraj, None; Carlos Subauste, None
Support: NIH Grant EY019250 (C.S.S), 5-2008-233 and 1-2009-204 from the
JDRF (C.S.S), Helen Weil Ross Memorial Grant from the Dietrich Diabetes
Research Institute (C.S.S), NIH Grant P30 EY11373,
Program Number: 2431 Poster Board Number: A526
Presentation Time: 3:45 PM - 5:30 PM
Copyright 2012 by the Association for Research in Vision and Ophthalmology, Inc., all rights reserved. For permission to reproduce any abstract, contact the ARVO Office at pubs@arvo.org.
ARVO 2012 Annual Meeting Abstracts by Scientific Section/Group – Biochemistry/Molecular Biology (BI)
Identification of a VEGF-independent and Plasma Kallikrein-Kinindependent pathway of retinal vascular permeability in Diabetic Macular
Edema
Takeshi Kita1A, Allen C. Clermont1A, Kimihiko Fujisawa2, Tatsuro Ishibashi2, Lloyd
P. Aiello1A,1B, Edward P. Feener1A,1C. AJoslin Diabetes Center, BDepartment of
Ophthalmology, CDepartment of Medicine, 1Harvard Medical School, Boston, MA;
2
Department of Ophthalmology, Graduate School of Medical Sciences, Kyushu
University, Fukuoka, Japan.
Purpose: We previously demonstrated that levels of plasma kallikrein-kinin system
(KKS) components including plasma kallikrein (PK) were increased in the vitreous
of patients with diabetic macular edema (DME) and identified subgroups of DME
patients with high PK and lower VEGF (vit↑PK), or high VEGF and lower PK
(vit↑VEGF) in their vitreous. In this study, we evaluated the direct effects of
vit↑PK and vit↑VEGF on retinal vascular permeability (RVP) following intravitreal
injection in rats. Since the effects of PK are mediated in large part by bradykinin
peptides, we also examined the role of bradykinin (BK), des-Arg9-bradykinin
(DABK), and B1 receptor (B1R) and B2 receptor (B2R) antagonists on RVP in
both diabetic and nondiabetic rats and retinal endothelial cells.
Methods: Cultured primary bovine retinal endothelial cells (REC) were stimulated
with BK (B2R agonist) or DABK (B1R agonist). vit↑PK and vit↑VEGF samples
were obtained from patients with DME but without proliferative diabetic
retinopathy and injected intravitreally into streptozotocin (STZ)-induced diabetic
rats. Effects on rat RVP following intravitreal injection of BK, DABK or vitreous
samples [with or without co-injection of bevacizumab or systemic administration of
des-Arg-Hoe140 (B1R antagonist) and Hoe140 (B2R antagonist)] were analyzed
by vitreous fluorophotometry. RVP following intravitreal injection of BK in eNOSdeficient mice was measured using Evans blue.
Results: Intravitreal injection of vit↑VEGF increased RVP within 40min, while
vit↑PK did so only after 48hrs. Hoe140/des-Arg10-Hoe140 inhibited vit↑PK
induced RVP but not vit↑VEGF induced RVP. Conversely, bevacizumab inhibited
vit↑VEGF induced RVP but not vit↑PK induced RVP. BK and DABK increased
RVP in diabetic rat at 40min and 48hrs, respectively, both of which were
significantly suppressed by systemic administration of L-NAME (a nitric oxide
synthesis inhibitor) and bradykinin receptor antagonists. Bevacizumab did not
inhibit BK- or DABK-induced RVP. In vitro, BK rapidly increased eNOS
phosphorylation in RECs. In addition, BK significantly increased RVP in wild type
mice, but not in eNOS deficient mice. Intravitreal injection of DABK increased
mRNA and protein expression of iNOS in diabetic rat retina, which co-localized
with glial fibrillary acidic protein (GFAP) and retinal vessels.
Conclusions: The effects of the KKS on RVP in diabetes involve the combined
actions of B1R and B2R, and are mediated at least in part, by nitric oxide. These
mechanisms are VEGF-independent. Heterogeneity of DME vitreous with regard to
VEGF and PK concentrations might account in part for variability of clinical
response to anti-VEGF agents.
Commercial Relationships: Takeshi Kita, None; Allen C. Clermont,
None; Kimihiko Fujisawa, None; Tatsuro Ishibashi, None; Lloyd P. Aiello,
None; Edward P. Feener, None
Support: NIH EY019029, Massachusetts Lions Eye Research, Juvenile Diabetes
Research Foundation, JSPS Postdoctoral Fellowships for Research Abroad
Program Number: 2432 Poster Board Number: A527
Presentation Time: 3:45 PM - 5:30 PM
Temporal and Spatial Expression of PHD-2 in Retina of Diabetic Rats
Cheng Yang, Gang Sun, Fang Chen, Huanjiao Zhou, Liqing Wei, Yungang Ding,
Xifang Zhang, Xiaoling Liang. State Key Laboratory of Ophthalmology,
Zhongshan Ophthalmic Center,Sun Yat-sen University, Guangzhou, China.
Purpose: To detect the expression and location of prolyl hydroxylase (PHD)-2 in
retina of diabetic rats.
Methods: Diabetes was induced in Wistar rats by a single injection of
streptozotocin. The retinal vasculature was observed by Evans blue perfusion.The
protein expression of PHD-2 and vascular endothelial growth factor (VEGF) was
determined by western blot analyses in the retina of the control rats and the diabetic
rats every month till 6months after STZ injection. To further define the location of
PHD-2 expression in the retina, immunohistochemistry was performed.
Results: The results of Evans blue perfusion were obtained in normal retinal
vessels without leakage. The stained vessels of diabetic retina showed increased
fluorescence,indicating the damage of retina-blood barrier. The protein expression
of VEGF was up-regulated after the onset of diabetic retina. The expression of
PHD-2 was stable in control retina,but decreased in the retina of rats firstly after
diabetics induction and reverted progressively since 3 months. Abundant
expression of PHD-2 protein was detected in the inner layers of retina in normal
control rats and diabetic rats.
Conclusions: The location of PHD-2 expression is in the inner layer of
retina,indicating that PHD-2 plays an important role in maintaining the functions of
vessels and nerve tissues. PHD-2 may play an important role in early diabetic
retinopathy.
Commercial Relationships: Cheng Yang, None; Gang Sun, None; Fang Chen,
None; Huanjiao Zhou, None; Liqing Wei, None; Yungang Ding, None; Xifang
Zhang, None; Xiaoling Liang, None
Support: None
Program Number: 2433 Poster Board Number: A528
Presentation Time: 3:45 PM - 5:30 PM
Deficiency Of p105 ( NFκB1) Increases Diabetes-induced Inflammation And
Vascular Degeneration In The Retina
Alexander A. Veenstra1, Nader Sheibani2, Timothy S. Kern3. 1Pharmacology, Case
Western Reserve University, Cleveland, OH; 2Ophthalmology and Visual Sciences,
Univ of Wisconsin-Madison, Madison, WI; 3Department of Medicine, Case
Western Reserve Univ, Cleveland, OH.
Purpose: Previous studies suggested that NFκB (p50/p65) contributes to the retinal
inflammation and capillary degeneration that are characteristic of early stages of
diabetic retinopathy in mice. p50 and p105 (NFκB1) (the precurser of p50) can
form heterotetramers and homodimers (p50) that inhibit NFκB-mediated
transcription. We postulated that deletion of p105 would eliminate possible p50
(and p105) inhibition of NFκB, and result in unrestrained inflammation and
pathology in diabetes.
Methods: Abnormalities characteristic of early stages of diabetic retinopathy were
evaluated in mice lacking the precursor of p50,(p105).
Results: Diabetes-induced increases in retinal capillary loss, superoxide generation
and iNOS levels were significantly increased in mice lacking p105. Leukocyte
superoxide generation was similarly increased. Murine retinal endothelial cells cocultured with leukocytes from diabetic animals were killed in greater numbers
when the leukocytes were isolated from diabetic animals lacking p105.
Conclusions: p105/p50 negatively regulates diabetes-induced inflammation and
vascular pathology of the retina, and its absence exacerbates diabetes-induced
vascular disease, further demonstrating the role of NFκB in development of
diabetic retinopathy.
Commercial Relationships: Alexander A. Veenstra, None; Nader Sheibani,
None; Timothy S. Kern, None
Support: NIH Grant EY000300
Program Number: 2434 Poster Board Number: A529
Presentation Time: 3:45 PM - 5:30 PM
Vitreous Biomarkers Correlate with the Severity of Proliferative Diabetic
Retinopathy: Implications for Treatment Development
Ann O. Igbre, Stephanie M. Ecker, Joshua C. Hines, Bert M. Glaser. National
Retina Institute, Towson, MD.
Purpose: The focus of this study was to explore potential proteomic biomarkers in
vitreous samples of patients with different severities of proliferative diabetic
retinopathy (PDR).
Methods: Seventy-two in-office vitreous aspirates were obtained from 42 patients
with PDR directly preceding intra-vitreal injection of bevacizumab. Twenty-four
age matched controls had vitreous aspirations drawn prior to vitrectomy for
macular hole or retinal detachment surgery. All vitreous aspirates in this study,
were drawn using a pars plana approach, with a 25 gauge needle on a 1 mL syringe.
Approximately 0.05 to 0.10 mL of vitreous fluid was aspirated from the midvitreous cavity. All 96 samples were probed against 44 pathway proteins using
Reverse Phase Protein Microarray technology.
Results: Statistical analysis revealed 17 proteins that have significantly different
levels of abundance between the non-diabetic controls and PDR samples. The
proteins that change most significantly are: C3a, αB Crystallin, MMP-9 and COX2,
all of which have a P-value of <0.01 and significant ROC curves with an AUC
>0.80. Interestingly, when the PDR patients were split based on patients with best
corrected ETDRS VA of 20/200 or less versus patients withVA better than 20/200,
20 proteins were shown to have significantly different levels. The presence of
vitreous hemorrhage did not change the results of the biomarkers studied. The most
significant of these proteins was FGFR Tyr 653/654, Estrogen Receptor α Ser118,
MMP-9 and BCL2 Thr 56, all of which have P-values <0.01 and significant ROC
curves with an AUC > 0.80.
Conclusions: Proteomic analysis reveals that there are biomarkers significantly
different between diabetic and non-diabetic patients. In addition, biomarkers differ
between diabetic patients who have significant loss in vision versus those with
stable vision. These differences in protein expression levels may lead to the
discovery of biomarkers that may provide us with better understanding of the
biology of PDR and possibly aid in the development of future treatments to prevent
the progression of PDR.
Commercial Relationships: Ann O. Igbre, None; Stephanie M. Ecker, Ocular
Proteomics LLC (E); Joshua C. Hines, Ocular Proteomics LLC (E); Bert M.
Glaser, Ocular Proteomics LLC (E)
Support: None
Program Number: 2435 Poster Board Number: A530
Presentation Time: 3:45 PM - 5:30 PM
Protective Effects Of Zeaxanthin On Retinal Pigment Epithelial Cells
Subjected To Methylglyoxal Damage
Copyright 2012 by the Association for Research in Vision and Ophthalmology, Inc., all rights reserved. For permission to reproduce any abstract, contact the ARVO Office at pubs@arvo.org.
ARVO 2012 Annual Meeting Abstracts by Scientific Section/Group – Biochemistry/Molecular Biology (BI)
Thomas O. Muldoon1A, Richard B. Rosen1A, Dan N. Hu1A, Men Chen1B, Howard
Savage1C, Steven A. McCormick1B. AOphthalmology, BPathology, CPthology, 1New
York Eye & Ear Infirmary, New York, NY.
Purpose: Methylglyoxal (MG) is the intermediate product of glycation and is the
precursor of advanced glycation endproducts (AGEs). MG itself and its metabolic
products (AGEs) are toxic to the cells. Excessive accumulation of MG due to aging
or hyperglycemia plays a role in the pathogenesis of various ocular diseases, e.g.
age-related macular degeneration and diabetic retinopathy. The present study
investigated the protective effects of zeaxanthin on retinal pigment epithelial (RPE)
cells against MG damage.
Methods: The toxic effects of MG and the protective effects of zeaxanthin on the
cell viability were tested in two human RPE cell lines (ARPE19 and a primary
culture of RPE cells from donor eye) using the MTT test. Cells were seeded into 96
well plates. Zeaxanthin was added to the medium at various concentrations. MG
(0.3 mM) was added 2 hr later and cultured for another 24 hr. Cells cultured
without any additive and cells cultured with MG alone were used as the negative
and positive controls, respectively. All groups were tested in triplicate.
Results: MG at 3 mM caused a decrease of 50 to 59% of cell viability of cultured
RPE cells. Pretreatment of zeaxanthin at 10-100 µM significantly protected RPE
cells against MG damage. Zeaxanthin at 10, 30 and 100 µM increased the cell
viability of RPE cells to 124%, 142% and 152% of cells treated with MG alone in
ARPE cells, respectively (P < 0.05 in all groups). Zeaxanthin at 10, 30 and 100 µM
increased the cell viability to 120%, 130% and 148% of cells treated with MG
alone in primary culture of RPE cells (P < 0.05 in all groups). However, cell
viability of cells treated with zeaxanthin and MG was still significantly lower than
that in cells not treated with MG (P < 0.05).
Conclusions: Zeaxanthin at 10-100 µM levels has a partial and significant
protective effect on the RPE cells subjected to MG damage in vitro.
Commercial Relationships: Thomas O. Muldoon, None; Richard B. Rosen,
None; Dan N. Hu, None; Men Chen, None; Howard Savage, None; Steven A.
McCormick, None
Support: NYEEI Ophthalmology Chairman’s Research Fund,the BendheimLowenstein Family Retina Center research Fund , New York Eye and Ear Infirmary
Pathology Research Fund, New York, NY , and Zeavision LLC.
Program Number: 2436 Poster Board Number: A531
Presentation Time: 3:45 PM - 5:30 PM
NADPH oxidase 4-derived Reactive Oxygen Species Mediate the Activation of
Adaptive Antioxidant Pathways in Early Diabetic Retinas of db/db mice
Meihua He, Hong Pan, Chunxia Xiao, Mingliang Pu. Anatomy, Peking University
Health Science Center, Beijing, China.
Purpose: To investigate the oxidative status and the role of Nox4 in the regulation
of Nrf2-mediated antioxidant pathway in the retina of db/db mice.
Methods: Male db/db C57BLKS/J mice aged at 8, 12, and 20 wks were used in
this study. Age-matched male heterozygous db/m littermates were used as control.
Animals were enucleated and isolated retinas were prepared for reactive oxygen
species (ROS) detection, immunohistochemistry, and western blotting analysis.
ROS generation was detected by dihydroethidium (DHE) assay, the expression of
4-hydroxy-2-nonenal (HNE), NADPH oxdase-4 (Nox4), and heme oxygenase-1
(HO-1) were examined by immunohistochemistry and western blotting.
Results: ROS generation in the retinas of db/db mice increased at 8 wks and
continued to progress at 20 wks of ages, compared to age-matched db/m mice.
Similarly, the expression of HNE, an end-product of polyunsaturated fatty acid
oxidation,was also increased in the retina of db/db mice in all three age groups (8,
12, and 20 wks). However, the increased expression of Nox4 was only observed in
the retinas of 8 and 12 wks, but not 20 wks db/db mice compared to age-matched
db/m mice. Meanwhile, in comparison with age-matched db/m mice, the expression
of HO-1, an Nrf2-mediated antioxidant, was also increased in the retinas of db/db
mice aged at 8 and 12 wks, but not at 20 wks.
Conclusions: The present results suggest that oxidative stress occurs in the early
stages of diabetic retina and Nox 4 contributes to the increased oxidative stress
(before 20 wks). Nrf2-mediated adaptive antioxidant pathway was activated to
counteract the increased oxidative stress in early diabetic retinas. The similar
activation pattern of Nox4 and HO-1 suggests that Nox4-derived ROS may play an
important role in regulating the activation of Nrf2-mediated antioxidant pathway
during the early stages of diabetic retinopathy in db/db mice.
Commercial Relationships: Meihua He, None; Hong Pan, None; Chunxia
Xiao, None; Mingliang Pu, None
Support: None
Program Number: 2437 Poster Board Number: A532
Presentation Time: 3:45 PM - 5:30 PM
Autophagy in Modified LDL-induced Pericyte Loss in Diabetic Retinopathy
Dongxu Fu, Jing Zhang, Shihe Yang, Mei Du, Mingyuan Wu, Kenneth Wilson,
Junping Chen, Timothy Lyons. Harold Hamm Oklahoma Diabetes Ctr, Univ of
Oklahoma Hlth Sci Ctr, Oklahoma City, OK.
Purpose: Our previous studies showed that in diabetic retinopathy (DR)
extravasated, modified LDL was associated with human retinal pericyte apoptosis
via activation of oxidative stress and ER Stress. Autophagy is a reparative process
and able to alleviate oxidative stress and ER stress, but if stress is prolonged,
autophagy may lead instead to cell death. Little is known about role of autophagy
in modified LDL-induced pericyte loss.
Methods: Human retinal capillary pericytes (HRCP) were exposed (for up to 24h)
to HOG-LDL vs. native LDL (N-LDL) (each at 50 or 200mg/L) with/without
pretreatment with inhibitors of autophagy (3-Methyladenine, 3MA), caspase (zVAD-fm), oxidative stress (N-Acetyl Cysteine, NAC), ER stress (4-phenyl butyric
acid, 4-PBA), JNK (sp600125). Cell viability, oxidative stress, ER stress, apoptosis
and autophagy were determined by methods including CCK-8 assay, western blots,
immunocytochemistry and TUNEL assay.
Results: Compared with N-LDL: (a) both doses of HOG-LDL activated oxidative
stress (increased ROS, 6h), ER Stress (increased expression of KDEL, p-eIF2α and
ATF6 nuclear translocation, 12h) and autophagy (increased expression of LC3II,
12h); (b) high but not low dose HOG-LDL decreased cell viability and induced
apoptosis (increase expression of Bax, AIF, Cyt-C and TUNEL positive cells, 24h);
however, when pretreated with 3-MA or sp600125, low dose HOG-LDL also
decreased cell viability and induced apoptosis; (c) HOG-LDL induced JNK
phosphorylation (12h) and increased expression of CHOP (12h); inhibition of
phospho-JNK or knockdown of CHOP attenuated autophagy (12h) and apoptosis
(24h) respectively.
Conclusions: Autophagys play different roles in modified LDL-induced pericyte
loss. Low dose HOG-LDL induced mild stress and anti-apoptotic effects of
autophagy promoted cell survival. High dose HOG-LDL induced severe stress and
autophagy was implicated in promotion of apoptosis.
Commercial Relationships: Dongxu Fu, None; Jing Zhang, None; Shihe Yang,
None; Mei Du, None; Mingyuan Wu, None; Kenneth Wilson, None; Junping
Chen, None; Timothy Lyons, None
Support: Oklahoma Center for the Advancement of Science and Technology
(HR08-067),
Program Number: 2438 Poster Board Number: A533
Presentation Time: 3:45 PM - 5:30 PM
Analysis And Comparison Of Human Circulatory MicroRNA Profiles Of
Aqueous And Vitreous Humour From Normal Eyes vs. Those With Diabetic
Retinopathy or AMD
Zeljka Smit-McBride1, Saadia Rashid2, Alfred K. Yu3, Susanna S. Park4, Leonard
M. Hjelmeland5, David G. Telander2, Lawrence S. Morse6. 1Vitreo-Retinal
Research Lab, Univ of California, Davis Sch of Med, Davis, CA; 2Ophthalmology,
University of California, Davis, Sacramento, CA; 3Ophthalmology & Vision
Science, University of California, Davis, Davis, CA; 4Ophthalmology & Vision
Science, Univ of California Davis Eye Ctr, Sacramento, CA; 5Ophthalmology,
Univ of California-Davis, Davis, CA; 6Ophthalmology, Univ of California-Davis,
Sacramento, CA.
Purpose: To investigate aqueous and vitreous humour microRNA profiles and to
explore the difference and similarities of microRNA species in normal eyes vs.
diabetic retinopathy or AMD patients.
Methods: Samples (12) were collected during standard of the care vitreoretinal
surgery - 3 control aqueous, 3 control vitreous, 2 diabetic retinopathy (DR)
aqueous, 2 DR vitreous, and 2 wet AMD aqueous. Controls were 2 macular
puckers and 1 displaced lens surgery sample. Samples were preserved in
RNAprotect, and stored at -20oC. MicroRNAs were isolated using QIAgen
microRNeasy kit. MicroRNA samples were quantified using a Nanodrop, labeled
with FlashTag kit and profiled on Affymetrix GeneChip miRNA 2.0 microarrays.
Data analysis was done using miRNAQCtool (Affymetrix) and IPA- Ingenuity
Pathway Analysis software.
Results: Comparison of circulatory microRNA population of aqueous and vitreous
humour showed that out of a total of 847 miRNA probes on the Chip, 25 were
present in both aqueous and vitreous samples, an additional 11 being unique for
aqueous samples, and 7 unique for vitreous. The most abundant common
microRNAs are members of the families hsa miR-218 (regulation of vascular
patterning and vascular guidance cues), hsa-miR-193 (differentiation of telocytes,
stromal cells between blood vessels and neurons, with a role in intercellular
signaling), and miR-let-7 (regulation of retinal Muller glia dedifferentiation and
retinal regeneration in teleosts). Comparison of aqueous and vitreous showed a
very similar abundance for a set of common miRNAs, and there are certain
circulatory microRNAs that are detected only in diabetic retinopathy and a different
set of microRNAs detected only in AMD patients.
Conclusions: The comparative profiling of circulatory microRNAs in the aqueous
and vitreous humour of normal eyes vs. those with diabetic retinopathy or AMD
shows that these molecular species are present in all samples with variability
related to the presence of either diabetic retinopathy or AMD. These results offer a
rationale for further studies on the potential use of ocular fluids for diagnostic or
ultimately therapeutic approaches involving micro RNAs.
Commercial Relationships: Zeljka Smit-McBride, None; Saadia Rashid,
None; Alfred K. Yu, None; Susanna S. Park, None; Leonard M. Hjelmeland,
None; David G. Telander, None; Lawrence S. Morse, None
Support: Macular Degeneration Research Fund, UC Davis; Research to Prevent
Blindness
Copyright 2012 by the Association for Research in Vision and Ophthalmology, Inc., all rights reserved. For permission to reproduce any abstract, contact the ARVO Office at pubs@arvo.org.
ARVO 2012 Annual Meeting Abstracts by Scientific Section/Group – Biochemistry/Molecular Biology (BI)
Program Number: 2439 Poster Board Number: A534
Presentation Time: 3:45 PM - 5:30 PM
The Expression Of Phosphorylated MeCP2 Is Altered In Proliferative Diabetic
Retinopathy Membranes
Shikun He, C. Spee, T. Yoshida, S. J. Ryan, D. R. Hinton. Ophthalmology-USC,
Doheny Eye Institute, Los Angeles, CA.
Purpose: Methyl-CpG-binding protein 2 (MeCP2) is an orchestrator of epithelial
myofibroblast transdifferentiation and a pivotal regulator in the development of
fibrotic response. MeCP2, especially phosphorylatd MeCP2 421, plays an
important role in the pathogenesis of neovascularization and the response to stress
and inflammation. The current research sought to investigate the expression of
phosphorylated MeCP2 in human proliferative diabetic retinopathy (PDR)
membranes and its association with VEGF and PEDF expression.
Methods: Five surgically excised membranes from patients (ages 45-70; 3 male, 2
female) with PDR were prepared for immunostaining. Tissues were snap frozen
and sectioned at 6 µm. Thawed tissue sections were air dried, rehydrated with PBS
(pH 7.4), fixed in acetone, and blocked with 5% normal goat serum. Sections were
stained with anti-MeCP2 phosphorylated forms (80 and 421), and anti-VEGF, antiPEDF and anti-DNA methyltransferase3a (DNMT3a). The red chromagen color
was developed using amino ethyl carbazole . The co-localization of MeCP2 and
VEGF or PEDF in the membranes was visualized using FITC and rhodaminelabeled secondary antibodies. Slides were examined using a Zeiss LSM510
confocal microscope.
Results: Both phosphorylated MeCP2 80 and 421 were positively stained in the
PDR membranes; however, the expression of MeCP2 421 was much stronger than
that of MeCP2 80. The high MeCP2 421 expression was associated with strong
expression of VEGF and negatively correlated with expression of PEDF in the
membranes. The immunoreactivity of DNMT was also abundant in the PDR
sections.
Conclusions: The expression of phosphorylated MeCP2 421 is increased in the
membranes of PDR. The upregulated expression of MeCP2 421 may be related to
the high expression of VEGF in the membranes.
Commercial Relationships: Shikun He, None; C. Spee, None; T. Yoshida,
None; S. J. Ryan, None; D. R. Hinton, None
Support: Grant support: NIH grants EY01545 and EY03040, RPB, Arnold &
Mabel Beckman Foundation
304 AMD Disease Mechanisms I
Tuesday, May 8, 2012, 8:30 AM - 10:15 AM
Room 305 Paper Session
Program #/Board # Range: 2712-2718
Organizing Section: Biochemistry/Molecular Biology
Contributing Section(s): Genetics Group
Program Number: 2712
Presentation Time: 8:30 AM - 8:45 AM
The Disease-associated Glycosaminoglycan-binding (Y402H) Region Of
Complement Factor H Mediates Host Recognition Of Human Bruch’S
Membrane And Choroid: Implications Of Age-related Macular Degeneration
Simon J. Clark1A, Liam Ridge1A, Andrew P. Herbert2, Svetlana Hakobyan3, Barbara
Mulloy4, Reinhard Wurzner5, Paul Morgan3, Dusan Uhrin2, Paul N. Bishop1A,
Anthony J. Day1B. AFaculty of Medicine and Human Sciences, BFaculty of Life
Sciences, 1University of Manchester, Manchester, United Kingdom; 2School of
Chemietry, University of Edinburgh, Edinburgh, United Kingdom; 3Department of
Medical Biochemistry and Immunology, Cardiff University, Cardiff, United
Kingdom; 4National Institute of Biological Standards and Controls, Potter's Bar,
United Kingdom; 5Division of Hygiene and Medical Microbiology, Innsbruck
Medical University, Innsbruck, Austria.
Purpose: Factor H (CFH) binds to host surfaces via its interaction with the
glycosaminoglycans (GAGs) heparan sulfate (HS) and dermatan sulfate (DS) and
thus suppresses local complement activation, thereby preventing tissue damage.
The CFH protein is comprised of 20 contiguous CCP domains, where it binds
GAGs via its CCPs6-8 and CCPs19-20 regions. The Y402H polymorphism in
CCP7, associated with AMD, alters CFH binding to HS/DS in Bruch’s
membrane/choroid, whereas polymorphisms in CCP19-20 are associated with renal
disease (i.e. atypical haemolytic uraemic syndrome). Here we directly compare the
GAG-binding properties of these two regions of CFH and determine their relative
contributions to the interaction of CFH with sites within the macula and kidney.
Methods: The heparin-binding properties of the CCPs6-8 region were compared
with recombinant CCPs19-20 and the full-length protein (flCFH) by using affinity
chromatography and solid phase binding assays. The competitive effects of CCP6-8
and CCP19-20 proteins on the binding of fluorescently-labelled flCFH to human
macula and kidney tissues were also investigated.
Results: Our studies demonstrate that the CCP6-8 region has a higher apparent
affinity for heparin than CCP19-20 and their sulfate specificities are somewhat
different. Interestingly, the CCP6-8 region makes more of a contribution to CFH’s
binding to human macula tissues (i.e. the Bruch’s membrane and choroid) than
CCP19-20, whereas the converse is seen for human kidney.
Conclusions: These data indicate that the CCP6-8 and CCP19-20 regions of CFH
have distinct GAG-binding specificities where the former is ‘tuned’ to interact with
GAGs in the macula. Furthermore, it provides an explanation as to why the Y402H
polymorphism in CCP7 is associated with AMD, whereas polymorphisms in
CCP19-20 are associated with renal disease. On the basis of these findings, tissue
specific modulation of complement activity might represent a feasible strategy for
the treatment of AMD.
Commercial Relationships: Simon J. Clark, None; Liam Ridge, None; Andrew
P. Herbert, None; Svetlana Hakobyan, None; Barbara Mulloy, None; Reinhard
Wurzner, None; Paul Morgan, None; Dusan Uhrin, None; Paul N. Bishop,
None; Anthony J. Day, None
Support: MRC grant no. G0900592
Program Number: 2713
Presentation Time: 8:45 AM - 9:00 AM
Regulation of Complement Factor H (CFH; chr 1q32) by multiple micro
RNAs (miRNAs) in human brain and retina
Walter J. Lukiw1, Surjyadipta Bhattacharjee1, Peter N. Alexandrov2, Yuhai Zhao3,
Prerna Dua4, Sergei Keryanov2. 1Neuroscience & Ophthalmology, Lousiana State
Univ Hlth Sci Ctr, New Orleans, LA; 2Neurogenetics, Russian Academy of
Medical Sciences, Moscow, Russian Federation; 3Center for Translational Injury
Research, University of Texas Health Sciences Center, Houston, TX; 4Department
of Health Information Management, Louisiana Technical University, Ruston, LA.
Purpose: Human brain and retinal cells rely on a specific set of micro RNAs
(miRNAs) to shape their gene expression patterns, and these actions are mediated
through miRNA effects on messenger RNA (mRNA) complexity. The purpose of
these studies was to examine (a) in short post-mortem interval (~1-2 hr)
Alzheimer’s disease (AD) association neocortex and retina; (b) in cytokine- and
Aβ42 peptide-stressed human neuronal-glial (HNG), astroglial (HAG) and
microglial (HMG) cells in primary culture; and (c) in several murine transgenic AD
(Tg-AD) models including Tg2576 and 5xFAD, the abundance of brain-and retinalabundant miRNA species that may impact mRNA speciation, alter gene expression,
and associate with neural and retinal pathology.We focused on pro-inflammatory
miRNAs, that through bioinformatics analysis, showed high potential to interact
stongly with the 3'-untranslated region (3'-UTR) of the mRNA encoding human
complement factor H (CFH; chr 1q32).
Methods: Aβ42-peptide+TNFα-induced stress; bioinformatics; DNA array; DNA
sequencing; human brain post-mortem tissue; human retinal tissue; human brain
and retinal cells in primary culture; gel shift assay; micro-RNA array; Northern
micro-dot blot analysis; RT-PCR; transfection assay; Western
immunohistochemistry
Results: In AD neocortex and retina, in stressed human brain cells, and in aging
Tg-AD models, we identified several brain-and retina-abundant miRNA species
that are consistently up-regulated, including miRNA-125b, miRNA-146a and
miRNA-155. Each of these inducible, NF-kB-regulated, 22 nucleotide small RNAs
target the 3’-UTR of mRNA encoding the innate-immune- and inflammationrelated regulatory protein, CFH, resulting in significant decreases in CFH
expression (p<0.01, ANOVA). Our results further indicate that HNG, HAG and
HMG cells each respond differently to Aβ42-peptide+TNFα-induced stress, in part
by variation in their intrinsic miRNA-125b-, miRNA-146a-and miRNA-155triggered responses. Both NF-kB and anti-miRNAs (AMs; antisense miRNAs;
antagomirs) were found to significantly quench miRNA-125b, miRNA-146a and
miRNA-155 induction, and restore CFH back to near homeostatic levels.
Conclusions: These data provide the first evidence of CFH expression regulation
by multiple miRNAs in the human brain and retina. The combinatorial use of NFκB inhibitors with antisense miRNA strategies may have potential as a multipronged therapeutic strategy directed against CFH-driven pathogenic signaling in
both neurodegenerative and retinal disease.
Commercial Relationships: Walter J. Lukiw, None; Surjyadipta
Bhattacharjee, None; Peter N. Alexandrov, None; Yuhai Zhao, None; Prerna
Dua, None; Sergei Keryanov, None
Support: Alzheimer's Association Investigator Initiated Research Grant (IIRG);
Louisiana Biotechnology Research Network (LBRN); NIH National Institute of
Aging (NIA)
Program Number: 2714
Presentation Time: 9:00 AM - 9:15 AM
Complement and Basal Deposit Formation in Efemp1-R345W Knockin Mice
Donita Garland1, Inderjeet Kaur1, Rosario F. Godino1, Kaye Speicher2, David
Speicher2, John Lambris3, Eric Pierce1. 1Ocular Genomics Institute, Massachusetts
Eye and Ear Infirmary, Boston, MA; 2Wistar Institute, Philadelphia, PA;
3
Department of Pathology, University of Pennsylvania, Philadelphia, PA.
Purpose: Doynes Honeycomb Retinal Dystrophy/Malattia Leventinese (DHRD
/ML), an inherited macular degeneration, is caused by a mutation in codon 345 of
EFEMP1. Knockin mice with the Efemp1-R345W mutation develop basal deposits
between the retinal pigment epithelia (RPE) and Bruch’s membrane and large
vacuoles in the RPE. These Efemp1-R345W mutant mice provide a model to study
the early stages in the pathogenesis of macular degeneration. In this study we
address the role of complement and the underlying mechanisms in the development
of the deposits and the RPE pathology.
Copyright 2012 by the Association for Research in Vision and Ophthalmology, Inc., all rights reserved. For permission to reproduce any abstract, contact the ARVO Office at pubs@arvo.org.
ARVO 2012 Annual Meeting Abstracts by Scientific Section/Group – Biochemistry/Molecular Biology (BI)
Methods: Deposit formation and RPE pathology were analyzed in Efemp1-R345W
knockin mice and Efemp1-R345W knockin mice that were null for C3 using
electron microscopy. Quantitative analyses of these features were done using
ImageJ software. A global analysis of the complement components in the basal
deposits was done using a proteomics approach with high resolution mass
spectrometry.
Results: The formation of deposits was essentially abolished in the Efemp1R345W mutant mice that were null for C3 and the formation of the large vacuoles
in the RPE was prevented. Complement components C3 and C4 were elevated in
Bruch’s membrane of Efemp1-R345W mutant mice relative to control mice. The
level of CFH was not increased in mutant relative to control mice. Low levels of
subunits A, B and C of C1q were observed and were elevated in the mutant mice.
Proteins required to initiate the lectin pathway were not detected.
Conclusions: These results implicate the classical complement pathway in
generating the deposits and the RPE pathology, since C1q binding initiates the
classical pathway. The demonstration that complement has an essential role in the
formation of drusen-like basal deposits in Efemp1-R345W knockin mice suggests
that complement is essential in an early step in the pathogenesis of macular
degeneration.
Commercial Relationships: Donita Garland, None; Inderjeet Kaur,
None; Rosario F. Godino, None; Kaye Speicher, None; David Speicher, None;
John Lambris, Potentia Pharmaceuticals (C); Eric Pierce, None
Support: Steinbach Foundation, Rosanne Silbermann Foundation, Foundation
Fighting Blindness, FM Kirby Center for Molecular Ophthalmology
Program Number: 2715
Presentation Time: 9:15 AM - 9:30 AM
Carboxymethyllysine and Pentosidine with Genotype as Predictors of AMD
John W. Crabb1,2, Geeng-Fu Jang1, Lei Zhang1, Jack S. Crabb1, Gayle J. Pauer1,
Craig D. Beight1, Stephanie A. Hagstrom1,2, Clinical Genomic and Proteomic AMD
Study Group. 1Cole Eye Institute, Cleveland Clinic, Cleveland, OH;
2
Ophthalmology, Cleveland Clinic Lerner College of Medicine of Case Western
Reserve University, Cleveland, OH.
Purpose: To establish molecular biomarkers for age-related macular degeneration
(AMD) susceptibility and progression. We have expanded AMD biomarker studies
of three oxidative protein modifications [carboxymethyllysine (CML), pentosidine
and carboxyethylpyrrole (CEP)] and four AMD risk genotypes [Y402H in CFH,
R80G in C3, A69S in ARMS2, and rs11200638 in HTRA1].
Methods: CML and furosine were quantified in AMD and control plasma by LC
MS/MS, pentosidine by LC fluorimetry, and CEP/CEP autoantibody by ELISA.
DNA was genotyped using TaqMan SNP genotyping assays. Logistic regression
modeling for c-statistics, odds ratios and p values was performed with SAS 9.2.
The risk for AMD was predicted based on genotype alone or in combination with
proteomic markers. Methods and results from 90 plasma specimens have been
reported for CML, pentosidine and furosine (2009 Mol Cell Proteomics 8, 1921)
and from 1404 plasma for CEP/CEP autoantibody (2009 Mol Cell Proteomics 8,
1338).
Results: CML, pentosidine and furosine measurements have been obtained from
~700 plasma samples and compared with available CEP data. CML and pentosidine
levels were elevated significantly in all categories of AMD but highest in advanced
atrophic AMD, up 23% and 65% respectively, relative to controls. No difference in
the concentration of furosine (fructosyl-lysine), a marker of early glycation, was
detected in control and non-diabetic AMD plasma, supporting a direct association
of CML and pentosidine with AMD. Combining CML and pentosidine plasma
concentrations with CEP marker levels yielded discriminatory accuracy (cstatistics) of ~89% for all AMD and >90% for geographic atrophy. Similar to that
previously reported for CEP, the AMD risk (odds ratio) for all disease categories
combined predicted for those with elevated CML or pentosidine in combination
with genotype was 2-5x higher than risk based on genotype alone (p < 0.001,
Fisher exact test), with joint effect odds ratios in the range of 7.6-25.5.
Conclusions: Molecular prognostics for identifying those susceptible to
progression to advanced AMD could help slow or prevent vision loss. Genomic
markers alone are insufficient for prognosis, as many carrying AMD risk genotypes
never develop AMD. In combination, CML, pentosidine, CEP and genomic
markers significantly improve AMD risk predictions.
Commercial Relationships: John W. Crabb, Allergan (C), SKS Ocular
(P); Geeng-Fu Jang, None; Lei Zhang, None; Jack S. Crabb, None; Gayle J.
Pauer, None; Craig D. Beight, None; Stephanie A. Hagstrom, None
Support: NIH grants EY021840, EY14239, EY16072, FFB Center Grant to Cole
Eye Inst, RPB Challenge Grant, RPB Sr Invest Award, RPB Special Scholar
Award, Steinbach Award.
Program Number: 2716
Presentation Time: 9:30 AM - 9:45 AM
Polarization Of Macrophages Toward M1 Pro-inflammatory Phenotype By
Oxidative Stress-induced Modifications Associated With Age-related Macular
Degeneration
Ali M. Saeed1, Fernando Cruz-Guilloty1, Stephanie J. Duffort1, Robert G.
Salomon2, Victor L. Perez1. 1Department of Ophthalmology, University of Miami,
Miami, FL; 2Department of Chemistry, Case Western Reserve University,
Cleveland, OH.
Purpose: Oxidative damage and inflammation have been widely recognized to
play a pathological role in the development of age-related macular degeneration
(AMD). Elevated retinal levels of carboxyethylpyrrole (CEP), a fatty-acid
oxidation fragment, have been correlated with AMD disease state. Additionally,
our previous studies have demonstrated CEP as the molecular link between
oxidative damage and inflammation; such that immunization of mice with CEPadducts leads to AMD-like lesions, anti-CEP antibody production, and localized
infiltration of macrophages. The impact of CEP on macrophage physiology is
unknown and we therefore sought to determine if CEP-adducts can lead to
macrophage activation and polarization (distinct production of inflammatory
cytokines).
Methods: Primary macrophage cultures were obtained by collecting the bone
marrow of C57BL/6 and BALB/c mice and culturing the marrow cells in L-929
cell-conditioned media for seven days. Macrophages were treated with CEP-MSA
or appropriate controls. Macrophage activation state was determined by measuring
cytokine production by ELISA and gene expression of cytokines and other relevant
genes by quantitative real-time PCR.
Results: Macrophages become activated in response to stimulation with CEPadducted proteins. Specifically, we found that CEP-adducts lead to upregulation of
inflammatory cytokines such as IL-12, TNF-α,and IL-1β, which indicate
macrophage activation and polarization to an M1 state. Upregulation of M2macrophage markers (like IL-10 and arginase) were not observed in response to
CEP-stimulation.
Conclusions: Our work demonstrates for the first time that CEP-adducts can lead
to macrophage activation and production of inflammatory cytokines. Specifically,
the cytokine profile we observed (IL-12, TNF-α, but not IL-10 production)
characterizes these macrophages as M1 macrophages, which are known to have a
pathological tissue destructive role. Importantly, the observed M1 phenotype from
this in vitro study mirrors our in vivo findings of retina-infiltrating M1 (but not
M2) macrophages in CEP-immunized mice. Overall, our findings suggest that CEP
triggers an inflammatory response and may play an initiating (or at least
supporting) role in retinal inflammation that leads to AMD.
Commercial Relationships: Ali M. Saeed, None; Fernando Cruz-Guilloty,
None; Stephanie J. Duffort, None; Robert G. Salomon, Patent (P); Victor L.
Perez, SKS Ocular (C)
Support: FCG is a Howard Hughes Medical Institute Fellow of the Life Sciences
Research Foundation, The Edward N. & Della L. Thome Foundation (VLP), NEI
P30 EY014801, Research to Prevent Blindness.
Program Number: 2717
Presentation Time: 9:45 AM - 10:00 AM
Oxidative Stress Sensitizes RPE Cells To Complement-Mediated Injury In A
Lectin Pathway- And Malondialdehyde Epitope-Dependent Manner
Baerbel Rohrer1, Kusumam Joseph1, Liudmila Kulik2, Steffen Thiel3, Nicole
Thielens4, V M. Holers2. 1Ophthalmology, Med Univ of South Carolina,
Charleston, SC; 2Medicine, University of Colorado School of Medicine, Aurora,
CO; 3Biomedicine, Aarhus University, Aarhus, Denmark; 4Institute for Structural
Biology, Grenoble, France.
Purpose: Uncontrolled activation of the alternative complement pathway is
thought to be associated with age-related macular degeneration (AMD). Previously,
we have shown that in retinal pigmented epithelium (RPE) monolayers, oxidative
stress reduced complement inhibitor expression and function on the cell surface,
resulting in sublytic activation of the membrane attack complex . Here we
examined the potential ligand and pathway(s) involved in initiating complementdependent RPE cell damage by oxidative stress.
Methods: ARPE-19 cells were grown as monolayers on transwell plates. Sublytic
complement activation was induced by challenging monolayers with H2O2 in the
presence of complement-sufficient normal human serum (NHS). Since sublytic
complement activation results in VEGF release, which in turn reduces barrier
function, transepithelial electrical resistance (TER) measurements were used as a
measure of cell injury.
Results: (1) TER deteriorated rapidly in H2O2-exposed monolayers upon adding
NHS as a source of complement. While the effect required alternative pathway
(AP) activation, the AP was not sufficient, since elimination of MBL/MASP
prevented TER reduction. Elimination of C1q from NHS had no effect. (2)
Reconstitution experiments revealed that both ficolin/MASP and MBL/MASP can
activate the complement cascade. (3) Ig-depleted human serum or mouse serum
from RAG-deficient mice eliminated the effect, demonstrating a requirement for Ig
to initiate injury. (4) TER reduction could be reinstituted using natural IgMproducing monoclonal antibodies (mAbs), with the most effective IgM recognizing
a malondialdehyde (MDA) epitope.
Conclusions: Oxidative stress sensitizes RPE cells to the deleterious effects of a
dysregulated complement system. Using a combination of complement-depletion
and reconstitution strategies, we have shown that the lectin pathway (LP) is
required to initiate the complement cascade, which is then further amplified by the
AP. LP activation is potentially triggered by natural IgM bound to MDA. In
summary, we have developed a model that reconstitutes complement activation in
Copyright 2012 by the Association for Research in Vision and Ophthalmology, Inc., all rights reserved. For permission to reproduce any abstract, contact the ARVO Office at pubs@arvo.org.
ARVO 2012 Annual Meeting Abstracts by Scientific Section/Group – Biochemistry/Molecular Biology (BI)
oxidatively stressed RPE, linking together important molecular events involved in
AMD, including the presence of autoantibodies to MDA-related epitopes that are
newly expressed.
Commercial Relationships: Baerbel Rohrer, None; Kusumam Joseph,
None; Liudmila Kulik, None; Steffen Thiel, None; Nicole Thielens, None; V. M.
Holers, None
Support: NIH grant EY019320, a Department for Veterans Affairs merit award
RX000444, Foundation Fighting Blindness and Research to Prevent Blindness.
Program Number: 2718
Presentation Time: 10:00 AM - 10:15 AM
Dicer1 Protects Rpe Cells By Regulating Caspase-1 And Myd88 Activation
Benjamin J. Fowler, Yoshio Hirano, Valeria Tarallo, Sami Dridi, Bradley Gelfand,
Nagaraj Kerur, Won Gil Cho, Sasha Bogdanovich, Mark Kleinman, Jayakrishna
Ambati. Ophthalmology, University of Kentucky, Lexington, KY.
Purpose: DICER1 maintains RPE cell health by regulating the expression of toxic
Alu RNA transcripts. Also, RPE can be rescued from Alu RNA toxicity by
overexpression of DICER1. Until now, the mechanism of Alu RNA toxicity was
unknown. Here, we reveal that DICER1 is an essential endogenous negative
regulator of NLRP3 inflammasome activation, and that DICER1 deficiency leads to
Alu RNA and Caspase-1-mediated, MyD88-dependent, microRNA-independent
RPE degeneration.
Methods: Caspase-1 activation was monitored by western blot analysis and by a
fluorescent reporter. IRAK 1/4 phosphorylation was measured by western blot
analysis. Subretinal injections of AAV1-BEST1-Cre vectors were performed in
order to delete DICER1 from Dicer1f/f mice. DICER1 knockdown and Alu RNA
blockade in vivo and in vitro was accomplished by antisense oligonucleotide
transfection. RPE degeneration was monitored by fundus photography and retinal
flat-mounts stained for ZO-1. Caspase-1 and MyD88 activation in vivo were
suppressed by intravitreous injection of known inhibitors. miRNA levels were
quantified by real-time qPCR.
Results: Alu RNA-induced Caspase-1 activation in human RPE cells was inhibited
by DICER1 overexpression. On the other hand, Caspase-1 cleavage induced by
DICER1 knockdown in human RPE cells was inhibited by simultaneous antisensemediated knockdown of Alu RNA. RPE degeneration and increased caspase-1
cleavage was observed in BEST1 Cre; Dicer1f/f mice, and also after subretinal
delivery of AAV1-BEST1-Cre in Dicer1f/f mice. DICER1 deficit-induced
pathology was blocked by intravitreous administration of the Caspase-1-inhibitory
peptide but not a control peptide. Similarly, AAV1-BEST1-Cre-induced RPE
degeneration in Dicer1f/f mice was also blocked by MyD88-inhibitory peptide but
not a control peptide. Also, the MyD88-inhibitory peptide prevented cell death in
human RPE cells treated with antisense oligonucleotides targeting DICER1.
Furthermore, DICER1 knockdown in human RPE cells increased phosphorylation
of IRAK1/4. The MyD88-inhibitory peptide also prevented cell death in Dicer1f/f
mouse RPE cells treated with an adenoviral vector coding for Cre recombinase.
Finally, MyD88 inhibition blocked RPE cell death without restoring the microRNA
expression deficits induced by Dicer1 knockdown.
Conclusions: Our data provide a novel anti-inflammatory role for DICER1:
Dampening inflammasome activation in RPE cells. Until now, NLRP3
inflammasome activation in vivo has been largely restricted to immune cells,
although our findings open the possibility that NLRP3 inflammasome activity may
be more widespread than previously thought. Importantly, these results provide
several new therapeutic strategies for patients with GA.
Commercial Relationships: Benjamin J. Fowler, None; Yoshio Hirano,
None; Valeria Tarallo, None; Sami Dridi, None; Bradley Gelfand,
None; Nagaraj Kerur, None; Won Gil Cho, None; Sasha Bogdanovich,
None; Mark Kleinman, None; Jayakrishna Ambati, iVeena (E, P), University of
Kentucky (P)
Support: NIH Grant TL1RR033172; UL1RR033173
350 Carotenoids and Retinoids (Macular Pigment and Visual Cycle)
Tuesday, May 8, 2012, 1:45 PM - 3:30 PM
Hall B/C Poster Session
Program #/Board # Range: 3343-3383/A488-A528
Organizing Section: Biochemistry/Molecular Biology
Program Number: 3343 Poster Board Number: A488
Presentation Time: 1:45 PM - 3:30 PM
Transcriptional Control of the Human RPE65 Promoter
Kecia L. Feathers1A, Cameron R. Strong1A, Sarah J. Garnai1A, Debra A.
Thompson1A,1B. AOphthalmology and Visual Sciences, BBiological Chemistry,
1
Univ of Michigan Med School, Ann Arbor, MI.
Purpose: In an effort to better understand the mechanisms involved in regulating
gene expression necessary for the specialized functions of the RPE, the purpose of
our studies was to identify the molecular interactions that regulate the promoter
activity of RPE65, the human gene encoding the visual-cycle retinoid isomerase.
Methods: A series of reporter constructs was generated by cloning genomic
sequence from the 5’-flanking region and first intron of human RPE65 (-2976 to
+1275 relative to the TSS) upstream of the firefly-luciferase gene in pGL3. Each
construct incorporated an ATG->TTG mutation of the RPE65-start codon.
Expression constructs encoding MITF, OTX2, CRX, and NRL were generated in
pcDNA3.1 using cDNAs amplified from human RPE/choroid-total RNA. Relative
transcriptional activity was evaluated in transfected HEK293T and D407 cells in
assays of firefly-luciferase activity normalized to the activity of a control Renilla
luciferase construct.
Results: Assays of luciferase activity in cells transfected with RPE65 reporter
constructs showed that the maximal-transcriptional activity attributable to the
upstream region was present within the sequence from -748 to +38. Constructs that
included the complete intron 1 sequence exhibited significantly more activity than
those containing only upstream sequence. However, the activity of constructs that
included the first 315 bp of intron 1 was profoundly reduced, suggesting the
presence of a silencer element in this region. Cotransfection of RPE65 reporter
constructs with a cDNA encoding the transcription factor MITF that regulates TYR
and BEST1 expression in the RPE had no positive effect on transcriptional activity.
Similarly, the transcription factors CRX and Nrl involved in regulating gene
expression in photoreceptor cells had little effect. However, cotransfection of a
cDNA encoding the transcription factor OTX2 that is necessary for TYR expression
significantly increased RPE65 reporter construct activity. No synergism was
detected in assays of reporter constructs in cells that were cotransfected with the
transcription factors in pairs.
Conclusions: Regulation of RPE65 promoter activity in transfected cells by OTX2,
but not MITF, suggests that the mechanisms controlling the expression of the visual
cycle genes are both unique, and overlapping, with those controlling other key
aspects of RPE function. Further understanding of the molecular mechanisms that
regulate RPE-gene expression will be important for future efforts to develop RPEtargeting vectors and cell-culture models.
Commercial Relationships: Kecia L. Feathers, None; Cameron R. Strong,
None; Sarah J. Garnai, None; Debra A. Thompson, None
Support: Foundation Fighting Blindness, Research to Prevent Blindness, and NIH
P30-EY07003
Program Number: 3344 Poster Board Number: A489
Presentation Time: 1:45 PM - 3:30 PM
The Rd12 Allele Of Rpe65 Has A Weak Negative Effect On Vision
Charles B. Wright1, Micah A. Chrenek1, Jeffrey H. Boatright2, John M. Nickerson1.
1
Ophthalmology, Emory University, Atlanta, GA; 2Ophthalmology, Emory
University School of Med, Atlanta, GA.
Purpose: Rpe65 knockout (KO), rd12, and TVRM148 mice are three reported
models of recessive, loss-of-function Rpe65 deficiency. Closer phenotypic
examination of these mutants reveals rd12 mice experience an earlier visual
function loss than other Rpe65 mutants. We sought to determine if the nonsense
rd12 mutation slightly negatively affects the visual system and how that might
occur.
Methods: Optokinetic tracking (OKT) and electroretinography (ERG) were used to
assess the visual acuity and retinal function of C57BL/6 (+/+), Rpe65 KO
(KO/KO), rd12 (rd12/rd12), rd12 heterozygote (rd12/+), Rpe65 KO heterozygote
(KO/+), Rpe65 KO/rd12 compound heterozygote (KO/rd12), TVRM148
heterozygote (T/+), and TVRM148 (T/T) mice. Quantitative measurements on
outer nuclear layer (ONL) thickness were performed on retina cross-sections. At
P30, western blotting with an N-terminal 1-43 amino acid specific antibody was
used for Rpe65 protein detection, and steady-state Rpe65 RNA levels were detected
through qRT-PCR. Data were analyzed with analysis of variance (ANOVA) with
post-hoc Student Newman-Keuls testing.
Results: +/+, KO/+, and T/+ mice had a constant visual acuity (0.38 c/d, or 100%)
through P210. rd12/+ mice had 92% visual acuity at P30 but declined to 79% visual
acuity by P210. KO/KO and T/T mice lost 50% visual acuity by P120 and had no
detectable visual acuity by P210. Conversely, rd12/rd12 mice lost detectable visual
acuity at a much earlier age, with 50% visual acuity at P60 and 0% by P120.
KO/rd12 mice lost visual acuity similarly to rd12/rd12 mice (79% at P30 and 0% at
P120). ERG results parallel OKT results. Comparison of +/+, KO/KO, rd12/rd12,
and T/T retina morphologies showed mutant lines experience ONL thinning but
preserved architecture. qRT-PCR showed rd12/rd12 Rpe65 mRNA does not
undergo nonsense-mediated decay, but western blotting showed no detectable 43
amino acid peptide.
Conclusions: Visual function loss in rd12/rd12, rd12/+, KO/rd12 mice suggests the
rd12 mutation exerts a slight negative effect on the visual system. KO/+ and T/+
OKT and ERG data suggests that the rd12/+ visual function loss is not the result of
Rpe65 haploinsufficiency. The presence of the rd12 Rpe65 transcript, not of an
Rpe65 protein fragment, may be responsible for a mild gain-of-function toxicity in
the visual system.
Commercial Relationships: Charles B. Wright, None; Micah A. Chrenek,
None; Jeffrey H. Boatright, None; John M. Nickerson, None
Support: Research to Prevent Blindness, The Foundation Fighting Blindness,
NIHP30EY06360, NIHR01EY016470, NIHR24EY017045, NIHT32EY007092,
NIHR01EY014026, The Katz Foundation
Program Number: 3345 Poster Board Number: A490
Copyright 2012 by the Association for Research in Vision and Ophthalmology, Inc., all rights reserved. For permission to reproduce any abstract, contact the ARVO Office at pubs@arvo.org.
ARVO 2012 Annual Meeting Abstracts by Scientific Section/Group – Biochemistry/Molecular Biology (BI)
Presentation Time: 1:45 PM - 3:30 PM
A Novel Visual Cycle In The Inner Retina Of Chicken
Mario E. Guido1, Nicolas M. Diaz1, Diego J. Valdez1, Daniela M. Verra1, Brandi S.
Betts2, Andrew T. Tsin3. 1Biological Chemistry, CIQUIBIC-CONICET, Facultad Cs
Quimicas, National University of Cordoba, Cordoba, Argentina; 2Biology,
University of Texas at San Antonio, San Antonio, TX; 3Biology, University of
Texas San Antonio, San Antonio, TX.
Purpose: In previous studies, we demonstrated the presence of intrinsically
photosensitive retinal ganglion cells (ipRGCs) expressing the photopigment
melanopsin in the wild type (WT) chicken retina as well as light responses
mediated by the inner retina of GUCY1* (blind) birds (Contin et al., 2006, 2010;
Valdez et al., 2009; Verra et al., 2011). Therefore, bistable photopigments
presumably responsible for photosensitivity may use a novel visual cycle for
chromophore regeneration that relies upon distinct isomerases through lightdependent or -independent processes (Wang et al., 2010). In the present study, we
investigated the expression of the photoisomerase RGR and zebrafish RPE65c
(cone cycle isomerase, Takahashi et al., 2011) as well as the activity of visual cycle
enzymes and levels of retinal chromophores (11-cis RAL and all-trans RAL) in the
inner retina of WT birds.
Methods: Dark-adapted young WT chickens were exposed to a 30 min light pulse
(2000 lux) or kept in the dark and sacrificed under dim red light. Eyes were
dissected and lyophilized, and the inner retina or different cell layers (ganglion cell
layer: GCL, inner nuclear layer: INL) obtained by the Scotch tape method (Guido
et al., 2001). Samples were processed for RNA extraction, RT-PCR,
immunochemical (RPE65c antibody from Dr. Ma at UOHSC) or enzyme activity
assays. Retinoids extracted were analyzed by HPLC.
Results: Levels of 11-cis RAL were higher in the GCL and INL samples from
light-adapted birds as compared with levels of all-trans RAL which were higher in
the dark samples. Also, we observed the presence of RGR and RPE65c-like protein
in different inner retinal cell layers: RGR in the GCL while RPE65c-like protein in
the INL and IPL. Isomerase activity was found in the INL only while acyl
CoA:retinol acyltransferase (ARAT) was observed in both INL and GCL.
Conclusions: These results demonstrate that in the chicken, different inner retinal
cell layers differentially express RGR and RPE65c-like proteins and selectively
display enzyme activities for isomerase and ARAT. The different light-dark effects
on retinoids and the differential distribution of photoisomerases present in the
retina strongly suggest that light-induced isomerization of retinal in the chicken
inner retina differs from those described in the classical and cone-visual cycles.
These results suggest that a novel visual cycle exists in the chicken inner retina to
support retinoid isomerization in ipRGCs or other photosensitive cells.
Commercial Relationships: Mario E. Guido, None; Nicolas M. Diaz,
None; Diego J. Valdez, None; Daniela M. Verra, None; Brandi S. Betts,
None; Andrew T. Tsin, None
Support: Agencia Nacional de Promoción Científica y Tecnológica (FONCyT)
(PICT 2004 No 967 and PICT Bicentenario 2010 No 647), CONICET, SeCyTUNC, MinCyT Cordoba, UTSA-CRTS
Program Number: 3346 Poster Board Number: A491
Presentation Time: 1:45 PM - 3:30 PM
A2E and Lipofuscin Accumulation in the Retinal Pigment Epithelium of wild
type and Abca4-deficient mice does not require Light Exposure
Nicholas Boyer, Daniel Higbee, Zsolt Ablonczy, Rosalie K. Crouch, Yiannis
Koutalos. Ophthalmology, Med Univ of South Carolina, Charleston, SC.
Purpose: To test the effect of light exposure on the levels of lipofuscin and A2E in
the retinal pigment epithelium (RPE). Current models of the formation of
lipofuscin require photoactivation of rhodopsin and subsequent release of all-transretinal leading to the formation of major fluorophores such as A2E.
Methods: 129/sv and Abca4-/- mice were reared in cyclic light or in darkness for up
to 12 months. The Abca4-/- animals were on a 129/sv background. Dark-reared
animals were exposed to dim red light only for monitoring and cage changes. A2E
was measured from chloroform-methanol extracts of RPE-choroid samples with
HPLC-UV/VIS spectroscopy. The identity of A2E was confirmed with tandem
mass spectrometry. Lipofuscin fluorescence was measured from whole flattened
eyecups with a 10× lens (NA = 0.3) on a SP2 Leica Laser Scanning Confocal
microscope (excitation, 488 nm; emission, 565-725 nm) after removal of the retina.
Samples were prepared under dim red light.
Results: Both lipofuscin and A2E levels increased with age in both Abca4-/- and
129/sv mice. For each strain, there was no difference in the absolute levels and the
rates of increase of lipofuscin and A2E between dark-reared and cyclic-light-reared
animals. In 129/sv animals, A2E accumulated at a rate of ~1 pmol/eye/month,
while in Abca4-/- animals at ~6 pmol/eye/month. In Abca4-/- animals, lipofuscin
accumulated at a rate ~2× higher than in 129/sv.
Fluorescence emission spectra (excitation, 488 nm) of lipofuscin granules from
dark-reared 129/sv and Abca4-/- mice were very similar to each other and to those
from cyclic-light-reared animals, with a broad peak at λmax ~ 610 nm.
Conclusions: The formation of lipofuscin and A2E in the RPE do not require the
generation of all-trans-retinal through exposure to light. A major source of
lipofuscin and A2E may be 11-cis-retinal, either free or as part of rhodopsin. The
results also suggest the need to reexamine the role of the Abca4 protein.
Support: NIH grants R01 EY014850 (YK), R01 EY004939 (RKC), R21 EY020661
(ZA/RKC), EY019065 (ZA), R24 EY14793 (MUSC vision core), Foundation
Fighting Blindness, Inc. (Owings Mills, MD) (RKC); and unrestricted awards to
the Departments of Ophthalmology at MUSC from Research to Prevent Blindness
(RPB; New York); RKC is an RPB Senior Scientific Investigator.
Commercial Relationships: Nicholas Boyer, None; Daniel Higbee, None; Zsolt
Ablonczy, None; Rosalie K. Crouch, None; Yiannis Koutalos, None
Support: NIH grants R01 EY014850 (YK), R01 EY004939 (RKC), R21
EY020661 (ZA/RKC), EY019065 (ZA), R24 EY14793 (MUSC vision core),
Foundation Fighting Blindness, Research to Prevent Blindness
Program Number: 3347 Poster Board Number: A492
Presentation Time: 1:45 PM - 3:30 PM
Removal Of All-Trans Retinol From Isolated Mouse Rod Photoreceptors By
Interphotoreceptor Retinoid-Binding Protein (IRBP)
chunhe chen1, Yiannis Koutalos1, Molly Sprada2,3, Federico GonzalezFernandez2,3. 1Ophthalmology, MUSC, Charleston, SC; 2Research Service,
VAWNYHS, Amherst, NY; 3SUNY Eye Institute, University at Buffalo/SUNY,
Buffalo, NY.
Purpose: To examine the removal of the all-trans retinol formed after rhodopsin
bleaching in the outer segment of single living mouse rod photoreceptors. All-trans
retinol is formed in outer segments from the reduction of the all-trans retinal
released from photoactivated rhodopsin; it is removed from outer segments by
IRBP, a specialized carrier present in the interphotoreceptor matrix (IPM).
Methods: Native IRBP was extracted from the soluble IPM fraction of bovine
retinas, and purified by a combination of concanavalin-A affinity, ion exchange,
and S-300 size-exclusion chromatography. The concentration of the purified IRBP
was determined by absorbance spectroscopy, and amino acid analysis. Experiments
were carried out with dark-adapted living rod photoreceptors isolated from 2-3
months old 129/sv wild type mice. The amount of all-trans retinol in the outer
segment was measured from its fluorescence (excitation 360 nm; emission >420
nm). Different concentrations of IRBP were added to the extracellular solution 30
min after bleaching and the removal of all-trans retinol was monitored from the
decline in outer segment fluorescence. In some experiments IRBP was present in
the extracellular solution prior to bleaching. Experiments were carried out at 37 0C.
Results: IRBP removed retinol with approximately first order kinetics. The rate
constant for all-trans retinol removal increased linearly with the concentration of
IRBP, reaching 0.29±0.05 min-1 at an extracellular concentration of 20 µM. At the
same extracellular concentrations of IRBP, removal of retinol proceeds with a
higher rate constant from mouse than from frog rod photoreceptors. When a similar
to the physiological 5 µM concentration of IRBP was present in the extracellular
solution, from the time before bleaching and throughout the experiment, the
concentration of retinol in the outer segment declined rapidly, having reached its
peak immediately after bleaching.
Conclusions: IRBP is highly effective in removing the retinol generated in mouse
rod outer segments after bleaching. The results indicate that the small diameter of
the mammalian rod outer segment may be an important independent factor in
facilitating the removal of retinol.
Commercial Relationships: chunhe chen, None; Yiannis Koutalos,
None; Molly Sprada, None; Federico Gonzalez-Fernandez, None
Support: NIH/NEI grants EY014850 and EY09412, Veterans Affairs R&D grant
I01BX007080, and unrestricted grants to MUSC Storm Eye Institute, and SUNY
Ross Eye Institute from Research to Prevent Blindness, Inc.
Program Number: 3348 Poster Board Number: A493
Presentation Time: 1:45 PM - 3:30 PM
Formation Of All-Trans Retinol After Bleaching In Single Isolated Human
Rod Photoreceptors
Yiannis Koutalos1, Chunhe Chen1, Zsolt Ablonczy1, Rosalie Crouch1, Molly
Sprada2,3, Federico Gonzalez-Fernandez2,3. 1Ophthalmology, Medical Univ of
South Carolina, Charleston, SC; 2Research Service, VAWNYHS, Amherst, NY;
3
SUNY Eye Institute, University at Buffalo/SUNY, Buffalo, NY.
Purpose: To examine the formation of all-trans retinol after rhodopsin bleaching in
the outer segment of single living human rod photoreceptors. All-trans retinol is
formed in rod outer segments from the reduction of the all-trans retinal released
from photoactivated rhodopsin via a reaction that utilizes NADPH.
Methods: Interphotoreceptor retinoid-binding protein (IRBP) was extracted from
the soluble interphotoreceptor matrix fraction of bovine retinas, and purified by a
combination of concanavalin-A affinity, ion exchange, and S-300 size-exclusion
chromatography. The concentration of the purified IRBP was determined by
absorbance spectroscopy, and amino acid analysis. Single living rod photoreceptors
were isolated from the retinas of human cadaver eyes (ages 21 to 90 years) obtained
from National Disease Resource Interchange. The visual pigment of isolated cells
was regenerated by incubating with 11-cis retinal using IRBP as a carrier. After
regeneration, the cell was bleached and all-trans retinol formation was measured by
Copyright 2012 by the Association for Research in Vision and Ophthalmology, Inc., all rights reserved. For permission to reproduce any abstract, contact the ARVO Office at pubs@arvo.org.
ARVO 2012 Annual Meeting Abstracts by Scientific Section/Group – Biochemistry/Molecular Biology (BI)
imaging its fluorescence (excitation 360 nm; emission >420 nm) in the outer
segment. Experiments were carried out at 37 0C.
Results: Bleaching of regenerated isolated human rod photoreceptors resulted in an
increase in all-trans retinol fluorescence in the outer segment. Formation of alltrans retinol proceeded with a rate constant of 0.2 - 0.4 min-1, which is several
times faster than in mouse rod photoreceptors. Subsequently, outer segment
fluorescence declined indicating the elimination of retinol.
Conclusions: Formation of all-trans retinol in the outer segments of human rod
photoreceptors proceeds much faster than in mouse cells. This is consistent with the
faster regeneration of rhodopsin after bleaching in humans. The results point to the
ability of the metabolic machinery of human rod photoreceptors to supply at a high
rate the NADPH necessary for the formation of all-trans retinol.
Commercial Relationships: Yiannis Koutalos, None; Chunhe Chen,
None; Zsolt Ablonczy, None; Rosalie Crouch, None; Molly Sprada,
None; Federico Gonzalez-Fernandez, None
Support: NIH/NEI grants EY014850, EY09412, EY020661, EY04039,
EY019065, Veterans Affairs R&D grant I01BX007080, Research to Prevent
Blindness, Inc.
Program Number: 3349 Poster Board Number: A494
Presentation Time: 1:45 PM - 3:30 PM
Identification of a New Class of Non-Retinoid RBP4 Antagonists
Nicoleta Dobri1A, Xiaoming Xu1B, Konstantin Petrukhin1A. AOphthalmology,
B
Medicine, 1Columbia University, New York, NY.
Purpose: Visual cycle inhibitors may reduce the formation of toxic bisretinoids
and prolong RPE and photoreceptor survival in dry AMD. Rates of the visual cycle
and A2E production depend on the influx of all-trans retinol from serum to the
RPE. Formation of the tertiary retinol-binding protein 4 (RBP4)-transthyretin
(TTR)-retinol complex in serum is required for retinol uptake from circulation to
the RPE. Retinol-binding site on RBP4 is sterically proximal to the interface
mediating the RBP4-TTR interaction. RBP4 antagonists that compete with serum
retinol for binding to RBP4 while blocking the RBP4-TTR interaction would
reduce serum retinol, slow down the visual cycle, and inhibit formation of
cytotoxic bisretinoids. The purpose of this study is to identify new classes of RBP4
antagonists.
Methods: We developed and optimized the TR-FRET assay for compounds
antagonizing retinol-dependent RBP4-TTR interaction using purified MBP-tagged
RBP4 and apo-TTR directly labeled with Eu3+-cryptate. We used the assay to
screen several commercial libraries of compounds with drug-like properties.
Positive compounds were further evaluated using the developed competition
binding assays which unutilized the scintillation proximity (SPA) format for
probing the displacement of tritiated retinol from MBP-RPB4. Medicinal chemistry
optimization of one positive compound was attempted in order to establish the
SAR, structure-activity relationship, in this structural series.
Results: Using the TR-FRET assay for the library screening, we identified a
farnesoid derivative, a non-retinoid compound, as a low micromolar inhibitor of the
retinol-dependent RBP4-TTR interaction. Using the competition binding assay, we
established the compound’s ability to directly compete with all-trans retinol for
binding to RBP4. We used the two assays to perform characterization of 9 newly
synthesized compounds along with 12 commercially available structures in order to
establish SAR in this structural series.
Conclusions: We identified a new class of non-retinoid RBP4 antagonists that may
potentially be used in dry AMD treatment. Conducted experiments defined the path
for further SAR optimization in this structural series.
Commercial Relationships: Nicoleta Dobri, None; Xiaoming Xu,
None; Konstantin Petrukhin, None
Support: R21 NS067594
Program Number: 3350 Poster Board Number: A495
Presentation Time: 1:45 PM - 3:30 PM
Oral Synthetic cis retinoid (QLT091001) treatment improves visual
performance in an Leber Congenital Amaurosis (LCA) mouse model
Robin Roberts1A, Bruce A. Berkowitz1B, David P. Bissig2, Deepank Utkhede3,
Anthony Pepio3. AAnatomy & Cell Biol, BAnatomy/Cell Biol & Ophthal, 1Wayne
State Univ Sch of Med, Detroit, MI; 2Anatomy and Cell Biology, Wayne State
Univ School of Med, Detroit, MI; 3QLT Inc., Vancouver, BC, Canada.
Purpose: Experimental mouse models are useful for evaluating the efficacy of new
pharmaceutical treatments for abnormal visual cycle activity and associated retinal
degeneration. We used a combination of two non-invasive methods: OKT, which
evaluates visual performance, and MRI, which measures central retinal thickness,
in an Rpe65 mutant mouse model of LCA to investigate the effectiveness of orally
administered QLT091001, a synthetic retinoid replacement for 11-cis retinal.
Methods: A total of 40 rd12 mutant mice with defective Rpe65 isomerase activity
(6-7 weeks of age, Jackson Labs) were treated in a masked fashion with vehicle or
QLT091001 (oral gavage) and then light (n=20) or dark (n=20) adapted. A control
group of 30 age-matched C57Bl/6 mice (C) was similarly treated with vehicle or
QLT091001 (oral gavage), then light (n=9) or dark (n=19) adapted. Each mouse
was studied with OKT (spatial frequency threshold [SF] and contrast sensitivity
[CS]) and MRI.
Results: The SF and CS data showed no differences between light and dark control
groups, and were in agreement with previously published values. In rd12 mice, the
following SF and CS patterns were found, and were mostly independent of light or
dark adaption: Cvehc = Cdrug = rd12drug > rd12vehc; note "="means not
significantly different and ">" or "<" means statistical significance on a 2-tailed test
(at the 0.05 level). One exception to this pattern was CS in the light adapted groups:
Cvehc and Cdrug less than or equal to rd12drug. Whole retinal thickness patterns,
regardless of light and dark, were: Cvehc = Cdrug which were greater than
rd12drug which was greater than rd12vehc. The relatively smaller retinal thickness
of the rd12vehc group likely reflects a higher number of somewhat older (7 week)
mice (and thus more retinal degeneration) relative to that in the other groups (~6
week).
Conclusions: In this single time point study, QLT091001 clearly improved reduced
visual performance in a mouse model of inherited retinal degeneration in a manner
independent of retinal thickness. The combination of OKT and MRI provides a
useful and informative approach for evaluating efficacy of pharmacological
treatment in mouse models with visual cycle deficits.
Commercial Relationships: Robin Roberts, QLT Inc. (F, R); Bruce A.
Berkowitz, QLT Inc. (F); David P. Bissig, QLT Inc. (F); Deepank Utkhede, QLT
Inc. (E); Anthony Pepio, QLT Inc. (E)
Support: QLT Inc.
Program Number: 3351 Poster Board Number: A496
Presentation Time: 1:45 PM - 3:30 PM
Resveratrol is an Efficient Uncompetitive Inhibitor of the RPE65
Isomerohydrolase
Gennadiy P. Moiseyev, Olga Nikolaeva, Jian-xing Ma. Physiology, Univ of
Oklahoma Hlth Sci Ctr, Oklahoma City, OK.
Purpose: Isomerization and hydrolysis of all-trans retinyl esters to 11-cis retinol is
a key reaction in the visual cycle and is catalyzed by RPE65, an iron-dependent
isomerohydrolase. The mechanism for the reaction catalyzed by RPE65 remains
unknown. Previously, the involvement of free radical formation in the reactions
catalyzed by RPE65 has been hypothesized. Resveratrol (3,4´,5-trihydrostilbene) is
a natural plant phytoalexin which demonstrated an efficient radical scavenging
activity. To further determine the role of free radicals in the isomerohydrolase
mechanism, we aim to study the effect of resveratrol on the RPE65
isomerohydrolase activity.
Methods: All-trans-[3H]-retinol was used as a substrate to measure the activities of
lecithin:retinol acyltransferase (LRAT) and isomerohydrolase in bovine RPE
microsomes. Resveratrol dissolved in dimethylformamide was added in a small
volume (less than 1%) from the stock solution into the reaction mixture. The
generated retinoids were extracted and analyzed by HPLC with a flow scintillation
analyzer. To determine the inhibition mode of the resveratrol, an adenoviral
expression vector was used to express chicken RPE65 in 293A cells, and then
RPE65 was used in a liposome-based isomerohydrolase assay.
Results: Resveratrol showed a concentration-dependent inhibition of the
isomerohydrolase activity as measured in bovine microsomes, with an IC50 of 250
µM. In the same reaction system, LRAT activity was not affected by the resveratrol
at a concentration as high as 2 mM. To analyze the inhibition type, all-trans retinyl
palmitate was incorporated in liposomes and used as a substrate for recombinant
RPE65. The concentration dependence of RPE65 reaction was measured in the
absence and presence of resveratrol. The Lineweaver-Burk graph demonstrated two
parallel lines suggesting that resveratrol inhibits the isomerohydrolase reaction in
an uncompetitive manner.
Conclusions: Resveratrol potently and selectively inhibited conversion of alltrans-retinyl ester to 11-cis-retinol catalyzed by RPE65 isomerohydrolase. The
uncompetitive mode of the resveratrol inhibition is in agreement with a free radicalmediated mechanism of the RPE65 reaction. This inhibition may be used to slow
down the visual cycle and to prevent accumulation of A2E in Stargardt’s disease
and age-related macular degeneration.
Commercial Relationships: Gennadiy P. Moiseyev, None; Olga Nikolaeva,
None; Jian-xing Ma, None
Support: NIH Grants EY018659, EY012231, EY019309, P20RR024215
Program Number: 3352 Poster Board Number: A497
Presentation Time: 1:45 PM - 3:30 PM
Mapping of the Insertion of the Catalytically Active RPE65 into the
Membrane Phospholipid Bilayer
Olga Nikolaeva, Gennadiy Moiseyev, Jian-xing Ma. Department of Physiology,
OUHSC, Oklahoma City, OK.
Purpose: RPE65 is a key enzyme of the visual cycle, converting all-trans retinyl
ester to 11-cis retinol. Association of RPE65 with the membrane causes a change of
the RPE65 conformation and is required for its isomerohydrolase activity. The
purpose of this study is to evaluate the effect of the different phospholipids on the
association of the RPE65 with the phospholipid membrane.
Methods: Recombinant chicken RPE65 with a His-tag was expressed in 293 cells
stably expressing LRAT using an adenovirus vector and purified to homogeneity.
Copyright 2012 by the Association for Research in Vision and Ophthalmology, Inc., all rights reserved. For permission to reproduce any abstract, contact the ARVO Office at pubs@arvo.org.
ARVO 2012 Annual Meeting Abstracts by Scientific Section/Group – Biochemistry/Molecular Biology (BI)
The RPE65 isomerohydrolase activity was quantified by HPLC using retinyl
palmitate incorporated into liposomes. Fluorescent spectroscopy was used to
evaluate an effect of the phospholipids nature on the depth of insertion of the
RPE65 into the membrane bilayer. Liposomes composed of either DOPS (50
mol%) or DOPC (50 mol%) and containing 35 mol% of PSPC with the internal
fluorescence quenchers were used to test the insertion depth.
Results: The quenching of RPE65 tryptophan fluorescence emission was evaluated
after RPE65’s association with the liposomes containing the internal quenchers
situated at different depths within the liposome’s bilayer. In the presence of DOPC
liposomes, the RPE65 tryptophan emission was quenched by the quencher attached
to the 6,7-positions of the phospholipid fatty acid acyl chain, whereas no quenching
was observed from the quenchers located at either the 9,10- or 11,12-positions.
However, upon the association with DOPS liposomes, the RPE65 tryptophan
emission quenching was observed for the quenchers located at the 6,7-, 9,10- and
11,12-positions. The quenching efficiency was higher in the presence of the DOPS
liposome containing the quencher at 6,7-positions in comparison to that with the
quencher at 9,10- or 11,12-positions.
Conclusions: The results of the RPE65 tryptophan emission changes demonstrated
that the depth of the RPE65’s insertion into the phospholipids membrane bilayer
depends on a phospholipids type. These results reveal the novel effect of
phospholipids nature on the RPE65 - membrane association and, in turn, contribute
to the understanding of the RPE65 enzymatic mechanism.
Commercial Relationships: Olga Nikolaeva, None; Gennadiy Moiseyev,
None; Jian-xing Ma, None
Support: EY018659, EY012231, EY019309, P20RR024215
Program Number: 3353 Poster Board Number: A498
Presentation Time: 1:45 PM - 3:30 PM
Retinyl Ester Accumulation In The Retinal Pigment Epithelium In The
Absence Of Light
Colleen K. Sheridan1, Yiannis Koutalos2. 1Biology, College Of Charleston,
Charleston, SC; 2Ophthalmology, Medical Univ of South Carolina, Charleston, SC.
Purpose: To test whether the amount of retinyl esters in the Retinal Pigment
Epithelium (RPE) increases in the absence of light. In the light, retinyl esters are
mobilized as substrates for regeneration of the visual chromophore, 11-cis retinal.
In mice lacking Rpe65, a protein required for regeneration of 11-cis retinal, large
quantities of retinyl esters accumulate in the RPE.
Methods: Wild-type mice (129/sv) were age matched and reared in the dark for
various lengths of time over the course of one month. Whole eyecups were
collected and retinyl esters were extracted and quantified using normal phase
HPLC coupled to UV/Vis spectroscopy. The quantity of retinyl esters found in dark
reared wild-type mice was compared to that in cyclic light reared and Rpe65deficient mice.
Results: The amounts of esters in the RPE of mice kept in the dark for up to 29
days was not significantly different from those in cyclic-light reared mice. Ester
levels stayed relatively stable at ~50 pmol per eye in both dark- and cyclic-light
reared mice. Quantities of retinyl esters in both groups of wild-type mice were
much lower than in age-matched Rpe65-deficient mice, which were ~460 pmol/eye
on Day 1 and ~1140 pmol/eye on Day 28.
Conclusions: The stability of retinyl ester content over one month suggests that
formation and storage of retinyl esters is tightly regulated in the RPE. The data
suggest that Rpe65 is not simply involved in the generation of 11-cis retinal, but
also in the regulation of the size of the retinyl ester pool.
Commercial Relationships: Colleen K. Sheridan, None; Yiannis Koutalos,
None
Support: NIH/NEI Grant EY014850 and an unrestricted grant to MUSC Storm
Eye Institute from Research to Prevent Blindness, Inc.
Program Number: 3354 Poster Board Number: A499
Presentation Time: 1:45 PM - 3:30 PM
Elongation of Very Long Chain Fatty Acids Protein 1 (ELOVL1) and Fatty
Acid Transport Protein 4 (FATP4) are Inhibitors of RPE65
Songhua Li1A, Tadahide Izumi1B, Jungsoo Lee2, Yongdong Zhou1A, William C.
Gordon1A, James M. Hill1A, Nicolas G. Bazan1A, Jeffrey H. Miner3, Minghao Jin1A.
A
Ophthalmology & Neuroscience, BCancer Center, 1LSU Health Sciences Center,
New Orleans, LA; 2Cellerant Therapeutics, San Carlos, CA; 3Internal Medcine,
Washington University, St. Louis, MO.
Purpose: RPE65, the retinoid isomerase, is an abundant protein in the RPE.
However, its activity is significantly lower than that of other visual cycle enzymes
in the RPE. One of the possible explanations for this low activity is that RPE
expresses inhibitor(s) of RPE65. The purpose of this study was to prove this
hypothesis by indentifying and characterizing negative regulator(s) of RPE65.
Methods: Expression screening of a bovine RPE cDNA library was done in 293TLRC cells stably expressing LRAT, RPE65 and CRALBP. RPE65 activity was
measured by monitoring synthesis of 11-cis retinol (11cROL) from all-trans retinol
or all-trans retinyl palmitate substrate. Retinoids were analyzed by highperformance liquid chromatography. Expression of FATP family members and
FATP4 in the mouse ocular tissues was determined by real-time RT-PCR,
immunoblot analysis and immunohistochemistry. Dark-adaptation kinetics and rod
visual function in the wild-type (WT) and FATP4 knockout (KO) mice were
determined through scotopic electroretinography (ERG). Retinal morphologies of
the WT and KO mice exposed or not exposed to high-intense light were observed
by optical coherence tomography (OCT) and light microscope.
Results: We isolated ELOVL1, FATP4 and 11-cis retinol dehydrogenase (RDH5)
as inhibitors of RPE65. The amount of 11cROL in the cells transfected with these
clones was significantly lower than that of the control cells transfected with mock
vector. The amount of 11-cis retinal (11cRAL) in the cells transfected with RDH5
clone was nearly 9-fold higher than that in the cells transfected with mock vector,
ELOVL1 or FATP4 clone, indicating that RDH5, but not ELOVL1 and FATP4,
catalyzed oxidation of 11cROL to 11cRAL. ELOVL1 and FATP4 slightly
promoted synthesis of all-trans retinyl ester but significantly inhibited synthesis of
11cROL. Kinetic assays showed that FATP4 functions as a mixed-type inhibitor of
RPE65. FATP4 was predominantly expressed in the mouse RPE, and its mRNA
content in the RPE was at least 5-fold higher than that of other FATPs. The KO
mice showed higher isomerase activity and faster dark adaptation rate compared to
WT mice. No significant morphological defect was observed in the KO retina.
However, the KO mice exhibited significantly increased susceptibility to lightinduced retinal degeneration and contained higher content of cytotoxic
retinaldehydes.
Conclusions: ELOVL1 and FATP4 negatively regulate the visual cycle by
inhibiting synthesis of 11cROL. FATP4, the dominant FATP in the RPE, functions
as a mixed-type inhibitor of RPE65 and is required for preventing retinal
degeneration and accumulation of cytotoxic retinaldehyde induced by long-time
exposure to high intense light.
Commercial Relationships: Songhua Li, None; Tadahide Izumi,
None; Jungsoo Lee, None; Yongdong Zhou, None; William C. Gordon,
None; James M. Hill, None; Nicolas G. Bazan, None; Jeffrey H. Miner,
None; Minghao Jin, None
Support: R01EY021208
Program Number: 3355 Poster Board Number: A500
Presentation Time: 1:45 PM - 3:30 PM
Identification of The Key Residues Determining The Product Specificity of
Isomerohydrolase
Yusuke Takahashi1A, Gennadiy P. Moiseyev1B, Olga Nikolaeva1B, Jian-xing Ma1B.
A
Medicine-Endocrinology, BPhysiology, 1Univ of Oklahoma Hlth Sci Ctr,
Oklahoma City, OK.
Purpose: The efficient recycling of the visual pigment chromophore, 11-cis retinal,
through the retinoid visual cycle is essential for maintaining normal vision. RPE65
is the isomerohydrolase which catalyzes the key reaction which generates
predominant 11-cis retinol (11cROL) and a minor amount of 13-cis retinol
(13cROL), from all-trans retinyl ester. The molecular mechanisms and the key
residues that determine the isomerization specificity of RPE65 have not been welldefined. The purpose of this study is to identify the key residues that determine
isomerization specificity of RPE65.
Methods: We recently identified and characterized two novel homologs of RPE65,
RPE65c and 13-cis isomerohydrolase (13cIMH), which are expressed in the
zebrafish retina and brain, respectively. Although these two isoforms shared 97%
of amino acid sequence identify, RPE65c generated predominantly 11cROL,
whereas 13cIMH generated exclusively 13cROL in the in vitro assay system. To
identify the key residues which confer the product specificity of these two
enzymes, we focused on the divergent residues in RPE65c and 13cIMH and
replaced these candidate residues by site-directed mutagenesis. Expression levels of
the mutants were confirmed by Western blot analysis. The enzymatic activities
were determined by performing in vitro isomerohydrolase activity assays using
HPLC analysis and quantification of produced retinoids.
Results: Single point mutations in RPE65c, Y58N, F103L and L133S altered the
isomerization specificity of RPE65c, increasing 13cROL while decreasing 11cROL
production, compared to that of wild-type RPE65c. On the other hand, a mutation
N58Y in 13cIMH completely switched the isomerization specificity to that of
RPE65c.
Conclusions: These results suggest that residue 58 is a primary key residue that
determines isomerization specificity in the novel homologs of zebrafish RPE65.
Identification of key residues determining the product specificity will contribute to
the understanding of mechanism for isomerization reaction catalyzed by RPE65.
Commercial Relationships: Yusuke Takahashi, None; Gennadiy P. Moiseyev,
None; Olga Nikolaeva, None; Jian-xing Ma, None
Support: NIH grants EY018659, EY012231, EY019309, P20RR024215
Program Number: 3356 Poster Board Number: A501
Presentation Time: 1:45 PM - 3:30 PM
Slowing Down The Visual Cycle By The Fatp1 Protein
Philippe Brabet, Laurent Guillou, Karim Chekroud. Institute for Neurosciences
Montpellier, INSERM U1051, Montpellier, France.
Purpose: Fatty acid transport protein 1 (FATP1) is a member of the long chain and
very long chain acyl-CoA synthetase family. We (Guignard et al., JBC, 2010)
Copyright 2012 by the Association for Research in Vision and Ophthalmology, Inc., all rights reserved. For permission to reproduce any abstract, contact the ARVO Office at pubs@arvo.org.
ARVO 2012 Annual Meeting Abstracts by Scientific Section/Group – Biochemistry/Molecular Biology (BI)
previously showed the expression of FATP1 protein in the retinal pigment
epithelium and its physical interaction with RPE65. This protein-protein interaction
caused the inhibition of the isomerase activity of RPE65. Here we evaluated in
vitro the inhibitory effect of peptides derived from the FATP1 interacting domain
and analysed the visual function of transgenic mice overexpressing the human
FATP1 protein in the retinal pigment epithelium (RPE).
Methods: Nucleotide sequences encoding peptides from the 307 C-terminal aa
residues of FAPT1 were used in yeast two hybrid systems to quantify the
interaction with the human RPE65. Peptides were transiently co-expressed with
RPE65 in 293 cells stably expressing human LRAT and CRALBP proteins.
Transfected cells were incubated with all-trans-retinol and retinoid extracted to
measure 11-cis-retinol production. We engineered transgenic mice with RPEspecific overexpression of human FATP1 using the VMD2 promoter. Q-PCR was
used to determine the level of transgene expression. RPE and neuroretina from F1
and F2 transgenic generations were isolated and used for western blot analysis. For
adaptation-ERG, mice were subjected to seven repetitions of a 1.59 cd.s-1.m-2 blue
flash; the seven b-wave amplitudes were averaged.
Results: The 307 C-terminal polypeptide of FATP1 was as effective as the whole
protein at inhibiting 11-cis retinol production. Among five overlapping peptides of
102 aa covering the C-terminal, three showed a strong interaction that defined a
more specific region. These peptides are currently being evaluated for inhibition of
RPE65 isomerase. Two independent lines of transgenic mice showed expression of
the human FATP1 cDNA specifically in RPE. One line displayed a delayed
recovery of the b-wave amplitude after bleaching.
Conclusions: FATP1 could inhibit the retinoid isomerase RPE65 both in vitro and
in vivo by protein-protein physical interactions, which could be restricted to the
polypeptide domain. This could allow the design of small peptides capable of
slowing the visual cycle as a therapeutic tool for Stargardt’s disease.
Commercial Relationships: Philippe Brabet, None; Laurent Guillou,
None; Karim Chekroud, None
Support: None
Program Number: 3357 Poster Board Number: A502
Presentation Time: 1:45 PM - 3:30 PM
Dysfunction Of Retinal Cells By All-trans-retinal And Its Condensation
Product A2E
Tadao Maeda1A, kiichiro Okano2, Yu Chen1B, Tsutomu Sakai2, Krzysztof
Palczewski1B, Akiko Maeda1A. AOphthalmology & Visual Sciences, BPharmacology,
1
Case Western Reserve University, Cleveland, OH; 2Ophthalmology, Jikei
University School of Medicine, Tokyo, Japan.
Purpose: High levels of all−trans−retinal and its associated condensation products
can cause retinal degeneration in a light−dependent manner, and contribute to the
pathogenesis of human macular diseases such as age−related macular degeneration
(AMD) and Stargardt’s disease. In this study, we evaluate retinal cell dysfunction
mediated by accumulation of potentially toxic all-trans-retinal and its condensation
product, diretinoid-pyridinium-ethanolamine (A2E).
Methods: Transgenic mice with rod-only or cone-like only retina were prepared by
genetically ablating cone-DTA (cone-specific diphtheria toxin A) transgene or
deletion of Nrl (rod photoreceptor-specific neural retina leucine zipper protein
gene). We examined these mice in addition to the progenies of such mice crossbred
with Rdh8 and Abca4 deficient mice manifesting severe light-induced retinal
dystrophy. Age− or light−dependent changes in retinal function and morphology
were evaluated by electroretinogram, scanning laser ophthalmoscope (SLO) and
spectral domain-optical coherence tomography (SD-OCT). RPE function and
morphology were evaluated by two-photon microscopy, immuhohistochemistry
and biochemical methods.
Results: Among these strains, Rdh8−/−Abca4−/− mice with a mixed rod−cone
population showed the most severe retinal degeneration under regular cyclic light.
Intense light exposure induced acute retinal damage in Rdh8−/−Abca4−/− mice and
rod−only mice whereas this change was not observed in cone−like−only mice.
Different
Conclusions: Rods, cones and RPEs exhibit their characteristic dysfunction by
excess levels of all-trans-retinal and A2E, which dictates the unique pathology
observed in retinal degenerative Rdh8−/−Abca4−/−mice.
Commercial Relationships: Tadao Maeda, None; kiichiro Okano, None; Yu
Chen, None; Tsutomu Sakai, None; Krzysztof Palczewski, None; Akiko Maeda,
None
Support: NEI Grant EY019880, EY009339, EY 021126, P30 EY11373
Program Number: 3358 Poster Board Number: A503
Presentation Time: 1:45 PM - 3:30 PM
ABCA4 Linked To Stargardt Disease is a Novel ABC Transporter of Nretinylidene-phosphatidylethanolamine and Phosphatidylethenolamine
Robert S. Molday, Stepan Lenevich, Faraz Quazi. Biochemistry/Molecular
Biology, University of British Columbia, Vancouver, BC, Canada.
Purpose: ABCA4 is a member of the superfamily of ABC transporters implicated
in the clearance of potentially toxic retinoid compounds from rod and cone cells
following photoexcitation. Mutations in ABCA4 are responsible for Stargardt
disease and other retinal degenerative diseases. Currently there is no direct
biochemical evidence for the function of ABCA4 as a retinoid transporter and the
direction of transport remains to be determined. The purpose of this study was to
identify substrates which are transported by ABCA4 and define the direction of
transport.
Methods: Retinoid transport activity of ABCA4 was determined by measuring
ATP-dependent transfer of radiolabeled retinal from donor proteoliposomes
reconstituted with purified ABCA4 or outer segment disc vesicles of WT and
abca4 KO mice to acceptor liposomes. Phospholipid transport activity was
determined by measuring ATP-dependent flipping of fluorescent-labeled lipids
across the bilayer of proteoliposomes reconstituted with ABCA4. The retinoid
substrate for ABCA4 was determined by HPLC, spectrophotometry, and
competitive inhibition.
Results: ATP-dependent transfer of retinal from donor to acceptor vesicles was
observed when the donor vesicles were either phosphatidylethanolamine(PE)containing proteoliposomes reconstituted with ABCA4 or disc membrane vesicles
from WT mice. No ATP-dependent retinal transfer was observed from donor
phosphatidylcholine proteoliposomes or disc membranes from abca4 knockout
mice. N-retinyl-PE but not retinol inhibited the retinal transfer activity of ABCA4.
The nonprotonated form of N-retinylidene-PE was the principal retinoid substrate
for ABCA4. In the absence of retinal, ABCA4 actively flipped PE across the lipid
bilayer. Both N-retinylidene-PE and PE were transported from the lumen to the
cytoplasmic side of membranes. Several Stargardt mutations severely reduced Nretinylidene-PE and PE transport activity of ABCA4.
Conclusions: ABCA4 functions as an active ‘importer’ of N-retinylidene-PE and
PE transporting these substrates from the lumen to the cytopolasmic side of the disc
membrane bilayer, a direction that is opposite to the ‘export’ direction observed for
all other characterized eukaryotic ABC transporters. These studies support the role
of ABCA4 in the removal of retinal from the disc membrane and suggest that
ABCA4 can also contribute to the asymmetrical distribution of PE across the disc
membrane. Finally, these studies provide further insight into the mechanisms
underlying Stargardt disease.
Commercial Relationships: Robert S. Molday, None; Stepan Lenevich,
None; Faraz Quazi, None
Support: NIH Grant EY02422
Program Number: 3359 Poster Board Number: A504
Presentation Time: 1:45 PM - 3:30 PM
Subretinal Microglia/Macrophages Contribute To Retinal Degeneration
Caused by All-trans-retinal
Hideo Kohno1A, Yu Chen1B, Tadao Maeda1A, Krzysztof Palczewski1B, Akiko
Maeda1A. AOphthalmology/Pharmacology, BPharmacology, 1CASE WESTERN
RESERVE UNIVERSITY, Cleveland, OH.
Purpose: To investigate the role of retinal inflammation in all-trans-retinalassociated retinal degeneration, we examined subretinal translocation of retinal
microglia, which are tissue resident macrophages in the retina, and macrophages,
which are supplied from the retinal circulation into the inner retina.
Methods: Rdh8-/-Abca4-/- mice, which show impaired metabolism of all-transretinal, and WT mice at 4 weeks of age were exposed to light at 10,000 lux for 30
min. Retinal phenotypes of these mice were assessed by in vivo imaging
techniques, such as Scanning Laser Ophthalmoscopy (SLO) and Optical Coherence
Tomography (OCT), and histological analyses.Clodronate-liposomes, which can
deplete macrophages, were injected into Rdh8-/-Abca4-/- mice immediately after
light via tail vein to examine the role of macrophages in light-induced retinal
degeneration. To determine possible triggers for translocation of
microglia/macrophages to the subretinal space, we measured mRNA expression of
those molecules in Rdh8-/-Abca4-/- and WT mice 24 h and 7days after light
exposure.
Results: Light-exposed Rdh8-/-Abca4-/- mice showed a significant accumulation of
autofluorescent spots in the subretinal space, whereas WT mice did not display
such changes. This accumulation started 3 days after light and peaked at 7 days.
Flat-mount RPE of light exposedRdh8-/-Abca4-/- eyes showed Iba-1-, a marker of
activated macrophage and microglia, and F4/80- , a marker of macrophages,
positive cells in the apical side of the RPE. The administration of Clodronateliposomes reduced the numbers of autofluorescent spots in light exposed Rdh8-/Abca4-/- mice, which showed milder retinal degeneration and weaker activation of
microglial and Muller glial cells. RNA analyses revealed increased expression of
several molecules, including Ccl2, Ccr2, Tnf and Il1b in retinas of light exposed
Rdh8-/-Abca4-/- mice.
Conclusions: Accumulation of microglia/macrophages in the subretinal space
contributes to retinal degeneration in mice with delayed clearance of all-transretinal. Increased expression of various chemokines and cytokines after light
exposure in Rdh8-/-Abca4-/- mice is a possible mechanism for the subretinal
accumulation of these cells
Commercial Relationships: Hideo Kohno, None; Yu Chen, None; Tadao
Maeda, None; Krzysztof Palczewski, None; Akiko Maeda, None
Support: None
Copyright 2012 by the Association for Research in Vision and Ophthalmology, Inc., all rights reserved. For permission to reproduce any abstract, contact the ARVO Office at pubs@arvo.org.
ARVO 2012 Annual Meeting Abstracts by Scientific Section/Group – Biochemistry/Molecular Biology (BI)
Program Number: 3360 Poster Board Number: A505
Presentation Time: 1:45 PM - 3:30 PM
Generation of NADPH by Mitochondrial-Mediated Pathways in Mouse Rod
Photoreceptors
Leopold Adler, IV1,2, Chunhe Chen2, Yiannis Koutalos2. 1Physics and Astronomy,
College of Charleston, Charleston, SC; 2Ophthalmology, Medical University of
South Carolina, Charleston, SC.
Purpose: To determine the contribution of different NADPH-generating metabolic
pathways to the reduction of all-trans retinal to retinol in the outer segment of
mouse rod photoreceptors. All-trans retinol is formed in rod outer segments from
the reduction of the all-trans retinal released from photoactivated rhodopsin via a
reaction that utilizes NADPH.
Methods: Experiments were carried out with dark-adapted living rod
photoreceptors isolated from 2-3 months old 129/sv wild type mice. The amount of
all-trans retinol in the outer segment was measured at various times after bleaching
from its fluorescence (excitation 360 nm; emission >420 nm). Experiments were
carried out at 37 0C. A numerical model describing the formation of all-trans retinol
was developed. From this model, the concentration of and production rate of
NADPH were estimated from the difference in the known kinetics of all-trans
retinal release and those of all-trans retinol formation.
Results: All-trans retinol formation was suppressed in the absence of glucose, and
was restored by addition of pyruvate. In the presence of 5 mM glucose, NADPH
was supplied to the rod outer segment at a rate of ~0.22 mM min-1. The
concentration of cytosolic outer segment NADPH present before bleaching was
~0.3 mM. In the absence of glucose, concentrations of 0.5 - 1.0 mM of pyruvate
were sufficient to restore NADPH supply rates of 0.20 - 0.24 mM min-1.
Conclusions: Mitochondrial-mediated pathways can generate NADPH at sufficient
rates to sustain the reduction of all-trans retinal to retinol following rhodopsin
bleaching.
Commercial Relationships: Leopold Adler, IV, None; Chunhe Chen,
None; Yiannis Koutalos, None
Support: NIH/NEI grant EY014850, and an unrestricted grant to MUSC Storm
Eye Institute from Research to Prevent Blindness, Inc., New York, NY.
Program Number: 3361 Poster Board Number: A506
Presentation Time: 1:45 PM - 3:30 PM
Thermal isomerization of cone pigments
Masahiro Kono, Patrice W. Goletz. Ophthalmology, Medical Univ of South
Carolina, Charleston, SC.
Purpose: Cone visual pigments are notoriously known to be unstable in the dark.
This has been attributed to thermal isomerization of the chromophore based
primarily on downstream signaling data. The purpose of this study is to determine
thermal isomerization of human cone visual pigments directly.
Methods: Cone opsins were transiently expressed in COS-1 cells, and pigments
were generated with 11-cis retinal. They were then immunopurified in 0.1%
dodecylmaltoside. Thermal isomerization was measured spectrophotometrically by
monitoring the change in absorbance at 380 nm in the presence of 10-fold excess of
11-cis retinal at different temperatures. Isomeric content was confirmed by HPLC.
Results: Chromatograms indicated that 11-cis retinal does thermally isomerize to
all-trans retinal in the presence of cone opsin faster than retinal alone. With a 10fold excess of 11-cis retinal present, multiple turnovers could be assessed by
following changes in absorbance at 380nm because of differences in extinction
coefficients between the 11-cis and all-trans retinals. As temperature is increased,
isomerization rates accelerated; however, the protein denatured with time as judged
by loss of pigment. From initial rates of isomerization at different temperatures, we
could estimate activation energy of isomerization to be about 20-25 kcal/mol.
Conclusions: Cone opsins do accelerate thermal isomerization of 11-cis retinal.
Commercial Relationships: Masahiro Kono, None; Patrice W. Goletz, None
Support: NIH grant EY019515; Research to Prevent Blindness
Program Number: 3362 Poster Board Number: A507
Presentation Time: 1:45 PM - 3:30 PM
Innovative Troxler-free Measurement of Macular Pigment and Lens Density
with Correction of the Former for the Aging Lens
Richard A. Bone1, Jeffrey B. Morris2, Anirbaan Mukherjee1. 1Physics, Florida
International University, Miami, FL; 2Morris Eye Group, Encinitas/Vista, CA.
Purpose: To develop an easy-to-use heterochromatic flicker photometer (HFP) for
precise macular pigment optical density (MPOD) and lens optical density (LOD)
measurements, with automatic LOD compensation in computing MPOD.
Methods: A LED-based HFP provided centrally fixated, focusable 1.5° and 14°
stimuli alternating between blue (455 nm) and green (515 nm) and set in a green
(515 nm) surround of the same luminance as the green component of the stimulus.
With the 1.5° stimulus, subjects adjusted the blue LED intensity to produce a
flicker null, guided by the clue that this would occur at equiluminance of the
stimulus and surround. With the 14° stimulus, they adjusted the blue LED to a
point where flicker was confined to a small central region with the periphery
appearing steady and again at equiluminance with the surround. A detector
recorded up to 10 blue light intensity settings for both stimuli, as well as the fixed,
green light intensity. Using the green light intensity and the blue light intensity for
the 14° stimulus, a microprocessor computed the subject's LOD at 425 nm and the
lens equivalent age (LEA). The uncorrected MPOD at 455 nm was given by PU =
log (IF/IP) (IF, IP ~ blue light intensities for 1.5° and 14° stimuli respectively). The
corrected P was computed by solving
....(1)
EB(λ), ΕG(λ) ~ energy spectra of blue and green lights, D(λ) ~ normalized MPOD
spectrum, V(λ,a) ~ luminosity function without MP filtering adjusted for subject
LEA, a. The effect of LEA on V(λ,a) was obtained from Sagawa et al. [J. Opt. Soc.
Am.A 18, 2659 (2001)].
Results: Comparing the new instrument and a traditional HFP, subjects were
unanimous in their preference for the former. In particular, the 14° centrally fixated
stimulus provided a much easier, Troxler fading-free task than the more traditional,
eccentrically viewed small stimulus. The null point for both stimuli was very
sharply defined. The subject's LEA had a significant impact on the computation of
MPOD from eqn. 1, e.g. subjects aged 16 and 57 with the same log (IF/IP) of 0.350
had peak MPODs of 0.554 and 0.603, respectively.
Conclusions: We succeeded in our objective of a patient-friendly HFP
(MAPCATsf™) for measuring MPOD and LOD, which may be associated with
propensity for AMD and nuclear sclerosis respectively.
Commercial Relationships: Richard A. Bone, 61/500,736 (P), Guardion Health
Sciences, LLC (C); Jeffrey B. Morris, Guardion Health Sciences, LLC
(I); Anirbaan Mukherjee, None
Support: Four Leaf Japan Ltd.
Program Number: 3363 Poster Board Number: A508
Presentation Time: 1:45 PM - 3:30 PM
Age-Related Decline in Macular Pigment with LED-based Flicker: a Possible
Artifact of the Aging Lens
Anirbaan Mukherjee, Richard A. Bone, Jorge C. Gibert. Physics, Florida
International University, Miami, FL.
Purpose: To determine how the spectral transmittance of the aging lens affects
macular pigment optical density (MPOD) measured by heterochromatic flicker
photometry HFP) employing light emitting diodes (LED).
Methods: If monochromatic blue and green lights form the HFP stimulus, the peak
MPOD, P = log (IF/IP). IF and IP are the blue light intensities needed for
equiluminance with the green light when the stimulus is imaged on the fovea and
parafovea respectively. If lights of significant bandwidth, such as LEDs, are
employed, the relationship is:
...(1)
EB(λ) and EG(λ) ~ energy spectra of blue and green lights, D(λ) ~ normalized
MPOD spectrum, V(λ,a) ~ luminosity function without MP filtering appropriate for
subject age, a. The effect of the aging lens on V(λ,a) was obtained
from Sagawa et al. [J. Opt. Soc.Am.A 18, 2659-2667 (2001)] and used to calculate
P as a function of IF/IP for any age. A random number generator was used to
simulate groups of subjects of different ages and peak MPODs. Using typical LED
spectra in eqn. 1, we calculated IF/IP ratios that these subjects would provide on an
HFP test. The reverse calculation was used to obtain apparent values of P from
these ratios by using a fixed, standard V(λ) with no adjustment for age.
Results: Age has a significant effect on the measured value of P if V(λ) is not
adjusted for age. The effect is greater for older subjects with high MPOD. E.g., if
subjects aged 20 and 80 provide a log (IF/IP) of 0.5 when tested by HFP, their peak
MPODs from eqn. 1 are 0.753 and 0.889, respectively. If a fixed, standard V(λ) is
used, it is 0.768 for both subjects. For the simulated groups of subjects, peak
MPODs were characterized by flat regression lines, i.e. no age-related change in
their true MPOD. However, calculations revealed that if such subjects were tested
by HFP, and eqn. (1) was used without an age correction for V(λ), the results would
indicate an apparent age-related decline in MPOD of ~ (1.44±0.51)×10-2 OD
units/decade.
Conclusions: HFP employing broad-band light sources, e.g. LEDs, gives erroneous
MPOD if the aging lens is not taken into account. The discrepancy is more
pronounced in older subjects leading to an apparent age-related decline in MPOD.
Studies in which such declines have been reported may need to be re-examined.
Commercial Relationships: Anirbaan Mukherjee, None; Richard A. Bone,
None; Jorge C. Gibert, None
Support: Four Leaf Japan Ltd.
Copyright 2012 by the Association for Research in Vision and Ophthalmology, Inc., all rights reserved. For permission to reproduce any abstract, contact the ARVO Office at pubs@arvo.org.
ARVO 2012 Annual Meeting Abstracts by Scientific Section/Group – Biochemistry/Molecular Biology (BI)
Program Number: 3364 Poster Board Number: A509
Presentation Time: 1:45 PM - 3:30 PM
The Effects of Supplementation on Macular Pigment Levels in Diabetics
without Maculopathy Measured by Two Objective Techniques
Nicole K. Scripsema1A, Patricia Garcia1A, Chavakij Bhoomibunchoo1A, Gennady
Landa1A, Melissa Rivas1B, Alex Yang1B, Katy Tai1B, Richard B. Rosen1A,2. ARetina
Center, BEinhorn Clinical Research Center, 1New York Eye and Ear Infirmary,
New York, NY; 2Ophthalmology, New York Medical College, Valhalla, NY.
Purpose: The purpose of this study was to determine if giving lutein (L) or
zeaxanthin (Z) supplements to diabetic (DM) patients with no evidence of
maculopathy would increase their macular pigment levels.
Methods: Patients with DM without maculopathy were enrolled in the clinical
trial. Each was randomly assigned to one of four supplementation formulations
containing different amounts of L or Z. Patients were examined at baseline, 1
month, 3 months, 6 months, and 1 year. At each visit patients were imaged with
two objective techniques for measuring MP. MPOD was measured with a modified
scanning laser ophthalmoscope (HRA Heidelberg Retinal Angiograph, Heidelberg,
Germany). LOD and ZOD were measured with the Macular Pigment Reflectometer
(MPR,Maastricht, Netherlands). Paired t-tests were used to compare mean optical
densities. We are reporting the preliminary 6 month data.
Results: Initially 10 patients were enrolled. However, four patients were lost to
follow-up and one had inadequate images for analysis. 9 eyes of 5 patients were
included. 60% were male. Mean age was 57.8±8.8 yrs. 60% were Hispanic, 20%
Caucasian, and 20% African American. All patients had Type II DM. Mean
duration of DM was 21±11.4 yrs and mean HbA1C was 6.55±0.75 mg/dL. Changes
in mean MPOD, ZOD, and LOD are shown in Table 1. Each parameter showed
significant increases from baseline after 1-3 months of supplementation. Increases
in mean LOD and ZOD measured by MPR were higher relative to the increases in
mean MPOD measured with HRA.
Conclusions: A previous study demonstrated that patients with Type II DM had
lower levels of macular pigment, inversely proportional to their HbA1C levels. It
was unclear whether this reflected absorption difficulties or increased breakdown.
These preliminary results suggest that diabetic patients are capable of absorbing
supplements, allowing increased macular levels of L and Z. This also suggests that
the increased oxidative stress associated with DM results in more rapid breakdown
of antioxidant pigments, leaving the macula more vulnerable to the onset of
macular disease. Additional patient enrollment is needed to confirm these results
and further studies are necessary to correlate MP supplementation and the oxidative
stress of DM.
Commercial Relationships: Nicole K. Scripsema, None; Patricia Garcia,
OPKO-OTI (C); Chavakij Bhoomibunchoo, None; Gennady Landa,
None; Melissa Rivas, None; Alex Yang, None; Katy Tai, None; Richard B.
Rosen, OD-OS Clarity (C), OPKO-OTI/Optos (C), Topcon Medical Systems, Inc
(C)
Support: The Bendheim-Lowenstein Retina Fund of the New York Eye and Ear
Infirmary
Clinical Trial: http://www.clinicaltrials.gov, NYEE0936
Program Number: 3365 Poster Board Number: A510
Presentation Time: 1:45 PM - 3:30 PM
Longitudinal Evaluation of Changes in Macular Pigment Density with Age
Jennifer C. Wong, Billy R. Hammond, Jr.. University of Georgia, Athens, GA.
Purpose: The question of whether macular pigment optical density (MPOD)
changes as a function of age has been debated. Some studies show large declines
with age (mostly those using Raman Spectroscopy as the basis for measurement),
others showing no change or even increases in density (mostly those using
heterochromatic flicker photometry,(HFP) or direct anatomical methods of
measurement). In both instances, however, results largely from cross-sectional
studies have been evaluated. This study assessed longitudinal changes in MP
density measured over a decade.
Methods: Fourteen healthy older participants (mean current age = 69 ± 14 yrs.)
were assessed. MPOD was measured with heterochromatic flicker photometry
(HFP) using the standard 1-deg stimulus during a baseline visit and then during a
ten-year follow-up visit (using the same instrument, stimuli, etc).
Results: MPOD at baseline (mean MPOD = 0.21 ± 0.17) was significantly lower (t
= -4.115, p < .001) than MP measured ten years later (mean MPOD = 0.37 ± 0.20).
Conclusions: The MPOD of this sample increased significantly over the study
period. This increase may have been due to the initial session which exposed these
mostly naïve subjects to information regarding lutein and zeaxanthin.
Commercial Relationships: Jennifer C. Wong, None; Billy R. Hammond, Jr.,
None
Support: None
Program Number: 3366 Poster Board Number: A511
Presentation Time: 1:45 PM - 3:30 PM
Comparison Of Serum Response To Supplements Containing The Macular
Carotenoids In Normals And In Patients With AMD
Katherine A. Meagher1, John M. Nolan1, David I. Thurnham2, Wayne Cummins3,
Alan N. Howard4, Stephen Beatty5, James Loughman6. 1Chemical and Life
Sciences, Macular Pigment Research Group, Waterford, Ireland; 2Northern Ireland
Centre for Food and Health, University of Ulster, Coleraine, United Kingdom;
3
Chemical and Life Sciences, Waterford Institute of Technology, Waterford,
Ireland; 4Downing College, The Howard Foundation, Cambridge, United Kingdom;
5
Whitfield clinic, Institute of Eye Surgery, Waterford, Ireland; 6Department of
Optometry, Dublin Institute of Technology, Dublin, Ireland.
Purpose: This study reports on serum response to three different macular
carotenoid supplements in normal subjects and in patients with age-related macular
degeneration (AMD).
Methods:
54 subjects were recruited; 27 with no ocular pathology (normals) and 27 with
AMD. Subjects were randomly assigned one of three carotenoid interventions.
Group 1: 20 mg L, 0.8 mg Z; Group 2: 10 mg L, 2 mg Z, 10 mg MZ; Group 3: 3
mg L, 2mg Z, 17 mg MZ. Serum was assessed at baseline, 4 weeks, and 8 weeks
using high performance liquid chromatography to quantify L, Z and MZ.
Results: Serum L concentrations significantly increased in Group 1 (0.60 µmol/L
[228%] increase; p< 0.001), and Group 2 (0.86 µmol/L [370%] increase; p< 0.001),
with no significant change in Group 3 (0.02 µmol/L [6%] increase; p= 0.501).
Serum Z concentrations significantly increased in Group 1 (0.03 µmol/L [63%]
increase; p= 0.003) and Group 2 (0.03 µmol/L [86%] increase; p< 0.001), with no
significant change in Group 3 (0.005 µmol/L [7%] decrease, p= 0.287). Serum MZ
concentrations significantly increased in Group 1 (week 8: 0.0094 µmol/L; p=
0.015), Group 2 (week 8: 0.063 µmol/L; p< 0.001), and Group 3 (week 8: 0.074
µmol/L; p< 0.001).
Conclusions: A supplement containing L, Z, and MZ appears to result with
optimal combined serum carotenoid response. Our novel finding that MZ is present
in serum following supplementation with 20 mg of L, suggests that MZ may be
formed in serum, or diffuse from the macula where it was originally hypothesised
to be formed.
Commercial Relationships: Katherine A. Meagher, None; John M. Nolan,
None; David I. Thurnham, None; Wayne Cummins, None; Alan N. Howard,
None; Stephen Beatty, None; James Loughman, None
Support: None
Clinical Trial: www.controlled-trials.com, ISRCTN81595685
Program Number: 3367 Poster Board Number: A512
Presentation Time: 1:45 PM - 3:30 PM
Macular Pigment Spatial Profiles in a Healthy Asian Population
Tanveer S. Asaria, Sheena D. Dhanani, John L. Barbur, Byki Huntjens. Applied
Vision Research Centre, The Henry Wellcome Laboratories for Vision Sciences,
The City University, United Kingdom.
Purpose: Reduced macular pigment optical density (MPOD) has been associated
with age-related macular degeneration (ARMD). MP spatial profiles tend to follow
either an exponential curve or exhibit a secondary peak up to 2° eccentricity in 40%
to 50% of Caucasian subjects. A higher incidence of secondary peak profiles has
been reported in ethnicities with low ARMD prevalence using fundus
autofluorescence image analysis. The aim of this study was to investigate the
distribution of MP spatial profiles in healthy Asian subjects.
Methods: MP spatial profiles were measured using heterochromatic flicker
photometry (Ophthalmic Physiol Opt. 30:470-483,2010) in 55 Asian subjects
(mean age 21 ± 3 years). Secondary peak classification was based on the MPOD at
0.8° or at 1.8° being 0.10 log units (the average within subject standard deviation at
each location) greater than the value predicted by the exponential fit. The
remaining subjects were allocated to the single peak subgroup. The average blue
light transmittance (Tav) and the average MPOD (ODav) between 0° and 1.8° were
calculated.
Results: According to our criterion, 25 subjects (45%) had secondary peak spatial
profiles. Mean MPOD at 0.8° was significantly higher in subjects with a secondary
peak (0.52 ± 0.12 log units) when compared to the single peak subgroup (0.41 ±
0.12 log units; t = -3.53, p = 0.001), but not at 0° (0.61 ± 0.13 log units versus 0.53
± 0.19 log units; t = -1.79, p = 0.08, respectively). Percentage Tav was significantly
decreased in subjects with secondary peak profiles (40 ± 8%) compared to those
with single peak profiles (46 ± 10%; t = 2.31, p = 0.03). ODav was significantly
greater in subjects with secondary (0.41 ± 0.09) versus single peak profiles (0.35 ±
0.10; t = -2.29, p = 0.03).
Conclusions: Significant differences in blue light transmittance and average
MPOD up to 1.8° were found between exponential and secondary peak MP
profiles. Subjects exhibiting a secondary peak were better protected against the
damaging effects of blue light. However, the incidence of secondary peak MP
profiles in Asian subjects was similar to that previously recorded in Caucasians,
suggesting that factors other than racial differences in secondary peak frequency
may explain the ethnic influence on ARMD prevalence.
Commercial Relationships: Tanveer S. Asaria, None; Sheena D. Dhanani,
None; John L. Barbur, None; Byki Huntjens, None
Copyright 2012 by the Association for Research in Vision and Ophthalmology, Inc., all rights reserved. For permission to reproduce any abstract, contact the ARVO Office at pubs@arvo.org.
ARVO 2012 Annual Meeting Abstracts by Scientific Section/Group – Biochemistry/Molecular Biology (BI)
Support: None
Program Number: 3368 Poster Board Number: A513
Presentation Time: 1:45 PM - 3:30 PM
Macular Pigment Response To Three Different Macular Carotenoid
Interventions In Patients With Early Age-Related Macular Degeneration
John M. Nolan1, Sarah Sabour-Pickett2, Eithne Connolly2, Loughman James3, Alan
Howard4, Stephen Beatty5. 1Macular Pigment Research Group, Waterford Institute
of Technology, Waterford, Ireland; 2Institute of Vision Research, Waterford,
Ireland; 3Optometry, Dublin Institute of Technology, Dublin, Ireland; 4Howard
Foundation, Cambridge, United Kingdom; 5Institute of Eye Surgery, Waterford,
Ireland.
Purpose: To investigate the impact of three different macular carotenoid
interventions on macular pigment optical density (MPOD), in subjects with early
age-related macular degeneration (AMD).
Methods: Seventy-five subjects (75 study eyes) with early AMD were recruited
into this single-blind, randomised clinical trial. Stereo fundus photographs were
graded at the accredited reading centre at the University of Wisconsin, USA. AMD
was defined as the presence of drusen and pigmentary changes. Of the 75 eyes, 9
were classified as having “atypical-AMD” (i.e. the presence of pigmentary changes
only). Subjects were randomly assigned into one of the three intervention groups,
as follows: Group 1 (n = 25): L = 20 mg/day, zeaxanthin (Z) = 2 mg/day; Group 2
(n = 28): meso-zeaxanthin (MZ) = 10 mg/day, L = 10 mg/day, Z = 2 mg/day;
Group 3 (n = 22): MZ = 17 mg/day, L = 3 mg/day, Z = 2 mg/day. MPOD was
measured using customised heterochromatic flicker photometry at four retinal
eccentricities (0.25°, 0.5°, 1.0° and 1.75°) and visual function was assessed using a
range of psychophysical tests. Study visits occurred at baseline, three, six and 12
months.
Results: Twenty-eight (37%) of the subjects were male. Mean (±sd) values at
baseline were, as follows: age (years) = 67.2 (±8.4); MPOD (at 0.25°) = 0.47
(±0.23); corrected distance visual acuity (CDVA) = 97.4 (±7.6) (circa. LogMAR:
0.05). Positive and statistically significant relationships between MPOD (at 0.25°)
and visual function at baseline included: CDVA, letter contrast sensitivity,
measures of grating contrast sensitivity and glare disability (r = 0.239-0.357;
p<0.05, for all). Longitudinal analysis demonstrated a statistically significant
increase in MPOD at 0.25° in Group 2 only (p=0.003); at 0.5° in Groups 1 and 2 (p
= 0.043 and p = 0.001, respectively); at 1.0° in Group 2 only (p = 0.012); at 1.75°
in Groups 1 and 2 (p = 0.046 and p = 0.002, respectively).
Conclusions: Cross-sectional analysis shows that MPOD correlates positively with
important measures of visual function, in subjects with early AMD. In addition, we
found that enrichment of MP across its spatial profile can be best achieved
following supplementation with all three macular carotenoids (L, MZ and Z), for
subjects with the disease. The morphological and functional implications of these
findings merit investigation, and will follow.
Commercial Relationships: John M. Nolan, None; Sarah Sabour-Pickett,
None; Eithne Connolly, None; Loughman James, None; Alan Howard,
None; Stephen Beatty, None
Support: None
Clinical Trial: www.controlled-trials.com, ISRCTN81595685
Program Number: 3369 Poster Board Number: A514
Presentation Time: 1:45 PM - 3:30 PM
Education is positively associated with macular pigment: the Irish
Longitudinal Study on Ageing (TILDA)
Stephen Beatty1, Joanne Feeney2, Rose Anne Kenny2, Hilary Cronin2, Claire
O'Regan2, George M. Savva2, James Loughman3, Ciaran Finucane2, John M.
Nolan1. 1Macular Pigment Research Group, Waterford Institute of Technology,
Waterford, Ireland; 2Trinity College Dublin, Dublin, Ireland; 3Optometry, Dublin
Institute of Technology, Dublin, Ireland.
Purpose: The three carotenoids lutein (L), zeaxanthin (Z), and meso-zeaxanthin
(meso-Z), which account for the “yellow spot” at the macula and referred to as
macular pigment (MP), are believed to play a role in visual function and protect
against age-related macular degeneration (AMD), via their optical and/or
antioxidant properties. This study was undertaken to investigate determinants of
MP in a large randomly selected sample from the Republic of Ireland.
Methods: 4,593 participants were recruited into the health assessment component
of The Irish Longitudinal Study on Ageing (TILDA). MP optical density (MPOD)
was measured using customized heterochromatic flicker photometry (cHFP) in
4,373 participants. Socio-demographic and self-reported health data was obtained
using computer assisted personal interview (CAPI) and a wide array of objective
health measures were also obtained during the health assessment.
Results: Mean (SD) MPOD for the study group was 0.203 (0.156) with a range of
0 to 1.01. MPOD was higher for participants with secondary education [mean (SD)
= 0.205 (0.148)] than for those with only primary education or no education [mean
(SD) = 0.183 (0.113); p <.001]. MPOD was also higher for those with tertiary
education [mean (SD) = 0.232 (0.231)] compared with primary/no education or
secondary education (p < .001 for both comparisons).
Conclusions: We report a relative lack of MP amongst those participants of a
population-based study who did not have secondary or third level education. Given
the emerging evidence that MP is important for visual performance and comfort,
and given the putative protection that this pigment confers against AMD (especially
important in the context of increased risk of AMD in this social group), public
health measures aimed at improving diet for this at-risk population need to be
considered.
Commercial Relationships: Stephen Beatty, None; Joanne Feeney, None; Rose
Anne Kenny, None; Hilary Cronin, None; Claire O'Regan, None; George M.
Savva, None; James Loughman, None; Ciaran Finucane, None; John M. Nolan,
None
Support: None
Program Number: 3370 Poster Board Number: A515
Presentation Time: 1:45 PM - 3:30 PM
Two-wavelength Fundus Autofluorescence Measurement Of Macular Pigment
Optic Density (MPOD) And Total Amount Within The Central 21 Degrees In
Healthy Subjects; Implications For Routine Testing
Anthony G. Robson1A,2, Simona Degli Esposti1B, Dawn A. Sim1B, Jack D.
Moreland3, Catherine A. Egan1B. AElectrophysiology, BMedical Retina,
1
Moorfields Eye Hospital, London, United Kingdom; 2UCL Institute of
Ophthalmology, London, United Kingdom; 3Keele University, Keele, United
Kingdom.
Purpose: To evaluate the influence of eccentric macular pigment (MP) on
computations of relative optic density (OD) and total amount of MP using 2wavelength fundus autofluorescence imaging.
Methods: Macular pigment optical density (MPOD) and the total complement of
MP were measured in 38 healthy subjects using 2-wavelength fundus
autofluorescence imaging (wavelengths 488nm and 514nm). Measurements were
made relative to an eccentric reference location at 10.5 degrees eccentricity and
were compared with measurements relative to 4.0, 6.0 and 8.0 degrees eccentricity.
Results: Peak MPOD relative to a reference location at 10.5 degrees ranged from
0.19 to 0.93. The mean MPOD dropped to 0.05 or less at between 3.1 and 8.0
degrees and to 0.02 or less between 5.6 and 9.4 degrees eccentricity. Eighteen
subjects had MPOD values of 0.02 or more at 8 degrees eccentricity. Reducing the
eccentricity of the reference location from 10.5 degrees to 4.0, 6.0 or 8.0 degrees
reduced the relative peak MPOD by up to 27% (median 18%), 16% (median 10%)
and 9% (median 4%) respectively; underestimation tended to be greater for subjects
with low peak levels of MPOD. Comparison of the total complement of MP within
the central 21.0 degrees with the amount in the central 8.0, 12.0 or 16.0 degrees led
to underestimation of up to 68% (median 53%), 42% (median 27%) and 24%
(median 8%) respectively.
Conclusions: Assessments of luteal pigment that employ a reference location at
less than 10.5 degrees eccentricity may significantly underestimate the peak OD
and total complement of MP.
Commercial Relationships: Anthony G. Robson, None; Simona Degli Esposti,
None; Dawn A. Sim, None; Jack D. Moreland, None; Catherine A. Egan, None
Support: None
Program Number: 3371 Poster Board Number: A516
Presentation Time: 1:45 PM - 3:30 PM
Comparison Of Two-wavelength Autofluorescence And Reflectance
Techniques For The Evolution Of Macular Pigment Optical Density In
Healthy Eyes
Caroline Picot1A, Frederic Nicot1A, Serge Aho1B, Catherine Creuzot-Garcher1A,
Alain Bron1A. AOphthalmology, BEpidemiology, 1CHU Dijon, Dijon, France.
Purpose: The aim of our study was to evaluate and to compare macular pigment
optical density (MPOD) of healthy young subjects measured with two methods: the
modified Heidelberg Retina Angiograph (HRA) versus the Zeiss Visucam 200.
Methods: In this prospective study, healthy young subjects with no vitamin
supplement were included, one eye per patient. We excluded subjects with any
ocular or systemic disease. Maximal and mean MPOD (density units [DU]) were
measured with both methods on the same day after recording demographics, vision
and lifestyle details. The modified HRA used two-wavelength (488 and 514 nm)
fundus autofluorescence (AF). The Zeiss Visucam 200 measured the reflectance of
a single 460 nm wavelength.
Results: Sixty-seven healthy young subjects were included, median age 25 (20 to
45). The modified HRA values were significantly higher than the Visucam values
for MPOD at 0.5 and 2 degrees eccentricity around the fovea for modified HRA
versus maximal and mean MPOD by Visucam, p < 0.0001. The mean MPOD by
HRA at 0.5 and 2 degrees eccentricity around the fovea were respectively 0.49 ±
0.20 DU and 0.33 ± 0.13 DU. The maximal and mean MPOD by Visucam were
0.34 ± 0.06 DU and 0.12 ± 0.02 DU, respectively. The correlation coefficient
between the two methods was low for maximal and mean MPOD, r² = 0.106, p =
0.007 and r² = 0.148, p = 0.001, respectively. With Bland-Altman analysis the
mean differences (95% limits of agreement) were 0.15 DU (-0.22 to 0.52) for
maximal MPOD and 0.21 DU (-0.03 to 0.45) for mean MPOD.
Conclusions: Our findings showed that the agreement between modified HRA AF
Copyright 2012 by the Association for Research in Vision and Ophthalmology, Inc., all rights reserved. For permission to reproduce any abstract, contact the ARVO Office at pubs@arvo.org.
ARVO 2012 Annual Meeting Abstracts by Scientific Section/Group – Biochemistry/Molecular Biology (BI)
and reflectance by Visucam was moderate in measurements of MPOD. These
results suggest that the two methods are not interchangeable.
Commercial Relationships: Caroline Picot, None; Frederic Nicot, None; Serge
Aho, None; Catherine Creuzot-Garcher, None; Alain Bron, None
Support: None
Program Number: 3372 Poster Board Number: A517
Presentation Time: 1:45 PM - 3:30 PM
The Relationship Between Macular Pigment, Visuospatial Performance And
Visuomotor Function
Melissa J. Dengler, Antonio N. Puente, Emily R. Bovier, L S. Miller, Billy R.
Hammond, Jr., Lisa M. Renzi. Psychology, University of Georgia, Athens, GA.
Purpose: Macular pigment (MP) is known to improve visual function via a variety
of known mechanisms. Recent research suggests that the lutein (L) and zeaxanthin
(Z) that compose MP are also optimally placed to influence cognitive function and,
potentially, motor function, although the mechanisms for these findings are
unknown. Past studies have differed somewhat with respect to which cognitive
functions L+Z may influence, as well as the magnitude of those relationships.
Given the ubiquitous placement of L+Z in the vision system, the purpose of this
study was to determine whether or not MP optical density (as a biomarker of
cortical L+Z) was significantly related specifically to visual and visuomotor
domains of cognition (e.g., visuospatial cognition, attention, vestibular function) in
healthy and cognitively impaired adults.
Methods: MP optical density (MPOD) was assessed psychophysically and The
Standing Leg Test and Physical Performance Test (short battery, SPPB) was used
to assess visuomotor performance in 96 physically healthy adults (M = 63.77
years). The Repeatable Battery for the Assessment of Neuropsychological Status
(RBANS) was used to assess visuospatial/ constructional performance, and
attention in 45 of the 96 participants. Of the 45 participants, 18 met criteria for
cognitive impairment as determined by the Clinical Dimentia Rating Scale.
Results: MPOD was significantly related to improved balance ability (r = 0.29, n =
96) and visuospatial cognition (r = 0.25, n = 45), independent of cognitive status.
The relation between MPOD and visuospatial cognition was stronger in cognitively
impaired elders (r = 0.43, n = 18). MPOD was also significantly related to
attention, but only in impaired elders (r = 0.47, n = 18).
Conclusions: MP has been related to cognitive function, broadly defined, in past
research. These results suggest that MP’s relationship with cognition may be
particularly strong in the visual domain.
Commercial Relationships: Melissa J. Dengler, None; Antonio N. Puente,
None; Emily R. Bovier, None; L. S. Miller, None; Billy R. Hammond, Jr.,
None; Lisa M. Renzi, None
Support: None
Program Number: 3373 Poster Board Number: A518
Presentation Time: 1:45 PM - 3:30 PM
A Clinical Comparison Of The MacuScope And QuantifEye Macular Pigment
Densitometers
Elizabeth Wyles, Robert J. Donati. Illinois College of Optometry, Chicago, IL.
Purpose: Age-related macular degeneration (AMD) is the leading cause of
blindness among individuals older than 65 years. Studies have investigated levels
of macular pigment (MP) with heterochromic flicker photometry (HFP) which have
suggested an increased risk of development of AMD is associated with having
reduced MP. There are two compact commercially available HFP instruments in the
USA. Our aim was to determine the inter- and intra-instrument measurement
variability in a representative clinical population.
Methods: Twenty eight patients with and without signs of early AMD over the age
of 50 were recruited from the Illinois Eye Institute patient base. Macular pigment
optical density (MPOD) measurements were taken using the MacuScope and
QuantifEye. Data were collected by a single operator in a single session for each
patient. Two measurements were taken on each instrument. If the difference was
greater than 0.04 between the two measurements on a single instrument, a third
measurement was taken. Paired and unpaired student’s t-tests were done to
compare the statistical significance of the results from both instruments.
Additionally, a Bland-Altman plot was done for an additional comparison.
Results: Twenty three subjects were capable of providing valid data on both
instruments; the results are based on 46 data points. The overall mean MPOD for
the cohort was 0.341±0.149 for the MacuScope and 0.317±0.191 for the
QuantifEye. There was no significant difference between the mean MPOD readings
of the two instruments. The mean standard deviation (SD) of each subject’s MPOD
readings was 0.107 for the MacuScope and 0.058 for the QuantifEye. There is a
significant difference between the two instruments (p<0.0006) when considering
individual subject variability.
Conclusions: If MPOD is being monitored clinically to assess risk of AMD with
the possibility of causing altered treatment regimens, the need for reliable data
measurements is imperative. Based on this limited study, both instruments appear
to demonstrate reliability based on the means and differences between the means.
However, when critically looking at each subject’s data points, there is significant
variability between the instruments. Thus, the clinician must take this into account
if using MPOD as an indicator for AMD risk and/or clinical care.
Commercial Relationships: Elizabeth Wyles, None; Robert J. Donati, None
Support: Illinois College of Optometry, Research Resources Committee
Program Number: 3374 Poster Board Number: A519
Presentation Time: 1:45 PM - 3:30 PM
Optimization Of The Uptake And Bioavailability Of Water-based Nanodispersions Of Zeaxanthin In C57BL/6 Mice
Preejith P. Vachali, Aihua Liu, Binxing Li, Zhengqing Shen, Brian Besch, Mike
Black, Ryan Terry, Paul S. Bernstein. Moran Eye Center, University of Utah, Salt
Lake City, UT.
Purpose:
Dietary lutein and zeaxanthin, the two principal carotenoids in the human eye, can
play a protective role against human ocular diseases such as age-related macular
degeneration and cataract. Carotenoids are lipophilic compounds with relatively
low oral bioavailability in mouse models. In this study, we evaluated the absorption
and bioavailability of zeaxanthin-sucrose monolaurate (SML) and zeaxanthinCaptisol nano-dispersed in aqueous media. These carotenoid formulations were
given to transgenic mice, with a specific zeaxanthin-binding-protein (human
GSTP1) over expressed in their retinas.
Methods:
C57BL/6 mice, (13-15 weeks old) were used. The experimental groups (10 each)
GSTP1 transgenic and wild type received zeaxanthin-Captisol (12.5
mg/day/mouse) by daily gavage or the zeaxanthin- SML (0.140 mg/day/mouse) in
drinking water. The control group (3 wild type mice) received Captisol or SML
alone. The tissues were harvested after 4 weeks of feeding, and the samples were
analyzed using HPLC.
Results:
Results are summarized in the attached table.
Conclusions:
While the zeaxanthin-Captisol method administered 10 times more carotenoid than
the zeaxanthin-SML method, the resulting serum levels did not vary much between
the dosages, and we were unable to detect any zeaxanthin in the retina. The
zeaxanthin-SML method seems to be a promising method of delivery, as the
amount of carotenoids delivered per day is closer to the physiological level an adult
human would receive via supplementation, and it can be delivered conveniently in
drinking water. We are currently optimizing various conditions of zeaxanthin
delivery to achieve a higher level of serum uptake and improved delivery into the
retina of the GSTP1 transgenic
mice.
Commercial Relationships: Preejith P. Vachali, None; Aihua Liu,
None; Binxing Li, None; Zhengqing Shen, None; Brian Besch, None; Mike
Black, None; Ryan Terry, None; Paul S. Bernstein, None
Support: NIH Grant EY11600, RPB and Lowy Foundation
Program Number: 3375 Poster Board Number: A520
Presentation Time: 1:45 PM - 3:30 PM
Relationship between Macular Pigment and Foveal Anatomic Architecture in
an Asian Population
Sheena D. Dhanani, Tanveer S. Asaria, John L. Barbur, Byki Huntjens. Applied
Vision Research Centre, The Henry Wellcome Laboratories for Vision Sciences,
City University London, United Kingdom.
Purpose: The extent to which reduced macular pigment optical density (MPOD)
contributes to the prevalence of age related macular degeneration (ARMD) in
Caucasians compared to other ethnicities has often been questioned. Foveal
architecture may be related to MPOD levels and hence be a contributing factor.
Previous studies have reported race-linked differences in peak MPOD and its
central spatial distribution. This study investigates the relationship between MPOD
and foveal architecture in an adult Asian population.
Copyright 2012 by the Association for Research in Vision and Ophthalmology, Inc., all rights reserved. For permission to reproduce any abstract, contact the ARVO Office at pubs@arvo.org.
ARVO 2012 Annual Meeting Abstracts by Scientific Section/Group – Biochemistry/Molecular Biology (BI)
Methods: The spatial profile of MPOD was assessed in 55 healthy Asian subjects
(mean age 21 ± 4 years) using heterochromatic flicker photometry (Ophthalmic
Physiol Opt. 30:470-483,2010). High-resolution macular thickness maps were
obtained using a spectral-domain optical coherence tomography (Spectralis OCT,
Heidelberg, Germany). The following relationships were investigated: 1) Peak
MPOD (at 0° eccentricity) and minimal foveal thickness (MFT) measured
manually at the point of sharpest foveal reflex; 2) Peak MPOD and central foveal
thickness (CFT: average retinal thickness within central 1mm circle of the ETDRS
grid); 3) Peak MPOD and foveal width (FW: measured from crest to crest); 4) MFT
and FW; 5) Average MPOD (ODav: over an area subtending ±2.8° centred at the
fovea) and FW; and 6) ODav and CFT.
Results: The peak MPOD values (mean 0.56 ± 0.17 log units) and the
corresponding MFT showed good correlation (R2 = 0.34 p<0.0005). A weaker
correlation was found between peak MPOD and CFT (R2 = 0.12; p=0.01). A
moderately significant negative correlation was found between FW and CFT (R2 =
0.22; p<0.0005) and between FW and MFT (R2 = 0.1; p=0.03). In contrast, no
correlation was found between FW and peak MPOD at 0° (p=0.84), ODav and FW
(p=0.41), or ODav and CFT (p=0.59).
Conclusions: The current findings suggest that minimal foveal thickness
(measured manually at the point of sharpest foveal reflex) is a better predictor value
for MPOD compared to the central foveal thickness given by the OCT. The
expectation that a wider foveal width may contain more macular pigment because
of longer cone axon fibres is not supported by our findings in the Asian subject
group. Our results suggest that differences in foveal architecture can explain some
of the measured variations in MPOD.
Commercial Relationships: Sheena D. Dhanani, None; Tanveer S. Asaria,
None; John L. Barbur, None; Byki Huntjens, None
Support: None
Program Number: 3376 Poster Board Number: A521
Presentation Time: 1:45 PM - 3:30 PM
Effect Of Carotenoid Supplementation On Macular Pigment Optical Density
And Visual Performance In Normal Observers: The Most Vision Trial
James Loughman1, Stephen Beatty2, Alan Howard3, Eithne Connolly4, John M.
Nolan2. 1Optometry, Dublin Institute of Technology, Dublin, Ireland; 2Waterford
Institute of Technology, Waterford, Ireland; 3Downing College, Cambridge, United
Kingdom; 4Institute of Vision Research, Waterford, Ireland.
Purpose: No study investigating the effect of macular pigment (MP) on visual
performance has emphasized or evaluated the potential role of meso-zeaxanthin
(MZ). Aside from its obvious protective function, MZ is somewhat intriguing from
a visual performance perspective for a number of reasons including its dominance
at the central macula and its capacity to extend the range of blue light filtration at
the macula.
Methods: Thirty six subjects were recruited into this single blind, randomised and
placebo controlled trial. Twelve subjects were randomly assigned to one of three
supplementation groups. Group 1 were supplemented with a product containing 20
mg lutein (L) & 2 mg zeaxanthin (Z), Group 2 were supplemented with a product
containing 10mg meso-zeaxanthin (MZ); 10mg L & 2 mg Z, while Group 3 were
supplemented with placebo. Visual performance was assessed using a range of tests
including: visual acuity, contrast sensitivity, glare disability, photostress recovery,
ocular straylight, ocular discomfort rating and visual experience by questionnaire.
MP, across its full spatial profile, was measured using the Macular Dentitometer
TM. The full range of assessments was conducted, for each subject, on three
separate visits, at baseline, three months and six months.
Results: At baseline, there were no significant differences, for any study
parameters, between the three study groups (p > 0.05 for all). The only significant
increase in MP was achieved in Group 2, and significance was reached by the 3
month visit (p = 0.002 to 0.035 across retinal eccentricities) and maintained at 6
months (p = 0.012 to 0.041 across retinal eccentricities). Statistically significant
improvements in visual performance were observed across measures of visual
acuity (p = 0.01), contrast sensitivity (p = 0.008 to 0.025 across spatial frequencies)
and glare disability (p = 0.023 to 0.043 across spatial frequencies), but only in
Group 2.
Conclusions: This study was designed to investigate the potential of two distinct
MP supplements (in comparison to a placebo product), one containing MZ, one not
containing MZ, and both with the same overall carotenoid content (22mg) to (a)
augment MPOD and (b) enhance visual performance. The data show that vision in
people with no occurring eye disease (i.e. normal healthy vision) can be improved
if MP is significantly increased as was achieved in Group 2. The lack of any
significant increase in MP or visual performance in either of the other two
supplementation groups suggests, perhaps, that supplementation with all three
macular carotenoids, including MZ, maximises the benefit of supplementation in
terms of augmentation of MP and consequential improvements in vision.
Commercial Relationships: James Loughman, Howard Foundation (C, R);
Stephen Beatty, Howard Foundation (C, R); Alan Howard, Howard foundation
(P); Eithne Connolly, None; John M. Nolan, Howard foundation (C)
Support: None
Program Number: 3377 Poster Board Number: A522
Presentation Time: 1:45 PM - 3:30 PM
Longitudinal Assessment Of Multiple Macular Pigment Parameters In
Patients With Macular Telangiectasia (MacTel) Type 2
Simona Degli Esposti1A, Jack D. Moreland2, Anthony G. Robson1B, Catherine A.
Egan1A. AMedical Retina, BElectrophysiology, 1Moorfields Eye Hospital, London,
United Kingdom; 2MacKay Institute of Communication and Neuroscience, Keele
University, Keele, United Kingdom.
Purpose: To characterise and monitor the spatial distribution and the computed
total amount of macular pigment (MP) in MacTel type 2 patients over periods of up
to 39 months.
Methods: 76 eyes of 44 patients were graded according to Gass classification of
MacTel type 2 (grades 1-5). Two-wavelength fundus autofluorescence (2-AF;
incident radiation 488nm and 514nm) was used to quantify MP optical density
(MPOD) and MP distribution using a scanning laser ophthalmoscope. Twodimensional 2-AF MP distribution profiles were assessed relative to a reference
location at 10.5 degrees eccentricity and the total amount of MP was measured
from the 2-AF image. Measurements were repeated over periods of 12-39 months
(mean follow up 21 months).
Results: Eight eyes had MP with a peak at the fovea (mean MPOD = 0.37) and 68
had an annular distribution with an eccentric peak (mean MPOD = 0.08; mean
eccentricity of peak = 5.04 degrees). Disease severity did not correlate significantly
with the MPOD peak or with the lateral extent of MP. The median total MP
complement tended to be less in severe disease than moderate disease but there was
no significant correlation. The mean change in peak MPOD at follow-up was less
than 0.01 and the eccentricity at which lateral MPOD dropped to 0.02 changed by a
mean of -0.13 degrees. No patient progressed to a different clinical group and no
patient with foveal MP developed a predominantly annular MP distribution over
the 12-39 months of the study, although marked reduction in total MP was seen in
14 individuals (mean change -2057, range -1065 to -4752).
Conclusions: Patients with MacTel type 2 commonly have an abnormal
paracentral distribution of MP. Evaluation of peak MPOD and distribution revealed
no significant correlation with severity of disease over the 12-39 months of the
study. The total amount of MP did not correlate with disease severity.
Commercial Relationships: Simona Degli Esposti, None; Jack D. Moreland,
None; Anthony G. Robson, None; Catherine A. Egan, None
Support: None
Program Number: 3378 Poster Board Number: A523
Presentation Time: 1:45 PM - 3:30 PM
Correlation of Macular Pigment Optical Density with foveal threshold
sensitivity and Optical Quality in Normal Asian Indian Eyes
Koushik R. Sargod, Rohit Shetty, Rajesh S. Kumar, Bhujang K. Shetty.
Ophthalmology, Narayana Nethralaya Eye Hospital, Bangalore, India.
Purpose: To determine macular pigment optical density (MPOD) using
heterochromatic flicker photometry in young healthy Asian Indian eyes and to
investigate its correlation with foveal threshold sensitivity and objectively
measured optical quality.
Methods: We determined MPOD using the Tinsley macular pigment densitometer
(Tinsley Ophthalmic, Surrey, UK) which measures macular pigment absorption
density using the log sensitivity to 460nm light for the fovea and parafovea after
normalizing with respect to 540nm. Foveal threshold sensitivity was measured
using the macular integrity assessment (MAIA) microperimeter (CenterVue,
Padova, Italy) using the central 10 degree (37 stimuli) field of testing centered at
the fovea. Optical quality indices [Modulation transfer function (MTF), Strehl ratio
(SR) and Optical scatter index (OSI)] were obtained from the optical quality
assessment system (Visiometrics, Terrassa, Spain) based on the double-pass
technique that provides an objective measurement of the optical quality of the eye.
Results: 50 eyes (25 subjects) were analyzed (15 males and 10 females); mean age
was 26.28 ±5.8 (range, 20-35) years. The mean MPOD was 0.42 ± 0.10 and the
mean foveal threshold sensitivity was 30.72 ±1.56. The mean MTF was
42.61±11.2, mean strehl ratio was 0.24±0.06 and mean OSI was 0.42 ± 0.24.
MPOD correlated poorly with foveal threshold (r=0.179, p=0.21). MPOD also
showed poor correlation with the optical quality indices [MTF(r=0.2, p=0.160;
SR(r=0.09, p=0.51); OSI(r=-0.140, p=0.33)].
Conclusions: MPOD appears to have poor correlation with foveal threshold
sensitivity and optical quality measures.
Commercial Relationships: Koushik R. Sargod, None; Rohit Shetty,
None; Rajesh S. Kumar, None; Bhujang K. Shetty, None
Support: None
Program Number: 3379 Poster Board Number: A524
Presentation Time: 1:45 PM - 3:30 PM
Macular Pigment After Surgery For Idiopathic Macular Hole
Elisa Carini, Ferdinando Bottoni, Emma Zanzottera, Marco Pellegrini, Mario
Cigada, Giovanni Staurenghi. Eye Clinic Department of Clinical Science "Luigi
Sacco", Sacco Hospital, University of Milan, Milan, Italy.
Copyright 2012 by the Association for Research in Vision and Ophthalmology, Inc., all rights reserved. For permission to reproduce any abstract, contact the ARVO Office at pubs@arvo.org.
ARVO 2012 Annual Meeting Abstracts by Scientific Section/Group – Biochemistry/Molecular Biology (BI)
Purpose: Purpose of the study was to investigate the changes of macular pigment
after surgical repair of idiopathic macular hole (IMH).
Methods: Seven eyes of 7 consecutive patients affected by IMH (stage 3 and 4)
were treated with 25 gauge pars plana vitrectomy, Brilliant Blue assisted peeling of
internal limiting membrane, air/fluid exchange with subsequent injection of 20%
sulfur hexafluoride and strict face-down positioning for 3 to 5 days. Follow-up
examinations were scheduled at 1, 3, 6 and 9 months after the operation and they
included the following examinations: best corrected visual acuity (BCVA, Snellen
charts), SD OCT ( Heidelberg HRA Spectralis), fundus autofluorescence (FA,
HRA Spectralis) and measurement of macular pigment optical density (MPOD)
with 2 wavelength autofluorescence ( HRA Heidelberg).
Results: Mean age was 68,7 years. All IMHs closed after surgery . Mean BCVA
changed from 0.2 before surgery to 0,7 after surgery. The mean follow up was 6.4
months (range, 1 to 9 months).
MPOD was already detectable at first month follow-up visit in all the patients and
none of them experienced progressive gain in MPOD during the follow up period.
There was no apparent correlation between external limiting membrane (ELM)
recovery and MPOD: eyes with still disrupted ELM at 1 month (4 out of 7) showed
levels of MPOD which were comparable to those at final follow-up visit.
A more consistent lack of correlation was observed between recovery of the inner
segment/outer segment (IS/OS) line and MPOD: none of the seven eyes showed a
continuous IS/OS line at one month whereas MPOD was already detectable in all
patients at the same time point.
The presence of a continuous IS/OS line was the most important predictive factor
for BCVA (p<0,0001).
MPOD had also a positive correlation with BCVA (p=0,02).
Conclusions: Macular pigment seems to be detectable in the immediate post
operative period after surgical repair of IMH. This might support the assumption
that the macular pigment detected after surgery is the one already present at the
edges of the hole before surgery. More patients are needed to better understand the
clinical and eventually the predictive value of MPOD.
Commercial Relationships: Elisa Carini, None; Ferdinando Bottoni,
None; Emma Zanzottera, None; Marco Pellegrini, None; Mario Cigada, None;
Giovanni Staurenghi, Allergan,Glaxo Smith Kline,Heidelberg Engineering,ODOS,Pfizer Opthalmics (C), Canon, Optovue (S), Ocular Instruments, Inc. (P)
Support: None
Program Number: 3380 Poster Board Number: A525
Presentation Time: 1:45 PM - 3:30 PM
The Ring Like Distribution Profile Of Macular Pigment Appears Highly
Heritable: A Twin Study
Erik F. van Kuijk1, S.H. Melissa Liew2, Stephen Beatty3, Clare E. Gilbert4,
Christopher J. Hammond5. 1Ophthalmology, Univ of Minnesota, Minneapolis, MN;
2
Twin Research and Genetic Epidemiology, King's College, London, United
Kingdom; 3Macular Pigment Research Group, Waterford Institute of Technology,
Waterford, Ireland; 4ICEH / CRU / ITD, London Sch of Hygiene & Tropical Med,
London, United Kingdom; 5Ophthalmology, King's College London, London,
United Kingdom.
Purpose: Macular pigment (MP) protects the retina from damage due to blue light
and other oxidative stress. Genetic factors determine the distribution profile of MP,
which may also be important in protection from oxidative stress. In addition it has
been suggested that the ring pattern (with a “shoulder” in the profile at ~0.5 degrees
from the fovea) may be protective of AMD.
Methods: 322 healthy white female twin volunteers, aged 16-50 years (mean age
40+/-8.7 years) had macular pigment optical density (MPOD) measured by 2wavelength fundus autofluorescence (AF). The sample consisted of 76
monozygotic twin pairs, and 74 dizygotic twin pairs.
Results: At baseline, mean MPOD by AF was 0.41 density units (SD 0.21; range
0.04 to 1.25) in the central half-degree field, and exhibited a near- normal
distribution. The ring like MP distribution profile was observed in 100 subjects
(prevalence 0.31, 95% CI 0.26-0.36). Concordance in monozygotic twins was 0.85
(95% CI 0.75-0.95) compared to 0.43 in dizygotic twins (95% CI 0.23-0.63), (p for
diff<0.001).
Conclusions: The finding that the monozygotic twin concordance is approximately
double the dizygotic concordance suggests that genetic factors are important in
determining the MP distribution in the
macula
Commercial Relationships: Erik F. van Kuijk, None; S.H. Melissa Liew,
None; Stephen Beatty, None; Clare E. Gilbert, None; Christopher J.
Hammond, None
Support: Research to Prevent Blindness
Program Number: 3381 Poster Board Number: A526
Presentation Time: 1:45 PM - 3:30 PM
Reduced perception of Haidinger’s brushes in MacTel type 2 patients
Marcus Fruttiger1, Pearse A. Keane2A, Michael B. Powner1, Dawn A. Sim3A,
Andrew Scott3, Javier Zarranz Ventura2, Simona Degli Esposti2, Praveen J. Patel3B,
Adnan Tufail3C, Catherine A. Egan3A. 1UCL Institute of Ophthalmology, London,
United Kingdom; ANIHR Biomed Resrch Ctr for Opht, 2Moorfields Eye Hosp NHS
Fndtn Trust, London, United Kingdom; AMedical Retina, BResearch &
Development, COphthalmology, 3Moorfields Eye Hospital, London, United
Kingdom.
Purpose: Linearly polarised light induces the perception of a blue-yellow
propeller-like structure in the centre of vision. This is an entoptic percept called
Haidinger’s brushes. The orientation of the blue and yellow arms depends on the
direction of the polarised light. It is believed that the perception of this
phenomenon is based on the dichroic properties of luteal pigment in Henle’s fibre
layer. To test this, we assessed Haidinger’s brushes perception in MacTel type 2
patients, who are known to lack luteal pigment in the macula.
Methods: Linear polarising filters were placed in front of a back illuminated white
diffuser disc. Subjects were asked to look at the disc from 1 m distance and identify
the orientation of the yellow arms. To train the subjects and to control for visual
acuity we printed a pattern resembling Haidinger’s brushes on non-polarising
filters. 5 training filters and 7 polarising filters with different orientations were used
to test both eyes independently.
Results: Of 20 healthy subjects (mean age 59) and 27 MacTel patients (mean aged
68) 7 MacTel patients failed the training session and were excluded because they
could not correctly identify the orientation of the yellow arms in the printed control
patterns. From the remaining patients the eye with the better visual acuity was
chosen. The healthy control group managed to identify 81% of the Haidinger’s
brushes orientation correctly. In comparison the MacTel patients only scored 18%
correctly. The performance of the two groups was statistically significant different
(p < 0.00001). Within the MacTel group there was no correlation between visual
acuity and test scores (Spearman’s rank r=-0.17, p=0.52).
Conclusions: Our results demonstrate that MacTel type 2 patients are not able to
perceive Haidinger’s brushes.
Commercial Relationships: Marcus Fruttiger, None; Pearse A. Keane,
None; Michael B. Powner, None; Dawn A. Sim, None; Andrew Scott,
None; Javier Zarranz Ventura, None; Simona Degli Esposti, None; Praveen J.
Patel, None; Adnan Tufail, None; Catherine A. Egan, None
Support: Lowy Medical Research Institute, Sydney, Australia
Program Number: 3382 Poster Board Number: A527
Presentation Time: 1:45 PM - 3:30 PM
Dietary Supplementation With Lutein Diacetate And Lutein: A Comparison
John T. Landrum1A, Richard A. Bone1B, Vanesa Mendez1A, Anisley Valenciaga1A,
Darwin Babino1A. AChemistry and Biochemistry, BPhysics, 1Florida International
University, Miami, FL.
Purpose: The responses of subjects taking a 20 mg/day lutein diacetate supplement
were compared with that for a 20 mg/day crystalline lutein or a placebo.
Methods: Ten subjects, assigned to each of three groups, lutein diacetate (group 1),
lutein (group 2), and a placebo (group 3), were supplemented for 24 weeks. Groups
Copyright 2012 by the Association for Research in Vision and Ophthalmology, Inc., all rights reserved. For permission to reproduce any abstract, contact the ARVO Office at pubs@arvo.org.
ARVO 2012 Annual Meeting Abstracts by Scientific Section/Group – Biochemistry/Molecular Biology (BI)
1 and 2 consumed a dose equivalent to 20 mg per day of free lutein. Serum
samples, collected at baseline, and at weeks 6, 12, 18, and 24 were analyzed by
HPLC. Macular Pigment Optical Density (MPOD) was obtained by
heterochromatic flicker photometry at baseline and weeks 6, 12, 18 and 24..
Results: The average serum lutein concentrations for weeks 6 to 24 expressed as a
ratio to the baseline value (±SD) were 5.52 ± 2.88 for group 1, 4.43 ± 1.61 for
group 2, and 1.03 ± 0.25 for group 3. The median rate of macular pigment increase
(milli-absorbance units/week) for groups 1, 2, and 3 were 2.35, 1.55, and 0.19
mAU/wk, respectively. P-values for these serum and MPOD increases are both
highly significant when compared to placebo.
Conclusions: The average serum response was ~25% higher for group 1 compared
with group 2 and, the median MPOD response was 52% higher for group 1 than
group 2. P-values calculated for the differences in these increases were, p = 0.066,
marginally significant, for serum, and p = 0.09 approaching significance, for
MPOD.
Commercial Relationships: John T. Landrum, Industrial Organica S.A. de
C.V. (F); Richard A. Bone, Industrial Organica S.A. de C.V. (F); Vanesa
Mendez, Industrial Organica S.A. de C.V. (F); Anisley Valenciaga, Industrial
Organica S.A. de C.V. (F); Darwin Babino, Industrial Organica S.A. de C.V. (F)
Support: Industrial Organica S.A. de C.V.
Program Number: 3383 Poster Board Number: A528
Presentation Time: 1:45 PM - 3:30 PM
Assessing The Visual Benefit Of Macular Pigment On Targets Viewed
Through Simulated Blue Haze And Achromatic Broadband Light
Laura M. Fletcher, Emily R. Bovier, Michael Engles, Billy R. Hammond.
Psychology, Univeristy of Georgia, Athens, GA.
Purpose: A potentially major factor limiting the detectability of distant targets is
veiling due to atmospheric light scattering, known commonly as haze. Under
typical conditions, atmospheric haze is shortwave dominant (peak = 460nm), hence
its name, Blue Haze. Wooten & Hammond (2002) first modeled the influence of a
yellow filter (in this case, the macular pigments, MP) that absorbs blue haze, thus
conferring a visual benefit (i.e., observers can, theoretically, see farther). The
purpose of this study was to begin to characterize the influence of MP on target
detectability under simulated blue haze and achromatic (i.e., “sunlight”) conditions.
Methods: Three experienced subjects participated in this study. A two-channel
Newtonian view optical system was used to present a 0.5-deg, 3.36cpd shortwave
deficient target (cutoff = 570nm) at 2.5cd m-2. Superposed onto the target was a
background (either a 582nm interference filter, a blue haze filter or an “unfiltered”
xenon) whose luminance was under experimenter control. Targets were viewed
binocularly. Alternating ascending (5) and descending (5) thresholds were obtained
via the method of limits. Threshold was taken to be the average of the background
luminance at each of the 10 transition points for each condition. Macular pigment
optical density (MPOD) was measured in each subject’s right eye using
heterochromatic flicker photometry.
Results: Visual benefit for the blue haze and achromatic conditions (affected by
MP absorption) was calculated as the ratio of the threshold in each condition to the
threshold obtained using the 582nm background (unaffected by MP absorption).
The mean MPOD for our subjects was 0.72±0.12. The mean visual benefit for the
blue haze and achromatic background conditions was 2.09±0.01 and 1.6±0.19.
Conclusions: These preliminary data indicate a significant relation between MP
and visibility measured under these varying conditions. Additional data will be
presented.
Commercial Relationships: Laura M. Fletcher, None; Emily R. Bovier,
None; Michael Engles, None; Billy R. Hammond, None
Support: None
365 RNA Editing in Retinal Health and Disease - Minisymposium
Tuesday, May 8, 2012, 3:45 PM - 5:30 PM
Grand B Symposium
Program #/Board # Range: 3684-3690
Organizing Section: Biochemistry/Molecular Biology
Contributing Section(s): Retinal Cell
Biology,Retina+,Glaucoma,Clinical/Epidemiologic Research
Program Number: 3684
Presentation Time: 3:45 PM - 4:00 PM
Introduction: RNA Editing In Retinal Health And Disease
Anneke I. den Hollander. Ophthalmology, Radboud Univ. Nijmegen Medical
Center, Nijmegen, The Netherlands.
New high-throughput sequencing technologies provide an opportunity to study the
architecture of retinal genes at an unprecedented level. RNA sequencing (RNAseq) allows an accurate cataloguing of retinal transcript abundances and alternative
splicing information at different developmental stages and in various cell types.
Such studies will aid our understanding of retinal cell development and biology in
health and disease.
Retinal degenerations are characterized by an extreme genetic heterogeneity,
involving a large number of genes in various biological pathways. Genetic studies
have identified an important role for RNA splicing in retinal disease, as mutations
in various genes of the splicing machinery have been identified in patients with
autosomal dominant retinitis pigmentosa. Studies that will be presented at his
minisymposium are targeting to unravel the mechanisms of RNA editing defects in
retinal disease.
During the last years considerable progress has been made in the development of
gene replacement therapies for retinal degenerations. For certain genetic defects
alternative therapeutic approaches based on RNA editing may be applicable. At this
minisymposium specific examples of studies that aim to develop therapies targeting
RNA molecules will be highlighted.
Commercial Relationships: Anneke I. den Hollander, None
Support: Netherlands Organisation for Scientific Research, Foundation Fighting
Blindness USA
Program Number: 3685
Presentation Time: 4:00 PM - 4:15 PM
Transcriptome Analyses of Retina & RPE
Krzysztof Palczewski. Dept Pharmacology School of Medicine, Case Western
Reservce University, Cleveland, OH.
Genetic and environmental factors have been extensively investigated as key
factors of underlying mechanisms of age-related retinal degeneration (ARD), but
the multifactorial nature of the disease has made it difficult to elucidate the causal
events that lead to irreversible vision loss in ARD. In this study, we characterized
the visual function of several mouse models to show that background genetic
effects have a pronounced role in ARD pathogenesis. RNA-Sequencing (RNA-Seq)
elucidated of the transcriptomes of normal and ARD model eyes at a young age
before pathology is present to understand the causal factors of ARD.
Commercial Relationships: Krzysztof Palczewski, None
Support: NIH Grant EYEY008061
Program Number: 3686
Presentation Time: 4:15 PM - 4:30 PM
RNA Splicing Factor RP
Eric A. Pierce. Ophthalmology, Massachusetts Eye and Ear Infirmary, Boston,
MA.
Commercial Relationships: Eric A. Pierce, None
Support: None
Program Number: 3687
Presentation Time: 4:30 PM - 4:45 PM
Gene Therapy to Correct Splice Defects: Recruiting Splice Factors to Mutated
Splice Sites
John Neidhardt. Institute of Medical Molecular Genetics, University of Zurich,
Schwerzenbach, Switzerland.
In humans, about 15-20 % of familial retinal degenerations are caused by mutations
inducing splice defects. The underlying pathogenic mechanism is an altered
binding of splice factors to the mutated pre-mRNA which often results in aberrant
splicing of the affected transcript. We developed a treatment strategy to correct
mutation-induced splice defects.
The splice factor U1 snRNP (U1) is essential to recognize splice donor sites and to
initiate the splicing process. As a therapeutic approach, we engineered the U1
sequence to increase its binding affinity to mutated splice donor sites. Patientderived cell lines carrying mutations in the ciliary genes RPGR and BBS1 were
transduced with viral particles delivering mutation-adapted U1 derivatives. The
correction of splice defects was found to be specific, dose dependent and applicable
to different mutations causing retinal degeneration.
The U1-based gene therapy constitutes a promising approach to treat a variety of
splice donor site mutations, independent of the disease gene.
Commercial Relationships: John Neidhardt, None
Support: Velux foundation
Program Number: 3688
Presentation Time: 4:45 PM - 5:00 PM
Genetic Therapy Correcting Splice Defects in Retinal Disease Using Antisense
Oligonucleotides
Rob W. Collin. Human Genetics, Radboud Univ Nijmegen Med Ctr, Nijmegen, The
Netherlands.
Leber congenital amaurosis (LCA) is the most severe form of inherited retinal
degeneration, with an onset in the first year of life. The most frequent mutation that
causes LCA, present in at least 10% of LCA patients from North-American and
Northern-European descent, is an intronic mutation in CEP290 that results in the
inclusion of an aberrant exon in the CEP290 mRNA. Here, we describe a gene
therapy approach that is based on antisense oligonucleotides (AONs), small RNA
molecules that are able to redirect normal splicing of aberrantly processed premRNA. Immortalized lymphoblastoid cells of LCA patients homozygously
carrying the intronic CEP290 mutation were transfected with several AONs that
target the aberrant exon that is incorporated in the mutant CEP290 mRNA.
Subsequent RNA isolation and RT-PCR analysis revealed that a number of AONs
were capable of almost fully redirecting normal CEP290 splicing, in a dose-
Copyright 2012 by the Association for Research in Vision and Ophthalmology, Inc., all rights reserved. For permission to reproduce any abstract, contact the ARVO Office at pubs@arvo.org.
ARVO 2012 Annual Meeting Abstracts by Scientific Section/Group – Biochemistry/Molecular Biology (BI)
dependent manner. Other AONs however displayed no effect on CEP290 splicing
at all, indicating that the rescue of aberrant CEP290 splicing shows a high degree
of sequence specificity. Currently, we are expanding our studies towards the
generation of viral vectors that express AONs, and using a tailor-made transgenic
mouse model that carries the intronic CEP290 mutation. Together, our data show
that AON-based therapy is a promising therapeutic approach to develop a cure for
this blinding disease.
Commercial Relationships: Rob W. Collin, Patent ID#: 61/531,137 (P)
Support: NWO/ZonMW VENI Grant 916.10.096
Program Number: 3689
Presentation Time: 5:00 PM - 5:15 PM
mRNA-microRNA Interactions in Retinal Disease
Nigel G. Cooper. Anatomical Sciences & NeuroBio, University of Louisville,
Louisville, KY.
The purpose of this study was to determine what role miRNAs (miRs) play in the
development of ischemia-reperfusion injury in the retina. We used a a rat model in
which intra-ocular eye pressure was increased for 1 hr then allowed to recover for
either 0 minutes, 24 hours or 7 days. We used miRNA arrays to determine altered
expression values at these time points. The predicted mRNA targets were obtained
from miR-databases. The predicted targets were compared to actual mRNA
expression values, as determined from parallel assays of mRNA expression arrays.
Pathway analyses indicated the activation of several cellular processes over time.
These included cell death, inflammation and complement activation. This study
demonstrates the involvement of microRNAs as regulators of altered gene
expression in ischemia-reperfusion injury in the retina.
Commercial Relationships: Nigel G. Cooper, None
Support: NIH Grant EY017594
Program Number: 3690
Presentation Time: 5:15 PM - 5:30 PM
The Spliceosome and Pre-mRNA Processing in Patients with Splicing Factor
RP
Carlo Rivolta. Department of Medical Genetics, University of Lausanne, Lausanne,
Switzerland.
Commercial Relationships: Carlo Rivolta, None
Support: None
371 Genomics, Proteomics and Molecular Biology of Glaucoma
Tuesday, May 8, 2012, 3:45 PM - 5:30 PM
Hall B/C Poster Session
Program #/Board # Range: 3829-3876/A529-A576
Organizing Section: Biochemistry/Molecular Biology
Program Number: 3829 Poster Board Number: A529
Presentation Time: 3:45 PM - 5:30 PM
Endogenous Lipids as Regulators of Intraocular Pressure in Glaucoma
Sanjoy K. Bhattacharya, Katyayini Aribindi, Manik Goel, Richard K. Lee. Bascom
Palmer Eye Institute, Univ of Miami Miller Sch of Med, Miami, FL.
Purpose: To determine whether differentially present phosphoserines in the normal
compared to glaucomatous aqueous humor modulate intraocular pressure (IOP) and
mechanotransduction channels on the trabecular meshwork (TM) cells.
Methods: All studies were performed adhering to the ARVO Statement for the Use
of Animals in Research and to the tenets of declaration of Helsinki. Differential
mass spectrometric shotgun lipidomic analyses were performed with normal and
glaucomatous aqueous humor (n= 10 each) for Phosphatidylserine species and the
corresponding lysophospholipids with neutral loss scan for m/z 87.1 (serine
residue) using a TSQ Quantum Access Max instrument. Intracameral injection of
selected identified lipids in DBA/2J mice (n=42-48) was made using
ultramicropump II. IOP measurements in control and experimental mice were
carried out using the Tonolab and intraocular cannulation. Eyes were enucleated
and optic nerve damage was assessed using paraphenylenediamine (PPD) staining.
Primary human TM cells were subjected to treatment with lipids.
Mechanotransduction channels (TREK-1, Piezo 1 &2) found in the TM by genomic
analyses were subjected to determination of level changes by Western Blot
analyses.
Results: We identified differential downregulation of a phosphoserine (lipid L525)
in the glaucomatous aqueous humor. Intracameral injection of Lipid Z (a
phosphoserine) in the TM of DBA/2J starting at 5 months of age (n=42-48) resulted
in dramatic reduction (about 6 mm of Hg) in peak IOP over uninjected control
mice. The optic nerve damage in DBA/2J mice correlated with elevated IOP.
Administration of phosphoserine renders level changes in Piezo1 and Piezo 2
channels determined by Western Blot analyses in DBA/2J mice and in primary
human TM cells.
Conclusions: The level of IOP is regulated by select endogenous phosphoserines.
The present investigation suggests endogenous phosphoserines may be involved in
the regulation of IOP mediated through mechanotransduction channels.
Commercial Relationships: Sanjoy K. Bhattacharya, Intent to file a patent (P);
Katyayini Aribindi, Intent to file a patent (P); Manik Goel, None; Richard K.
Lee, Intent to file a patent (P)
Support: Supported by RPB Career award (SKB), an unrestricted grant from RPB
to University of Miami, NIH grants R01EY016112 and P30EYEY014801.
Program Number: 3830 Poster Board Number: A530
Presentation Time: 3:45 PM - 5:30 PM
Lipidomic Analyses of the Aqueous Humor and Trabecular Meshwork
Katyayini Aribindi1, Bogdan Gugiu2, Richard K. Lee1, Sanjoy Bhattacharya1.
1
McKnight Vision Res Ctr-Ophthalmology, Bascom Palmer Eye Institute, Miami,
FL; 2City of Hope, Los Angeles, CA.
Purpose: To identify the endogenous phospholipids of the aqueous humor (AQH)
and trabecular meshwork (TM) by mass spectrometric shotgun lipidomics.
Methods: The human TM and AQH samples were collected adhering to tenets of
declaration of Helsinki under IRB approved protocols. The TM and AQH were
obtained from Caucasian donors with mean age of 55 ±8 years (n=10 each).
Control TM and AQH were from cadavers and cataract surgery patients
respectively. Lipids were extracted using the Bligh and Dyer method, and resuspended in Isopropanol/Acetonitrile solution. For lipid analyses we have used
recently developed shotgun lipidomic methods. Briefly, positive mode precursor
ion scan (PIS) for phosphocholines (PC; product m/z of 184) and negative mode
PIS for phosphoinositol (PI; product m/z 241) and phosphoethanolamine (PE;
product m/z of 196) was used with a TSQ Quantum Access Max instrument. The
samples were infused and scanned for one minute between 200 m/z to 1000 m/z.
Ratiometric quantification was performed using quantitative standards for each
lipid class.
Results: All classes of phospholipids (PC, PI and PE) and corresponding
lysophospholipids were found in both the AQH and TM. We found variation in
lipid profile between AQH and TM. All phospholipid classes showed differences
with respect to levels and species between glaucomatous and control groups.
Unique phosphopholipids in controls that are absent in glaucomatous AQH and TM
are being subjected to further characterization using high resolution mass
spectrometry.
Conclusions: We found unique phospholipids and lysophospholipids in control
AQH and TM that are either absent or present in very low levels in glaucomatous
samples. We identified different phospholipid species in AQH and TM using
shotgun lipidomics.
Commercial Relationships: Katyayini Aribindi, Intent to file a Patent
(P); Bogdan Gugiu, None; Richard K. Lee, Intent to file a Patent (P); Sanjoy
Bhattacharya, Intent to file a Patent (P)
Support: Supported by RPB Career award (SKB), an unrestricted grant from RPB
to University of Miami, NIH grants P30EYEY014801 and R01EY016112.
Program Number: 3831 Poster Board Number: A531
Presentation Time: 3:45 PM - 5:30 PM
Mass Spectrometric Lipidomic Analyses Of Psychosine And Glycolipids Of
Trabecular Meshwork
Archana A. Gupta, Katyayini Aribindi, Anna K. Junk, Sanjoy K. Bhattacharya.
Ophthalmology, Bascom Palmer Eye Institute, Miami, FL.
Purpose: To identify the endogenous Psychosine and glycolipids of the trabecular
meshwork (TM) by mass spectrometric shotgun lipidomics.
Methods: The human TM samples were collected adhering to tenets of declaration
of Helsinki under IRB approved protocols. The TM were obtained from Caucasian
donors with mean age of 60 ± 6 years (n=8 each). Control TM samples were from
cadavers and left over rim tissues of penetrating keratoplasty surgery respectively.
Lipids were extracted using the Bligh and Dyer method, and re-suspended in
Isopropyl, Acetonitrile solution. For lipid analyses we have used positive ion mode
neutral loss scan (NLS) for psychosine (neutral product loss of m/z 180) using a
collision energy of 24 and spray voltage of 4000V with a TSQ Quantum Access
Max instrument. The samples were infused and scanned for one minute between
200 m/z to 1000 m/z. Ratiometric quantification was performed using quantitative
galactosyl sphingosine D-galactosyl-ß1-1'-D-erythro-sphingosine (parent mass
461.64).
Results: We found several lipid species in the human TM that are identified by
NLS scan for neutral loss of m/z 180. We found a number of glycolipids (sugar
moiety: neutral loss of m/z 180) that were identified in scan of m/z 180 neutral loss.
Unique glycolipids in controls that are absent in glaucomatous TM are being
subjected to further characterization using high-resolution mass spectrometry.
Conclusions: We found unique glycolipids in control TM that are either absent or
present in very low (sub picomole) levels in glaucomatous samples.
Commercial Relationships: Archana A. Gupta, None; Katyayini Aribindi,
None; Anna K. Junk, None; Sanjoy K. Bhattacharya, None
Support: RPB Career award (SKB), an unrestricted grant from RPB to University
of Miami, NIH grants P30EYEY014801 and R01EY016112.
Program Number: 3832 Poster Board Number: A532
Presentation Time: 3:45 PM - 5:30 PM
Copyright 2012 by the Association for Research in Vision and Ophthalmology, Inc., all rights reserved. For permission to reproduce any abstract, contact the ARVO Office at pubs@arvo.org.
ARVO 2012 Annual Meeting Abstracts by Scientific Section/Group – Biochemistry/Molecular Biology (BI)
Candidate Serum Biomarkers in Patients with Glaucoma
Gulgun Tezel1A,1B, Michael L. Merchant1C, Xiangjun Yang1A, Cheng Luo1A, Joern B.
Soltau1A, Jeffrey M. Liebmann2, Robert Ritch2, Jon B. Klein1C,1D. AOphthalmology
& Visual Sciences, BAnatomical Sciences & Neurobiology, CMedicine, DJames
Graham Brown Cancer Center, 1University of Louisville, Louisville, KY; 2Einhorn
Clinical Research Center, New York Eye and Ear Infirmary, New York, NY.
Purpose: Development of clinically useful biomarkers for glaucoma is an area of
active investigation, and proteomics is at the center of these activities. This
proteomic study aimed to comparatively identify the presence and abundance of
proteins in serum samples of patients with different subgroups of glaucoma and
non-glaucomatous controls.
Methods: Serum samples were collected from 196 patients with glaucoma,
including primary open-angle glaucoma (POAG) and pseudoexfoliative glaucoma
(XFG), and an age-matched control group of 92 healthy volunteers without
glaucoma or any other ocular disease. Un-depleted serum samples were
quantitatively analyzed in 5 random samples from each group by two-dimensional
capillary liquid chromatography and linear ion trap mass spectrometry (LCMS/MS). Scaffold Proteome Software was used to validate MS/MS-based peptide
and protein identifications. Peptide identifications were accepted if they could be
established at >95.0% probability as specified by the Peptide Prophet algorithm.
Protein identifications assigned by the Protein Prophet algorithm were accepted if
they could be established at >99.0% probability and contained at least two
identified peptides. Proteins that contained similar peptides and could not be
differentiated based on MS/MS analysis alone were grouped to satisfy the
principles of parsimony. Group differences between the MS/MS data and the
ability of the identified serum proteins to discriminate between groups were
statistically analyzed using SigmaStat. The Ingenuity Pathways Analysis was used
for bioinformatic analysis of biomarkers.
Results: Analysis of serum protein digests using LC-MS/MS-based proteomic
methods identified 325 proteins by two peptides or more at the 0.2% protein and
5.0% peptide false discovery rates. A total of 248 proteins were common to three
sample groups (control, POAG, and XFG), while 22 proteins were detected only in
glaucomatous samples. As an alternative narrowing down strategy, we also
determined whether the serum MS/MS data overlap with our previous highthroughput proteomic data obtained from the glaucomatous human retina or the
glaucomatous serum IgG elutes. Overlapping proteins which included various
immune or cell death mediators were selected to initially pursue for validation
studies in larger number of samples using specific immunoarrays.
Conclusions: This serum proteomic study in patients with glaucoma and nonglaucomatous controls presented a panel of serum proteins that may serve as
candidate protein biomarkers. Ongoing studies in a larger patient population should
further validate and establish their potential value for future clinical applications as
a diagnostic and/or prognostic tool in glaucoma.
Commercial Relationships: Gulgun Tezel, None; Michael L. Merchant,
None; Xiangjun Yang, None; Cheng Luo, None; Joern B. Soltau, None; Jeffrey
M. Liebmann, None; Robert Ritch, None; Jon B. Klein, None
Support: NEI grants, R01 EY013813 and R01 EY017131, and Research to Prevent
Blindness Inc.
Program Number: 3833 Poster Board Number: A533
Presentation Time: 3:45 PM - 5:30 PM
Immune/Inflammatory Responses of Retinal Astrocytes in Experimental
Glaucoma
Xiangjun Yang1A, Cheng Luo1B, Jian Cai1C, David W. Powell1D,1E, Gulgun
Tezel1B,1F. AOphthalmology and Visual Sciences, BOphthalmology & Visual
Sciences, CPharmacology & Toxicology, DMedicine, EBiochemistry & Molecular
Biology, FAnatomical Sciences & Neurobiology, 1University of Louisville,
Louisville, KY.
Purpose: With the advantage of cell-specific sampling, this proteomic study aimed
to analyze retinal astrocyte-specific responses in a chronic pressure induced rat
model of glaucoma.
Methods: Intraocular pressure elevation was induced in rats by hypertonic saline
injections into episcleral veins. Enriched samples of retinal astrocytes were isolated
through the two-step immunomagnetic cell selection process originally established
to enrich retinal ganglion cell samples. Ocular hypertensive and control samples
were collected by pooling from rat eyes matched for the cumulative intraocular
pressure exposure. Protein expression was complementarily analyzed by
quantitative LC-MS/MS followed by quantitative Western blot analysis and
immunohistochemical analysis using cleavage or phosphorylation site-specific
antibodies to selected proteins.
Results: Western blots verified GFAP expression in enriched astrocyte samples;
however, neuronal markers, including NeuN and Brn-3, were not detectable in
these samples. After validation of astrocyte-specific protein sampling, analysis of
cell-specific protein expression identified hundreds of proteins with high
confidence (by two peptides or more at the 0.2% peptide and 0.1% protein false
discovery rates). The MS/MS data also included GFAP expression in astrocyte
samples. Bioinformatic comparison analysis of the cell-specific high-throughput
data by the Ingenuity Pathways Analysis supported distinct responses of astrocytes
during the experimental paradigm, which predominantly exhibited cellular
activation and immune/inflammatory responses as opposed to cell death signaling
in retinal ganglion cells. As also validated by Western blot analysis and tissue
immunolabeling using specific antibodies, a number of proteins mediating
inflammatory processes exhibited significant up-regulation in ocular hypertensive
astrocyte samples (Mann-Whitney Rank Sum test; p<0.05). These proteins included
a number of low-abundant downstream proteins linked to TNF-α/TNFR1 signaling
(TRADD, TNFAIP2, and an astrocytic phosphoprotein, PEA-15), NF-κB activation
(RIPK2, IκKB, p65, p100/52, COP9-signalosome), and inflammasome assembly
(NLRP1, NLRP3, caspase-1).
Conclusions: Findings of this study indicated various molecules characterizing
retinal astrocyte responses during the experimental paradigm. By highlighting
various co-players of inflammatory responses mediated by ocular hypertensive
astrocytes, these findings support that dissection of astrocyte-specific responses can
benefit the development of new treatment strategies for glaucoma targeting not
only retinal ganglion cells but also astrocytes.
Commercial Relationships: Xiangjun Yang, None; Cheng Luo, None; Jian
Cai, None; David W. Powell, None; Gulgun Tezel, None
Support: NEI grants, R01 EY013813 and R01 EY017131, and Research to Prevent
Blindness Inc.
Program Number: 3834 Poster Board Number: A534
Presentation Time: 3:45 PM - 5:30 PM
Cell-Specific Regulation of Autophagy in Experimental Glaucoma
Cheng Luo1A, Xiangjun Yang1B, Jian Cai1C, Dawid W. Powell1D,1E, Gulgun
Tezel1A,1F. AOphthalmology & Visual Sciences, BOphthalmology and Visual
Sciences, CPharmacology & Toxicology, DMedicine, EBiochemistry & Molecular
Biology, FAnatomical Sciences & Neurobiology, 1University of Louisville,
Louisville, KY.
Purpose: Autophagy is a physiological mechanism enabling cells to digest their
own cytosol, remove toxic protein aggregates, and eliminate defective or surplus
organelles. This cytoplasmic homeostasis pathway allows cells to survive nutrient
depletion or the absence of growth factors; however, under specific conditions, may
also be linked to cell death. This study aimed to explore autophagy in an
experimental rat model of glaucoma.
Methods: IOP elevation was induced in rats by hypertonic saline injections into
episcleral veins. Enriched samples of RGCs and astrocytes were isolated through
the two-step immunomagnetic cell selection process. Ocular hypertensive and
control samples were collected by pooling from rat eyes matched for the
cumulative IOP exposure. Protein expression was complementarily analyzed by
quantitative LC-MS/MS followed by quantitative Western blot analysis and
immunohistochemical analysis using specific antibodies.
Results: Quantitative LC-MS/MS analysis of cell-specific samples identified
thousands of proteins with high confidence, which exhibited up-regulated or downregulated expression in ocular hypertensive samples. Significantly up-regulated
proteins in ocular hypertensive samples relative to normotensive controls (MannWhitney Rank Sum test; p<0.05) included various molecules involved in the
autophagy signaling, such as immunity-related GTPase (IRG, a mediator of
autophagy), mammalian target of rapamycin (mTOR, an upstream negative
regulator of autophagy signaling), and autophagy-related proteins (Atgs, involved
in the execution stages of autophagy). The MS/MS data and the findings of
Western blot analysis and tissue immunolabeling collectively supported upregulation of IRG and various Atgs in both ocular hypertensive RGCs and
astrocytes. However, based on immunolabeling with a phosphorylation site-specific
antibody, phosphorylation-mediated activation of mTOR was detectable only in
ocular hypertensive astrocytes that predominantly exhibited co-activation of NFκB. Despite increased expression of IRG and Atgs, no increase was detectable in
phospho-mTOR expression in ocular hypertensive samples of RGCs.
Conclusions: Our findings highlighting autophagy signaling in experimental
glaucoma for the first time motivate further research to clarify the importance and
regulation of autophagy-related pathways in glaucoma. Whether NF-κB-dependent
activation of mTOR controls the balance between activator and inhibitor pathways
of autophagy in astrocytes, or whether autophagy (broadly associated with innate
and adaptive immunity) may contribute to antigen presentation and/or autoantibody
generation in glaucoma, seem to be particularly interesting to further pursue.
Commercial Relationships: Cheng Luo, None; Xiangjun Yang, None; Jian
Cai, None; Dawid W. Powell, None; Gulgun Tezel, None
Support: NEI grants, R01 EY013813 and R01 EY017131, and Research to Prevent
Blindness Inc.
Program Number: 3835 Poster Board Number: A535
Presentation Time: 3:45 PM - 5:30 PM
Oculocerebral Renal Syndrome of Lowe: the Role of Ocrl in Primary Cilia
Development
Yang Sun1A, Na Luo1A, Callah West2, Luo Sun2A, Carlos Murga Zamalloa3, Hemant
Khanna4, Jeffrey Travers1B. ADepartment of Ophthalmology, BDepartment of
Dermatology, 1Indiana University, indianapolis, IN; AOphthalmology, 2Indiana
University, Indianapolis, IN; 3Department of Pathology, University of Michigan,
Copyright 2012 by the Association for Research in Vision and Ophthalmology, Inc., all rights reserved. For permission to reproduce any abstract, contact the ARVO Office at pubs@arvo.org.
ARVO 2012 Annual Meeting Abstracts by Scientific Section/Group – Biochemistry/Molecular Biology (BI)
Ann Arbor, MI; 4Ophthalmology, University of Massachusetts Medical School,
Worcester, MA.
Purpose: Lowe Syndrome (Oculocerebral renal syndrome; MIM#309000) is an Xlinked disorder characterized by congenital glaucoma, cataract, renal dysfunction,
and mental retardation. The defective gene in Lowe syndrome is Ocrl, an inositol
polyphosphate 5-phosphatase. The purpose of this study is to investigate the role of
Ocrl in the pathogenesis of the ocular phenotypes of Lowe syndrome.
Methods: Immunofluorescence and live-cell microscopy of primary and
transformed human trabecular meshwork (HTM) and retinal pigmented epithelial
(RPE) cells were performed. Knockdown of Ocrl in HTM and RPE in cell lines
was performed using specific plko.1 shRNA as described (Feng, Y. Genomics
Proteomics 2010).
Results: Endogenous and overexpressed human Ocrl localizes inside and at the
base of the primary cilia. During cell cycle, Ocrl localizes with the centrioles,
except during metaphase and anaphase; Ocrl is also detected at the midbody during
cytokinesis. Lowe syndrome causing mutations in the inositol phosphatase domain
of Ocrl result in failure of Ocrl to localize at the primary cilia. Interestingly, Lowe
patient fibroblasts and Ocrl knockdown cells demonstrate shorter ciliary length.
Notably, the ciliary GTPase Rab8A mediates recruitment of Ocrl to the primary
cilia and as the Rab-binding domain of Ocrl interacts with Rab8A, we found that
Lowe syndrome causing mutations in this domain disrupt ciliary recruitment of
Ocrl.
Conclusions: Our data suggest that Ocrl modulates cilia length and the interaction
with Rab8A is crucial for its function at the primary cilium. Our data provide for
the first time evidence of the involvement of ciliary pathways in the manifestation
of Lowe syndrome.
Commercial Relationships: Yang Sun, None; Na Luo, None; Callah West,
None; Luo Sun, None; Carlos Murga Zamalloa, None; Hemant Khanna,
None; Jeffrey Travers, None
Support: Knights Templar Eye Foundation, American Glaucoma Society
Program Number: 3836 Poster Board Number: A536
Presentation Time: 3:45 PM - 5:30 PM
Status Of Systemic Oxidative Stresses In Patients With Primary Open Angle
Glaucoma, Pseudoexfoliation Syndrome, And Cataract
Masaki Tanito, Sachiko Kaidzu, Yasuyuki Takai, Akihiro Ohira. Ophthalmology,
Shimane Univ Faculty of Medicine, Izumo, Japan.
Purpose: Involvement of local and systemic oxidative stresses in intraocular
pressure (IOP) elevation and optic nerve damage have been hypothesized in the
development and progression of glaucoma. To test this hypothesis, systemic levels
of oxidative stresses were measured by blood biochemical analysis in patients with
glaucoma.
Methods: Peripheral blood samples were collected from Japanese patients with
primary open angle glaucoma (PG) (n=206), exfoliation syndrome (EX) (n=199),
and cataract (CT) (n=126). Plasma levels of lipid peroxides, ferric reducing
activity, and thiol antioxidant activity were measured by diacron reactive oxygen
metabolites (dROM), biological antioxidant potential (BAP), and sulfhydryl (SH)
tests, respectively, using a free radical analyzer (FREE, Wismerll Company Ltd.,
Tokyo, Japan). The values were statistically compared among groups by using ttest combined with the Bonferroni correction for multi-group comparisons.
Results: In the CT, PG, and EX groups, measured values (mean +/- SD) were
348±56, 355±63, and 357±69, respectively, for dROM (U.CARR); 2033±252,
1951±282, and 1969±252, respectively, for BAP (µmol/L); and 617±99, 614±98,
584±91, respectively, for SH (µmol/L). The differences were statistically
significant between CT and PG groups for BAP (p=0.0062), between CT and EX
groups for SH (p=0.0017), and between PG and EX groups for SH (p=0.0026).
After the adjustment for differences in age and sex among groups by using multiple
regression analysis, lower BAP values correlated significantly with the PG
(p=0.0155) and EX (p=0.0049) groups. By linear regression analysis, lower SH
values correlated significantly with older age (r=-0.37, p<0.0001). None of the
values were significantly different between higher (≥ 21 mmHg) and lower (< 21
mmHg) baseline IOPs in the PG group, or between with and without glaucoma in
the EX group.
Conclusions: Lower systemic ferric reducing activity may be involved in the
pathogenesis of PG and EX. The age-related decline of thiol antioxidant activity
may be an epigenetic risk factor for the development of EX.
Commercial Relationships: Masaki Tanito, None; Sachiko Kaidzu,
None; Yasuyuki Takai, None; Akihiro Ohira, None
Support: Grant from Imai Memorial Foundation
Program Number: 3837 Poster Board Number: A537
Presentation Time: 3:45 PM - 5:30 PM
Isolation Of Primary Mouse Retinal Ganglion Cells By ImmunopanningMagnetic Separation Method
Samin Hong, Yoko Iizuka, Chan Yun Kim, Gong Je Seong. Ophthalmology, Yonsei
University College of Medicine, Seoul, Republic of Korea.
Purpose: To verify the isolation method of primary mouse retinal ganglion cells
(RGCs) by immunopanning-magnetic separation method.
Methods: Retinal cell suspension was obtained from one to four day-old ICR
mouse eyeballs. Primary RGCs were isolated using three methods: 1) direct
magnetic separation method, 2) two step immunopanning method, and 3)
immunopanning-magnetic separation method.
Results: As determined by Immunocytochemical staining and Western
immunoblots, the primary RGCs isolated using direct magnetic separation method
were contaminated by syntaxin-positive retinal amacrine cells; the cells isolated
using two step immunopanning method were mixed by GFAP-positive retinal glial
cells; the RGCs isolated using immunopanning-magnetic separation method
showed the highest purity compared to other methods.
Conclusions: Immunopanning-magnetic separation method is a useful method for
isolation of primary mouse RGCs in vitro.
Commercial Relationships: Samin Hong, None; Yoko Iizuka, None; Chan Yun
Kim, None; Gong Je Seong, None
Support: None
Program Number: 3838 Poster Board Number: A538
Presentation Time: 3:45 PM - 5:30 PM
The Roles for DNA Damage Response in Retinal Ganglion Cell Death
Mari Katsura1A,1B, Makoto Aihara1A, Reiko Yamagishi1A, Masamitsu Shimazawa2,
Hideaki Hara2, Kiyoshi Miyagawa1C. AOphthalmology, BRadioisotope center,
C
Molecular Radiology, Center for Disease Biology and Integrative Medicine,
Graduate School of Medicin, 1The University of Tokyo, Tokyo, Japan;
2
Department of Drug Delivery Technology and Science, Pharmaceutical
Engineering, Gifu Pharmaceutical University, Gifu, Japan.
Purpose: DNA damage response (DDR) plays crucial roles in the fates of cells and
the mechanism of DDR in neuro-degenerative diseases are focused. But little is
known of the role of DDR in the loss of retinal ganglion cells (RGCs) in glaucoma.
Here, we investigate the role DDRs play in RGC death under normoxic or hypoxic
conditions in rat RGCs in vitro and in vivo.
Methods: Using primary cultured rat RGCs under normoxic or hypoxic conditions,
the number of 53BP1 nuclear foci, a marker for DNA double strand breaks (DSB)
and DNA repair, and the number of apoptotic cells were counted. Ataxia
telangiectasia mutated (ATM) protein is known to play a pivotal role in DDR by
phosphorylating apoptosis-related proteins at cell cycle checkpoints. Therefore,
RGC-5 cells were treated with the ATM inhibitor, KU55933 and caffeine, and the
numbers of 53BP1 foci and annexin V-positive cells, an apoptosis marker, were
counted. We also counted 53BP1 foci in RGCs in a rat optic nerve (ON) crush
model.
Results: Hypoxia significantly suppressed 53BP1 focus formation in cultured rat
RGCs. 53BP1 positive cells were decreased from 17.9 % to 3.7 % (p < 0.05).
Correspondingly, RGCs with more than five foci were decreased from 23.8 % to
10.9 % (p < 0.01) in a rat ON crush model. The ATM inhibitors significantly
decreased the number of 53BP1 foci and increased apoptosis in hypoxic as well as
normoxic culture conditions (p < 0.05).
Conclusions: These findings support that both ATM inhibition and hypoxia downregulates 53BP1 focus formation and facilitates apoptosis of RGCs. This is the first
demonstration of the possible roles for ATM-dependent DDR in hypoxia-induced
RGC death.
Commercial Relationships: Mari Katsura, None; Makoto Aihara, None; Reiko
Yamagishi, None; Masamitsu Shimazawa, None; Hideaki Hara, None; Kiyoshi
Miyagawa, None
Support: Japanese Society for Promoting Science (23592553, 21592262) and from
the Ministry of Education, Culture, Sports, Science and Technology of Japan
(22390321)
Program Number: 3839 Poster Board Number: A539
Presentation Time: 3:45 PM - 5:30 PM
Copyright 2012 by the Association for Research in Vision and Ophthalmology, Inc., all rights reserved. For permission to reproduce any abstract, contact the ARVO Office at pubs@arvo.org.
ARVO 2012 Annual Meeting Abstracts by Scientific Section/Group – Biochemistry/Molecular Biology (BI)
Down Regulation Of Myelin Proteins In The Myelination Transition Zone
(mtz) In The Non-human Primate (nhp) Early Experimental Glaucoma (eeg)
Model
Cheri Stowell1, An Zhou2, George A. Cioffi1, Claude F. Burgoyne1. 1Discoveries in
Sight, Devers Eye Institute, Portland, OR; 2Neurobiology & Neuroscience Institute,
Morehouse School of Medicine, Atlanta, GA.
Purpose: We have previously reported profound optic nerve head (ONH)
connective tissue deformation and remodeling in NHP EEG. Here we detect
proteomic changes in retrolaminar MTZ myelin proteins in NHP EEG and seek to
validate them by western blotting (WB) and immunohistochemistry (IHC).
Methods: Following initiation of unilateral, laser-induced, chronic IOP elevation,
10 NHPs were sacrificed at the onset of reproducible ONH surface change (EEG
definition) for either proteomic analysis by mass spectrometry (MS) followed by
WB or IHC. Based on the magnitude of post-laser IOP elevation, each animal was
retrospectively assigned to either a mild IOP (MIOP EEG - peak IOP less than 25
mm Hg, n= 4) or high IOP (HIOP EEG - peak IOP greater than 30 mm Hg, n=6)
group. ONH trephines of either 6 mm (for MS and WB analyses; 2 mild and 2 high
IOP animals) or 10 mm (for IHC; 2 mild and 4 high IOP animals) were taken from
both eyes of each animal. For MS analyses, proteins extracted from individual
trephines were trypsin digested and analyzed with an LTQ ion-trap MS system
(Thermo Finnegan) with 3 technical replicates of each sample. Using a MS spectral
counting approach, ratios of spectral counts for proteins in the EEG eye of each
animal compared to its contralateral normal eye were determined. For IHC,
individual trephines were fixed, paraffin embedded, sectioned at 5um and analyzed
with IHC.
Results: MS analysis detected a significant decrease for both 2’, 3’-cyclic
nucleotide 3’ phosphodiesterase (CNPase) and myelin basic protein (MBP) in the
HIOP EEG eyes (average ratios -1.87 and -1.57 respectively; p-values < 0.001,
GEE analysis), and a moderate decrease in the mild IOP EEG eyes (not statistically
significant) in the MIOP EEG eyes. Results of semi-quantitative WB analyses
demonstrated reduced levels of both proteins in both the HIOP and MIOP EEG
eyes compared to that in control eyes (CNPase ratios -1.20 HIOP and -1.16 MIOP;
MBP ratios -1.75 HIOP and -1.72 MIOP). Results of IHC with an anti-human
CNPase or an anti-MBP antibody revealed consistent down regulation of both
proteins within the retrolaminar MTZ in all MIOP and HIOPeyes compared to their
control eyes.
Conclusions: In NHP EEG, axon myelination protein alterations are present within
the retrolaminar MTZ. The timing of these alterations and their relationship to
ONH axon homeostasis, connective tissue remodeling and astrocyte, microglial and
oligodendrocyte activity remains to be determined.
Commercial Relationships: Cheri Stowell, None; An Zhou, None; George A.
Cioffi, None; Claude F. Burgoyne, None
Support: NIH R01 EY011610
Program Number: 3840 Poster Board Number: A540
Presentation Time: 3:45 PM - 5:30 PM
Functional Defects Caused By Glaucoma-associated Mutations Of Optineurin
Dorairajan Balasubramanian1, Ananthamurthy Nagabhushana2, Madhavi L.
Chalasani2, Ghanshyam Swarup2. 1Hyderabad Eye Research Foundation, LV
Prasad Eye Institute, Hyderabad, India; 2Centre for Cellular and Molecular
Biology, Hyderabad, India.
Purpose: Optineurin is involved in vesicle trafficking, signal transduction and
autophagy. We had shown earlier that it regulates endocytic trafficking of
transferrin receptor to the recycling endosomes, but its glaucoma-associated mutant
E50K displays defective endocytic recycling due to its altered interactions with
Rab8 and transferrin receptor. Over-expression of E50K in the retinal ganglion cell
line RGC-5 induced cell death, mediated by oxidative stress. We examine here
some functional defects generated by E50K and the other glaucoma-associated
mutant H468R.
Methods: Plasmids expressing optineurin mutants were transfected in the retinal
ganglion cell line RGC-5. Endocytic trafficking in cells was examined using
fluorescently labeled transferrin. Proteins interacting with optineurin were
identified by yeast two-hybrid assay. Optineurin knockdown was done by using
shRNA. NF-kappaB activity was measured by using a luciferase reporter.
Results: We find that over-expression of transferrin receptor protected against
E50K-induced cell death. We have also identified several novel optineurininteracting proteins including CYLD, the ubiquitin carboxy-terminal hydrolase
enzyme involved in signal transduction to the transcription factor NF-kappaB. We
show that optineurin is required for CYLD-dependent inhibition of TNFa-induced
NF-kappaB activation. The mutant, H486R is defective in regulating NF-kappaB
activation due to its impaired interaction with CYLD.
Conclusions: The E50K mutant of optineurin causes defective endocytic recycling
of transferrin receptor which contributes to the death of retinal ganglion cells. The
H486R mutant is defective in regulating signaling to NF-kappaB activation.
Commercial Relationships: Dorairajan Balasubramanian,
None; Ananthamurthy Nagabhushana, None; Madhavi L. Chalasani,
None; Ghanshyam Swarup, None
Support: DBT India, Champalimaud Foundation, Portugal
Program Number: 3841 Poster Board Number: A541
Presentation Time: 3:45 PM - 5:30 PM
Comparison of Serum Homocysteine, Vitamin B12, Vitamin B6, and Folate
Levels in Different Types of Glaucoma
Joo Hwa Lee, Yongseok Kang, Jae Suk Kim, Mi Sun Sung, Jin Choi. Department of
Ophthalmology, Inje University Paik Hospital, Seoul, Republic of Korea.
Purpose: To compare the levels of serum homocysteine, vitamin B12, vitamin B6,
and folate in healthy individuals and patients with normal tension glaucoma,
pseudoexfoliation glaucoma, primary open-angle glaucoma.
Methods: Thirty-two healthy subjects, and 35 patients with normal tension
glaucoma, 22 patients with pseudoexfoliation glaucoma, 31 patients with primary
open-angle glaucoma were included in the study. Fasting venous samples were
collected for the overall participants. The levels of homocysteine, vitamin B12,
folate were measured by chemiluminescent immunoassay, the levels of vitamin B6
were measured by high performance liquid chromatography. One-way analysis if
variance was used for the comparison of homocysteine, vitamin B12, vitamin B6,
and folate levels among the four groups.
Results: The mean homocysteine levels of pseudoexfoliation glaucoma and
primary open-angle glaucoma group were 17.91±5.11 µmol/L, 17.60±3.89 µmol/L,
which were significantly higher than that of the control group(14.15±4.57 µmol/L)
(p=0.014, p=0.013). The mean vitamin B6 levels of pseudoexfoliation glaucoma
and primary open-angle glaucoma group were 17.67±14.32 nmol/L, 17.00±10.58
nmol/L, which were significantly lower than that of the control group(32.42.±30.56
nmol/L) (p=0.026, p=0.008). There were no statistical differences in serum vit-B12,
folate levels among the four groups (p=0.992 for vitamin B12, p=0.141 for folate).
Conclusions: Hyperhomocysteinemia might play a role, as a modifiable risk factor,
in the development or progression of high pressure glaucoma types, such as
pseudoexfoliation glaucoma and primary open-angle glaucoma.
Commercial Relationships: Joo Hwa Lee, None; Yongseok Kang, None; Jae
Suk Kim, None; Mi Sun Sung, None; Jin Choi, None
Support: None
Program Number: 3842 Poster Board Number: A542
Presentation Time: 3:45 PM - 5:30 PM
Lipid Peroxidation In Aqueous Humor Of Primary Open Angle Glaucoma
And Pseudoexfoliative Glaucoma
Haruna Yoshikawa1A, Morio Ueno1A, Yoko Ikeda1A, Tomoko Oya1B, Kazuhiko
Mori1A, Shigeru Kinoshita1A. AOphthalmology, BMolecular gastroenterology and
hepatology, 1Kyoto Prefectural University of Medicine, Kyoto, Japan.
Purpose: 4-hydroxynonenal (4-HNE) is one of the aldehydic secondary products
of lipid peroxidation, which are generally accepted markers of oxidative stress.
Moreover, it has been shown to be capable of binding to proteins and forming
stable adducts. Oxidative modification of lipids can be induced during aging and in
certain disease conditions. It was reported that primary open angle glaucoma
(POAG) and pseudoexfoliative glaucoma (PEG) were caused by oxidative damage
to trabecular meshwork cells. The purpose of this present study was to examine
oxidative stress in the anterior chamber as a measure of concentrations of 4-HNE in
aqueous humor (AH) specimens obtained from glaucoma patients.
Methods: AH specimens were directly obtained at the beginning of surgery from 8
patients being treated for POAG and from 4 patients being treated for PEG without
any contamination of blood. As control samples, specimens were also collected
from 8 glaucoma-free patients at the beginning of cataract surgery. Specimens were
separated in relation to patient age, and oxidative stress in the AH specimens was
then evaluated by quantifying the 4-HNE-His protein adducts by enzyme
immunoassay.
Results: Mean 4-HNE concentrations in AH specimens obtained from the POAG
patients were 1.347µg/ml in patients 60-70 years of age, 0.829µg/ml in patients 7080 years of age, and 0.824µg/ml in patients 80-90 years of age. Those in specimens
obtained from the PEG patients were 0.891µg/ml in patients 60-70 years of age,
1.347µg/ml in patients 70-80 years of age, and 0.644µg/ml in patients 80-90 years
of age. Those in specimens obtained from the control patients were 0.918µg/ml in
patients 60-70 years of age and 1.146µg/ml in patients 70-80 years of age. No
significant difference of 4-HNE concentrations was found between the POAG
patients, PEG patients, and controls.
Conclusions: The findings of this study show that there was no significant
difference of lipid peroxidation in the anterior chamber among POAG, PEG and
control subjects in any age distributions.
Commercial Relationships: Haruna Yoshikawa, None; Morio Ueno,
None; Yoko Ikeda, None; Tomoko Oya, None; Kazuhiko Mori, None; Shigeru
Kinoshita, None
Support: None
Program Number: 3843 Poster Board Number: A543
Presentation Time: 3:45 PM - 5:30 PM
Aconitase Activity, As A Measure Of Oxidative Stress, In Patients With
Normal Tension Glaucoma Vs Ocular Hypertension - Preliminary Findings
Gerassimos Lascaratos1, David Chau2, Anthony H. Schapira2, David F. GarwayHeath1. 1Institute of Ophthalmology, University College London and Moorfields
Copyright 2012 by the Association for Research in Vision and Ophthalmology, Inc., all rights reserved. For permission to reproduce any abstract, contact the ARVO Office at pubs@arvo.org.
ARVO 2012 Annual Meeting Abstracts by Scientific Section/Group – Biochemistry/Molecular Biology (BI)
Eye Hospital, London, United Kingdom; 2Clinical Neurosciences, UCL Institute of
Neurology, Royal Free Hospital, London, United Kingdom.
Purpose: Aconitase, an iron-sulfur protein that catalyzes the stereospecific
isomerization of citrate to isocitrate in the mitochondrial tricarboxylic acid cycle, is
vulnerable to oxidative damage and has been widely used as a biochemical marker
of cellular oxidative stress. In order to explore the role of systemic oxidative stress
in glaucoma, we measured the aconitase activity in the lymphocytes of patients
with and without exogenous oxidative stress induction, contrasting individuals at
the extremes of intraocular pressure (IOP) susceptibility.
Methods: Two cohorts of 6 subjects with ≥8 Humphrey 24-2 visual fields over ≥5
years of follow-up were recruited prospectively from Moorfields Eye Hospital: a)
Normal Tension Glaucoma (NTG) group: rapidly progressing patients with Mean
Deviation change > -1.0 dB/yr and mean IOP<16; b) Ocular Hypertension (OHT)
group: non-progressing patients with mean IOP>24. An equal number of agesimilar subjects with normal IOP, healthy discs and no family history of glaucoma
was recruited as controls. Lymphocytes were isolated, after the removal of
monocytes, from anticoagulated peripheral blood using Lymphoprep, and
maintained under unstimulated conditions. Paraquat (PQ), a potent free radical
generator, was added (final concentration 100µM for 24hrs) to measure the
susceptibility of lymphocytes to oxidative stress. Aconitase activity was measured
by absorbance kinetics at 37°C after correction for protein level. Student’s t-test
was used for the statistical analysis.
Results: There were no statistically significant differences (mean±SEM) in
baseline aconitase activity for the control, NTG and OHT groups: 1.23±0.11,
1.50±0.18 and 1.41±0.16 pmol/min/mg, respectively. Upon PQ treatment, the
aconitase activity for the control, NTG and OHT groups was reduced to 82±4%
(p<0.05 comparing to baseline), 79±6% (p<0.05) and 89±17% (p=0.46, not
significant), respectively. Thus, a tentative finding, given the small number of
subjects to date, is that OHT lymphocytes may be more resistant to the oxidative
stress insult produced by PQ, comparing to the NTG and control groups.
Conclusions: Our preliminary data suggest, for the first time, that OHT patients
may demonstrate an enhanced capacity to deal with oxidative stress at a systemic
level, when compared to NTG patients and controls. This study implicates the role
of systemic antioxidant capacity in resistance to glaucoma damage and glaucoma
progression, particularly in the context of OHT.
Commercial Relationships: Gerassimos Lascaratos, None; David Chau,
None; Anthony H. Schapira, None; David F. Garway-Heath, None
Support: Fight for Sight, Allergan UK
Program Number: 3844 Poster Board Number: A544
Presentation Time: 3:45 PM - 5:30 PM
Gene Expression Profiling Of Human Trabecular Meshwork In Glaucoma
Patients With Or Without Myocilin Mutations
Yutao Liu1A, Xuejun Qin1A, David Layfield1A, Andrew E. Dellinger1A, Jason
Gibson1A, Joshua Wheeler1A, Allison E. Ashley-Koch1A, W Daniel Stamer1B,
Michael A. Hauser2, R R. Allingham1B. AMedicine, BOphthalmology, 1Duke
University Medical Center, Durham, NC; 2Ophthalmology & Medicine, Duke Univ
Medical Center, Durham, NC.
Purpose: To identify genes differentially expressed in human trabecular meshwork
(HTM) in patients with primary open-angle glaucoma (POAG), with or without
myocilin mutations, compared with non-glaucomatous controls.
Methods: Surgical HTM samples were obtained from 15 patients undergoing
trabeculectomy. Non-glaucomatous control tissue was obtained from 13 donor
human eyes. The HTM was dissected in a manner similar to the approach used in
trabeculectomy surgery. Total RNA was labeled and hybridized to HumanWG-6
BeadChip. The expression data was applied with quantile normalization prior to
analyses using linear model of limma in Biocondutor. Pathway analyses were
performed with DAVID Bioinformatics Resources and Ingenuity Pathway
Analysis.
Results: One POAG case had a heterozygous Q368X myocilin mutation
(designated as MYOCcase). For the MYOCcase and 6 controls, expression data
was available from both left and right eyes. We used the average of the expression
value from both eyes for analysis. The analyses were done in the following manner:
1) MYOCcase vs 14 non-MYOC cases; 2) MYOCcase vs 13 controls; 3) 14 nonMYOC cases vs 13 controls. Myocilin expression was not different in all
comparisons. In the first comparison between cases, we identified 35 differentially
expressed genes, including two non-protein-coding RNAs. Pathway analysis
indicated that there was an enrichment of genes related to DNA binding,
acetylation, alternative splicing, and organelle lumen such as ER. The second
comparison identified more than 200 genes with differential expression related to
the MYOCcase compared with controls. Pathway analysis indicated enrichment of
genes associated with the enzyme linked receptor protein signaling pathway, signal
peptides, glycoproteins, serine/threonine and tyrosine kinase signaling pathways,
and secretion. Since myocilin has been shown to be constituent of exosomes, we
identified 11 components of TM exosomes with differential expression caused by
myocilin mutation. The third comparison identified over 100 differentially
expressed genes, which are enriched in actin cytoskeleton organization, regulation
of apoptosis, and NF-kB cascade. Three genes are involved in Rho-kinase
pathways, suggesting the importance of this pathway in POAG.
Conclusions: This is the first study to describe gene expression profiles in HTM of
a case with a well described myocilin mutation. Our findings lend support to the
notion that myocilin mutations may increase ER stress as well as evidence that
myocilin mutations may exert their pathophysiological effect by altering exosome
function in POAG. We also provide evidence that Rho-kinase pathways may be
involved in POAG pathogenesis.
Commercial Relationships: Yutao Liu, None; Xuejun Qin, None; David
Layfield, None; Andrew E. Dellinger, None; Jason Gibson, None; Joshua
Wheeler, None; Allison E. Ashley-Koch, None; W Daniel Stamer,
None; Michael A. Hauser, None; R. R. Allingham, None
Support: NIH grants R01EY013315 (MAH), R01EY019126 (MAH),
R03EY014939 (RRA), R01EY015543 (RRA), the Glaucoma Research Foundation
(YL), American Health Assistance Foundation (YL), The Glaucoma Foundation
(YL).
Program Number: 3845 Poster Board Number: A545
Presentation Time: 3:45 PM - 5:30 PM
New Mechanisms of Glaucoma Pathology Spreading
Andrei Surguchov1,2, Victor Sharov3, Irina G. Surgucheva1,2. 1Retinal Biology Lab,
VAMCKC, Kansas City, MO; 2Neurology, Kansas University Medical Center,
Kansas City, KS; 3Department of Pharmaceutical Chemistry, Kansas University,
Lawrence, KS.
Purpose: Glaucomatous vision loss results from the progressive degeneration of
ON axons and the death of RGC. The accumulation and deposition of γ-synuclein
(γ-syn) in the optic nerve, both in axonal spheroids and within astrocytes is a new
hallmark of glaucoma. Since aberrant forms of γ-syn are associated with
pathological manifestations of glaucoma, this ocular disease might be considered as
γ-synucleinopathy. Here we investigate the mechanisms of γ-syn secretion from
neuronal cells and internalization by glial cells leading to its intracellular
accumulation.
Methods: Clones of SH-SY5Y cells overexpressing human γ-syn and γ-syn-GFP
were generated. After 48h of growth cell extracts (CE) and conditioned media
(CM) were collected and analyzed by Western blotting. CM was further incubated
with glial cells, which were subsequently examined by immunofluorescent and
confocal microscopy to reveal γ-syn internalization and intracellular localization.
Exosomes were isolated from CM by differential centrifugation or precipitation by
ExoQuick (System Biosciences, Inc.). The following immortalized cell cultures
were used as recipients of γ-syn: neuroblastoma cell line SH-SY5Y, glioblastoma/
astrocytoma U87 and A7 astrocytes from the optic nerve.
Results: Both monomeric γ-syn and γ-syn-GFP-fusion protein are secreted into
CM in the form of exosomes. Inhibition of proteasomal activity differentially
affects the level of secreted γ-syn aggregation. γ-Syn without a GFP tag is secreted
predominantly as a monomer both in the presence and absence of proteasome
inhibitor MG132. γ-Syn fused to GFP forms aggregates in the presence of MG132
with molecular weight 60-100 KDa. The secretion of γ-syn-GFP from SH-SY-5Y
is significantly reduced in the presence of inhibitors of exosome biogenesis
GW4869 (68%±5% inhibition) and methyl-β-cyclodextrin (MBC, 92±3%
inhibition). MBC decreased monomer γ-syn secretion by 34±4%. Accordingly, the
amount of exosome marker CD63 was also reduced in the presence of both
inhibitors. The average reduction of CD63 by GW4869 was 46.2±5%, by MBC
73.6±6%. Finally, we found that γ-syn secreted into CM can be internalized by glial
cells. According to the Western blot analysis, this process is accompanied by the
alteration of γ-syn aggregation pattern which may be explained by changes in
protein conformation and/or post-translational modifications.
Conclusions: Our studies revealed exosomal secretion of γ-syn from neuronal cells
into CM and its internalization by glial cells as the first steps leading to
intracellular accumulation of aberrant γ-syn.
Commercial Relationships: Andrei Surguchov, None; Victor Sharov,
None; Irina G. Surgucheva, None
Support: VA Merit Review Grant and The Glaucoma Foundation Grant
Program Number: 3846 Poster Board Number: A546
Presentation Time: 3:45 PM - 5:30 PM
p38 MAPK Activation in Rodent Retina with Glaucoma-Relevant Stressors
Jason D. Dapper, David J. Calkins. Vanderbilt Eye Institute, Vanderbilt University
Medical Center, Nashville, TN.
Purpose: We recently showed that p38 mitogen-activated protein kinase (MAPK)
signaling becomes activated in an inducible rat model of ocular hypertension and
contributes to the progression of retinal ganglion cell degeneration. As age is a
significant risk factor for glaucoma, we sought to differentiate the effects of
increasing age and ocular pressure on p38 MAPK activation using aged naïve mice
and an inbred mouse model in which intraocular pressure increases with age.
Methods: We induced unilateral ocular pressure elevation in 3 month C57BL/6J
(C57) mice via polystyrene microbead injection into the anterior chamber; the
opposing eye received an equal volume saline injection. We also used the DBA/2J
(DBA) mouse model of pigmentary glaucoma aged 3 to 10 months to represent
various stages of progression. Naïve C57 mice aged 3 to 11 months were used as
controls. Forty-eight hours prior to sacrifice and paraformaldehyde perfusion, mice
Copyright 2012 by the Association for Research in Vision and Ophthalmology, Inc., all rights reserved. For permission to reproduce any abstract, contact the ARVO Office at pubs@arvo.org.
ARVO 2012 Annual Meeting Abstracts by Scientific Section/Group – Biochemistry/Molecular Biology (BI)
received intravitreal injection of fluorescent cholera toxin beta subunit to label
retinal ganglion cells. Dissected retinas were either lysed for protein extraction and
subsequent western blotting or cross-sectioned for immunohistochemistry.
Furthermore, retinal layer-specific staining intensities of activated p38 MAPK were
quantified and compared across micrographs using a custom-developed algorithm.
Results: Microbead occlusion induced an average 28.3% elevation in C57 ocular
pressure over a 4 week period. This elevation resulted in increased p38 MAPK
immunolabeling throughout the retina, with significant increases in the outer
plexiform layer (3.38 fold), inner nuclear layer (3.51 fold), inner plexiform layer
(2.68 fold), and the ganglion cell and nerve fiber layers (which was highest at 9.98
fold). This expression pattern was similar in DBA mice as 10 month old mice, with
an elevated intraocular pressure, had increased activated p38 MAPK over 3 month
mice when compared by immuolabeling in retinas, again with the largest increases
seen in the ganglion cell layer. Concordantly, whole retina western blots also
showed nearly a 2-fold increase in activated p38 MAPK in 10 month over 3 month
DBA. We did not find detectable differences in activated p38 MAPK expression
across naïve C57 ages.
Conclusions: These results support the hypothesis that ocular pressure has a
greater role than advanced age on p38 MAPK activation in the retina of relevant
glaucoma models. Furthermore, these data implicate that specific cell-signaling
responses may be regulated by particular stress signals. While aging may not
directly activate p38 MAPK, it may be relevant in lowering the threshold for signal
pathway activation and subsequent injury.
Commercial Relationships: Jason D. Dapper, None; David J. Calkins, None
Support: Unrestricted Grant from Research to Prevent Blindness to the Vanderbilt
Univ. School of Med. Dept. of Ophthal. and Vis. Sci.; Vanderbilt Vision Research
Center (P30EY008126); GRF Catalyst for a Cure
Program Number: 3847 Poster Board Number: A547
Presentation Time: 3:45 PM - 5:30 PM
Temporal Changes In Retinal Gene Expression After Optic Nerve Crush In
Mice
Tasneem M. Putliwala1, Colleen McDowell1, Yang Liu1, Thomas L. Casavant2,
Benjamin Faga2, David M. Thole2, Robert J. Wordinger1, Terry A. Braun2, Abbot
F. Clark1. 1CBAN - Visual Sciences, University of North Texas Health Science
Center, North Texas Eye Research Institute, Fort Worth, TX; 2Bioinformatics and
Computational Biology, University of IOWA, Iowa City, IA.
Purpose: Glaucoma is a progressive optic neuropathy characterized by axonal
impairment, retinal ganglion cell (RGC) loss, and visual field defects.
Understanding temporal global gene expression patterns that eventually lead to
RGC death will identify pathways associated with glaucoma pathogenesis. The
purpose of this study is to evaluate changes in retinal gene expression using an in
vivo optic nerve crush (ONC) mouse model that mimics many features of
glaucoma.
Methods: Unilateral ONC was performed on 8-10-week-old BALB/cJ eyes using
the Nickell’s technique. Retinas (N=5) were harvested at six different time points
(0, 3, 7, 14, 21, and 28 days) post crush. Pooled RNA samples (N=5/ time point)
were run on Affymetrix Mouse Gene array chips. PARTEK ®, STRING and
DAVID databases were used for bioinformatic analysis. Temporal expression
clusters and network maps were statistically identified (p < 0.05).
Results: After ONC, gene expression was significantly and temporally altered
(p<0.05, fold change of 1.5) in 29 up-regulated clusters and 20 down-regulated
clusters, based on the three gene ontologies. Early up-regulated clusters at 3 and 7
days included structural eye proteins, calcium ion binding and extracellular matrix,
while later time points showed protein kinase and G-protein coupled receptor
activity, ribosome function and sensory perception. No significant changes at early
time points in the down-regulated clusters were found; however, by 21 days there
was decreased expression in the categories of axonogenesis, neuronal
differentiation, microtubule based process, and pattern binding. Key genes in both
datasets included GAP43, neuritin 1, synuclein ϒ, neurofilaments, visinilin-like 1,
synaptotagmin like 3 and GFAP.
Conclusions: Temporal changes seen in key genes that down regulate neuronal
projection and axonogenesis and up regulate signal transduction and kinase
activities will establish novel neuropathy mechanisms. Our findings will be a
crucial source of information in the development of therapeutic strategies to
prevent the loss of RGCs in optic nerve axonopathy.
Commercial Relationships: Tasneem M. Putliwala, None; Colleen McDowell,
None; Yang Liu, None; Thomas L. Casavant, None; Benjamin Faga,
None; David M. Thole, None; Robert J. Wordinger, None; Terry A. Braun,
None; Abbot F. Clark, None
Support: DoD grant ( W81XWH-10-2-0003 )
Program Number: 3848 Poster Board Number: A548
Presentation Time: 3:45 PM - 5:30 PM
Identification Of Proteins That Interact With TANK binding kinase 1 (TBK1)
John H. Fingert, Ben Roos, Frances Solivan-Timpe, Melissa Humbert, Seongjin
Seo. Ophthalmology and Visual Sciences, Carver College of Medicine, University
of Iowa, Iowa City, IA.
Purpose: Duplication of the TANK-binding Kinase 1 (TBK1) gene has been
associated with familial normal tension glaucoma (NTG). The purpose of this
research is to identify the proteins that interact with TBK1 as additional candidates
for causing NTG
Methods: We generated a plasmid that contains the full-length TBK1 cDNA with
two epitope tags (FLAG and S-antigen) that is expressed under the control of CMV
promoter sequences. HEK293 cells were transfected with this plasmid and stable
lines expressing epitope-tagged TBK1 were generated. TBK1 and interacting
proteins were isolated from cell extracts by tandem affinity purification, first using
the FLAG epitope then using the S-protein epitope. Isolated proteins were analyzed
with SDS-polyacrylamide gel electrophoresis and were identified using mass
spectrometry.
Results: A total of five prominent protein bands were identified. One of the bands
represents the tagged TBK1 and the other 4 bands represent TBK1 interacting
proteins. Mass spectrometry identified these proteins as 5-azacytidine induced
protein 2 (AZI2), TRAF family member-associated NFKB activator (TANK),
TANK-binding kinase 1 binding protein 1 (TBKBP1), and TANK binding Kinase 1
(TBK1).
Conclusions: We have identified four unique proteins interact with TBK1 in
HEK293 cells. One of the proteins is TBK1, suggesting that TBK1 may interact
with itself to form homo-oligomers. The other three identified proteins (TANK,
TBKBP1, and AZI2) were previously known to associate with TBK1, however,
these experiments provide additional support for this interaction. The identity of
these TBK1 interacting proteins will help elucidate the mechanism by which
defects in TBK1 and the NF-KB pathway contribute to glaucoma pathogenesis.
Furthermore, the genes encoding each of these proteins represent new candidates
for causing NTG.
Commercial Relationships: John H. Fingert, None; Ben Roos, None; Frances
Solivan-Timpe, None; Melissa Humbert, None; Seongjin Seo, None
Support: NIH R01EY018825
Program Number: 3849 Poster Board Number: A549
Presentation Time: 3:45 PM - 5:30 PM
Oxidative Stress Markers in Patients with Different types of Glaucoma
Fabian S Lerner1,2, Sandra M. Ferreira1, Claudia Reides1, Susana Llesuy1. 1School
of Pharmacy and Biochemistry, University of Buenos Aires, Buenos Aires,
Argentina; 2Fundacion para el Estudio del Glaucoma, Buenos Aires, Argentina.
Purpose: To determine oxidative stress markers in blood of patients with different
types of glaucoma.
Methods: Patients with primary open angle glaucoma (POAG, n=16),
pseudoexfoliation glaucoma (PEXG, n=15) and controls (n= 16) were evaluated.
The following markers were determined in red blood cells: chemiluminescence
(CL), the activities of antioxidant enzymes: superoxide dismutase (SOD), catalase
(CAT) and glutathione peroxidase (GPX); and the total antioxidant potential
(TRAP) was determined in plasma.
Results: SOD activity was significant decreased in PEXG patients (0.37 ± 0.05 U
SOD/ mg protein) compared to controls (0.70 ± 0.20 USOD/ mg protein; p< 0.01).
SOD activity was 0.19 ± 0.12 USOD/ mg protein in POAG patients (p<0.001).
CAT levels were 1.3 ± 0.1 pmol/ mg protein in PEXG (p<0.001), 1.4 ± 0.1 pmol/
mg protein in POAG (p<0.01) (control levels 2.1 ± 0.2 pmol/ mg protein). CL in
PEXG (353 ± 25 cpm/ mg haemoglobin), was higher than controls (139 ± 10 cpm/
mg haemoglobin; p<0.001). CL in POAG was 143 ± 17 cpm/ mg haemoglobin.
TRAP levels of GPEX patients were 250 ± 17 µM Trolox (p<0.01), POAG patients
315 ± 19 µM Trolox (ns) (control values 338 ± 15 µM).
Conclusions: A significantly reduced levels of non-enzymatic antioxidant (TRAP),
a decreased in SOD and CAT activities and an increased of prooxidants (CL) were
observed in pseudoexfoliation glaucoma. Meanwhile in POAG there were only a
decrease in antioxidant enzymes activities. TRAP and CL could be used as
biomarkers in both types of glaucoma.
Commercial Relationships: Fabian S Lerner, None; Sandra M. Ferreira,
None; Claudia Reides, None; Susana Llesuy, None
Support: UBA 948
Program Number: 3850 Poster Board Number: A550
Presentation Time: 3:45 PM - 5:30 PM
Global Proteomic Analysis of the Human Iris
Abby L. Sewell1, Jeffrey Dunmire1, Rachida Bouhenni1, Deepak P. Edward2,3.
1
Ophthalmology, Summa Health System, Akron, OH; 2Johns Hopkins University,
Baltimore, MD; 3King Khaled Eye Specialist Hospital, Riyadh, Saudi Arabia.
Purpose: Recent studies have suggested that that iris thickness may be a risk factor
in the development of chronic angle closure glaucoma. The molecular components
of the iris tissue however have not been well characterized. These components
likely influence iris biomechanics and may contribute to iris thickness. In this
study, we performed a global proteomic analysis to identify the proteins expressed
in the iris and to link these proteins to specific functions and roles.
Methods: Two fresh eye bank eyes, age 80 and 87 respectively, with no history of
ocular diseases were obtained. Iris tissues were dissected and total protein was
extracted. Tryptic digests of the complex mixtures of proteins were analyzed using
Copyright 2012 by the Association for Research in Vision and Ophthalmology, Inc., all rights reserved. For permission to reproduce any abstract, contact the ARVO Office at pubs@arvo.org.
ARVO 2012 Annual Meeting Abstracts by Scientific Section/Group – Biochemistry/Molecular Biology (BI)
Liquid Chromatography/Tandem Mass Spectrometry (LC-MS/MS). Proteins were
identified by searching the data against the human subset of the UniProt database
and classified into functional categories using Scaffold 3 software.
Results: A total of 550 proteins were identified with Vimentin being the most
dominant. 10% of the total proteins were extracellular matrix proteins (ECM);
other proteins were involved in different functions such as: development (25%),
adhesion (4%), antioxidant activity (2%) and other cellular processes such as cell
killing and growth. Proteins previously implicated in glaucoma such as
Prostaglandin D2 synthase, Opticin, Tranthyretin, and proteins from the SERPIN
family were also detected.
Conclusions: Identification of the normal iris proteome forms the basis of further
investigation of molecular components of iris tissue which may provide insights
into the molecular mechanisms involved in chronic angle closure glaucoma.
Commercial Relationships: Abby L. Sewell, None; Jeffrey Dunmire,
None; Rachida Bouhenni, None; Deepak P. Edward, None
Support: Summa Foundation
Program Number: 3851 Poster Board Number: A551
Presentation Time: 3:45 PM - 5:30 PM
The Role of Mitochondrial Dynamics and Axonal Transport in a Glaucoma
Model
Mary P. Nivison1A, David J. Calkins2, Philip J. Horner1B. APathology,
B
Neurosurgery, 1University of Washington, Seattle, WA; 2Vanderbilt Eye Institute,
Vanderbilt University Med Ctr, Nashville, TN.
Purpose: Glaucoma is a neurodegenerative disease of the eye and optic nerve,
characterized by retinal ganglion cell (RGC) axonal degeneration and eventual
soma loss in the retina. As glaucoma progresses, axonal transport is disrupted,
interfering with mitochondrial transport. An inability for mitochondria to freely
move and remodel may contribute to degeneration and progression of glaucoma.
We propose that disease-induced metabolic challenges create imbalance of
mitochondrial fusion proteins in specific cellular compartments, which, combined
with compromised axonal transport, contributes to increased mitochondrial
dysfunction.
Methods: Measures of protein levels, RNA levels, and cell-specificity of mitofusin
(Mfn) are evaluated. Protein is from pooled samples for Western blot analysis.
NanoPro (NP) quantifies protein from one-animal sample pools. Our new
development of NP assays allows for probing of Mfn1, Mfn2 and ubiquitin
expression on an animal-by-animal basis. RNA transcript levels are assessed from
pooled samples. Laser-capture microdissection (LCM) will isolate in vivo RGCs
and be used with the NP for determining cell-specific Mfn and ubiquitin
expression. In vitro cultures of RGCs exposed to high pressure will be compared
with LCM-isolated RGCs and assessed for damage done to the fusion proteins and
resultant mitochondrial behavioral changes.
Results: Western blot shows higher levels of the fusion proteins Mfn1 and Mfn2 in
retina, optic nerve (ON) and superior colliculus (SC) between control and agematched diseased tissues.
Mfn1 RNA expression is steady in both retina and SC, with expression in ON
trending to increased expression with age in control, while decreasing with age and
disease. In Mfn2, the same trend was apparent in the ON, while expression in
control retinal tissue was steady, but significantly lower in disease.
NP shows differences in Mfn2. In diseased ON, a dramatic decrease in the amount
of Mfn2 is seen, while retinal levels dramatically increase in disease.
Conclusions: Analyses of RNA expression shows transcript changes in ON and
retinal tissue in conjunction with both age and disease. Analysis of protein
expression changes show mitofusin protein levels are directly affected by the
progression of glaucoma in the ON and retina. There is adequate Mfn2 present in
the RGCs, but it is not being transported down the axon to where it is needed.
Commercial Relationships: Mary P. Nivison, None; David J. Calkins,
None; Philip J. Horner, None
Support: Glaucoma Research Foundation Catalyst for a Cure Initiative; The Melza
M. and Frank Theodore Barr Foundation
Program Number: 3852 Poster Board Number: A552
Presentation Time: 3:45 PM - 5:30 PM
In Vitro Model For The Functional Analysis Of LOXL1 Gene Variants In The
Pathophysiology Of Pseudoexfoliation Syndrome
Anita W. Krysta, Matthias Zenkel, Marco Birke, Anselm Jünemann, Gabriele
Gusek-Schneider, Friedrich E. Kruse, Ursula Schlotzer-Schrehardt. Department of
Ophthalmology, University of Erlangen - Nuremberg, Erlangen, Germany.
Purpose: Lysyl oxidase-like 1 (LOXL1) gene variants have been identified as the
most significant genetic risk factor for pseudoexfoliation (PEX) syndrome, a
complex disorder of the elastic fiber system and frequent cause of glaucoma. To
evaluate the role of LOXL1, an elastin cross-linking enzyme, in the
pathophysiology of PEX syndrome/glaucoma, we developed a cell culture model
for the functional analysis of PEX-associated risk variants in extracellular matrix
formation.
Methods: Haplotypes of the non-synonymous LOXL1 variants rs1048661 and
rs3825942 were generated by site-directed mutagenesis of full-length human
LOXL1 cDNA and cloned into the mammalian expression vector pCMV-Entry.
Human Tenon’s capsule fibroblasts (hTCF) were isolated from normal donor eyes
and transfected with the pCMV-LOXL1 constructs by nucleofection (Amaxa). To
select stably transfected clones cells were grown in DMEM/F12 medium
containing 30% FCS and 800µg/ml G418 for 2 weeks. Extracellular matrix
synthesis was stimulated by TGF-ß1. Expression profiles of LOXL1, BMP-1 and
elastic fiber constituents (elastin, fibrillin-1, fibulin-4, fibulin-5) were analyzed in
cell lysates and media up to 14 days post-confluence using Real-time PCR,
Western blotting, and light and electron microscopic immunocytochemistry;
LOXL1 activity was assessed by a high sensitive fluorescent assay.
Results: Transfection efficiency ranged from 15-20% in transiently transfected to
80% in stably transfected hTCF cells. Transfected cells could be expanded as stably
transgene-expressing clones over 3 weeks enabling long-term analysis of elastic
fiber assembly. Stable clones produced a high steady-state level of LOXL1, which
was 300-fold increased compared to non-transfected controls and could be
localized to cytoplasmic secretory vesicles. TGF-ß1 predominantly stimulated coexpression of elastic proteins and promoted incorporation of elastin into a
preformed microfibrillar scaffold 10-14 days post-confluence. LOXL1, together
with its processing protease BMP-1, was secreted into culture medium and was
found to associate with elastic fibers in the extracellular space.
Conclusions: The results demonstrate the efficiency of nucleofected primary
fibroblasts as a model system to analyze synthesis, secretion and targeting of
LOXL1 to the extracellular elastic matrix. This cell-based assay may represent a
useful strategy to unravel critical functional differences of LOXL1 gene variants
predisposing to PEX syndrome and glaucoma.
Commercial Relationships: Anita W. Krysta, None; Matthias Zenkel,
None; Marco Birke, None; Anselm Jünemann, None; Gabriele GusekSchneider, None; Friedrich E. Kruse, None; Ursula Schlotzer-Schrehardt,
None
Support: None
Program Number: 3853 Poster Board Number: A553
Presentation Time: 3:45 PM - 5:30 PM
Dysregulated Expression Of Fibrogenic microRNAs In Eyes With
Pseudoexfoliation Syndrome
Matthias Zenkel, Angelika Mößner, Friedrich E. Kruse, Ursula SchlötzerSchrehardt. Department of Ophthalmology, University Erlangen Nuernberg,
Erlangen, Germany.
Purpose: Dysregulation of microRNAs (miRNAs) has been implicated in various
fibrotic conditions and in the pathophysiology of glaucoma. To determine the role
of miRNAs in pseudoexfoliation (PEX) syndrome, a stress-induced elastic
microfibrillopathy and a major risk factor for glaucoma, we examined the
expression profile of miRNAs in ocular tissues from PEX and control patients.
Methods: Iridal and ciliary tissue specimens were obtained from donor eyes with
PEX syndrome and age-matched normal donor eyes. miRNAs were isolated using
the miRNeasy kit and subjected to quality control by the Human RT2 QC PCR
array. Iridal specimens were analyzed for 88 different miRNAs using the Human
RT2 Profiler miRNA Finder PCR Array. The differential expression of miRNAs
was verified by specific miRNA real-time PCR assays in iridal and ciliary
specimens. Computational analysis of potential miRNA target sequences in
mRNAs of major constituents of PEX material as well as key components of the
TGF-ß1 signaling pathway was carried out using the TargetScan and MiRanda
algorithms.
Results: PCR-Array analysis revealed increased levels of 15 miRNAs and
decreased levels of 4 miRNAs in tissue specimens from patients with PEX
syndrome as compared to normal donor eyes (n=3 for each group). Quantitative
real-time PCR confirmed a 3-fold increase of mir-96 and a 2-fold decrease of mir29a, -29b, -29c and mir-32 in iridal and ciliary body tissue specimens from PEX
patients (n=6). Computational analysis predicted several target sequences for mir29a, -29b, -29c, and mir-32 in the 3´ untranslated region (3´-UTR) of fibrillin-1 and
elastin, two main components of PEX material, whereas mir-96 targets SMAD-7, a
known inhibitor of TGF-ß1 signaling.
Conclusions: Our data suggest that dysregulated expression of miRNAs may play
a pathophysiological role in the abnormal matrix metabolism characteristic of PEX
syndrome. In view of the predicted target sequences of these miRNAs, the
downregulation of mir-29a, -29b, -29c and mir-32 may contribute to the increased
expression of fibrillin-1 and elastin in ocular tissues of PEX patients, whereas the
upregulation of mir-96 may lead to increased TGF-ß1 activity through targeting the
inhibitory SMAD-7.
Commercial Relationships: Matthias Zenkel, None; Angelika Mößner,
None; Friedrich E. Kruse, None; Ursula Schlötzer-Schrehardt, None
Support: None
Program Number: 3854 Poster Board Number: A554
Presentation Time: 3:45 PM - 5:30 PM
IgG Subclass Autoimmunity Analysis In Sera Of Patients With
Pseudoexfoliation Syndrome, Pseudoexfoliation Glaucoma and Cataract
Controls
Copyright 2012 by the Association for Research in Vision and Ophthalmology, Inc., all rights reserved. For permission to reproduce any abstract, contact the ARVO Office at pubs@arvo.org.
ARVO 2012 Annual Meeting Abstracts by Scientific Section/Group – Biochemistry/Molecular Biology (BI)
Joanna Wasielica-Poslednik, Katrin Lorenz, Marcus Schlich, Nils Boehm, Norbert
Pfeiffer, Franz H. Grus. Ophthalmology, Universitaetsmedizin Mainz, Mainz,
Germany.
Purpose: Using protein microarrays we could previously show evidence for
differentiation between pseudoexfoliation syndrom (PEXS) and pseudoexfoliation
glaucoma (PEXG) on the basis of autoantibody profiles. To gain further insight into
immunoreactivities of PEXS and PEXG patients we analyzed the IgG1-4 antibody
reactivities in these patients and cataract controls (CAT).
Methods: Sera of patients with PEXG (n=17), PEXS (n=17) and controls with
cataract (n=17) were used for antibody analysis . Analyses were performed using
protein-microarrays, which were prepared by spotting 51 different ocular antigens
onto microarray slides. Arrays were incubated with sera (1:250), and were treated
with anti-IgG1-4 antibodies. For visualization of the antibody-antigen-reactions we
used a fluorescence labeled tertiary antibody. Emitted signals were digitized and
spot intensities were compared using diverse statistical techniques, such as
ANOVA and multivariate discriminant analysis.
Results: The intensities of the antibody-antigen-reactions response decreased from
IgG1 to IgG4. The general immunoreactivity distribution did not differ between IgG
subclasses (IgG1 40%, IgG2 24%, IgG3 21%, IgG4 15%). However, the
immunoreactivity distribution of some antigens differed significantly e.g.
Macroglobulin (CAT IgG1 46%, IgG2 9%, IgG3 32%, IgG4 13%, PEXG IgG1 48%,
IgG2 10%, IgG3 22%, IgG4 20%, PEXS IgG1 58%, IgG2 9%, IgG3 18%, IgG4 15%).
The normalized immunoreactivities showed also significant differences for 7
antigens for IgG1 e.g. Neuro specific enolase (CAT vs PEXS p≤0.01 and PEXG vs
PEXS p≤0.01), for 6 antigens for IgG2 e.g. γ-Synuclein (PEXG vs PEXS p≤0.01),
α-1-Antitrypsin (CAT vs PEXS p≤0.03), for 17 antigens for IgG3 e.g. Neuro
specific enolase (CAT vs PEXS p≤0.01 and PEXG vs PEXS p≤0.02) and for 8
antigens for IgG4 e.g. Macroglobulin (CAT vs PEXS p≤0.04 and PEXG vs PEXS
p≤0.02).
Conclusions: The general immunoreactivity distribution of the IgG subclasses did
not distinguish between PEXS, PEXG and CAT. However,we found statisticially
significant differences for all IgG subclasses between study groups. The most
significant differences in the immunoreactivity could be shown for IgG3, which is
the strongest activator of the complement cascade. This fact seems to support the
theory of the involvement of autoimmunity in glaucoma pathogenesis.
Commercial Relationships: Joanna Wasielica-Poslednik, None; Katrin
Lorenz, None; Marcus Schlich, None; Nils Boehm, None; Norbert Pfeiffer,
None; Franz H. Grus, None
Support: None
Program Number: 3855 Poster Board Number: A555
Presentation Time: 3:45 PM - 5:30 PM
Proteomic Profiles Of Aqueous Humor In Glaucoma And Cataract
Darrell WuDunn1A, Susanne Ragg1B, Melissa Key1B, Louis B. Cantor1A, Rudy
Yung1A, Yara Catoira-Boyle1A, Shailaja Valluri1A, Linda S. Morgan1A, Joni Hoop1A.
A
Department of Ophthalmology, BCenter for Computational Diagnostics, 1Indiana
Univ Sch of Medicine, Indianapolis, IN.
Purpose: To understand the underlying cause of glaucoma by comparing the
aqueous humor proteins of subjects with glaucoma versus those with cataract.
Methods: Aqueous samples were obtained from eyes during glaucoma or cataract
surgery. Liquid chromatography tandem mass spectrometry (LC-MS/MS) provides
great depth of protein coverage, while protein antibody arrays are used for lower
abundance proteins. Glaucoma and cataract samples were age and gender matched.
For LC-MS/MS, aqueous samples were depleted of albumin and immunoglobulins.
Tryptic peptides were analyzed on a linear ion-trap (LTQ) mass spectrometer. After
peptide identification, peptide-level quantitative information was combined into
protein summaries based on reference sequence databases. For protein antibody
arrays, aqueous samples were incubated on customized glass slides spotted with
antibodies to 40-50 proteins previously identified in aqueous humor. A mixed
effects model fit with restricted maximum likelihood estimation was used to test
the differential abundance of each protein. Multiple comparison correction was
performed using the Benjamini-Hochberg method.
Results: From 21 cataract and 20 glaucoma samples LC-MS/MS detected 82
proteins with high confidence, all of which had been previously found in aqueous
humor. For most proteins, mean intensity levels between glaucoma and cataract
samples differed by less than 10%. After adjustment for multiple comparisons,
alpha-2 macroglobulin was found to be significantly different between the
glaucoma and cataract samples. Two sets of protein antibody array analysis were
performed. In the first set (21 glaucoma and 21 cataract samples), although no
proteins were significantly different after multiple comparison correction, at least
seven proteins showed potential for further study. We included these seven proteins
with an additional 33 proteins in our second set of protein antibody arrays using a
larger sample size (50 cataract and 50 glaucoma samples). After adjusting for
multiple comparisons and excluding one outlier, we identified 8 proteins, including
interleukin-8, that were significantly higher in abundance in the glaucoma samples
compared to the cataract samples.
Conclusions: In these studies, over 150 proteins were compared between glaucoma
and cataract aqueous humor samples. Nine proteins, including alpha-2
macroglobulin and interleukin-8 were found to be significantly different in
abundance. Subtle differences detected in aqueous humor protein profiles between
glaucoma and cataract may help elucidate the pathophysiology of glaucoma.
Commercial Relationships: Darrell WuDunn, None; Susanne Ragg,
RayBiotech (F); Melissa Key, None; Louis B. Cantor, None; Rudy Yung,
None; Yara Catoira-Boyle, None; Shailaja Valluri, None; Linda S. Morgan,
None; Joni Hoop, None
Support: American Health Assistance Foundation - National Glaucoma Research
Program Number: 3856 Poster Board Number: A556
Presentation Time: 3:45 PM - 5:30 PM
The Putative Inducer of Myocilin Transcription (IMT) is Expressed Within 10
hours of Dexamethasone Treatment in Cultured Human Trabecular
Meshwork Cells
Sarah J. Garnai1A, Colin E. Marrs1A, Kathleen M. Scott1A, Frank W. Rozsa1A, Julia
E. Richards1B, Hemant S. Pawar1A. AOphthalmology and Visual Sciences,
B
Ophthalmology and Visual Sciences and Epidemiology, 1Univ of
Michigan/Kellogg Eye Ctr, Ann Arbor, MI.
Purpose: Long term dexamethasone (DEX) treatment is known to induce myocilin
(MYOC) transcription in trabecular meshwork (TM) cells. Excess myocilin protein
has been observed in the TM tissue in about 50% of primary open-angle glaucoma
(POAG) cases (Lütjen-Drecoll et al. IOVS 1998;39:517). Accumulation of
myocilin in the TM is thought to increase aqueous humor outflow resistance,
causing elevation of intraocular pressure (IOP) (Tamm, ER. Prog Ret Eye Res
2002;21:395). Shepard and colleagues have previously shown that the translation
inhibitor cycloheximide prevents the induction of MYOC by DEX in TM cells
(IOVS 2001;42:3173). This implies the existence of an intermediate protein, which
we refer to as the Inducer of MYOC Transcription (IMT), which is necessary for
upregulation of MYOC transcription. The purpose of this project was to identify the
time period during which the putative IMT protein is synthesized.
Methods: Primary culture human TM cells were grown to 75% confluence and
treated with DEX as previously reported (Rozsa et al. Mol Vis 2006;12:125). DEXtreated and untreated cells were harvested at 0, 2, 4, 6, 10, 12, 18, 24, and 48 h.
Total RNA was extracted using TRIzol® Reagent (Life Technologies) and reverse
transcribed; MYOC transcript was quantified by TaqMan® assay (Applied
Biosystems, Inc.). Presence of secreted myocilin in the spent media was monitored
by Western blot using a polyclonal antibody against myocilin (Santa Cruz
Biotechnology).
Results: We analyzed MYOC expression in three primary TM cell cultures by
TaqMan® assay and normalized the data to β-actin expression levels. We observed
that DEX treatment led to a small but detectable increase in MYOC transcription
after 6 to10 h with an 8- to 14-fold increase by 48 hours. Western blot analysis of
the spent media from one cell line showed increased expression of myocilin
starting around 10 h after DEX induction and becoming more prominent at 18 h
and later.
Conclusions: We find that induction of MYOC transcription begins within 6 to 10
h of exposure to DEX, implying that the putative IMT protein required for DEX
induction of MYOC is expressed prior to this time frame. Analysis of the
transcriptome and proteome of cells captured before this time will assist in the
identification of the IMT protein, which will lead to a better understanding of the
MYOC induction pathway as well as a potential new drug target for glaucoma
treatment.
Commercial Relationships: Sarah J. Garnai, None; Colin E. Marrs,
None; Kathleen M. Scott, None; Frank W. Rozsa, None; Julia E. Richards,
None; Hemant S. Pawar, None
Support: NIH-R01-EY011671, NIH-P30-EY070003 (Core), and Research to
Prevent Blindness
Program Number: 3857 Poster Board Number: A557
Presentation Time: 3:45 PM - 5:30 PM
Expression of Multiple TRPV5 Isoforms and Localization to Ganglion Cells in
the Rodent Retina
Patrick S. Donahue, Jason D. Dapper, Tatiana N. Sidorova, Wendi S. Lambert,
David J. Calkins. Ophthalmology, Vanderbilt University, Nashville, TN.
Purpose: Members of the TRPV (transient receptor protein vanilloid) ion channel
family are implicated in glaucoma, including TRPV1 and TRPV4. TRPV channels
are known to assemble into homo- and heteromeric channels, the composition of
which regulates channel physiology. Since TRPV5 is implicated in age-related
disease, we examined its expression and localization with aging and IOP elevation
for relevance to glaucoma.
Methods: Whole-mount retinas and whole eye vertical sections from 3 and 8
month old C57 mice were immunolabeled for TRPV5, SMI31, and GFAP. RNA
was isolated from fresh C57 retinas, RT-PCR was performed, and TRPV5 products
were separated on agarose gels. PCR products were isolated and re-amplified, then
sequenced by the Vanderbilt DNA Sequencing facility. Western Blotting was
performed using protein extracted from Brown Norway rat retinas. For comparison
in glaucoma models, IOP in some mice was elevated 25-30% unilaterally using
microbead occlusion of the anterior chamber; the opposing eye received an
equivalent volume of saline.
Copyright 2012 by the Association for Research in Vision and Ophthalmology, Inc., all rights reserved. For permission to reproduce any abstract, contact the ARVO Office at pubs@arvo.org.
ARVO 2012 Annual Meeting Abstracts by Scientific Section/Group – Biochemistry/Molecular Biology (BI)
Results: In retina from 3 month C57 mice, TRPV5 labeling was punctate and
localized to retinal ganglion cell (RGC) somas and axons as well as to astrocytes.
TRPV5 expression increased with age and elevated IOP throughout the inner
retina, but especially in RGC axons. TRPV5 immunolabeling in the ONH was faint
in young mice, but increased with age in both axons and astrocytes. Primers against
N- and C-termini of TRPV5 did not yield expected products. However primers
spanning internal exons produced amplicons of the appropriate size in addition to a
splice variant missing exon 4. Western Blotting of TRPV5 revealed bands at 75 and
85 kDa, corresponding to unglycoslated and glycosylated forms of TRPV5.
Conclusions: TRPV5 is present in the mouse and rat retina with strong expression
in RGCs and their axons and in astrocytes. Expression increases with age and
elevated IOP. Furthermore, TRPV5 appears to be modified at the genetic and
protein levels to produce various isoforms. Inclusion or exclusion of specific
domains may affect TRPV5 interactions with other TRPV proteins, which could
alter the physiology of heteromeric TRPV channels during disease processes.
Commercial Relationships: Patrick S. Donahue, None; Jason D. Dapper,
None; Tatiana N. Sidorova, None; Wendi S. Lambert, None; David J. Calkins,
None
Support: Melza and Theodore Barr and GRF (DJC), AHAF (DJC), NEI Grant
(5R01EY017427-03) (DJC), RPB (DJC), NEI Core Grant (5P30EY008126-19)
(DJC)
Program Number: 3858 Poster Board Number: A558
Presentation Time: 3:45 PM - 5:30 PM
Shear stress induced multimerization of cochlin and its interaction with
Annexin A2
Renata Picciani1, Sanjoy K. Bhattacharya1, Horacio M. Serra2. 1Ophthalmology,
Bascom Palmer Eye Institute, Miami, FL; 2Bioquimica Clinica, CIBICI, Fac ultad
de Cs Quimicas UNC, Cordoba, Argentina.
Purpose: To characterize cochlin multimerization in response to shear stress and
determine the interaction of native and multimerized cochlin with Annexin A2.
Methods: Native cochlin and recombinant cochlin domains were purified from
HEK cells and E.coli. The proteins were subjected to purification using standard
methods. Purified proteins were incubated with trabecular meshwork extract with
or without being subjected to shear stress and their interaction with Annexin A2
was probed using immunoprecipitation and Western analyses. Cochlin-Annexin A2
interactions were also probed with overlay assay and mass spectrometry using a
LCQ Deca XP instrument.
Results: We found native cochlin to interact with Annexin A2. In our kinetic
assays, multimerized cochlin interacted with slightly higher binding strength with
Annexin A2. The recombinant cochlin domains (LC and vWFA domains) poorly
expressed either in E.coli or in HEK cells, they also failed to fold properly upon
expression.
Conclusions: Multimeric cochlin formed in response to shear stress interacts with
higher binding strength with Annexin A2 compared to native cochlin.
Commercial Relationships: Renata Picciani, None; Sanjoy K. Bhattacharya,
None; Horacio M. Serra, None
Support: RPB Career award (SKB), an unrestricted grant from RPB to University
of Miami, NIH grant EY016112
Program Number: 3859 Poster Board Number: A559
Presentation Time: 3:45 PM - 5:30 PM
Characterisation Of The Gelatinase Component Of The Matrix
Metalloproteinase (MMP) System At The Human Optic Nerve Head Region
Ali A. Hussain, Yunhee Lee, JinJun Zhang, John Marshall. Division of Molecular
Therapy, UCL Institute of Ophthalmology, London, United Kingdom.
Purpose: Matrix metalloproteinases (MMPs) play a pivotal role in maintaining the
fluidity of the ECM of the lamina cribrosa. Some of the MMPs involved in the
turnover of the ECM have been identified but little is known of the distribution of
active and latent forms, their age related transformations or the degree of
proteolytic activity present. Our purpose was to identify the presence of individual
components of the gelatinase MMP system and to quantify the level of activity of
these enzymes in the optic nerve head and surrounding rim region of the human
fundus.
Methods: Samples of optic disc, rim region and Bruch’s membrane-choroid from
macular and peripheral regions were isolated from 12 donor eyes ranging in age
between 60-72 years. MMPs were extracted with non-reducing sodium dodecyl
sulphate (SDS) sample buffer and separated by gelatin zymography. Individual
gelatinase species were identified by their respective molecular weights and levels
quantified by standard densitometric techniques. Ratios of active/latent MMPs
were calculated as representative indicators of the degree of proteolytic activity at
each of the locations examined.
Results: All of the gelatinase species normally found in Bruch’s membrane were
also present at the optic nerve head. The greater presence of the high molecular
weight species (HMW1 & HMW2) at the ONH was indicative of the age-related
accumulation of the polymerisation products of MMPs 2&9. The relative
distribution of MMPs 2&9 found in Bruch’s was reversed at the ONH and the
surrounding rim area. Active levels of MMPs 2&9 at the ONH and rim region were
considerable raised in comparison to their latent forms indicative of the much
greater turnover of the matrix in these regions (p<0.005).
Conclusions: The components of the gelatinase pathway mediating matrix turnover
in Bruch’s membrane were also present at the ONH. The presence of high levels of
active MMPs 2&9 at the ONH and rim area is indicative of a high rate of matrix
remodelling in these regions. Enhanced matrix turnover at the ONH may represent
an important mechanism for maintaining the plasticity of the lamina cribrosa but
the reason for high MMP activity in the rim region and its relevance to the
biomechanics of the ONH requires further investigation.
Commercial Relationships: Ali A. Hussain, None; Yunhee Lee, None; JinJun
Zhang, None; John Marshall, None
Support: None
Program Number: 3860 Poster Board Number: A560
Presentation Time: 3:45 PM - 5:30 PM
Chemokine Receptor Antagonist Lowers Intraocular Pressure and Prevents
Retinal Degeneration in an Animal Model Glaucoma
Alexandre Denoyer1,2, David Godefroy1, Julie Frugier1, Isabelle Célérier3, Julie
Degardin1, Françoise Brignole-Baudouin1, William Rostène1, Christophe
Baudouin1,2. 1Institut de la Vision/INSERM/UPMC Univ Paris 06/CNRS, Paris,
France; 2CHNO des Quinze-Vingts, Paris, France; 3Team 1, Centre de Recherche
des Cordeliers / UMR872 / INSERM / UPMC, Paris, France.
Purpose: To investigate the in vivo effects of antagonism of the chemokine
receptor CXCR3 in a rat model of glaucoma.
Methods: Long-Evans male rats underwent episcleral vein cauterization in order to
induce stable elevation in intraocular pressure (IOP). CXCR3 antagonist or the
vehicle only were injected in glaucomatous eyes (n=10 in each), which were
assessed for IOP weekly. Measurement of the trabecular filtrating function
(fluorophotometry, dynamic recording of fluid turn-over, and microsphere injection
combined with confocal microscopy of the trabecular meshwork), retinal nerve
fiber count by scanning laser ophthalmoscopy, and optokinetic testing to assess
visual function were conducted two months after.
Results: IOP was significantly decreased during at least 6 weeks in glaucoma eyes
treated with the antagonist compared to eyes receiving the vehicle only (P<0.01 at
each time point). Aqueous humor outflow was increased in treated eyes (P<0.01)
due to an increase in trabecular filtrating surface (P<0.01). Retinal nerve fiber
density was higher in treated eyes than in untreated eyes (P<0.01), and further
correlated with the visual function (P<0.01).
Conclusions: In vivo blockade of the chemokine receptor CXCR3 in a rat model of
glaucoma lowers ocular hypertension by restoring trabecular function and protects
the retina against IOP-related degeneration. These original findings open new
therapeutic avenues based on chemokine/chemokine receptor targeting in
glaucoma.
Commercial Relationships: Alexandre Denoyer, None; David Godefroy,
None; Julie Frugier, None; Isabelle Célérier, None; Julie Degardin,
None; Françoise Brignole-Baudouin, None; William Rostène, None; Christophe
Baudouin, None
Support: None
Program Number: 3861 Poster Board Number: A561
Presentation Time: 3:45 PM - 5:30 PM
High-Density Protein Arrays For Serum Autoantibody Biomarker Profiling In
Glaucoma And Ocular Hypertensive Patients
Sabine Beck, Nils Boehm, Norbert Pfeiffer, Franz H. Grus. Experimental
Ophthalmology, University of Mainz, Mainz, Germany.
Purpose: In previous studies significant alterations in IgG autoantibody patterns of
glaucoma patients have been shown. We could demonstrate up- as well as downregulated immunoreactivities to ocular and non-ocular antigens. The aim of this
investigation was to identify new autoimmune biomarkers for open angle and
normal tension glaucoma as well as ocular hypertension by means of an advanced
high-density protein array approach.
Methods: For the analysis of autoantibody reactivities, sera of patients with
primary open angle glaucoma (POAG, n=20) and normal tension glaucoma (NTG,
n=20) are compared with healthy subjects (CTRL, n=20) and patients with ocular
hypertension (OHT, n=20). Two pools of ten sera each were created for each
group, which were incubated on nitrocellulose-coated slides with 3800
immobilized randomly selected human proteins from the UNIclone® library
(UNIchip®, Protagen, Dortmund, Germany). For visualization of the resultant
antigen-antibody complexes, slides were treated with a secondary fluorescence
labeled antibody (Dylight 650) followed by confocal laser scanning. After data
normalization spot intensities were compared and group differences were analyzed.
Results: Overall we could detect complex autoantibody patterns in all groups.
Proteins at least 1.6 fold decreased or 1.8 fold increased were considered
significantly altered. Out of 15 shifted immunoreactivities in POAG, 7 in NTG and
7 in OHT in comparison to CTRL-group only one (TTLL12, tubulin tyrosine
ligase-like family member 12) was found in both glaucoma groups (>1.85 fold
increase). All others were unique to their respective groups (e.g. DUSP2 for POAG
(dual specificity phosphatase 2, 2.3 fold increase), PRG2 (plasticity related gene 2,
Copyright 2012 by the Association for Research in Vision and Ophthalmology, Inc., all rights reserved. For permission to reproduce any abstract, contact the ARVO Office at pubs@arvo.org.
ARVO 2012 Annual Meeting Abstracts by Scientific Section/Group – Biochemistry/Molecular Biology (BI)
2.14 fold increase) for NTG, SRP14 (signal recognition particle 14kDa, 2.02 fold
increase) for OHT) and might be potential biomarkers.
Conclusions: In this study a panel of 3800 randomly chosen antigens we were able
to detect a small number of significant up- and down-regulations of autoimmune
reactivities in sera of patients. After further validation in subsequent studies, these
potential biomarkers could lead to new therapeutic drug targets for innovative
immunomodulatory treatments and give further insights in the pathogenesis of eye
diseases.
Commercial Relationships: Sabine Beck, None; Nils Boehm, None; Norbert
Pfeiffer, None; Franz H. Grus, None
Support: DFG ("Deutsche Forschungsgemeinschaft") Gr-1463-4-2
Program Number: 3862 Poster Board Number: A562
Presentation Time: 3:45 PM - 5:30 PM
Time Course of Hypoxia Response in Primary Human Optic Nerve Head
Astrocytes
Darren W. Chan1, Jeremy M. Sivak1, John G. Flanagan1,2. 1Ophthalmology and
Vision Sciences, University of Toronto, Toronto Western Hospital, Toronto, ON,
Canada; 2School Of Optometry, University of Waterloo, Waterloo, ON, Canada.
Purpose: To establish an in-vitro model of hypoxia on cultured primary astrocytes
of the human optic nerve head (ONH). Both hypoxic responses and astrocyte
activation in the ONH are implicated in the pathogenesis of glaucoma. These
experiments were designed to determine the time course and optimal conditions to
assess hypoxic effects.
Methods: Explants prepared from isolated ONHs dissected from healthy human
donor eyes were cultured to develop into primary cell lines. Together with these
primary cells, SVGp12 cells, a human fetal brain glial cell line, were also used for
some preliminary experiments. Hypoxia experiments were run in parallel for 5 time
points over 24 hours (2, 5, 8, 18, 24 ). Both the primary astrocytes and SVGp12
cells, were serum deprived for 24 hours upon confluence. They were placed into a
hypoxic chamber that was preset for 1% oxygen and 5% carbon dioxide. Control
cells were run separately, in parallel, in normoxic conditions. At the end of each
time point, samples of conditioned media and cells were harvested in an ice bath,
immediately processed for nuclear extracts, and stored at -80°C for future analysis.
Some cells were grown on coverslips through hypoxic treatments, and fixed for
immunofluorescence analysis.
Results: Nuclear extracts from the experimental samples were used for Western
blotting and were analyzed by densitometry. The hypoxia inducible factor HIF1alpha was found to be stabilized in the nucleus following hypoxia, with maximum
levels between 5 and 8 hrs, as compared to normoxic controls. The hypoxia and
metabolic response factor, PGC-1alpha, was maximally upregulated around 8 hrs.
Increases in the biomarker GFAP were detected from 2 hrs, reflecting astrocyte
activation. Immunofluorescent studies showed active translocation of HIF-1alpha
from cytoplasm to nucleus.
Conclusions: Primary human ONH astrocytes were activated during hypoxic
insult, with typical hypoxic responses peaking between 5 and 8 hours. We propose
a model of hypoxia that has the potential of being combined with previous models
of biomechanical insult.
Commercial Relationships: Darren W. Chan, None; Jeremy M. Sivak,
None; John G. Flanagan, None
Support: John Flanagan- CIHR, GRSC, Jeremy Sivak- CNIB, TGH and TWH
Foundation
Program Number: 3863 Poster Board Number: A563
Presentation Time: 3:45 PM - 5:30 PM
Global biochemical Profile of Aqueous Humor from POAG patients and
matched controls
Coralia C. Luna1, Chang He2, Jing Wu1, Guorong Li1, Pratap Challa1, Xialin Liu2,
David L. Epstein1, Pedro Gonzalez1. 1Ophthalmology, Duke University Eye Center,
Durham, NC; 2Zhongshan Ophthalmic Centre, Sun Yat-Sen University,
Guangzhou, China.
Purpose: To evaluate potential differences between the biochemical profile of
aqueous humor (AH) from Primary Open Angle Glaucoma (POAG) patients and
age matched controls.
Methods: Aqueous humor samples were obtained from patients with a history of
POAG and age matched controls at Zhongshan Ophthalmic Centre, Sun Yat-Sen
University, Guangzhou, China, following the tenants of the declaration of Helsinki.
Samples were grouped by patient condition: control (9) or POAG (9) and processed
by Metabolon Inc. Samples were split into equal parts for analysis on the GC/MS
and LC/MS/MS platforms. Instrument variability was determined by calculating
the median relative standard deviation (RSD) from the internal standards added to
each sample. Overall variability was determined by calculating the median RSD for
all endogenous metabolites (i.e., non- standards) present in the matrix samples
(pooled samples). Welch’s two-sample t-tests were used to evaluate significance
(p≤0.05) and the q-value was used to calculate the false discovery rate.
Results: Comparison of global biochemical profiles for aqueous humor from
glaucoma and controls revealed statistically significant differences in 31
biochemical compounds, 26 increased and 5 decreased in POAG patients compared
to controls. Among the increased metabolites in POAG were, free amino acids
(AA) (tryptophan, tyrosine, histidine, methionine, lysine metabolites) and Nacethyl AA (N6-acetyllysine, N-acetylvaline), protein glycation and glycosilation
(sialic acid, 2-aminobutyrate), and some drugs and chemical metabolites (1,2
propanediol, dyethanolamine).
Conclusions: Metabolic profile of AH humor from POAG patients suggest several
mechanisms by which the observed changes could contribute to the
pathophysiology of POAG. Specifically, the observed increase in free AA may
reflect reduced uptake or elevated release to aqueous humor under conditions of
increased protein breakdown and/or increased solute concentration in the aqueous
humor could alter osmotic balance/pressure in the fluid and surrounding tissues. In
addition, global metabolic profile might be a promising avenue for the
identification of new markers for glaucoma.
Commercial Relationships: Coralia C. Luna, None; Chang He, None; Jing
Wu, None; Guorong Li, None; Pratap Challa, None; Xialin Liu, None; David L.
Epstein, None; Pedro Gonzalez, None
Support: NEI EY016228, NEI EY01894, NEI EY05722, RPB
Program Number: 3864 Poster Board Number: A564
Presentation Time: 3:45 PM - 5:30 PM
Development of a Mini-qPCR Array for Mouse Retinal Ganglion Cells using
MIQE Guidelines
Heather R. Pelzel1, Joel A. Dietz2, Kimberly A. Toops2, Michael Waclawski2,
Robert W. Nickells2. 1Biology, Univ of Wisconsin-Whitewater, Whitewater, WI;
2
Ophthalmology, Univ of Wisconsin-Madison, Madison, WI.
Purpose: Changes in retinal ganglion cell (RGC) gene expression are important
metrics to evaluate the response of these cells to apoptotic and neuroprotective
stimuli. We sought to develop a qPCR array to interrogate normal and stressresponse gene expression for mouse RGCs that also complied with the Minimal
Information required for Quantitative PCR Experiments (MIQE) guidelines.
Methods: RGC specific and select stress-response genes were identified from the
literature. Primers were designed to bridge introns, contain 60% GC identity, and
amplify approximately 200 bp of cDNA. All primers were tested for specificity at a
common temperature. All amplimers were cloned and sequenced, confirming
identity. Standard curve data was obtained from cloned cDNAs of all target genes.
Experimental cDNAs were generated from retinas isolated from eyes after optic
nerve crush, including eyes from mice treated with the HDAC inhibitor trichostatin
A (TSA) and from different strains that exhibit different susceptibility to optic
nerve damage.
Results: Using a 96 well plate, we analyzed (in triplicate) the transcript abundance
of 7 ganglion cell specific or enriched genes (Thy1, Brn3b, Sncg, Nrn1, Fem1c,
TrkB, Nfl), 4 stress response genes (Hsp27, Gfap, Bim, BclX), 2 axonal
regeneration genes (Gap43, Tubb3), and 2 loading control genes (S16, Gapdh),
from two independent samples. All gene products exhibited efficient amplification
allowing for either relative quantification using the ∆∆Ct method after Pflaffl
correction or calculation of absolute values from a representative standard curve
included on the plate. Test-retest evaluation of the same and different cDNA
batches showed less than 1-cycle variation in most transcripts except those with
low abundance. Most variation occurred between retinas of different mice.
Experimentally, BALB/cByJ mice exhibit greater damage than DBA/2J mice. RGC
mRNAs exponentially decay after crush, and TSA injection was able to prevent and
even increase expression of RGC specific genes. These outcomes are consistent
with literature reports.
Conclusions: Using best practices, as outlined in the MIQE guidelines, this miniarray provides a useful tool to evaluate RGC gene expression. The use of a miniarray provides a straightforward method to assay multiple samples for several
genes at once to generate reliable, reproducible data.
Commercial Relationships: Heather R. Pelzel, None; Joel A. Dietz,
None; Kimberly A. Toops, None; Michael Waclawski, None; Robert W.
Nickells, None
Support: NIH EY012223, NIH EY018869, NIH EY016665
Program Number: 3865 Poster Board Number: A565
Presentation Time: 3:45 PM - 5:30 PM
Changes to Retinal Complement Gene Expression Induced by Elevated
Intraocular Pressure in the Microbead Model of Glaucoma in Mice
Esther C. Yoon1A,2, Lampros Panagis1A,2, Lizhen Ren1A,2, John Danias1B,2. ACell
Biology, BOphthalmology, 1SUNY Downstate, NY, NY; 2SUNY Eye Institute,
State University of New York, NY.
Purpose: To investigate whether retinal complement gene expression is affected by
short (1 week) and long term (8weeks) intraocular pressure elevation (IOP) in an
induced IOP elevation mouse model of glaucoma.
Methods: High IOP was unilaterally induced in C57BL/6J mice for 8 days (short
term, n=6) or 56 days (long term, n=6) via unilateral intracameral injection of 10um
polystyrene beads while another group (n=6) served as naïve control group (no
injection). IOP was monitored using a rebound tonometer. At the end of the
experiment, RNA and protein was extracted from retinas and qPCR was performed
for C1qb, C2, C3, C4 and CRRY. Protein expression of C1q and C3 was examined
Copyright 2012 by the Association for Research in Vision and Ophthalmology, Inc., all rights reserved. For permission to reproduce any abstract, contact the ARVO Office at pubs@arvo.org.
ARVO 2012 Annual Meeting Abstracts by Scientific Section/Group – Biochemistry/Molecular Biology (BI)
using immunoblotting and normalized against b-actin expression.
Results: qPCR experiments, showed low levels of expression of the complement
genes studied. After one week of induction of elevated IOP, no significant
differences (ANOVA, p>0.05) were observed between injected, contralateral and
naïve control eyes. However after 8 weeks of induction of elevated IOP, C1qb and
C3 were significantly upregulated in both eyes of experimental animals compared
to naïve controls (ANOVA, p0.05) was observed in the protein levels of both C1q
and C3 in any group.
Conclusions: The expression of complement components the retina in vivo is not
influenced by short term rise in intraocular pressure. Longer exposure to high
intraocular pressure affects the levels of certain complement components C1qb and
C3 expression in the retina.
Commercial Relationships: Esther C. Yoon, None; Lampros Panagis,
None; Lizhen Ren, None; John Danias, None
Support: R01 EY15224
Program Number: 3866 Poster Board Number: A566
Presentation Time: 3:45 PM - 5:30 PM
Risk Polymorphism in SERPING1 and Primary Open Angle Glaucoma: The
Los Angeles Latino Eye Study (LALES)
Luis E. Vazquez1, Mina Torres1, Cathy Wu1, Roberta McKean-Cowdin2, Rohit
Varma1. 1Ophthalmology, USC Doheny Eye Institute, Los Angeles, CA;
2
Preventive Medicine, USC, Los Angeles, CA.
Purpose: Recent studies suggest that IOP-driven RGC expression of immune
complement genes is an early event in glaucomatous damage. Complement
activation leads to destruction of dendritic RGC synapses, resulting in RGC
dysfunction and susceptibility. We thus hypothesize that complement inhibitors
play a role in neuroprotection early in disease, but whether complement underlies
development of primary open angle glaucoma (POAG) in humans remains
unknown. Here, we test whether polymorphisms affecting complement inhibition
are associated with primary open angle glaucoma (POAG) in Latinos.
Methods: Out of 290 POAG cases identified in LALES, a population-based study
on the incidence/ prevalence of major eye diseases, we selected all cases with
available DNA samples (172) as our case group. As controls, we selected 172
individuals with no eye disease (POAG, AMD, or diabetic retinopathy) from the
LALES cohort by frequency matching to age, central corneal thickness, smoking
and diabetes. We used TaqMan assays (ABI) to sequence a total of 10 single
nucleotide polymorphisms (SNPs) across genes that activate or inhibit the
complement cascade, namely Serping-1, C2, Factor B, C3, and CFH; sequencing
was performed at USC’s epigenome center. The selected SNPs are predicted to
change the expression or aminoacid code of the genes of interest. Chi square
analysis and one-sided P values (5% significance level) were calculated to
determine association of risk genotypes (either heterozygous or homozygous for
the risk SNP) and POAG.
Results: The frequency of risk genotypes (fRG) for rs2509897, a SNP in the
promoter region of Serping-1 predicted to affect gene expression, was 31% higher
in our POAG cases (50.3%) compared to controls (38.3%), p=0.02. The odds ratio
of POAG conferred by this SNP was 1.6. Similarly, the fRG in C3 that result in the
C3 fast variant (rs2231099, predicted to be an overactive form of C3) was modestly
higher in POAG cases (19.8%) compared to controls (14.6%). Although this was
not statistically significant (p=0.07), the odds ratio conferred by rs2231099 was
also 1.6. There was also a trend for a higher fRG for rs1061170 (CFH Y402H) in
cases of joint AMD and POAG compared to either control, AMD alone or POAG
alone (p=0.07, OR=1.8 vs. control). We did not find an association between rs4926
(V480M in Serping-1), rs1047286 (P292L in C3), or polymorphisms in C2 or
Factor B and POAG, although our sample was too small to detect differences in
relatively rare polymorphisms.
Conclusions: Our preliminary analysis suggests that risk polymorphisms in
complement regulators may be associated with POAG.
Commercial Relationships: Luis E. Vazquez, None; Mina Torres, None; Cathy
Wu, None; Roberta McKean-Cowdin, None; Rohit Varma, None
Support: NIH Grants EY-11753, EY-03040, and Research to Prevent Blindness,
NY
Program Number: 3867 Poster Board Number: A567
Presentation Time: 3:45 PM - 5:30 PM
Discovery and SAR of a Class of Ocularly-active Compounds Displaying a
Dual Mechanism of Activity for the Treatment of Glaucoma
Mitchell A. deLong1A, Jeff Yingling1B, Cheng-Wen Lin1B, Bryan Sherman1B, Jill
Sturdivant1A, Geoff Heintzelman1A, Carmen Lathem1B, Tom van Haarlem1B, Casey
Kopczynski1B. AChemistry, BBiology, 1Aerie Pharmaceuticals, Research Triangle
Park, NC.
Purpose: Inhibitors of Rho kinases (ROCKs) lower intraocular pressure
exclusively by increasing aqueous outflow through the trabecular meshwork (TM).
Presented here is the discovery and SAR of a class of compounds that possesses a
dual-mechanism of activity in vitro and enhanced IOP-lowering efficacy in vivo.
Methods: A large panel of compounds were synthesized and screened for protein
kinase inhibitory activity, including ROCK inhibition. Select compounds were
tested for ocular hypotensive activity and tolerability in normotensive Dutch Belted
rabbits and Formosan Rock monkeys. From that initial set, a series was developed
that had a distinct IOP-lowering profile. Representative compounds were
subsequently screened for inhibitory activity against a panel of non-kinase proteins
to assess whether a second target other than Rho kinase might contribute to the
IOP-lowering activity.
Results: In vivo testing of compounds demonstrated that compounds possessing a
beta-amino acid had a distinct pharmacologic profile from compounds containing
either an alpha, gamma, or delta amino acid skeleton. In a series of rabbit studies,
mean IOP for untreated eyes ranged from 24.8 - 28.0 mm Hg. Treatment with betaamino acid derivatives produced an initial rise in mean IOP followed by mean IOP
reductions of 1 to 10 mm Hg (p +2 lasting for 24 hours. The addition of a
hydrophobic side chain produced a series of compounds with maximal efficacy and
improved tolerability. In 3-day monkey studies, mean IOP for untreated eyes
ranged from 19.8 - 20.5 mm Hg. Treatment with selected hydrophobic compounds
reduced mean IOP on Day 3 by 3-7.5 mm Hg (p<0.01) at 24 hours after dosing
with no evidence of ocular irritation. Maximal IOP-lowering efficacy correlated
with inhibitory activity against neurotransmitter reuptake receptors, including the
norepinephrine transporter.
Conclusions: Compounds containing beta-amino acids produced the largest
reductions in IOP with the longest duration of action due to their unique profile as
in vitro inhibitors of both rho kinases as well as neurotransmitter transporter
proteins. Addition of hydrophobic modifications to select compounds preserved
efficacy while improving tolerability in normotensive rabbits and monkeys. The
best of these compounds, AR-13324, was selected for further study.
Commercial Relationships: Mitchell A. deLong, Aerie Pharmaceuticals
(E); Jeff Yingling, None; Cheng-Wen Lin, Aerie Pharmaceuticals (E); Bryan
Sherman, Aerie Pharmaceuticals (E); Jill Sturdivant, Aerie Pharmaceuticals
(E); Geoff Heintzelman, None; Carmen Lathem, Aerie Pharmaceuticals (E);
Tom van Haarlem, Aerie Pharmaceuticals (E); Casey Kopczynski, Aerie
Pharmaceuticals (E)
Support: None
Program Number: 3868 Poster Board Number: A568
Presentation Time: 3:45 PM - 5:30 PM
Testican-1 (SPOCK-1) is differentially expressed in Human Ciliary Body and
Trabecular Meshwork
Min Hyung Kang, Dong-Jin Oh, Ayan Chatterjee, Douglas J. Rhee. Department of
Ophthalmology, Harvard Medical School/MEEI, Boston, MA.
Purpose: The matricellular protein Testican-1 has an inhibitory effect on matrix
metalloproteinases in non-ocular tissue. It is unknown if Testican-1 is present in the
outflow pathways. We hypothesized that Testican-1 would be found in the relevant
drainage tissues.
Methods: Cultured cells obtained from human ciliary body (CB) and trabecular
meshwork (TM) were used. Total RNA was obtained from 4th or 5th passage
cultured CB and TM cells, and qRT-PCR was performed using primers specific for
Testican-1. Immunoblot analysis was performed to determine the expression of
Testican-1 in cultured CB and TM cells.
Results: In qRT-PCR experiments, we found that Testican-1 mRNA was expressed
in CB (0.010 ± 0.001 fold, n=4) and TM (0.037 ± 0.010 fold, n=4), respectively,
normalized with β-Actin. This indicates that Testican-1 in TM is expressed 4 times
higher (p=0.027) than in CB. Immunoblot analysis, demonstrated equivalent
expression of Testican-1 in TM and CB (0.48 ± 0.45 fold, n=3).
Conclusions: The findings indicated that Testican-1 mRNA and protein are
expressed in cultured CB and TM cells as well as in the anterior segments of
normal and glaucomatous eyes. Although the function of Testican-1 is unknown, its
function may be related to protease inhibition.
Commercial Relationships: Min Hyung Kang, None; Dong-Jin Oh,
None; Ayan Chatterjee, None; Douglas J. Rhee, None
Support: NIH R01 EY 019654-01 (DJR) and NIH EY 014104 (MEEI Vision-Core
Grant)
Program Number: 3869 Poster Board Number: A569
Presentation Time: 3:45 PM - 5:30 PM
Effect of Short Term Elevation of Hydrostatic Pressure on Complement Gene
Expression in Murine and Primate Retinal Organotypic Cultures
Konstantin Astafurov1,2, Lampros Panagis1,2, Lizhen Ren1,2, Sandeep Kumar1,2,
Esther Yoon1, John Danias1,2. 1Cell Biology, SUNY Downstate Medical Center,
Brooklyn, NY; 2SUNY Eye Institute, Brooklyn, NY.
Purpose: To investigate whether complement expression is regulated by short term
elevation of hydrostatic pressure in mouse and monkey retinal explanted tissue
cultures.
Methods: Whole mounted C57BL/6 mouse and Macaca radiata retina organotypic
cultures were maintained under hydrostatic pressures of: 0, 15, 30 or 45mmHg for
either 24 or 72 hours. All experiments were repeated 4 times. At the end of the
experiment, RNA and protein was extracted from the explants and quantitative
PCR (qPCR) was performed for C1q, C2, C3, C4, CFH, Thy1,Sncg and GFAP.
Protein expression of C1q and C3 was examined using immunoblotting and
Copyright 2012 by the Association for Research in Vision and Ophthalmology, Inc., all rights reserved. For permission to reproduce any abstract, contact the ARVO Office at pubs@arvo.org.
ARVO 2012 Annual Meeting Abstracts by Scientific Section/Group – Biochemistry/Molecular Biology (BI)
normalized against beta-actin expression.
Results: Quantitative PCR experiments for mouse and monkey retinal explant
tissue cultures showed low levels of expression of the complement genes studied
while no significant difference (ANOVA, p>0.05) was observed in the levels of
C1q, C2, C3 and C4 under any of the conditions of hydrostatic pressure they were
subjected to, for either 24 or 72 hours. Similarly, levels of C1q and C3 protein
remained unchanged (p>0.05) in both murine and monkey tissue compared to
controls that were not subjected to elevated pressure. Levels of both Thy1 and
Synuclein-gamma gene expression were significantly decreased (2 way ANOVA,
p<0.05) in mouse retinas subjected to 72 hours of culture compared to retinas
cultured for only 24 hours. In monkey retina, levels of CFH were significantly
downregulated in explants subjected to 45mmHg compared to those under ambient
pressure (Fisher LSD, p<0.05).
Conclusions: The expression of most complement components in murine and
primate retinal explants in culture is not influenced by short term rise in hydrostatic
pressure.
Commercial Relationships: Konstantin Astafurov, None; Lampros Panagis,
None; Lizhen Ren, None; Sandeep Kumar, None; Esther Yoon, None; John
Danias, None
Support: R01 EY15224
Program Number: 3870 Poster Board Number: A570
Presentation Time: 3:45 PM - 5:30 PM
In Vitro Proliferative Response Of Human Tenons And Scleral Cells From
Patients Undergoing Glaucoma Filtration Surgery- A Clinical Correlation
Karunakaran Coral1, Jagaveerapandiyan Sarangapani1, Vineet Ratra2, Sulochana
KN1. 1Dept of Biochemistry & Cell Biology, Vision Research Foundation, Sankara
Nethralaya, Chennai, India; 2Smt Jadhavbai Nathmal Singhvee Glaucoma Services,
Medical Research Foundation, Sankara Nethralaya, Chennai, India.
Purpose: Glaucoma is an optic neuropathy characterized by optic disc changes and
corresponding visual field defects in which intra ocular pressure (IOP) is the only
treatable factor. Failure of trabeculectomy surgery is due to excessive scarring in
sclera and subconjunctiva. The purpose of this study is to look at the proliferative
response of the sclera and tenons tissues removed from patients undergoing
trabeculectomy surgery and also to screen the effect of compounds which inhibit
excess wound healing.
Methods: The study was approved by the Ethics committee of the Institute and
informed consent were obtained from patients. Detailed clinical proforma was
filled. Scleral tissues (n=8) and tenons (n=7) removed surgically from patients
undergoing trabeculectomy was processed for cell culture. The clinical outcome of
the patients after surgery was assessed.The tissues were treated with 0.2 %
collagenase and plated on 0.1 % gelatin coated dishes with EGM medium. The
isolated cells were identified using specific markers viz Fibroblast specific protein
(FSP) for human tenons fibroblast (HTF) and SOX9 for human scleral cells (HSC)
by RT-PCR. Wound healing was done by scratch assay in cells using drugs like
mitomycin C (MMC) and cyclosporine A (CsA) at concentrations of 10 ng to 100
µg/ml and endogenous extracellular matrix derived peptides at concentrations of 10
to 100 µM.
Results: Sclera and tenons tissues from patients (n=2) who had post operatively
corkscrew vessels on the bleb which is suggestive of increased scarring grew in
vitro.These cells grew after 5-7 days and the confluent cells showed typical cell
specific morphology. mRNA expression of HSC were positive for SOX 9 (213bp)
and HTF were positive for FSP (153bp) by RT-PCR. Wound healing as evaluated
by scratch assay showed inhibition of cell migration with a combination of MMC
(100 µg/ml ie 300 µM) and CsA (50 µg/ml ie 40 µM) compared to MMC alone.
Extracellular matrix derived peptides were effective in inhibiting cell migration at
10 µM concentration. No cytotoxicity was observed for these compounds at the
tested concentrations by MTT assay.
Conclusions: In vitro cell growth of sclera and tenons could be a predictive marker
for the poor outcome of glaucoma filtration surgery, such cases could be treated
with endogenous extracellular matrix derived peptides which inhibit cell migration
thereby preventing scar formation.
Commercial Relationships: Karunakaran Coral, None; Jagaveerapandiyan
Sarangapani, None; Vineet Ratra, None; Sulochana Kn, None
Support: None
Program Number: 3871 Poster Board Number: A571
Presentation Time: 3:45 PM - 5:30 PM
Attenuated Glial Activation After Optic Nerve Crush In Bax-deficient Mice
Caitlin E. Mac Nair, Cassandra L. Schlamp, Robert W. Nickells. Ophthalmology
and Visual Sciences, Univeristy of Wisconsin, Madison, WI.
Purpose: Bax-deficient retinal ganglion cells are completely resistant to acute optic
nerve crush-induced damage. Models of secondary degeneration after acute optic
nerve damage predict that apoptosis-inducing cytokines are produced by retinal glia
reacting to ganglion cells undergoing primary degeneration. Since these cytokines
should activate extrinsic apoptosis (Bax-independent), we investigated the level of
glia reaction, cytokine expression, and susceptibility of ganglion cells to select
inflammatory cytokines in Bax-deficient mice.
Methods: Bax-deficient and wild type C57BL/6 mice were compared in this study.
mRNA and protein levels of glial reactivity markers and cytokine production were
monitored by qPCR and ELISA assays, respectively. Glial markers used were
GFAP for macroglia and Aif1 for microglia, and proinflammatory cytokines
monitored included IL1b, IL6, and TNF. Experiments to directly test Bax-deficient
ganglion cell susceptibility to these cytokines are underway and will be reported.
Results: Bax-deficient mice are completely resistant to optic nerve crush, but still
exhibit early onset ganglion cell atrophy such as nuclear shrinkage and loss of
normal ganglion cell-specific gene expression. Glial activity is greatly diminished
in Bax-deficient mice compared to wild-type mice, with a modest increase in
GFAP and Aif1 mRNA levels by 2 weeks following crush injury. In wild type
mice, GFAP protein levels rise over the course of 2 weeks and remained elevated
after 7 days. IL6 and TNF mRNA levels were low in Bax-deficient and wild-type
mice at 1 and 2 weeks post-crush, however in wild type mice IL6 proteins spiked
within 24 hours, returning to normal levels by 1 week. IL1b mRNA was elevated in
both Bax-deficient and wild-type mice at 1 week, and at 2 weeks remained elevated
in Bax-deficient mice while dropping in wild type mice. qPCR results indicate that
reactivity of both macro and microglia are substantially muted after optic nerve
crush in Bax-deficient mice. Similarly, preliminary experiments suggest no changes
in expression of inflammatory cytokines.
Conclusions: While Bax-deficient ganglion cells undergo early onset atrophy and
loss of gene expression after optic nerve crush, activation of glial cells in response
to damage appears to require complete execution of ganglion cells subjected to the
primary damaging stimulus. These results provide a framework to interrogate the
mechanisms of glial activation and secondary degeneration.
Commercial Relationships: Caitlin E. Mac Nair, None; Cassandra L.
Schlamp, None; Robert W. Nickells, None
Support: R01 EY012223, P30 EY016665, RPB
Program Number: 3872 Poster Board Number: A572
Presentation Time: 3:45 PM - 5:30 PM
Retinal miRNAs in Normal Aging and Glaucomatous Neurodegeneration
Caroline E. Haldin1, Philip J. Horner2, Shunbin Xu1. 1Ophthalmology/Neurological
Sciences, Rush University Medical Center, Chicago, IL; 2Institute for Stem Cell
and Regenerative Medicine, University of Washington, Seattle, WA.
Purpose: microRNAs (miRNAs) are small, non-coding RNAs, that regulate gene
expression through their target sites in the 3’ untranslated regions (UTRs) of
downstream mRNAs, causing mRNA degradation and/or reduction in translation.
Glaucoma is a progressive neurodegenerative eye disease due to dysfunction and
death of retinal ganglion cells (RGCs) and degeneration of optic nerve. To date,
miRNAs’ involvement in glaucoma has not been fully studied. This study aims to
examine the roles of miRNAs in the retina during the development of glaucoma
using a mouse model, the DBA/2J (D2) mouse, a surrogate animal model for
human glaucoma.
Methods: Total RNA was isolated from retinas of D2 mice at four- (pre-disease,
with IOPs near or below the colony average), eight- (after detectable signs of
glaucoma with elevated IOPs) and eleven months of age (after IOPs are elevated,
signs of glaucoma have fully developed) and their sibling control, D2-Gpnmb+
mice, using mirVana™ miRNA isolation kit (Ambion). Rodent Taqman lowdensity arrays v3.0 were used to profile 754 miRNAs on a 7900HT Fast Real-Time
PCR System. Expression profiles were acquired using RQ Manager software with
automatic baseline and RQ threshold set at 0.2. Statistical analysis was carried out
using DataAssist v2 (Applied Biosystems).
Results: 429-445 miRNAs were detected in the retina of D2 and control mice at all
ages. At four months old, only six miRNAs were differentially expressed (p<0.05),
two of which had more than 2-fold change, suggesting little miRNA-expression
changes at the pre-disease stage. At eight- and 11-months, increasing numbers of
miRNAs were differentially expressed in the retina, with 13 and 17 differentially
expressed at 8 and 11 months old (p<0.05), respectively. In addition, we identified
a series of miRNAs whose expression levels changed at different ages of control
and D2 mice. Currently, miRNA expression levels, localization, target sequence
and function are being confirmed.
Conclusions: miRNA expression in the retina changes during normal aging and
development of glaucoma. Further characterization of these differentially expressed
miRNAs may identify miRNAs involved in the pathogenesis of glaucomatous
neurodegeneration. Our ongoing study on miRNAs in optic nerve head (ONH) and
retinal ganglion cells (RGCs) isolated by laser-capture microdissection (LCM) will
further elucidate the roles in the development of glaucoma.
Commercial Relationships: Caroline E. Haldin, None; Philip J. Horner,
None; Shunbin Xu, None
Support: American Health Assistance Foundation and the Glaucoma Research
Foundation
Program Number: 3873 Poster Board Number: A573
Presentation Time: 3:45 PM - 5:30 PM
Follistatin and Activin A Expression in Normal and Glaucomatous Human
Trabecular Meshwork Cells and Tissues
Copyright 2012 by the Association for Research in Vision and Ophthalmology, Inc., all rights reserved. For permission to reproduce any abstract, contact the ARVO Office at pubs@arvo.org.
ARVO 2012 Annual Meeting Abstracts by Scientific Section/Group – Biochemistry/Molecular Biology (BI)
Ashley M. Fitzgerald1, Abbot F. Clark2, Robert J. Wordinger1. 1Cell Biology and
Anatomy, UNT-Health Science Center, Fort Worth, TX; 2Cell Biology &
Anatomy, University of North Texas HSC, Fort Worth, TX.
Purpose: Primary open angle glaucoma (POAG) is a blinding ocular disease
affecting 70 million people worldwide. A major risk factor for POAG is elevated
intraocular pressure resulting from increased resistance of aqueous humor outflow
through the trabecular meshwork (TM). We have previously reported that BMP-4
attenuates TGF-β2 induced extracellular matrix (ECM) deposition in TM cells, and
that gremlin, a BMP antagonist, blocks this inhibitory effect. Follistatin (FST) has
also been reported to inhibit BMPs as well as activins (Act). Three isoforms of FST
(288, 315, 303) have been described. FST and Act expression and function in
normal (NTM) and glaucomatous (GTM) TM cells and tissues are unknown. The
purpose of this study was to determine if: (a) FST isoforms and activin A are
differentially expressed in NTM vs. GTM cells and tissues, and (b) exogenous FST
or activin A regulate ECM protein production in TM cells.
Methods: QRT-PCR and RT-PCR were used to determine mRNA expression of
FST isoforms and Act A in TM cells (N=10). Immunohistochemistry (IHC) was
used to demonstrate FST isoforms and Act A in NTM (N=3) and GTM (N=3)
tissues. TM cells were cultured with FST or Act A, at previously reported
concentrations, for 6, 24, and 48 hrs. Western immunoblot analysis was used to
evaluate FST and Act A effects on ECM proteins fibronectin (FN), PAI-1, and
collagen1A.
Results: mRNA for FST isoforms was detected in TM cells, but with significantly
higher expression in GTM cells (p<0.05). Using IHC, a greater amount of FST was
also seen in GTM tissues compared to NTM tissues. Act A mRNA was detected in
TM cells and proteins were detect in TM tissues with significantly lower protein
expression in GTM tissues (p<0.05). Exogenous FST and activin A increased FN,
and PAI-1 expression in a dose-dependent manner.
Conclusions: This is the first report in differences of FST and Act A mRNA and
protein expression in NTM vs. GTM cells and tissues. GTM cells and tissues had
significantly higher expression of FST while NTM tissues had significantly lower
expression of Act A. This is also the first documentation of FST and Act A
function in TM cells. Both exogenous FST and Act A increased ECM proteins in
TM cells. These results further our knowledge of the potential role of BMP
antagonists in the human TM and their potential pathogenic roles in the
pathogenesis of glaucoma.
Commercial Relationships: Ashley M. Fitzgerald, None; Abbot F. Clark,
None; Robert J. Wordinger, None
Support: NIH Grant
Program Number: 3874 Poster Board Number: A574
Presentation Time: 3:45 PM - 5:30 PM
Interaction Between ATOH7 And RFTN1 In Association With Adult-onset
Primary Open Angle Glaucoma In Southern Chinese
Mingzhi Zhang1, Jian-Huan Chen1,2, Degui Wang1, Yuqian Zheng1, Chi-Pui Pang2.
1
Ophthalmology, Joint Shantou International Eye Center, Shantou, China;
2
Department of Ophthalmology & Visual Sciences, The Chinese University of
Hong Kong, Hong Kong, China.
Purpose: Recently genome-wide association studies have shown association of the
atonal homolog 7 (ATOH7) and raftlin lipid raft linker 1 (RFTN1) genes with
glaucoma-related optic disc parameters. We investigated ATOH7 and RFTN1
sequence variations in patients with primary open angle glaucoma (POAG) and
their relationships with vertical cup-to-disc ratio (VCDR) and central corneal
thickness (CCT).
Methods: In 289 unrelated controls and 142 unrelated adult-onset POAG, the
single exon of ATOH7 was sequenced by direct sequencing after PCR. Additional
single nucleotide polymorphisms (SNP) at upstream ATOH7 (rs1900004 and
rs3858145) and a RFTN1 SNP (rs690037) were genotyped by Taqman assays.
Quantitative trait and disease associations were analyzed by linear and logistic
regression respectively, controlling gender and age.
Results: ATOH7 rs61854782 was associated with VCDR (P = 0.004) in controls
and RFTN1 rs690037 was associated with CCT in POAG (P = 0.026). No coding
mutation in ATOH7 was detected in POAG. None of the SNP investigated was
associated with POAG (P-values between 0.441 and 0.996). However, SNP
rs3858145 in ATOH7 showed significant interaction with RFTN1 rs690037 in
POAG (P = 0.013). ATOH7 rs3858145 GG combined with RFTN1 rs690037 TT
conferred risk to glaucoma in POAG (odds ratio = 2.69).
Conclusions: Coding mutations of ATOH7 are unlikely to be involved in adultonset POAG. But combination of ATOH7 and RFTN1 SNPs increased risk to
POAG, indicating their diversified effects in the complex genetics of glaucoma.
Commercial Relationships: Mingzhi Zhang, None; Jian-Huan Chen,
None; Degui Wang, None; Yuqian Zheng, None; Chi-Pui Pang, None
Support: research grants from National Natural Science Foundation of China (No.
81000397) and Natural Science Foundation of Guangdong Province, China (No.
8151503102000019)
Program Number: 3875 Poster Board Number: A575
Presentation Time: 3:45 PM - 5:30 PM
Evaluation Of Oxidative DNA Damage And Its Repair In Pathogenesis Of
Primary Open-angle Glaucoma
Ireneusz Majsterek1, Magdalena Cuchra1, Karolina Przybylowska1, Mira Gacek2,
Anna Kaminska2, Jerzy Szaflik2, Jacek P. Szaflik2. 1Clinical Chemistry and
Biochemistry, Medical University of Lodz, Lodz, Poland; 2Ophtlamology and Eye
Clinic, Medical University of Warsaw, Warsaw, Poland.
Purpose: Glaucoma is a heterogeneous group of ocular disorder, which is
characterized by progressive degeneration of optic nerve axon. Oxidative stress
may play important role in glaucoma development, what suggests an important role
of base excision repair (BER) pathway responsible for removing of oxidative DNA
lesions. The aim of study was to evaluate the level of oxidative DNA lesions and its
repair in peripheral lymphocytes of glaucoma patients.
Methods: The study was performed on group of 10 patients with primary openangle glaucoma (POAG) and 10 healthy subjects. An alkaline comet assay was
used to measure DNA damage of oxidized purines as glicosyloformamidoglicosylase (Fpg) sites, and oxidized pirmidines as endonuclease III
(Nth) sites. We measured endogenous as well as exogenous DNA damage after 10
µM hydrogen peroxide treatment (H2O2). The efficiency of DNA repair was
measured within 120 min of post treatment incubation with hydrogen peroxide.
Results: Endogenous level of oxidative DNA damage in POAG patients was found
to be statistically higher than the controls (P<0.001). Moreover, lymphocytes
isolated from POAG patients with were more susceptible for oxidative DNA
lesions induced by hydrogen peroxide than control subjects (P<0.001). Finally, we
found an impaired repair of oxidative DNA lesions in POAG patients as compared
to healthy controls (P<0.05).
Conclusions: In conclusion our data revealed that oxidative stress might play an
important role in POAG development and an impaired BER repair may be critical
factor in glaucoma pathogenesis. Therefore, we suggested that the modulation of a
pro-oxidant/antioxidant status might be a relevant target for prevention and therapy
of glaucoma patients.
This work was supported by grants N N402 375838 and N N402 248936 from
Polish Ministry of Science and Higher Education.
Commercial Relationships: Ireneusz Majsterek, None; Magdalena Cuchra,
None; Karolina Przybylowska, None; Mira Gacek, None; Anna Kaminska,
None; Jerzy Szaflik, None; Jacek P. Szaflik, None
Support: This work was supported by grants N N402 375838 and N N402 248936
from Polish Ministry of Science and Higher Education.
Program Number: 3876 Poster Board Number: A576
Presentation Time: 3:45 PM - 5:30 PM
Myelination Transition Zone Astrocytes Manifest Lipid-processing Related
Changes In Glaucoma
Nicholas Marsh-Armstrong1, Judy V. Nguyen1, Chung-ha O. Davis1, Pooja
Karukonda1, Eric Bushong2, Keun-Young Kim2, Mark Ellisman2. 1Neuroscience
and Ophthalmology, Johns Hopkins Univ Sch of Med, Baltimore, MD;
2
Neuroscience, University of San Diego, National Center for Microscopy and
Imaging Research, San Diego, CA.
Purpose: We have previously shown that optic nerve head (ONH) astrocytes,
including those at the myelination transition zone (MTZ), phagocytose axonal
material even in normal healthy mice. In glaucoma animal models, the MTZ
astrocytes increase expression of Mac-2, a marker associated with phagocytosis. In
order to determine whether axonal phagocytosis by astrocytes is altered in
glaucoma, we have analyzed molecular and structural evidence at the MTZ in the
DBA/2J mouse glaucoma model.
Methods: Longitudinal sections of ONHs from Gpnmb+ DBA/2J (control) mice
and DBA/2J mice were analyzed with molecular markers associated with lipid
processing (Adipose Differentiation Related Protein (Adrp) and Apolipoprotein-D
(ApoD) mRNA) and an antibody that recognizes MBP in degenerating myelin, as
well as the previously reported Mac-2 protein, using imaging multiplesegmentation based quantification methods. The ONH of Gpnmb+ DBA/2J mice
and DBA/2J mice with mild or severe axonal degeneration were also analyzed by
block-face scanning electron microscopy (BFSEM).
Results: In 9-10 month-old (m) animals, the labeling for degenerating MBP and
ApoD, as well as Mac-2, peaked at the MTZ in the non-diseased Gpnmb+ DBA/2J
mice and all three were upregulated in DBA/2J mice (p<0.005, p<0.006 and
p<0.009, respectively). Surprisingly, both normal and upregulated ApoD mRNA
was found nearly exclusively within oligodendrocytes. Adrp expression was shown
to normally peak at the MTZ, but then to be upregulated (p<0.05) in a pattern that
did not match the upregulation patterns of Mac-2 or the microglia marker Iba-1.
BFSEM showed that MTZ normally internalize segments of myelin, and that in
DBA/2J mice contain lipid droplets early and heterogenous debris late in the
degeneration.
Conclusions: The oligodendrocytes at the MTZ of normal mice express markers
that both distinguish them from other oligodendrocytes and which are increased in
animal models of glaucoma. This supports the view that the MTZ constantly
experiences milder forms of the insult or insults that blind in glaucoma. MTZ
astrocytes internalize and degrade myelin, and have lipid droplet accumulations
early in the disease. This suggests that the normal phagocytosis of myelin by
astrocytes at the MTZ may become dysfunctional early in glaucoma.
Copyright 2012 by the Association for Research in Vision and Ophthalmology, Inc., all rights reserved. For permission to reproduce any abstract, contact the ARVO Office at pubs@arvo.org.
ARVO 2012 Annual Meeting Abstracts by Scientific Section/Group – Biochemistry/Molecular Biology (BI)
Commercial Relationships: Nicholas Marsh-Armstrong, None; Judy V.
Nguyen, None; Chung-ha O. Davis, None; Pooja Karukonda, None; Eric
Bushong, None; Keun-Young Kim, None; Mark Ellisman, None
Support: Glaucoma Research Foundation and EY019960-01A1
403 Phototransduction Proteins and Signalling
Wednesday, May 9, 2012, 8:30 AM - 10:15 AM
Room 114 Paper Session
Program #/Board # Range: 4130-4136
Organizing Section: Biochemistry/Molecular Biology
Program Number: 4130
Presentation Time: 8:30 AM - 8:45 AM
Interplay Between Steric Volume Exclusion and Posttranslational Lipidation
in Setting Protein Concentrations in Photoreceptor Sensory Cilia
Mehdi Najafi1A, Nycole A. Maza1B, Peter D. Calvert1C. AOphthalmology, Biochem
& Mol Biol, BOphthalmology, COphthalmology, Biochem & Mol Biol , Neurosci &
Physiol, SUNY Eye Inst., 1SUNY Upstate Medical University, Syracuse, NY.
Purpose: We previously demonstrated that the proportions of soluble molecules
found in the ciliary rod outer segment (OS), relative to the inner segment (IS), were
steeply dependent on molecular size and the geometry of cytoplasmic spaces due to
steric volume exclusion (SVE)1. Since it is widely believed that the majority of
(OS) proteins involved in light signaling are targeted to and confined there by
addition of lipid moieties, we systematically evaluated how posttranslational
modifications and SVE act together to set the distributions of proteins in rods.
Methods: Concatamers of EGFP (1x-, 2x- and 3xEGFP), without and with lipid
modifications, including single myristoyl (Myr), farnesyl (Far) or geranylgeranyl
(GerGer), double geranylgeranyl (EGFP-(GerGer)2) or myristoyl and farnesyl
(Myr-EGFP-Far), were expressed in Xenopus laevis rods. Protein distributions in
live retinal slices were determined from 3D confocal scans. To study protein
mobility, PAGFP variants of the probes were locally multiphoton-photoactivated
and their movements subsequently monitored by confocal imaging.
Results: Single-lipidated EGFPs are present in the OS at as much as 40% greater
abundance compared to 1xEGFP. The distribution of Myr-EGFP-Far was similar to
the distribution of single-lipidated EGFPs whereas EGFP-(GerGer)2 was
predominantly localized to the OS. Mobility studies show that single-lipidated
PAGFPs and Myr-PAGFP-Far were able to dissociate from membranes and travel
between compartments whereas PAGFP-(GerGer)2 was tightly membrane-bound,
never dissociating from membranes over the course of hours.
Conclusions: Addition of lipid moieties to GFPs variably overcame SVE, resulting
in increased OS abundance. Tight membrane binding via addition of (GerGer)2 can
confine proteins to the OS, but addition of single lipid moieties that are common to
any phototransduction proteins, including transducin, rhodopsin kinase and PDE6,
are not sufficient to do so. Finally, we propose a novel mechanism for lightdependent translocation of transducin to the IS whereby transducin subunits
associate with partners that act to increase their solubility as well as their effective
size, thus driving transport to the IS via SVE.
1
Najafi et al., Proc. Natl. Acad. Sci., in press.
Commercial Relationships: Mehdi Najafi, None; Nycole A. Maza, None; Peter
D. Calvert, None
Support: NIH Grant EY018421, Research to Prevent Blindness
Program Number: 4131
Presentation Time: 8:45 AM - 9:00 AM
Central 139-loop Enhances Stability And Selectivity For P-rh* Of Arrestin-1
Sergey A. Vishnivetskiy1A, Miyeon Kim2, Ned Van Eps2, Maria C. Palazzo1, Britney
N. Lizama1, Wayne L. Hubbell2, Vsevolod V. Gurevich1A. APharmacology,
1
Vanderbilt University, Nashville, TN; 2UCLA, Los Angeles, CA.
Purpose: To determine the function of 139 loop in arrestin-1.
Methods: Site-directed spin labeling and distance measurements by Double
Electron-Electron Resonance (DEER) were used to monitor the movement of 139loop upon arrestin-1 binding to light-activated phosphorhodopsin (P-Rh*). Direct
binding assay with 139-loop deletion mutants was used to determine its role in
arrestin-1 selectivity and stability.
Results: The central crest on the rhodopsin-binding side of arrestin-1 contains two
loops: the finger loop, involved in P-Rh* binding, and 139-loop. The mobility of
the spin label in position 139 is reduced upon arrestin-1 pre-docking to dark P-Rh,
but reverts to the initial high level upon rhodopsin activation to P-Rh*, suggesting
that it moves away from the receptor in high-affinity complex. DEER distance
measurements between the spin label at 139 and in eight different positions in Nand C-domain show that upon P-Rh* binding 139-loop moves by >10Å towards the
N-domain and to the side of the molecule. This shift removes 139-loop from the
receptor-binding interface, yet 139-loop is conserved in all arrestins, suggesting
that it plays an important biological role. We introduced four deletions of 139-loop
of variable length, and found that two of these reduced arrestin-1 selectivity for PRh* by increasing binding to dark P-Rh and Rh*. The same two deletions
dramatically decreased arrestin-1 stability, whereas the other two reduced
selectivity and stability only modestly. Homologous deletions in bovine and mouse
arrestin-1 yielded virtually identical effects on selectivity and stability. Thus, 139-
loop deletion mutants follow the same pattern as previously described pre-activated
forms of arrestin-1: protein stability inversely correlates with its ability to bind dark
P-Rh and Rh*.
Conclusions: In arrestin-1, 139-loop has two related functions: 1) it stabilizes the
basal conformation; 2) it serves as a brake, minimizing binding to non-preferred
forms of rhodopsin, thereby ensuring its specificity for P-Rh*.
Commercial Relationships: Sergey A. Vishnivetskiy, None; Miyeon Kim,
None; Ned Van Eps, None; Maria C. Palazzo, None; Britney N. Lizama,
None; Wayne L. Hubbell, None; Vsevolod V. Gurevich, None
Support: NIH grants EY011500, GM077561, GM081756 (VVG), EY05216
(WLH).
Program Number: 4132
Presentation Time: 9:00 AM - 9:15 AM
NMR Study of Arrestin-1 Binding to Rhodopsin
Qiuyan Chen, Tiandi Zhuang, Sergey A. Vishnivetskiy, Min-Kyu Cho, Tarjani M.
Thaker, Tina M. Iverson, Vsevolod V. Gurevich, Charles R. Sanders.
Pharmacology, Vanderbilt University, Nashville, TN.
Purpose: The arrestin-receptor interaction is a complex multi-step process.
Arrestins undergo global conformational changes upon binding to their cognate
receptors, but the conformation of active, receptor-bound arrestins remains
unknown. We identified arrestin-1 elements engaged by different functional forms
of rhodopsin and the conformational changes induced by receptor binding.
Methods: We used solution nuclear magnetic resonance (NMR) spectroscopy of
15N-labeled arrestin-1, free and in the presence of light activated (Rh*),
phosphorylated light activated rhodopsin (P-Rh*), and phospho-opsin (P-Ops) in
bicelles.
Results: Solution NMR was used to assign ~40% of arrestin-1 backbone
resonances. Native rhodopsin-containing disc membranes are too large for NMR,
whereas detergents that solubilize rhodopsin denature arrestin-1. Bicelles, where
bilayered lipid discs are edge-stabilized by detergent, provide a native membranelike environment for rhodopsin and preserve arrestin-1 structure and function, as
judged by near-UV circular dichroism spectra and arrestin binding to P-Rh*, Rh*,
and P-Ops. We reconstituted different functional forms of rhodopsin into the
bicelles and collected the spectra of arrestin-1 bound to Rh*, P-Rh*, and P-Ops. To
identify changes in binding-induced chemical shifts, NMR spectra of free arrestin-1
were compared with the spectra collected in the presence of increasing amounts of
Rh*, P-Rh*, and P-Ops. To make the arrestin-1-P-Rh* complex amenable to NMR
analysis, its affinity was reduced using elevated NaCl. Arrestin elements engaged
by Rh*, P-Rh*, and P-Ops were identified. The results suggest that distinct
arrestin-1 residues are engaged by Rh* and P-Rh*. The data demonstrate that
arrestin-1 binds P-Ops and P-Rh* similarly, which is consistent with the crystal
structure of opsin resembling the activated form of rhodopsin.
Conclusions: Rh*, P-Rh*, and P-Ops engage multiple arrestin-1 residues and
induce distinct conformational rearrangements in the arrestin-1 molecule. Bicelles
provide a viable alternative to HDL nanoparticles for biophysical studies of arrestin
interactions with G protein-coupled receptors.
NIH grants EY011500, GM077561, GM081756 (VVG), GM080513 (CRS),
EY018435, GM095633 (TMI).
Commercial Relationships: Qiuyan Chen, None; Tiandi Zhuang, None; Sergey
A. Vishnivetskiy, None; Min-Kyu Cho, None; Tarjani M. Thaker, None; Tina
M. Iverson, None; Vsevolod V. Gurevich, None; Charles R. Sanders, None
Support: EY011500, GM077561, GM081756, GM080513, EY018435,
GM095633
Program Number: 4133
Presentation Time: 9:15 AM - 9:30 AM
CNG-modulin, The Cone Specific Modulator Of CNG Channel Activity, Is
Required For The Recovery Of Flash Sensitivity Under Continuing
Illumination Characteristic Of Cone Photoreceptors
Tatiana I. Rebrik1, Milap Mehta1, Nomingerel Tserentsoodol1, James B. Hurley2,
Juan I. Korenbrot3. 1Ophthalmology, Duke University Eye Center, Durham, NC;
2
Biochemistry, University of Washington, Seattle, WA; 3Physiology Department,
Univ California - San Francisco, Tiburon, CA.
Purpose: The ligand sensitivity of cGMP-gated ion channels in cone
photoreceptors changes as a function of Ca2+ and this effect is mediated by CNGmodulin, a newly discovered Ca2+ binding protein expressed in cones, but not rods.
Sensitivity modulation renders channel activity dependent on both cGMP and Ca2+
and helps control the light-sensitivity, time course and stability of the
photoresponse. Suppression of CNG-modulin expression in zebrafish (ZF) cones is
used to test one specific function possibly associated with CNG-modulin: the slow
recovery of sensitivity in the continuing presence of steady light.
Methods: A morpholino antisense oligonucleotide complementary to the amino
terminus of ZF CNG-modulin was injected into ZF embryos. 5-6 days later the
expression of CNG-modulin in cones was assayed with immunohistochemistry and
the cone electrical photoresponse was measured from the a-wave of ergs recorded
in intact larvae incubated in APB (2-amino-4-phosphonobutyric acid), a wellestablished blocker of non-photoreceptor erg components.
Results: 5-6 days post fertilization the retina of wild type ZF larva have mature,
Copyright 2012 by the Association for Research in Vision and Ophthalmology, Inc., all rights reserved. For permission to reproduce any abstract, contact the ARVO Office at pubs@arvo.org.
ARVO 2012 Annual Meeting Abstracts by Scientific Section/Group – Biochemistry/Molecular Biology (BI)
normally functioning cone photoreceptors, but not rods. The isolated erg a-wave in
the wild type larva shows that under continuous illumination, the cone
photoresponse to test flashes superimposed on light steps is initially small, but
recovers in amplitude with an exponential time course of 2-3 sec time constant.
Anti CNG-modulin morpholino-injected larva, in contrast, responds to the same
test flashes with the same initial small response, but the response amplitude does
not recover in amplitude at all over the following 15 sec. Immunohistochemistry
demonstrates that CNG-modulin is expressed in the cones of wild type larvae, but
not in those of morpholino-injected ones.
Conclusions: Slow sensitivity recovery in the continuous presence of light
characteristic of normal cones does not occur in cones in which the expression of
CNG-modulin is suppressed by gene knock-down. This indicates that sensitivity
recovery depends on the Ca2+-dependent modulation of CNG ion channel activity
mediated by CNG-modulin.
Commercial Relationships: Tatiana I. Rebrik, None; Milap Mehta,
None; Nomingerel Tserentsoodol, None; James B. Hurley, None; Juan I.
Korenbrot, None
Support: NIH Grant EY020654, NIH Core Grant P30 EY-005722 , NIH Core
Grant P30 EY1730
Program Number: 4134
Presentation Time: 9:30 AM - 9:45 AM
Single Photonresponse In The Fly Photoreceptor
David Holcman1, GRegoire Lejay1, Juergen Reingruber1, Baruch Minke2. 1Biology
and Mathematics, Ecole Normale Superieure, Paris, France; 2Physiology, Hebrew
University, Jerusalem, France.
Purpose: We analyze the photonresponse in the fly photoreceptor using a
computational model of biochemical reactions starting with the activation of the
opsin. Since the direct messenger to the TRP is still not identified, we proposed
here some binding rules at the TRP channel leading to a normal photoresponse. We
estimated the mean and variance of the number of DAG, TRP channels open during
the response.
Methods: Biophysical Modeling and Stochastic Simulations and comparison with
electrophysiological data.
Results: The fly photonresponse requires the activation of few TRP channels
located on each microvilli. To estimate the number of open TRPs, we use Brownian
simulations of each molecule involved in the cascade of chemical reactions from
the opsin to the TRP channels.
We developed a simulation tool using the spatial structure of the microvilli. This
simulation allows us to compute the time course of the photonresponse, the number
of DAG molecules produced and the number of open TRP channels. We identified
the rules for the number of bound DAG and calcium ions involved directly in the
opening of the TRP-complex.
Our analysis can reproduce recent electrophysiological data obtained in
collaboration with the group of B. Minke, leading to a bistability behavior. Indeed
under the molecular rules we identified, our modeling agrees with and can
reproduce the phenomenological observation that as the outer calcium influx
decreases, the photonresponse increases, while the spontaneous bump decreases.
Conclusions: Our results suggest that at least 2 DAG molecules should bind to a
TRP channel complex in order for our model to account for the photoreceptor
bistability, generated by changing the external calcium concentration.
Commercial Relationships: David Holcman, None; GRegoire Lejay,
None; Juergen Reingruber, None; Baruch Minke, None
Support: None
Program Number: 4135
Presentation Time: 9:45 AM - 10:00 AM
The Contribution Of Calcium Feedback Regulation To Stability And
Reproducibility Of Single Photon Responses
Owen P. Gross, Edward N. Pugh, Jr., Marie E. Burns. Neuroscience, University of
California, Davis, Davis, CA.
Purpose: Rod photoreceptors generate highly amplified single-photon responses
(SPRs) using G-protein signaling that is under strict temporal regulation through
tightly determined lifetimes of photoactivated rhodopsin (R*) and the G-proteinPDE complex (G*-E*). Paradoxically, genetic perturbations that dramatically alter
these lifetimes have little effect on the amplitudes of SPRs. Our purpose was to
investigate how this amplitude stability across genotypes arises, and to test whether
the mechanisms governing amplitude stability also contribute to the reproducibility
of single photon responses from trial to trial in normal rods.
Methods: Mice with faster or slower rates of R* and G*-E* deactivation were
crossed into a line lacking calcium feedback regulation of cGMP synthesis
(GCAPs-/-), and the photoresponses of rods were measured with suction electrodes.
SPRs were extracted from variance-to-mean analysis or by constructing histograms
of quantal amplitudes from ensembles of responses to extremely dim flashes.
Results: When calcium feedback mechanisms were abolished, rods with slowed R*
and G*-E* deactivation kinetics showed much larger increases in peak amplitudes
than when calcium feedback was operating normally. Ensembles of SPRs from
rods with and without feedback reveal that the consequences of trial-to-trial
fluctuations in R* lifetime in normal rods are likewise dampened by feedback
regulation of cGMP synthesis.
Conclusions: Calcium feedback trumps the intricate mechanisms of R* and G*-E*
deactivation at the SPR peak, preserving the time-to-peak and attenuating responses
arising from longer active lifetimes to a greater extent than those arising from
shorter ones. As a result, SPRs are of similar amplitude, a feature critical for
reliable transmission through the visual system.
Commercial Relationships: Owen P. Gross, None; Edward N. Pugh, Jr.,
None; Marie E. Burns, None
Support: NIH Grants R01-EY014047, T32 - EY15387
Program Number: 4136
Presentation Time: 10:00 AM - 10:15 AM
Rhodopsin Photolysis in Mouse Disk Membranes After Targeted Deletion of
Transducin βγ-Complex
Oleg G. Kisselev1, Elena Lomonosova1, Alexander V. Kolesnikov2, Vladimir J.
Kefalov3. 1Ophthalmology, Saint Louis University Eye Institute, St Louis, MO;
2
Ophthalmology, Washington University, St Louis, MO; 3Ophthalmology & Visual
Sciences, Washington University School of Medicine, Saint Louis, MO.
Purpose: The focus of the present study is to characterize the possible role of
transducin (Gt) βγ-complex in modulating the signaling properties of
photoactivated rhodopsin and its lifetime in rod disk membranes and intact rods
using Gtγ-deficient mice.
Methods: We studied rhodopsin photolysis using UV-Visible spectroscopy and
rapid scanning spectroscopy in the presence of hydroxylamine in highly purified
wild type and Gtγ-deficient mouse rod disk membranes. Complex formation
between photoactivated rhodopsin and transducin was measured by spectroscopic
assay of extra-Metarhodopsin II formation at 5% rhodopsin bleach levels. Recovery
of dark current and flash sensitivity following a moderate 12% rhodopsin bleach in
individual intact wild type and Gtγ-deficient mouse rods was measured by singlecell suction recordings.
Results: Photoconversion of rhodopsin to Meta I/Meta II equilibrium proceeds
normally after the elimination of transducin βγ-complex in mouse rod disk
membranes. The Meta I/Meta II ratio, the rate of Meta II decay, the reactivity of
Meta II toward hydroxylamine, and the rate of Meta III formation in Gtγ-deficient
rod disk membranes were identical to those observed in wild type samples. The
lack of Gtβγ did not affect the stability of dark-state rhodopsin in the presence of
hydroxylamine. Under low intensity illumination, the amount of extra-Meta II in
Gtγ-deficient discs was significantly reduced. The initial rate of dark current
recovery following 12% rhodopsin bleach was 3 times faster in Gtγ-deficient rods,
while the rate of the late current recovery was largely unchanged. Mutant rods also
exhibited faster postbleach recovery of their flash sensitivity.
Conclusions: Photoactivation and thermal decay of rhodopsin proceed similarly in
wild type and Gtγ-deficient mouse rods, but the complex formation between
photoactivated rhodopsin and transducin is severely compromised in the absence of
Gtβγ. The resulting lower transduction activation contributes to faster
photoresponse recovery following a moderate pigment bleach in Gtγ-deficient rods.
Commercial Relationships: Oleg G. Kisselev, None; Elena Lomonosova,
None; Alexander V. Kolesnikov, None; Vladimir J. Kefalov, None
Support: NIH grants RO1GM63203, R21EY018107 (OGK), EY019312 and
EY02112601 (VJK).
464 Apoptosis and Gene Expression and Alterations
Wednesday, May 9, 2012, 1:45 PM - 3:30 PM
Hall B/C Poster Session
Program #/Board # Range: 5118-5141/D1088-D1111
Organizing Section: Biochemistry/Molecular Biology
Program Number: 5118 Poster Board Number: D1088
Presentation Time: 1:45 PM - 3:30 PM
Enhancement Of P53-dependent Pro-Apoptotic Response By Perp In Uveal
Melanoma Cells
Luminita I. Paraoan1, David Spiller2, Michael R. White2, Ian Grierson1, Lyndsay
Davies1. 1Eye and Vision Science, University of Liverpool, Liverpool, United
Kingdom; 2Faculty of Life Sciences, University of Manchester, Manchester, United
Kingdom.
Purpose: We have previously shown that PERP (p53 apoptosis effector related to
PMP-22) protein levels influence the protein levels of its own transcriptional
regulator p53 in uveal melanoma. Additionally, PERP expression causes nuclear
localization of p53 that is critical for its transcriptional function. The purpose of
this study was to investigate the functional status of the elevated p53 following
PERP expression and to identify the potential pro-apoptotic genes activated.
Methods: Fluorescent fusion constructs of PERP fused to green fluorescent protein
under a CMV promoter (GFP-PERP), and of MDM2 fused to yellow fluorescent
protein under its human native promoter (MDM2-YFP) were used to transfect the
human uveal melanoma cell line MEL202. The subcellular localization of PERP
and MDM2 fluorescent fusion proteins in transfected cells was analysed by
confocal microscopy and the expression level of MDM2 was analysed using
ImageJ. Western blotting assessed the phosphorylation status of p53. Expression of
p53-target genes in response to elevated PERP was evaluated by real-time
Copyright 2012 by the Association for Research in Vision and Ophthalmology, Inc., all rights reserved. For permission to reproduce any abstract, contact the ARVO Office at pubs@arvo.org.
ARVO 2012 Annual Meeting Abstracts by Scientific Section/Group – Biochemistry/Molecular Biology (BI)
quantitative PCR. Pifithrin-α was used to inhibit p53-dependent gene transcription.
Results: The expression of MDM2-YFP was significantly higher in cells coexpressing GFP-PERP, and it was significantly reduced by pifithrin-α treatment.
Phosphorylation of p53 at Ser20 and Ser46 was significantly increased in cells
expressing elevated PERP protein. The p53 pro-apoptotic target genes DR4 and
LRDD were significantly upregulated in response to PERP expression, but levels of
the cell cycle arrest-related protein p21 remained unchanged.
Conclusions: Elevated PERP protein levels increase levels of transcriptionally
active p53. Phosphorylation of p53 serine residues that interfere with the
interaction between p53 and its negative regulator MDM2 and enhance specific
pro-apoptotic gene transcription (DR4, LRDD) also occurs subsequent to PERP
expression. Together, these results implicate a role for PERP in amplifying
functional p53 levels that promote p53-dependent apoptosis, and reveal a potential
target for exploitation in enhancing p53 activity.
Commercial Relationships: Luminita I. Paraoan, None; David Spiller,
None; Michael R. White, None; Ian Grierson, None; Lyndsay Davies, None
Support: The Humane Research Trust, UK.
Program Number: 5119 Poster Board Number: D1089
Presentation Time: 1:45 PM - 3:30 PM
Protection Of Axotomised Retinal Ganglion Cells From Apoptosis By
Pharmacological Inhibition Of Caspase-2
Vasanthy Vigneswara, Martin Berry, Ann Logan, Zubair Ahmed. Clinical and
Experimental medicine, University of Birmingham, Birmingham, United Kingdom.
Purpose: Injury to the optic nerve (ON) triggers progressive death of retinal
ganglion cells (RGC), the severity of which is dependent upon the type of lesion
and its distance from the eye. Recently, we showed after ON transection, exclusive
activation of caspase-2 in RGC and neuroprotection of RGC using a stablymodified siRNA to inhibit caspase-2 for at least 7 days after injury. Here we
investigated whether the cell permeable pharmacological inhibitor of caspase-2 (ZVDVAD-FMK), confers RGC protection 15 days after ON crush.
Methods: The ON of anesthetised adult female Sprague-Dawley rats were crushed
2 mm from the orbit, and either 400 or 4000ng/ml of caspase-2 inhibitor ((ZVDVAD-FMK, R&D Systems, CA) or PBS (for control group) was administered
intravitreally at 0, 4, 7 and 10 days post-ON crush. FluroGold was injected into the
proximal ON segment on day 13 and two days later retinae were either immersionfixed in formaldehyde, flat-mounted and the number of FluroGold-labelled RGC
was counted or snap frozen for western blotting. Animals were also intracardially
perfused and eyes and ON were prepared for immunohistochemistry to detect
cleaved caspase-2, βIII-tubulin and GAP43.
Results: Intravitreal injections of 400ng/ml Z-VDVAD-FMK promoted 2-fold
more RGC survival whilst 4000ng/ml promoted 6-fold more RGC survival and
protected 60% of the total number of RGC compared to intact PBS controls at 15
days. Immunohistochemistry and western blotting demonstrated that Z-VDVADFMK treatment suppressed levels of cleaved caspase-2 in RGC while western
blotting also confirmed no significant differences in the levels of cleaved caspase-3,
-6, -7 nor -8 when compared to their controls. In Z-VDVAD-FMK treated optic
nerves, only a few GAP43+ axons were seen beyond the crush site, indicating the
regeneration of small number of injured axons.
Conclusions: Caspase-2 plays a critical role in RGC apoptosis and
pharmacological suppression of caspase-2 is a promising therapy for RGC
protection in conditions where RGC apotosis occurs, such as glaucoma. However,
since suppression of caspase-2 does not promote significant levels of RGC axon
regeneration, a combinatorial approach will be required to both promote RGC
survival and axon regeneration.
Commercial Relationships: Vasanthy Vigneswara, None; Martin Berry,
None; Ann Logan, None; Zubair Ahmed, None
Support: Welcome Trust Fund
Program Number: 5120 Poster Board Number: D1090
Presentation Time: 1:45 PM - 3:30 PM
Human Lens Epithelium in Cataract: Expression of Bcl-2, BAX and Caspase-3
in Fresh and Cultured Epithelium
Oyvind Ringen1, Aboulghassem Shahdadfar1, Kristine Ustgård-Andersen1, Bjorn
Otto Nicolaissen2, Charlotta Zetterstrom1, Ole Morten Halvorsen3A, Magnus
Roger3B, Kahsai Beraki3B, Morten C. Moe1, Bjorn Nicolaissen1. 1Center for Eye
Research/Dept. of Ophthalmology, University of Oslo/Oslo University hospital,
Oslo, Norway; 2Center for Eye Research, University of Oslo, Oslo, Norway; ADept.
of Ophthalmology, BDept. of Pathology, 3Oslo University hospital, Oslo, Norway.
Purpose: Irreversible cellular stress induced by UV-irradiation and oxidative
damage, and initiation of apoptosis, are pathogenetic factors in the development of
age related human cataract. In the present study we examine freshly removed
human lens epithelium for changes in expression of Bcl-2, Bax and Caspase-3
induced by transfer to a cell culture system.
Methods: Through a clear corneal incision viscoelastic material was introduced
and the anterior capsule obtained. The samples were either fixed in 4% formalin
(n=6) and processed for immunohistochemical detection of Bcl-2, Bax and
Caspase-3, or processed for RT-PCR for evaluation of expression of the Bcl-2, Bax
and Caspase-3 genes (n=6). Other samples were immersed in Dulbecco’s Modified
Eagle Medium / F12 (DMEM/F12) with 15% foetal bovine serum (FBS) and 100
U/l Penicillin-Streptomycin (n=12) for culturing in an incubator in a humid
atmosphere at 37°C in 5% CO2 prior to the analytical procedures.
Results: Transfer of the lens epithelium to cell culture induced a significant upregulation of Bcl-2 and Bax in the epithelium. Expression of Bcl-2 increased 10
fold, while there was a 15 fold increase in expression of Bax. However, in both
fresh and cultured epithelium the Bcl-2/Bax ratio was approximately 1. There was
virtually no change in the expression of Caspase-3 in the cultured epithelium.
Conclusions: We here demonstrate that transfer of cataractous human lens
epithelium to a cell culture system induce a significant up-regulation of Bcl-2 and
Bax gene expression. However, cell culture did not induce any significant shift in
the Bcl-2/Bax ratio. The transfer to a cell culture system does therefore not increase
the apoptotic suceptibility mediated by a relative increase in expression of Bax.
An equilibrium between anti- and pro-apoptotic signals is further indicated by the
similar expression of Caspase-3 in both fresh and cultured epithelium.
Our results support the usefulness of ex vivo systems in assays aimed at exploring
mechanisms related to lens epithelial cell- and molecular damage and repair.
Commercial Relationships: Oyvind Ringen, None; Aboulghassem Shahdadfar,
None; Kristine Ustgård-Andersen, None; Bjorn Otto Nicolaissen,
None; Charlotta Zetterstrom, None; Ole Morten Halvorsen, None; Magnus
Roger, None; Kahsai Beraki, None; Morten C. Moe, None; Bjorn Nicolaissen,
None
Support: None
Program Number: 5121 Poster Board Number: D1091
Presentation Time: 1:45 PM - 3:30 PM
Epigenetic Regulation of Corneal Endothelial Cell Proliferation
Peter W. Chen1, Lauren Tien2, Jessamee Mellon1. 1Ophthalmology, Univ Texas
Southwestern Med Center, Dallas, TX; 2Ophthalmology, The University of Texas
at Austin, Austin, TX.
Purpose: To determine if endothelial cell growth arrest is epigenetically regulated,
and whether manipulation of epigenetic regulatory mechanisms can promote
corneal endothelial cell proliferation.
Methods: Corneal endothelial sheets were harvested from BALB/c or C57BL/6
mice and either cultured in Shem’s Medium containing 10% FBS and immortalized
with human papilloma virus E6/E7 genes or used after fresh isolation. Corneal
endothelial cells treated with TGFβ for 24 hours, and harvested for RNA isolation.
Real time PCR using gene-specific primers was used to quantitate expression of de
novo methyltransferase genes. DNA and histone methylation was quantitated by
fluorometric ELISA-based kits according to manufacturer’s instructions. Corneal
endothelial cells were treated with the demethylating agents 5-Aza 2-deoxycytidine
or Vorinostat for 24 hours, allowed to recover for 48 hours and assessed for
proliferation in a conventional 3H thymidine release assay.
Results: TGFβ-treated immortalized corneal endothelial cells and freshly isolated
corneal endothelial cells upregulated de novo methyltransferases and exhibited an
increase in global methylation. Proliferation of TGFβ-treated cells was suppressed
compared to untreated controls. However, there was no difference in histone
methylation between TGFβ - treated and untreated corneal endothelial cells.
Corneal cell proliferation was significantly increased by treatment with Vorinostat
(P< 0.002) but was not significantly increased by treatment with 5-Aza 2Deoxycytidine.
Conclusions: Corneal endothelial cells can utilize de novo methylation to impart
epigenetic gene regulation when exposed to TGFβ. Demethylation or inhibition of
histone deacetylases promotes corneal endothelial cell proliferation which may play
an important role in repopulating and restoring the endothelial cell layer in corneal
diseases and in corneal transplantation.
Commercial Relationships: Peter W. Chen, None; Lauren Tien,
None; Jessamee Mellon, None
Support: NIH Grants EY017198 and EY020799, and an unrestricted grant from
Research to Prevent Blindness
Program Number: 5122 Poster Board Number: D1092
Presentation Time: 1:45 PM - 3:30 PM
Promoter Demethylation of the Keap1 Gene in Human Aging Lens: A Possible
Epigenetic Mechanism for Lens Oxidation by Failure of Keap1/Nrf2
Dependent Antioxidant Protection
Palsamy Periyasamy1, Elanchezhian Rajan1, Masahiko Ayaki2, Toshimichi
Shinohara1. 1Ophthalmology and Visual Sciences, University of Nebraska Medical
Center, Omaha, NE; 2Ophthalmology, Saitama National Hospital, Wako City,
Saitama, Japan.
Purpose: Aging is a major risk factor associated with age-related cataracts (ARCs).
So lens oxidation increases eventually as an individual is aged. However, limited
information is available on the master transcriptional regulators, especially the
Kelch like-ECH-associated protein 1 (Keap1)/Nuclear factor (erythroid-derived 2)like 2 (Nrf2), for lens antioxidant genes. It is known that Nrf2, upon oxidative
stress, activates expression of glutathione reductase, catalase, thioredoxin, etc. to
preserve cellular redox homeostasis. Also, the Nrf2 level is regulated by its
Copyright 2012 by the Association for Research in Vision and Ophthalmology, Inc., all rights reserved. For permission to reproduce any abstract, contact the ARVO Office at pubs@arvo.org.
ARVO 2012 Annual Meeting Abstracts by Scientific Section/Group – Biochemistry/Molecular Biology (BI)
negative regulator, Keap1 by proteasomal degradation. Epigenetic mechanisms
may also play a pivotal role in the regulation of gene expressions. We hypothesized
that Keap1/Nrf2 dependent antioxidant protection might be failed with aging. Here,
we investigated the Keap1 promoter DNA methylation status in human aged and
cataract lenses.
Methods: The genomic DNA from human cataract capsulotomy specimens and
clear lenses (NDRI, Philadelphia, PA) were treated with sodium bisulfite. The
bisulfite-modified DNA was amplified by bisulphite sequencing PCR with specific
primers. The PCR products were purified, then cloned into pCR®4-TOPO vector
using TOPO TA Cloning® kit (Invitrogen, CA). About 10 independent clones of
each amplicon were sequenced to identify CpG methylation status.
Results: A significant change in the DNA methylation status was found in the CpG
islands of Keap1. The CpG island (-433 to -96) of the Keap1 promoter was
hypermethylated at age 17. But, these methylated CpGs were significantly
demethylated at age 37 and further at age 63. In addition, the Keap1 promoter DNA
methylation was highly heterogeneous in each lens epithelial cells of single lens,
suggested the heterogeneity in lens oxidation status. Based on the sequencing data,
we found transcriptional element binding sites for AP2, CREB, E2F, Sp1, and NFκB, which further activates transcription, in the demethylated CpG island of Keap1
promoter. This suggested the increased level of Keap1 during aging; thereby Nrf2
is reduced by proteasomal degradation. Although changes in methylation pattern
were found in the ARC lenses, demethylation status during aging was significantly
greater than that of ARC lenses.
Conclusions: Thus, promoter DNA demethylation of Keap1 with aging leads to
lower levels of Nrf2 which results in the reduced antioxidant protection and
increased lens oxidation.
Commercial Relationships: Palsamy Periyasamy, None; Elanchezhian Rajan,
None; Masahiko Ayaki, None; Toshimichi Shinohara, None
Support: RPB and EY018172
Program Number: 5123 Poster Board Number: D1093
Presentation Time: 1:45 PM - 3:30 PM
The Role Of Periostin In The Regression Of Hyaloid Vascular System During
Ocular Development
Mitsuru Arima1, Shigeo Yoshida1, Keijiro Ishikawa1, Shintaro Nakao1, Ryo Asato1,
Yukio Sassa1, Takeshi Kita1, Akira Kudo2, Akira Matsuda3, Tatsuro Ishibashi1.
1
Ophthalmology, Kyushu University, Fukuoka, Japan; 2Department of Biological
Information, Tokyo Institute of Technology, Tokyo, Japan; 3Department of
Ophthalmology, Juntendo University School of Medicine, Tokyo, Japan.
Purpose: The appropriate regression of hyaloid vascular system (HVS) is required
for normal ocular development and the failure of the regression could cause severe
visual loss. Although it is recognized vitreous macrophage lineage cells play a
crucial role in this process, the accurate mechanism is unclear. Periostin is a
matricellular protein that is involved in tissue and vascular remodeling. The
purpose of this study was to investigate the role of periostin in the HVS regression.
Methods: Wild type and periostin null mice eyeballs were enucleated at postnatal
day (P) 4, 5, 7, 9, 12 and 15. Hyaloid vessels and vitreous macrophages in flatmounted ocular specimen at each time point were stained with lectin B4 or with
F4/80 or Iba-1, respectively. For quantification of the apoptosis of endothelial cells
of hyaloid vessels, TUNEL labeling was performed. Immunohistochemistry was
performed to detect the localization of periostin. Laser capture microdissection
(LCM) and semiquantitative RT-PCR was also performed to determine the levels
of periostin mRNA.
Results: Lectin flat mount staining revealed the pronounced delay of HVS
regression in periostin null mice relative to wild type. However the total number of
F4/80 positive cells significantly increased in periostin null mice at each time point
examined. The number of TUNEL positive endothelial cells reached a peak at P7 in
wild type and P12 in periostin null mice, respectively. Additionally, the only small
population of Iba-1 positive cells in vitreous cavity, which located nearby hyaloid
vessels, was costained with periostin. Immunofluorescent triple staining of acridine
orange, F4/80 and periostin revealed that acridine orange staining colocalized only
with F4/80 but not with periostin. RT-PCR of vitreous macrophage lineage cells
collected by LCM revealed the production of periostin mRNA.
Conclusions: These results suggest that periostin is produced by the macrophages
activated in the vitreous cavity and may be involved in the HVS regression.
Commercial Relationships: Mitsuru Arima, None; Shigeo Yoshida,
None; Keijiro Ishikawa, None; Shintaro Nakao, None; Ryo Asato, None; Yukio
Sassa, None; Takeshi Kita, None; Akira Kudo, None; Akira Matsuda,
None; Tatsuro Ishibashi, None
Support: None
Program Number: 5124 Poster Board Number: D1094
Presentation Time: 1:45 PM - 3:30 PM
Novel Caspase-Activated Cell-Penetrating Probes Reveal Endosomal Release
During Apoptosis In a RGC-5 Cell Retinal Neurodegeneration Model
James R. Johnson1A,1B, Xudong Qiu1A,1C, Edward M. Barnett1C, David PiwnicaWorms1A,1B. AMolecular Imaging Center, Mallinckrodt Institute of Radiology,
BRIGHT Institute, BDepartments of Cell Biology and Physiology, Developmental
Biology, COphthalmology & Visual Sciences, 1Washington University School of
Medicine, Saint Louis, MO.
Purpose: Caspase-activatable cell-penetrating peptide (CPP) probes show promise
for characterizing retinal ganglion cell (RGC) apoptosis in vivo. These probes
incorporate a CPP sequence (kkkrkv) and a fluorophore-quencher pair linked by a
caspase-labile peptide sequence (DEVD). This scaffold displays efficient cell
uptake and CPP probes are optically silent until cleavage by executioner caspases.
Here, these probes were applied to RGC-5 cells to characterize the mechanisms
underlying probe uptake, endosomal release and activation for correlation with
probe activity observed with in vivo models of RGC neurodegeneration.
Methods: Our probes detected cell death in real-time facilitating the generation of
time-lapse movies showing both the morphological changes of cells undergoing
apoptosis and concurrent probe activation. To further characterize probe uptake and
endosomal release, nonquenched probes Kcap488, KcapTR488 and Kcap647
(green, green/red and near infrared fluorescence, respectively) were synthesized
and analyzed in RGC-5 cells using high-resolution fluorescence microscopy. For
analysis of cell death, caspase-activatable probes KcapTR488, KcapQ488 and
KcapQ647 were synthesized and tested in staurosporine and ionomycin
cytotoxicity models.
Results: RGC-5 cells internalize and retain CPP probes in endocytic
compartments. High-resolution fluorescence microscopy revealed distinct probe
(KcapQ488 and KcapQ647) activation in dying cells. Probe activation was
confined to the cytosol and at no time after ionomycin or staurosporine treatment
was endosomally associated signal observed. Thus, quenched probe escaped from
endosomes into the cytosol during the course of apoptosis rather than being
activated within endosomes prior to escaping. KcapTR488 facilitated multispectral
imaging of endosomal probe release, subsequent cytosolic probe cleavage and
differential subcellular trafficking of probe fragments with the progression of cell
death. Independent confirmation of cell death was obtained via Annexin V costaining as cells displaying probe activation were also bound by fluorescentlylabeled Annexin V.
Conclusions: These caspase-activatable probes are apoptosis biosensors in RGC-5
cells. KcapTR488 facilitates monitoring of probe uptake, endosomal release and
activation in RGC-5 neurodegeneration models. These studies demonstrate a
mechanism by which caspase-activatable CPPs are internalized via endocytosis by
living RGC-5 cells, released during apoptosis and activated during cell death as
well as their utility for imaging apoptosis in RGCs.
Commercial Relationships: James R. Johnson, None; Xudong Qiu,
None; Edward M. Barnett, None; David Piwnica-Worms, None
Support: NIH grant F32 EY20051-01, NIH R01 EY019587, P30 CA091842, P50
CA94056
Program Number: 5125 Poster Board Number: D1095
Presentation Time: 1:45 PM - 3:30 PM
Characterizing the Role of DNA Methylation in Retinal Neurons
Raymond A. Enke1, Karl J. Wahlin1, Donald J. Zack1, Shannath L. Merbs2.
1
Ophthalmology, Johns Hopkins University, Baltimore, MD; 2Ophthalmology,
Oncology, Wilmer Eye Institute, Johns Hopkins Univ, Baltimore, MD.
Purpose: Retinal cells undergo programmed cell death (PCD) during normal
development as well as in response to injury and disease. We hypothesize that
epigenetic mechanisms may regulate aspects of apoptosis of retinal neurons in the
developing and diseased retina. As a prelude to studying the role of DNA
methylation in the onset and progression of glaucoma and photoreceptor disease,
we set out to determine the normal expression pattern and functional role of DNA
methyltransferase (Dnmt) enzymes in the vertebrate retina and mouse models of
glaucoma and retinal degeneration.
Methods: Eyes from human donor globes, adult wild type mice, and aging DBA/2J
mice were fixed in 4% PFA and cryopreserved. Retinal cross sections were cut and
used for immunohistochemical (IHC) analysis of Dnmt localization. Additionally,
eyes from the rd1 mouse were studied by IHC analysis using an antibody against 5methyl cytosine (5-meC) as well as markers of PCD. Primary cultured retinal
ganglion cells (RGCs) were immunopanned from dissociated retina using an
antibody against Thy1. Newborn wild type and transgenic mice with a targeted
mutation in the Dnmt1 gene were studied. Cultured RGCs grown in the presence of
Dnmt inhibitors as well as from Dnmt1 mutant mice were assayed for survival
using a CellTiter-Glo viability assay.
Results: IHC analysis of the human and mouse retina demonstrated that Dnmt1
and Dnmt3b are expressed in the nuclei of adult and aging ganglion cell layer
(GCL) cells. Additionally, TUNEL positive neurons in the degenerating retina of
adult rd1 mice demonstrated enhanced staining for 5-meC. Although cleaved
caspase-3 (cCaspase-3) positive retinal neurons were present at similar periods of
development there was little overlap with 5-meC positive cells suggesting that they
are expressed at different stages of PCD. We are currently evaluating the viability
of primary cultured RGCs with crippled Dnmt activity.
Conclusions: Vertebrate retinal neurons in the late stages of PCD demonstrated
DNA hypermethylation by IHC, suggesting that epigenetic mechanisms might play
a role in apoptosis of neurons during retinal development and degeneration.
Likewise, nuclear localization of Dnmt1 and Dnmt3b in GCL cells from aging
human and rodent retina indicates that DNA methylation may be involved in RGC
Copyright 2012 by the Association for Research in Vision and Ophthalmology, Inc., all rights reserved. For permission to reproduce any abstract, contact the ARVO Office at pubs@arvo.org.
ARVO 2012 Annual Meeting Abstracts by Scientific Section/Group – Biochemistry/Molecular Biology (BI)
homeostasis. Further investigation is needed to determine if these enzymes play a
role in RGC survival.
Commercial Relationships: Raymond A. Enke, None; Karl J. Wahlin,
None; Donald J. Zack, None; Shannath L. Merbs, None
Support: RPB unrestricted funds
Program Number: 5126 Poster Board Number: D1096
Presentation Time: 1:45 PM - 3:30 PM
A Hammerhead Ribozyme Database
Juliette M. Stenz1, Jack M. Sullivan2,3. 1Ophthalmology- Ross Eye Institute,
University at Buffalo/SUNY, Buffalo, NY; 2Research, VA Western NY Healthcare
System, Amherst, NY; 3Ophthalmology-Ross Eye Institute,
Pharmacology/Toxicology, Physiology/Biophysics, University at Buffalo/SUNY
and SUNY Eye Institute, Buffalo, NY.
Purpose: A bioinformatics study was conducted to develop a database (DB) of
hammerhead ribozymes (hhRz) from published literature.
Methods: A PubMed query with keyword “hhRz” was performed. Criteria for
entry in the DB were: (i) efficacy of hhRz was tested in vitro, and/or in cellulo,
and/or in vivo; (ii) efficacy of independent hhRz agents targeting NUH sites was
quantifiable through extent of RNA cleavage, mRNA and/or protein knockdown, or
quantifiable changes in kinetic parameters; (iii) at least 5 target cleavage sights
were tested in each mRNA; (iv) at least one control experiment with scrambled,
mismatched, or null hhRz sequence; (v) articles were published in the English
language which allowed review by the authors. A rational DB was designed and
key information was mined from the included articles and entered in the DB.
Results: The PubMed query returned 951 articles, and 10 met the inclusion criteria.
An additional 4 articles and one doctoral dissertation recommended by JMS were
also included for a total of 15 articles. The title, author, journal, and date of each
article are included in the DB. The hhRz sequence and target mRNA information
were included. For in vitro or in cellulo studies the extent of target mRNA cleavage
and/or protein knockdown was included. When available, Kcat or Km was also
included.
Conclusions: The hhRz DB (Version 1) is a bioinformatics tool intended to assist
in selection of optimal NUH hhRz cleavage sights for therapeutic development.
Surprisingly, only a small percentage of hhRz studies evaluated cleavage efficacy
or knockdown of targets at a substantial number of potential cleavage sites (5)
throughout each mRNA. Such information is needed to better assess and refine
rules for NUH target site selection. The current data set could be combined with in
silico RNA folding or experimental RNA accessibility analysis to correlate with
measured knockdown efficacy. The DB can be refined as more studies are
conducted and represented in the literature.
Commercial Relationships: Juliette M. Stenz, None; Jack M. Sullivan, US
Patent App: 2008/0227103A1 (P)
Support: NIH Grant R01 EY013433, VA Merit Grant (1I01BX000669-01),
Research to Prevent Blindness
Program Number: 5127 Poster Board Number: D1097
Presentation Time: 1:45 PM - 3:30 PM
Toward Cellular Directed Evolution of Therapeutic Ribozymes
Mark C. Butler1,2A, Aishwarya Bhaskar3, John N. Misasi4, Jack M. Sullivan1,2B.
1
Research Service, VA Western NY Healthcare System, Amherst, NY;
A
Ophthalmology-Ross Eye Institute, BOphthalmology-Ross Eye Institute,
Pharmacology/Toxicology, Physiology/Biophysics, 2University at Buffalo/SUNY
and SUNY Eye Institute, Buffalo, NY; 3Biotechnical Clinical Laboratory Sciences,
University at Buffalo/SUNY, Buffalo, NY; 4Ophthalmology, Upstate Medical
University/SUNY, Syracuse, NY.
Purpose: Conduct a limited proof-of-principle test of a strategy (CELL-SELEX)
for cellular directed evolution of knockdown efficacy by hammerhead ribozyme
(hhRz) gene-based therapeutics.
Methods: The hhRz target cDNA (human RHO) is engineered with the 3’UT
converted to protein coding sequence, followed by an in-frame suicide gene cDNA
to generate a toxic target gene (TTG). Expressed in human cells, the TTG
promotes efficient cell death. A gene-specific hhRz library was made to all GUC
cleavage sites within hRHO mRNA. HhRzs were expressed within a chimeric RNA
(VAI) from plasmids containing EBV oriP episomal maintenance elements in
HEK293E cells that express EBNA1. Cell numbers are measured with a SYTOX
Green HTS assay. HhRz episomes are isolated from selected 293E cells by a
modified Hirt procedure and amplified in bacteria. HhRz episomal evolution was
assayed by restriction fragment gel analysis.
Results: A RHO-TK TTG has a HSV thymidine kinase as the suicide gene that
operates on added gancyclovir (GCV) (prodrug) to create toxic DNA metabolites.
GCV concentrations (25-50 µg/ml) induced efficient cell death in 293E cells
expressing RHO-TK. 293E cells co-expressing stabilized TTG with the hhRz
library, or with the library vector without hhRzs (control), or with discrete hhRz
expression plasmids targeting RHO mRNA were exposed to GCV and cell viability
measured over time. Only the hhRz library and discrete positive control hhRzs
capable of RHO target knockdown provided viability protection. HhRz library was
polluted with empty vector (no hhRzs) (1:10 ratio) and selection in GCV of co-
transfected cells for two months resulted in progressive selection-based enrichment
of episomal plasmids containing hhRzs. Sequences of cell/bacteria amplified
episomal plasmids were enriched for two hhRzs against RHO GUC sites not
identified in rational RNA drug discovery.
Conclusions: Cellular directed evolution involving a randomized population of
episomal hhRz expression vectors, strong cell selection, and amplification of
successful winners has potential for development of gene-based hhRz therapeutics.
Commercial Relationships: Mark C. Butler, None; Aishwarya Bhaskar,
None; John N. Misasi, None; Jack M. Sullivan, None
Support: NIH Grant: R01 EY013433 (JMS), R24 EY016662, RPB Unrestricted
Grant
Program Number: 5128 Poster Board Number: D1098
Presentation Time: 1:45 PM - 3:30 PM
RNA Drug Discovery- An Efficient Pipeline for Post-Transcriptional Gene
Silencing Agent Development
Jack M. Sullivan1,2A, Edwin H. Yau2B, Robert T. Taggart3, Mark C. Butler1,3, Tiffany
A. Kolniak2C. 1Research Service, VA Western NY Healthcare System, Amherst,
NY; AOphthalmology-Ross Eye Institute, Pharmacology/Toxicology,
Physiology/Biophysics, BOphthalmology and Pharmacology/Toxicology,
C
Ophthalmology and Neuroscience Program, 2University at Buffalo/SUNY and
SUNY Eye Institute, Buffalo, NY; 3Ophthalmology, University at Buffalo/SUNY,
Buffalo, NY.
Purpose: Develop and utilize a technological pipeline for efficient RNA Drug
Discovery (RDD) of candidate therapeutic post-transcriptional gene silencing
(PTGS) agents (ribozyme, shRNA, miRNA).
Methods: A bioinformatics model operates on output of three algorithms (MFold,
SFold, OligoWalk) to map accessible regions in target mRNAs at the single nt
level. A novel cDNA mapping of accessible RNA sites (CMARS) uses a library of
partially randomized oligodeoxynucleotides to map target RNA regions that
support reverse transcription initiation. Large sets of PTGS agents are screened for
knockdown efficacy in a human cell expression system (HEK293) co-transfected
with expression plasmids for a discrete PTGS agent and the target cDNA fused to a
reporter enzyme (SEAP) in a bicistronic mRNA. Knockdown efficacy is measured
by a HTS enzyme fluorescence assay for SEAP and rank-ordered to identify a lead
candidate. Lead optimization occurs by variation of antisense flank length,
ribozyme structure, and nature of supportive RNA expression chimeras, and is
facilitated by a HTS quantitative immunocytochemistry platform. Toxicity is
evaluated in a HTS apoptosis assay. Subretinal vector delivery in mice occurs with
a novel surgical stereo microscope optimized for the small rodent eye to achieve
detailed real time in vivo imaging. Ultrahigh resolution OCT imaging identifies
successful subretinal vector delivery.
Results: Four target mRNAs (human RHO, mouse RHO, SEAP, RPE65) were
mapped for accessible regions by bioinformatics and CMARS with correlative
outcomes and large single stranded regions are rare in all targets evaluated. For
hRHO and SEAP sets of PTGS agents were tested against accessible and
inaccessible regions and lead candidate were identified and optimized for potent
intracellular performance. PTGS expression vectors are not toxic in human cells.
Vector delivery into the subretinal space is definitive to initiate preclinical
evaluation.
Conclusions: A rational RDD technological platform can realize potent PTGS
agents to validated disease target mRNAs in the outer retina.
Commercial Relationships: Jack M. Sullivan, US Patent application:
2008/0227103A1 (P); Edwin H. Yau, US Patent App: 2008/0227103A1
(P); Robert T. Taggart, None; Mark C. Butler, None; Tiffany A. Kolniak, None
Support: NIH Grants: R01 EY013433 (JMS), R24 EY016662; Veterans
Administration Merit Grant (1I01BX000669-01) (JMS), RPB Unrestricted grant
Program Number: 5129 Poster Board Number: D1099
Presentation Time: 1:45 PM - 3:30 PM
Doxycycline´S Effect In Primary Pterygium Proteome Apoptosis
Victor M. Bautista, Sr.1, Marilú Arredondo-Flores2A, Nadia Luz López-Espinosa1,
Teresa Valdéz-González2, Herlinda Mejía-López1. 1Microbiology and Ocular
Proteomics, Inst de Ophthal Conde de Valenciana, Mexico, Mexico; AMicrobiology
and Ocular Proteomics, 2Hospital "Nuestra Señora de la Luz", Mexico, Mexico.
Purpose: Pterygium is a benign and fibrovascular lesion, originated from the
bulbar conjunctiva. In pterygium has been described abnormal expression of
apoptotic genes. We recently described that apoptosis is inhibited by the
overexpression of peroxiredoxin 2 and anti-apoptotic proteins like Hsp-70, that
block cytochrome c release and caspase activation, it results in a pro-caspase 3
accumulation. Some reports showed that doxycycline has pro-apoptotic effects
activating caspase 3, 7 and 9, and inhibiting matrix metalloproteinase activity, and
inducing cytochrome c release into cytosol. The aim of this work was to analyze in
vivo the effect of doxycycline in pterygium proteome apoptosis
Methods: Eigth patients with primary pterygia, previous informed consent, were
treated with topic 2% doxycycline during two weeks and eigth no treated patients
with primary pterygia and were analyzed by apoptosis protein array. Pterygia were
rejected by surgery and were lysed. Two-hundred micrograms of proteins were
Copyright 2012 by the Association for Research in Vision and Ophthalmology, Inc., all rights reserved. For permission to reproduce any abstract, contact the ARVO Office at pubs@arvo.org.
ARVO 2012 Annual Meeting Abstracts by Scientific Section/Group – Biochemistry/Molecular Biology (BI)
incubated with the arrays and revealed with chemoluminiscence and spots density
was quantified in G-BOX system. Fold change between pterygium treated and nontreated was obtained in order to establish relative protein expression. This study
was approved by Scientific and Ethics Committees of Hospital "Nuestra Señora de
la Luz" at Mexico City.
Results: The analyzed results showed that in doxycycline treated pterygia 9
proteins were overexpressed, 2 proteins not had changes and 24 were downexpressed. Only catalase showed a fold change more than 2 times. Interestingly
procaspase 3, clusterin, cytochrome c, Fas/TNFRSF6, HIF-1a, SMAC/DIABLO
and caspase 3 were down expressed in comparison to previously report where we
describe that these proteins were overexpressed in primary pterygium (ARVO
2011). The expression of bcl-2 and bcl-x decreased in doxycycline treated pterygia.
Conclusions: We have described apoptosis inhibition in pterygium by
overexpression of anti-apoptotic proteins and also reported the effect in vitro of
doxycycline in pterygia cells, where doxycycline reduced cell viability and induced
the production of TNF-alpha an others cytokines. In this work we describe the
down expression of several apoptotic proteins by doxycycline´s effect that suggest
that apoptosis pathway in pterygium is recovered in contrast to apoptotic proteome
described previously. Doxycycline could be an important part in the treatment of
pterygium.
Commercial Relationships: Victor M. Bautista, Sr., None; Marilú ArredondoFlores, None; Nadia Luz López-Espinosa, None; Teresa Valdéz-González,
None; Herlinda Mejía-López, None
Support: Conde de Valenciana Foundation and CONACYT-126779
Clinical Trial: Ethics Committee of Hospital Nuestra Señora de la Luz"", None
Program Number: 5130 Poster Board Number: D1100
Presentation Time: 1:45 PM - 3:30 PM
Dna Methytransferases Are Differentially Expressed In Human Eyes
Loic Blanchon1, Corinne BELVILLE1, Nicolas BONNIN2, Vincent Sapin3, Frederic
Chiambaretta4. 1Med Faculty, Biochem Lab, Clermont Ferrand, France; 2Med
Faculty, Ophthalmology, Clermont Ferrand, France; 3Genetique Reproduction et
Dvlpmt, Faculte de Medicine, Clermont Ferrand, France; 4Ophthalmology,
Clermont Ferrand Hospital, Clermont Ferrand, France.
Purpose: Epigenetic marks, such as methylation of DNA, miRNA expression or
post-translational histone modifications, are involved in the control of genes
expression. Epigenetic remaniements are involved in several human pathologies
but poorly described in ophthalmology ones. For this purpose, we focus on DNA
methylation and particularly on the expression level of DNA methyltransferases
(DNMT) implicated in CpG methylation pattern. The aim of our work was to
extensively check the presence of DNMT (mRNA and protein levels) and quantify
their expressions in various ocular zones.
Methods: mRNAs were extracted from human cornea, conjunctiva, capsule,
trabeculum and from related cell lines (HCE, HTCE, CHANG and TM). Quality
controls were done on Bioanalyzer 2100 Agilent. cDNAs were generated by
reverse transcription, quantified by amplification (LightCycler LC480-Roche) with
specific primers for DNMT1, 3A, 3B and 3L and normalized to the housekeeping
gene 36B4. Positive and negative controls were done with cDNAs from placenta
already known to express DNMTs or in absence of cDNA. For
immunohistochemistry, normal human corneas were provided by the regional
corneal graft bank. All proteins were detected by specific primary antibody for
DNMT1, 3A, 3B and 3L (Santa-Cruz®), negative control were done with a rabbit
IgG antibody as primary one. Secondary antibody Cy3-coupled was used.
Results: All DNMT are expressed in the human eyes but at different levels.
Furthermore, DNMT3L, not directly implied in the DNA methylation looks like to
be the weakly expressed. All tested cell
lines also expressed DNMTs. Quantitative RT-PCR demonstrated strong
differences between members and zones of expression of these DNA
methyltransferases. Our transcripts results were confirmed by
immunohistochemistry experiments on cornea sections.
Conclusions: For the first time, an inventory of the DNMT expression in tissues
and cells lines from human ocular sphere was performed. Future studies will
certainly permit to demonstrate the presence of a direct link between a deregulation
of the CpG methylation pattern and the already “well known” eye pathologies.
Commercial Relationships: Loic Blanchon, None; Corinne Belville,
None; Nicolas Bonnin, None; Vincent Sapin, None; Frederic Chiambaretta,
None
Support: None
Program Number: 5131 Poster Board Number: D1101
Presentation Time: 1:45 PM - 3:30 PM
Regulation of Photoreceptor Gene Expression by Thyroid Hormone Involves
Alterations in Histone Methylation
Samir S. Deeb1A, Darren Bisset1B, Samin Sajan1A, Jo Ling Liao1A, R. David
Hawkins1A. AMedicine (Medical Genetics) and Genome Sciences,
B
Medicine/Medical Genetics, 1University of Washington, Seattle, WA.
Purpose: We previously showed that thyroid hormone (T3) induces or represses
expression of genes in the human cone-like retinoblastoma cell line WERI-Rb1.
Histone lysine modifications (HKM) are correlated with chromatin architecture and
play key roles in photoreceptor differentiation during retinal development. The
purpose of this study was to assign enhancers to promoters by correlating changes
in gene expression by T3 with genomic changes in HKM.
Methods: WERI cells were grown in the absence or presence of T3. Chromatinimmunoprecipitation analysis was performed to map genomic sites that are
associated with histone 3-lysine 4-monomethylation (H3K4me1, associated with
active enhancers), or trimethylation sites (H3K4me3, associated with active
promoters). These HKM marks were compared with gene expression.
Results: Significant alteration in the positions and levels of H3K4me1 and
H3K4me3 marks were observed at genes that are induced or repressed by T3. The
promoters and potential enhancers of most genes that are induced by T3, including
those that encode the red and green opsin genes, showed an increase in binding of
H3K4me1 and H3K4me3, respectively. In contrast, genes that are repressed by T3
generally showed the opposite results. A few of the genes induced or repressed by
T3 had no significant changes in the levels of the above types of methylated
histones bound to enhancers or promoters.
Conclusions: Regulation of gene expression in WERI cells by T3 includes
alterations in the levels of histone lysine methylation, suggesting that this process
also contributes to the control of gene expression by T3 during cone photoreceptor
development.
Commercial Relationships: Samir S. Deeb, None; Darren Bisset, None; Samin
Sajan, None; Jo Ling Liao, None; R. David Hawkins, None
Support: NIH EY08395
Program Number: 5132 Poster Board Number: D1102
Presentation Time: 1:45 PM - 3:30 PM
Age Alters MicroRNA Expression Profile in Mouse Retinal Pigment
Epithelium (RPE)/choroid
Sudha Priya Soundara Pandi, Mei Chen, Jasenka Guduric-Fuchs, David Simpson,
Heping Xu. Centre for Vision and Vascular Science, Queen's University Belfast,
Belfast, United Kingdom.
Purpose: MicroRNAs are non-coding regulatory RNAs, which fine tune and
regulate gene expressions. The purpose of this study is to examine the influence of
age on microRNA expression profile in retinal pigment epithelium (RPE)/choroid.
Methods: MicroRNAs were extracted from RPE/choroid of young (3-month) and
adult (9-month) C57BL/6 mice, cDNA library construction using Illumina Truseq
followed by Deep Sequencing using Illumina Genome Analyser. The data were
annotated with miRBase using CLC Genomics Workbench V4.0. Each microRNA
reads were normalised to number of microRNA reads/million mapped. Young and
adult mice microRNA were compared and significant fold changes were calculated
using Baggerley’s test. Age-related microRNA expression was identified using
criteria of false discovery rate (FDR) < 0.05 in combination with fold change >2.
The predicted target genes of significantly altered microRNAs and biological
pathways that might be affected were analysed using DIANA miRPath database.
Results: A total of 407 microRNAs were detected in RPE/choroid. Among them,
14 microRNAs (miR-21, -126, -30e, -16, -10a, -186, -199a, -145, -142, -195, -24, 15a, -335, -322) were downregulated and 2 microRNAs (miR486, miR423)
upregulated in adult mice. Interestingly, 11 out of 14 downregulated microRNAs
(miR-21, -126, -30e, -16, -10a, -186, -199a, -145, -142, -195, -15a) are known to
negatively regulate upstream genes of various immune-related signalling pathways,
including T/B cell receptor, NK cell mediated cytotoxicity, Toll-like-receptor,
VEGF receptor, and cytokine receptor signalling pathways. In addition, 8
downregulated microRNAs (miR-21, -126, -30e, -16, -186, 199a, -145, -142) are
known to negatively regulate upstream genes of leukocyte transendothelial
migration pathway.
Conclusions: Our results show that age negatively regulates microRNA expression
in RPE/choroid. Many of altered microRNAs can regulate the expression of genes
involved in immune-related signalling pathways. Previously, we and others have
observed increased inflammatory responses (e.g. immune cell infiltration and
complement activation) at retinal-choroidal interface in aged mice. Our result
suggests that down-regulation of miR-21, -126, -30e, -16, -10a, -186, -199a, -145, 142, -195, -15a may contribute to age-related para-inflammation at the
RPE/choroid.
Commercial Relationships: Sudha Priya Soundara Pandi, None; Mei Chen,
None; Jasenka Guduric-Fuchs, None; David Simpson, None; Heping Xu, None
Support: None
Program Number: 5133 Poster Board Number: D1103
Presentation Time: 1:45 PM - 3:30 PM
Characterisation of the Effect of miR-26a Upon Global mRNA Expression in
Bovine Retinal Microvascular Endothelial Cells
David A. Simpson, Anna O' Connor, Jasenka Guduric-Fuchs, Tim M. Curtis.
Centre for Vision & Vascular Science, Queens University Belfast, Belfast, United
Kingdom.
Purpose: Primary bovine retinal microvascular endothelial cells (BRECs)
constitute a widely-used model of angiogenesis. Information about mRNA
expression is crucial to understand how these cells perform their roles in
Copyright 2012 by the Association for Research in Vision and Ophthalmology, Inc., all rights reserved. For permission to reproduce any abstract, contact the ARVO Office at pubs@arvo.org.
ARVO 2012 Annual Meeting Abstracts by Scientific Section/Group – Biochemistry/Molecular Biology (BI)
angiogenesis, barrier selectivity and control of vascular tone. However, because the
cow is not a standard model organism, tools to measure global gene expression
have been limited. The aim of this study was to apply only recently available ‘next
generation’ sequencing techniques to characterise the mRNA profile of BRECs.
Furthermore, we wanted to measure the effect of altering a specific microRNA
upon the mRNA profile.
Methods: RNA was isolated from primary cultures of untreated BRECs or
following transfection with an LNA to inhibit, or a plasmid to over-express, miR26a. cDNA libraries were prepared using a ScriptSeq kit (Epicentre) and sequenced
on an Genome Analyzer (Illumina). Reads were mapped to the bovine genome
(UMD3.1) using Genomics Workbench software (CLCbio) and the number of
reads mapped per kilobase of each gene, per million fragments mapped (FPKM)
calculated.
Results: Approximately 12 million reads were obtained from each library, of
which ~8 million mapped to the genome. Extremely highly expressed mRNAs
previously associated with endothelial cells and angiogenesis included
Thrombospondin 1 (820 FPKM) and Thymosin beta10 (1060 FKM). Modulation of
miR-26a expression caused significant changes in mRNA expression. Altered
genes included predicted miR-26a targets such as PECAM1 and many potential
novel targets including Angiopoietin-2 and Endothelin-1. Mapping of reads to
exons facilitated identification of splicing patterns and many examples of novel
alternatively spliced transcripts were observed.
Conclusions: RNA-Seq enables the quantitative evaluation of mRNA expression
and splicing patterns without prior sequence knowledge, an advantage over
hybridization-based array approaches, particularly in less well characterized
organisms. This global profile of BREC mRNA expression will be an invaluable
resource for future studies of endothelial biology. The significant mRNA changes
observed following manipulation of miR-26a underline the important role of
microRNAs in regulating endothelial gene expression.
Commercial Relationships: David A. Simpson, None; Anna O' Connor,
None; Jasenka Guduric-Fuchs, None; Tim M. Curtis, None
Support: BBSRC grant BB/H005498/1; DEL studentship
Program Number: 5134 Poster Board Number: D1104
Presentation Time: 1:45 PM - 3:30 PM
MicroRNA-206 Inhibits Uveal Melanoma Cell Proliferation and Migration by
targeting c-Met
Xiaoyan Chen. Sch of Ophthal & Optometry, Wenzhou Medical College,
Wenzhou, China.
Purpose: MicroRNAs (miRNAs) are 18-26 nucleotide non-coding RNAs which
are expressed endogenously and repress protein translation through binding to
target mRNAs. Evidence indicates that miRNAs are essential for tumor cell
proliferation and migration. The function of miR-206 in uveal melanoma, however,
remains unknown. In this study, we investigated the function of miR-206 in uveal
melanoma cells.
Methods: Realtime RT-PCR was carried out to detect the expression of miR-206
in uveal melanoma cells and normal melanocytes. Transfection of miR-206 into
uveal melanoma cells was performed by liperfectamine 2000. The proliferation of
uveal melanoma cells was measured by MTS assay. Cell cycle analysis was
performed by flow cytometry. Cell migration was examined by transwell migration
assay. Western blot analysis was carried out to detect the expression of c-Met in
uveal melanoma cells.
Results: miR-206 was downregulated in uveal melanoma cells as compared with
uveal melanocytes. Transfection of miR-206 into uveal melanoma cells
significantly inhibited cell proliferation and migration. miR-206 induced cell cycle
G1-arrest. c-Met expression was downregulated by miR-206 in uveal melanoma
cells.
Conclusions: Our results demonstrated that miR-206 may act as a tumor
suppressor in uveal melanoma cell proliferation and migration by targeting c-Met.
Commercial Relationships: Xiaoyan Chen, None
Support: National Natural Science Foundation of China(30772385) and Zhejiang
Provincial Natural Science Foundation of China(Y2080853)
Program Number: 5135 Poster Board Number: D1105
Presentation Time: 1:45 PM - 3:30 PM
Exploration Of The Target Gene Independent Mechanism By Which Shrna
Regulates Rhodopsin Promoter Activity
Tomohiro Masuda, Anitha Yerrabelli, Donald J. Zack. Ophthalmology, Wilmer
Eye Inst, Johns Hopkins Univ, Baltimore, MD.
Purpose: To better understand the target independent mechanism by which
shRNAs can modulate the activity of rhodopsin-promoter and other reporter
constructs.
Methods: Bovine rhodopsin promoter reporters were transfected into HEK293,
COS7, and WERI retinoblastoma cells with or without CRX, NRL, and shRNA
expression vectors. The reporters used were firefly (Fluc) and Gaussia (Gluc)
luciferase and mRFP. The shRNAs used targeted EGFP and Pias2 genes. Various
shRNAs with random and Pias2-based mutation stem structure were also used. The
culture medium or the cells were collected at designated time points to measure
luciferase activity. mRFP signal was detected and analyzed using a Cellomics
image-analysis system. Cells were also collected and analyzed for endogenous gene
and miRNA expression by quantitative real-time PCR (qPCR), microarray, and
nCounter miRNA expression assay.
Results: In HEK293 cells, CRX and NRL induced Gluc activity ~7 fold compared
to control. Surprisingly, reporter activity was enhanced synergistically to a
maximum of ~100 fold in the presence of several shRNAs, including control
shRNAs. However, shRNA alone, without CRX and NRL, induced the Gluc
activity ~5 fold at most. Some shRNAs, however, had little or no induction of the
Gluc activity both by itself and in the presence of CRX and NRL. Transfection of
mutant shRNAs identified a critical nucleotide for the activity from the stem of the
shRNA - replacing the key nucleotide largely eliminated the ability of the shRNA
to enhance CRX- and NRL-mediated Gluc activity. Results were similar with the
other reporters and cell lines. Microarray and qPCR analysis did not identify any
gene expression changes that could explain the observed shRNA-mediated reporter
effects. miRNA expression studies to explore whether the observed shRNA effects
could be mediated by modulation of miRNA activity are underway.
Conclusions: Our results indicate that the synergistic enhancement of rhodopsin
promoter activity by shRNAs in the presence of CRX and NRL is target geneindependent but shRNA sequence-specific. We have identified a critical nucleotide
in the stem of the shRNA that appears crucial for this enhancing activity. Further
research is required to elucidate the mechanism of this unique shRNA function.
Commercial Relationships: Tomohiro Masuda, None; Anitha Yerrabelli,
None; Donald J. Zack, None
Support: 2R01EY009769, 5P30EY001765, Research to Prevent Blindness, and
generous gifts from the Guerrieri Family Foundation and from Robert and Clarice
Smith.
Program Number: 5136 Poster Board Number: D1106
Presentation Time: 1:45 PM - 3:30 PM
Age-related Variation of Cytosine Methylation in the Sod2 Promoter in the
RPE/choroid and Retina Within and Among Individual BALB/c Mouse Eyes
Leonard M. Hjelmeland, Alfred K. Yu, Zeljka Smit-McBride. Ophthalmology, Univ
of California-Davis, Davis, CA.
Purpose: To quantify the variation in the methylation of cytosines within a single
individual and among a cohort of isogenic members of the BALB/c strain as a
function of age. For this purpose, high resolution bisulfite sequencing of the Sod2
promoter at the 20X level was performed on gDNA samples prepared from the
RPE/choroid and retina of the BALB/c mouse eye.
Methods: BALB/c mice were purchased from Jackson Laboratories (2 months) or
the NIA aging animal colony (18 months). Animals were housed and fed according
to the ARVO guidelines. Genomic DNA was prepared from freshly dissected
RPE/choroid and retina of 3 replicate animals 2 or 18 months of age from both
males and females. These samples were treated with sodium bisulfite. Selected
regions of the Sod2 gene (promoter and intron 2) were amplified by PCR and
cloned. At least 15-20 individual clones for each amplified region were sequenced
and these data were used to calculate percent methylation at each cytosine residue.
The mean values for each position were then averaged among 3 different animals.
Data were tested for significant differences among groups.
Results: Variance in the methylation of individual cytosines was itself also variable
with respect to each individual residue examined in the Sod2 sequence. When data
were averaged over 3 biological replicates the same trends in variance were
observed. No individual cytosine showed significant differences among groups at
the p< 0.05 level, but several residues near to NFkappaB and FOXO3A binding
sites in the proximal promoter as well as a region in the 2nd intron trended towards
significance (i.e. p< 0.07 to p<0.09).
Conclusions: Our results suggest that the experiments were underpowered and that
increasing the number of biological replicates and/or depth of sequencing may
yield statistically significant results. Significant alterations in the cytosine
methylation near transcription factor binding sites could affect gene expression in
an age-related manner.
Commercial Relationships: Leonard M. Hjelmeland, None; Alfred K. Yu,
None; Zeljka Smit-McBride, None
Support: Research to Prevent Blindness Unrestricted Departmental Grant, NEI
Grant 1R01EY021024-01A2, NEI Grant 1R01EY021537-01
Program Number: 5137 Poster Board Number: D1107
Presentation Time: 1:45 PM - 3:30 PM
Epigenetic Regulation of Wnt signaling to mediate Müller Cell Survival and
Proliferation
Muhammad Taimur A. Malik1, Rajesh C. Rao2, Chenying Guo1, Justin Chew1,
Xiaoling Jiao1,3, Dong Feng Chen1,4. 1Schepens Eye Research
Institute/Massachusetts Eye and Ear, Department of Opthalmology, Harvard
Medical School, Boston, MA; 2Department of Opthalmology and Visual Sciences,
Washington University School of Medicine, St. Louis, MO; 3Department of
Opthalmology, Beijing University First Hospital, Beijing, China; 4VA Center for
Innovative Visual Rehabilitation, RR&D Center of Excellence, VA Boston
Healthcare System, Boston, MA.
Copyright 2012 by the Association for Research in Vision and Ophthalmology, Inc., all rights reserved. For permission to reproduce any abstract, contact the ARVO Office at pubs@arvo.org.
ARVO 2012 Annual Meeting Abstracts by Scientific Section/Group – Biochemistry/Molecular Biology (BI)
Purpose: Histone Lysine Methyltransferases (HKMTases) catalyze histone lysine
methylation (HKM) on terminal tails of histone H3 and represent an important
epigenetic mechanism that regulates cell specific gene expression, development and
survival. Müller cells, via gliosis and proliferation, play an active role in many
types of retinal disorders. In this study we investigated the relationship between
HKMTases and wnt signaling in mediating Müller cell survival and proliferation
Methods: Müller cells were isolated from the retinas of mice at the age of postnatal
day 0 and cultured in the defined media. Inhibitors of the HMTases Ezh2 and G9a,
Dzneb and Bix, were applied to the culture media in the presence and absence of
Wnt3a. An in situ cell death detection kit (TUNEL) was used to quantify cell
survival, and 5 bromo deoxyurdinine (BrdU) incorporation assays were used to
assess cell proliferation. Effects of HMTase inhibitors and Wnt3a on Müller cell
survival and proliferationwere examined.
Results: Inhibition of HMTases significantly increased Müller cell apoptosis and
decreased cell proliferation. There was a dose dependent effect of Dzneb and Bix
on Müller cell survival. While addition of Wnt3a alone did not affect Müller cell
survival and proliferation, it reversed the effects of Dznep and Bix
Conclusions: Müller cell survival and proliferation are epigenetically regulated by
the HKMTases Ezh2 and G9a. Our results furher suggest that Wnt3a is downstream
signal of Ezh2 and G9a that may regulate Müller cell survival and proliferation.
Aberrant proliferation and reactive gliosis of Müller glia is associated with many
diseases including vitreoretinal interface disorders such as epiretinal membrane,
proliferative vitreoretinopathy following retinal detachment, exuberant fibrosis in
various forms of macular degenerations. Moreover, Müller glia have been
suggested as a reservoir of endogeneous neurogenic progenitor cells amenable to
retinal repair following retinal neurodegeneration. By regulating vital retinal glial
functions, the HKMTases emerge as a potential therapeutic target to modulate
Müller glial proliferation and survival in a variety of retinal disorders.
Commercial Relationships: Muhammad Taimur A. Malik, None; Rajesh C.
Rao, None; Chenying Guo, None; Justin Chew, None; Xiaoling Jiao,
None; Dong Feng Chen, None
Support: NEI (EY017641), National Institute of Drug Abuse (DA024803), the
Department of Veterans Affairs (1I01RX000110), and DOD (W23RYX-9104N603, W81XWH-09-2-0091, W81XWH-11-1-0477)
Purpose: After optic nerve crush (ONC) injury, mature retinal ganglion cells
(RGC) are unable to regenerate their severed axons and eventually die through
apoptotic mechanisms. This study was conducted to determine whether intravitreal
administration of siRNAs namely, PF-04523655 targeted against RTP801 (also
known as REDD1, a negative regulator of the mTOR pathway) and/or QPI1007
targeted against Caspase-2 (a pro-apoptotic gene expressed in mature RGC after
injury) could promote RGC survival and axon regeneration after an ONC injury.
Methods: Wistar rats received a bilateral ONC that transected 100% RGC axons
on day 0, this was immediately followed by an intravitreal injection of either PBS
(vehicle), siEGFP (negative control), or the following combinatorial therapies: PF04523655+QPI1007, PF-04523655+siEGFP or QPI1007+siEGFP. Animals
received additional siRNA injections on days 8 and 16 and, on day 24, eyes and
optic nerves were harvested and prepared for histological examination. Optic
nerves were immunostained for growth associated protein-43 (GAP-43) to assess
RGC axonal regeneration whilst retinal sections were stained for βIII-tubulin to
evaluate RGC survival.
Results: Treatment with QPI1007+siEGFP or PF-04523655+siEGFP significantly
increased RGC survival compared to siEGFP and PBS treatments (Figure 1A).
These neuroprotective effects were enhanced by the combinatorial administration
of QPI1007 and PF-04523655. When given together, PF-04523655 and QPI1007
caused a significant increase in RGC survival (~95%) compared to QPI1007 and
PF-04523655 mono-therapies (~79%). Furthermore, treatment with PF-04523655
promoted significant RGC axonal regeneration into the distal stump of the optic
nerve (for distances of up to 1200µm), irrespective of whether it was administered
alone or in combination with QPI1007 (Figure 1B).
Conclusions: PF-04523655 and QPI1007 alone or in combination may be effective
therapies for promoting RGC survival, whereas PF-04523655 may be also efficient
in promoting axonogenesis after RGC
injury.
Program Number: 5138 Poster Board Number: D1108
Presentation Time: 1:45 PM - 3:30 PM
Mir-146a Promotes Cell Proliferation And Survival By Targeting Nf-kb In A
Human Retinal Pigment Epithelial Cell Line
Larry Estlack1,2, Ginger Pocock2, Brent Lavey2, Adam Schenk2, Jeffrey Wigle2.
1
Conceptual Mindworks Inc, San Antonio, TX; 2711 HPW/RHDO, Fort Sam
Houston, TX.
Purpose: To study the effect of low power laser inactivation (LPLI) on the
expression of miR-146a in RPE cells in association with cell proliferation and
survival by targeting NF-kB.
Methods: A human retinal pigment epithelial cell line (hTERT-RPE1) was
exposed to LPLI (670 nm, 2.88 J/cm2). The cell line was then characterized to
determine the relative abundance of protein and mRNA levels of NF-kB and the
up-regulation (expression) of miR-146a. Cell proliferation and survival assays were
used to determine the effects of miR-146a targeted NF-kB.
Results: Following LPLI (670 nm, 2.88 J/cm2) expression kinetics for NFkB
protein and mRNA levels were increased by 7 fold at 24 hours post exposure and 6
fold at 6 hours post exposure, respectively. Up-regulation of miR-146a was 10 fold
at 2 hours post exposure. Compared to unexposed control cells the exposed cells
had an increase of 25% in cell proliferation and survival 48 hours post exposure.
Antagomir-mediated inhibition of miR-146a contributed to a decrease in expression
of NFkB protein (24 hours post exposure) and mRNA (6 hours post exposure) by
about 35% and 42%, respectively and the increase in cell proliferation and survival
48 hours post exposure was no longer visible.
Conclusions: Up-regulation of miR-146a induced by LPLI (670 nm, 2.88 J/cm2)
targets the attenuation of NF-kB activity promoting cell proliferation and survival.
This phenomenon represents a possible negative feedback loop affecting post
transcriptional proteins. Therefore it may be possible to regulate RPE cell growth
utilizing LPLI by affecting transcription controlled pathways.
Commercial Relationships: Larry Estlack, None; Ginger Pocock, None; Brent
Lavey, None; Adam Schenk, None; Jeffrey Wigle, None
Support: None
Program Number: 5139 Poster Board Number: D1109
Presentation Time: 1:45 PM - 3:30 PM
Pharmacological Activation of mTOR by siRNA Compound PF-04523655
Inhibiting RTP801 Promotes Mature RGC Axon Regeneration and Survival
after Optic Nerve Crush Injury
Jenna T. O'Neill1, Lisa Hill1, Ben Mead1, Zubair Ahmed1, Martin Berry1, Elena
Feinstein2, Ann Logan1. 1Neuropharmacology and Neurobiology, University of
Birmingham, Birmingham, United Kingdom; 2Quark Pharmaceuticals Inc,
Fremont, CA.
Copyright 2012 by the Association for Research in Vision and Ophthalmology, Inc., all rights reserved. For permission to reproduce any abstract, contact the ARVO Office at pubs@arvo.org.
ARVO 2012 Annual Meeting Abstracts by Scientific Section/Group – Biochemistry/Molecular Biology (BI)
Commercial Relationships: Jenna T. O'Neill, None; Lisa Hill, None; Ben
Mead, None; Zubair Ahmed, None; Martin Berry, None; Elena Feinstein,
Quark Pharmaceuticals (F); Ann Logan, None
Support: None
Commercial Relationships: Ravi Metlapally, None; Pedro Gonzalez,
None; Felicia Hawthorne, None; Khanh-Nhat Tran-Viet, None; Christine F.
Wildsoet, None; Terri L. Young, None
Support: K12EY017269
Program Number: 5140 Poster Board Number: D1110
Presentation Time: 1:45 PM - 3:30 PM
Epigenetic Regulation of MicroRNA-127 and Its Role in Uveal Melanoma
Dongsheng Yan1, Shasha Yao1, Xiaoyan Chen1, Jiao Wang1, Dan-Ning Hu2, Lili
Tu1. 1Sch of Ophthal & Optometry, Wenzhou Medical College, Wenzhou Zhejiang,
China; 2Tissue Culture Center, The New York Eye and Ear Infirmary, New York
Medical College, New York, NY.
Purpose: MicroRNAs (miRNAs) are ~22 nucleotide non-coding RNAs, which are
endogenously expressed and inhibit protein translation through binding to target
mRNAs. Recent studies have demonstrated that miRNAs played important roles in
tumorigenesis. The role of miRNAs in uveal melanoma, however, remains largely
unclear. In the present study, we investigated the function and regulation of
microRNA-127 (miR-127) in uveal melanoma cells.
Methods: Realtime RT-PCR was performed to detect the expression of miR-127 in
uveal melanoma cells. Uveal melanoma cells were transfected with miR-127 by
liperfectamine 2000. The proliferation of uveal melanoma cells was quantified by
MTS assay. Cell cycle and apoptosis was examined by flow cytometry and
caspase3/7 assay, respectively. The expression of cell cycle related proteins was
analyzed by Western blotting.
Results: miR-127 was downregulated in uveal melanoma cells and its expression
was upregulated after treatment with epigenetic drugs. Introduction of miR-127
into uveal melanoma cells led to a significant decrease in cell growth. miR-127
inhibited cell proliferation by blocking cell cycle in G1 phase rather than
stimulating apoptosis. miR-127 was found to downregulate the expression of cell
cycle related proteins by Western blot analysis.
Conclusions: Our results demonstrated that miR-127 may act as a tumor
suppressor in uveal melanoma cell proliferation.
Commercial Relationships: Dongsheng Yan, None; Shasha Yao,
None; Xiaoyan Chen, None; Jiao Wang, None; Dan-Ning Hu, None; Lili Tu,
None
National Natural Science Foundation of China（30772385）and Zhejiang
Provincial Natural Science Foundation of China (Y2080853)
477 Growth Factors and Cytokines
Wednesday, May 9, 2012, 3:45 PM - 5:30 PM
Hall B/C Poster Session
Program #/Board # Range: 5303-5314/A138-A149
Organizing Section: Biochemistry/Molecular Biology
Program Number: 5141 Poster Board Number: D1111
Presentation Time: 1:45 PM - 3:30 PM
Micro-RNAs in the Sclera: Role in Ocular Growth, and Implications for
Myopia
Ravi Metlapally1, Pedro Gonzalez2A, Felicia Hawthorne2B, Khanh-Nhat TranViet2C, Christine F. Wildsoet1, Terri L. Young3. 1Optometry, UC Berkeley,
Berkeley, CA; AOphthalmology, Duke Eye Center, BUniv Prog in Genetics &
Genomics, CCenter for Human Genetics, 2Duke University, Durham, NC;
3
Ophthalmology, Duke University Eye Center, Durham, NC.
Purpose: The socio-economic impact of myopia on our society is significant.
Ocular axial elongation during myopia development is driven by a retino-scleral
signaling cascade and guided by scleral extracellular matrix remodeling. MicroRNAs (miRNAs) regulate gene expression by pairing with the 3’UTR of target
sequences, and serve as nodes of signaling networks. We hypothesized that the
sclera, like most tissues, expresses miRNAs, and that some may play an active role
in ocular growth regulation.
Methods: Scleral samples from normal human fetal (24 week gestation) and adult
(age-matched) donor eyes (n=3, each group) were obtained. RNA was extracted
using the miRVANA kit and genome-wide miRNA profiling performed using the
Agilent Human miRNA Microarray platform. Microcosm, TargetScan and PicTar
algorithms were used to obtain miRNA target predictions. Follow-up experiments
using TaqMan® MicroRNA Assays targeting select micro-RNAs were applied to
tissue from posterior and peripheral scleral regions (n=7, each group). Microarray
data were analyzed using miRInform, and quantitative PCR data with 2^-deltaCt
method.
Results: Human sclera expressed approximately 300 miRNAs (298 & 353 detected
in at least one adult and fetal sclera sample respectively), with several miRNAs
showing differential regulation (p<0.01, min p=1.5x106). Of the miRNAs examined
further, mir-214, let-7c, let-7e, mir-103, mir-107, and mir-98 showed increased
expression in fetal tissue (fold changes 1.5 to 4, p<0.01). No significant differences
were observed in miRNA expression between posterior and peripheral regions
within either age group.
Conclusions: To our knowledge, this is the first study of micro-RNA expression in
human sclera. Of the miRNAs identified, many showed age- and presumed growthrelated differential regulation, higher in rapidly growing fetal eyes, consistent with
a role in ocular growth regulation. A link between these scleral micro-RNAs and
myopia, which also involves rapidly elongating eyes, is plausible but yet to be
established. Genome-wide mRNA profiling is underway to characterize the
pathways involved and the correlation with micro-RNA signatures.
Program Number: 5303 Poster Board Number: A138
Presentation Time: 3:45 PM - 5:30 PM
Connective Tissue Growth Factor (CTGF) Expression in Human RPE Cells is
Regulated by Inflammatory Cytokines, TGF-β and Ceramide
Ram Kannan1, Shozo Sonoda1, Chandrasekharam N. Nagineni2, Mizuki Kitamura1,
David R. Hinton1,3. 1Ophthalmology, Arnold and Mabel Beckman Macular
Research Center, Doheny Eye Institute, Los Angeles, CA; 2Laboratory of
Immunology and Virology, National Eye Institute, Bethesda, MD; 3Pathology,
Keck School of Medicine USC, Los Angeles, CA.
Purpose: CTGF is a matricellular protein secreted and sequestered in the
extracellular matrix where it interacts with integrins, growth factors and cytokines.
Our previous work reported that CTGF is secreted by human retinal pigment
epithelial cells (HRPE) and is a major mediator of retinal fibrosis . The aim of the
present study was to investigate the effects of inflammatory cytokines, TGF-β and
ceramide-induced oxidative stress on CTGF expression and to characterize the
nature of polarized secretion of CTGF by HRPE cultures.
Methods: Microarray analysis using Affymetrix GeneChip was performed using
RNA extracted from HRPE cells treated with TGF-β1 or inflammatory cytokine
mix (IFN-γ, TNF-α and IL-1β) for 8h. CTGF gene expression and protein secretion
were studied in both confluent fetal human RPE cells and polarized RPE
monolayers (TER 350 ohms.cm2) treated with TGF-β1 alone (4 ng/ml) or in the
presence of 25 µM C2 ceramide. Quantitative ELISA assay was used to determine
the levels of cellular and secreted CTGF.
Results: Microarray analysis revealed that TGF-β treatment upregulated CTGF
expression by 4.5 fold, while cytokine mix treatment downregulated CTGF gene
expression by more than 10 fold. In confluent HRPE cells, ceramide inhibited both
constitutive and TGF-β-enhanced secretion of CTGF significantly (p<0.05).
Further, CTGF exhibited asymmetry of secretion in polarized HRPE cultures.
CTGF secretion was predominantly apical (323 ± 25 pg/ml) and not basolateral (35
± 5 pg/ml). Both apical and basolateral secretion of CTGF were augmented by
TGF-β and were significantly attenuated by ceramide pretreatment. TGF-β and
ceramide treatment had no significant effect on cell associated CTGF levels. Real
time PCR analysis showed that CTGF mRNA levels were significantly upregulated
by TGF-β and inhibited by ceramide suggesting transcriptional regulation of CTGF
by TGF-β and ceramide.
Conclusions: Our data show that a) inflammatory cytokines and ceramide cause a
marked inhibition of the expression of CTGF while TGF-β enhances CTGF
expression by RPE, b) ceramide suppresses the action of TGF-β on CTGF secretion
and c) CTGF secretion in HRPE cells is predominantly apical. Our results suggest
that enhanced apical secretion of CTGF in the presence of TGF-β may be
associated with retinal fibrosis.
Commercial Relationships: Ram Kannan, None; Shozo Sonoda,
None; Chandrasekharam N. Nagineni, None; Mizuki Kitamura, None; David
R. Hinton, None
Support: EY01545, EY 03040, Grants from RPB and Arnold and Mabel Beckman
Foundation
Program Number: 5304 Poster Board Number: A139
Presentation Time: 3:45 PM - 5:30 PM
KLOTHO Regulates Phagocytosis and VEGF Secretion by Increasing Ca2+
Entry in Human Retinal Pigment Epithelia
Maria Kokkinaki1A, Gerard Ahern1B, Mia Gunawan1C, Sanjai Jalaj1D, Nady
Golestaneh1A. AOphthalmology/Neurology, BPharmacology, CBiochemistry,
D
School of Medicine, 1Georgetown University Medical Center, Washington, DC.
Purpose: Our aim is to study the role of Klotho family members Klotho-alpha
(KL) and Klotho-gamma (lactase-like, LCTL) in the function of Retinal Pigment
Epithelia (RPE) and their possible implication in Age-related Macular
Degeneration (AMD).
Methods: To study the effect of KL and LCTL on human RPE, gene and protein
expression was analyzed by qRT-PCR, immunostaining and Western blot analysis.
The siRNA technology was used to knock down KL, LCTL and Transient Receptor
Potential cation channel subfamily V member 5 (TRPV5) genes in RPE.
Phagocytosis assays were performed using fluorescently labeled zymosan.
Oxidative stress was induced by tert-butylhydroperoxide (tBH). VEGF secretion
was measured by ELISA. Single cell patch clamp electrophysiology technique and
Copyright 2012 by the Association for Research in Vision and Ophthalmology, Inc., all rights reserved. For permission to reproduce any abstract, contact the ARVO Office at pubs@arvo.org.
ARVO 2012 Annual Meeting Abstracts by Scientific Section/Group – Biochemistry/Molecular Biology (BI)
calcium imaging were also applied to measure the activity of TRPV5 channel in
RPE.
Results: Human RPE express both KL and LCTL genes, with LCTL mRNA levels
being approximately 10 times higher than KL. Our results demonstrated that KL
protein increases phagocytosis and reduces VEGF secretion significantly in RPE.
Using Ca2+ imaging we demonstrated that KL protein regulates the activity of
TRPV5 in human RPE and increases the Ca2+ entry across the apical membrane.
We further demonstrated that both KL and LCTL are down regulated by oxidative
stress.
Conclusions: Our results show for the first time that KL regulates RPE functions
such as phagocytosis and VEGF secretion by increasing Ca+2 entry through
TRPV5 channels. Therefore, a decrease in KL expression during aging might be
directly implicated in AMD.
Commercial Relationships: Maria Kokkinaki, None; Gerard Ahern,
None; Mia Gunawan, None; Sanjai Jalaj, None; Nady Golestaneh, None
Support: Intramural GU grant
VEGF-A along with VEGFR2 Tyr951, Tyr996, & Tyr1175, by way of Reverse
Protein Microarray (RPPA). Patients who’s VA measurement increased by ≥10
letters (ETDRS) were considered responders, while everyone else was a nonresponder.
Results: A total of 41 patients were included; 14 were responders while 27 were
non-responders. There was a statistically significant difference (P=0.0082) in
VEGFR2 Tyr951 between responders (mean [SEM], 2.183 [.1769] relative value
units (RVU)) and non-responders (mean [SEM]. 1.622 [.1082] RVU). There is also
a significant difference (P=0.0259) between responders and controls (mean [SEM]
1.635 [.1625] RVU) also in VEGFR2 Tyr951. However, there is no significant
difference between the non-responder and control treatment response groups.
Conclusions: A significant amount of research now points to VEGFR2 as a major
signal transducer in angiogenic disease states. Mapping activated VEGF receptors
therefore becomes crucial to fully understanding initiation of angiogenesis.
Vitreous VEGF-A showed no significant difference between responders and nonresponders, however the activated receptor VEGFR2 Tyr951 showed a significant
difference between responders and non-responders as well as controls. Past studies
have implicated VEGFR2 Tyr951 as a critical regulator of endothelial cell
migration, as well as active angiogenesis. To fully understand the role of
angiogenesis in wAMD, VEGFR2’s role in phosphorylation must be understood
biochemically.
Commercial Relationships: Joshua C. Hines, Ocular Proteomics (E); Stephanie
Ecker, Ocular Proteomics (E); Bert M. Glaser, Ocular Proteomics (E)
Support: None
Program Number: 5305 Poster Board Number: A140
Presentation Time: 3:45 PM - 5:30 PM
TEAD4 Splice Variants from Mouse Neural Retina Increase VEGF Promoter
Activity in Muller Glia and a HIF1-negative Cell Line
Robert S. Cargill1A, Trevor J. McFarland1A, Michael H. Davies1B, Deborah C.
Otteson2, M R. Powers1B, J T. Stout1A, Binoy Appukuttan1A. ACasey Eye Institute,
B
Pediatrics and Ophthalmology, Casey Eye Institute, 1Oregon Health & Science
Univ, Portland, OR; 2Optometry, University of Houston, Houston, TX.
Purpose: TEAD4 has been found to influence VEGF promoter activity in 293T
and endothelial cells (EC), and is upregulated in the neural retina of a mouse model
of oxygen-induced retinopathy (OIR). In EC, TEAD4 is upstream of HIF1-α
signaling, enhancing HIF1-α transcription through binding MCAT-like sequences
in the HIF1-α promoter. Here, we examine the effect of four murine isoforms of
TEAD4 on VEGF promoter activity in Muller glia and other mammalian cells
under normoxic and hypoxic conditions. We also investigate whether HIF1
influences this activity.
Methods: Four splice variants of TEAD4 (427, 384, 202, and 159) were previously
cloned from OIR neural retina. MIO-M1 human and C57M10 mouse Muller glia
were cotransfected with each isoform and a reporter plasmid encoding a secretable
alkaline phosphatase (SEAP) driven by 1050bp of the mouse VEGF promoter.
Cells were incubated in normoxic or hypoxic conditions, and media was assayed
for SEAP. TEAD4 isoforms were also transfected individually, and secreted
VEGF165 levels were measured by ELISA. The reporter expression assay was
repeated in HIF1-negative C4 mouse hepatoma cells and compared to 1C1C7
controls.
Results: All four isoforms enhanced VEGF promoter activity in MIO-M1 and
293T cells, but surprisingly not within C57M10 cells. Promoter activity was
increased from 3- to 6-fold under normoxic conditions and 6- to 10-fold under
hypoxic conditions. Relative to the control, the longer 427 and 384 isoforms had no
effect on promoter activity in C4 or 1C1C7 cells. However, the two shorter
isoforms (202 and 159) enhanced promoter activity 2- to 3-fold in both C4 and
1C1C7 cells with no significant difference between cell lines (P <0.01).
Conclusions: Murine TEAD4 isoforms enhance VEGF promoter activity in human
Muller glia, with increased effect under hypoxia. The lack of effect in C57M10
cells suggests that cell-type specific cofactors may be necessary for their activity.
The results from C4/1C1C7 cells suggest that functional HIF1 is not required for
the shorter TEAD4 isoforms to regulate VEGF promoter activity. The absence of
activity of the two longer isoforms may indicate the involvement of YAP in these
cells, as the two shorter isoforms lack the C-terminal YAP-binding domain.
Commercial Relationships: Robert S. Cargill, None; Trevor J. McFarland,
None; Michael H. Davies, None; Deborah C. Otteson, None; M. R. Powers,
None; J. T. Stout, None; Binoy Appukuttan, None
Support: NIH:NEI:R01 EY019042; EY011548; Clayton Foundation for Research;
Research to Prevent Blindness
Program Number: 5307 Poster Board Number: A142
Presentation Time: 3:45 PM - 5:30 PM
Effect of IGF-1 and Pigment Epithelium Derived Factor on Epo Production in
hRPE Cells
Angeline L. Wang, Piyush Kothary, Monte Del Monte. Department of
Ophthalmology, University of Michigan, Ann Arbor, MI.
Purpose: Pathologic proliferation of vascular endothelial cells and retinal pigment
epithelial cells in the eye caused by various angiogenic growth factors contribute to
the development of blinding proliferative vitreoretinopathy. As previous studies
have demonstrated that insulin-like growth factor-1 (IGF-1) induces the production
of angiogenic factors such as VEGF, and as pigment epithelium-derived factor
(PEDF) inhibits glucose-stimulated production of erythropoietin (Epo), this study
investigated the effect of IGF-1 and PEDF on Epo production in in vitro human
retinal pigment epithelial (hRPE) cells.
Methods: Human RPE specimens were obtained from postmortem nonpathological eyes and cultured in vitro. Cellular proliferation in the presence of
increasing concentrations of FBS, IGF-1, and IGF-1 with PEDF was measured by
3H-thymidine incorporation; trypan blue exclusion studies verified cell viability.
Under the same experimental conditions, synthesis of Epo was measured utilizing
14C-methionine incorporation using immunoprecipitation and immunocytochemical methods.
Results: FBS stimulated hRPE cell proliferation in a dose-dependent manner, as
measured by trypan blue exclusion and 3H-thymidine incorporation in hRPE cells.
IGF-1 showed a further stimulatory effect on hRPE cell proliferation. IGF-1 also
stimulated 14C-Epo synthesis in hRPE cells in a dose-dependent manner, as
demonstrated by 14C-methionine immunoprecipitation. PEDF (10 ng/mL)
suppressed the stimulatory effect of IGF-1 (50 ng/mL) on hRPE cell number
(112,500±11,500 vs. 68,750±10,200, CPM±SEM, p<0.05,N=8) and
immunoprecipitated 14C-Epo (394.66±42.52 vs. 316.07±20.30, CPM±SEM,
p<0.05,N=16). This data was qualitatively confirmed by immuno-cytochemical
studies.
Conclusions: PEDF inhibits IGF-1 stimulation of Epo synthesis and hRPE cell
proliferation and may have therapeutic value in treating proliferative eye diseases.
Commercial Relationships: Angeline L. Wang, None; Piyush Kothary,
None; Monte Del Monte, None
Support: None
Program Number: 5306 Poster Board Number: A141
Presentation Time: 3:45 PM - 5:30 PM
Differentially Activated VEGF Receptors In The Vitreous Of Treatment Naïve
Eyes With Wet AMD
Joshua C. Hines, Stephanie Ecker, Bert M. Glaser. Ocular Proteomics, The
National Retina Institute, Towson, MD.
Purpose: This study aimed to profile the soluble, activated VEGF receptors in the
vitreous of eyes with wAMD during the course of bevacizumab treatment, versus
non-proliferative control samples.
Methods: 164 in-office vitreous samples were obtained from 41 wAMD patients.
Vitreous was aspirated from 24 control eyes prior to undergoing vitrectomy for
macular hole or retinal detachment. Each wAMD patient was treatment naïve with
the sample taken before initiation of anti-VEGF treatment, and also before each of
the next three subsequent treatments. All samples were aspirated via pars plana
approach, utilizing a 25 gauge needle with 1 mL syringe directed mid-vitreous
cavity and collecting approximately 0.05 to 0.10 mL. Samples were then probed for
Program Number: 5308 Poster Board Number: A143
Presentation Time: 3:45 PM - 5:30 PM
Pigment Epithelium Derived Factor (PEDF) Inhibits Activation of Stat3, an
Important Transcription Factor in Metastatic Ocular Melanoma
John Lattier1, Chaunte Stampley2, Hua Yang1, Manuela Bartoli2, Hans
Grossniklaus1. 1Ophthalmology, Emory University, Atlanta, GA; 2Ophthalmology,
Georgia Health Sciences University, Augusta, GA.
Purpose: To determine the effects of pigment epithelium derived factor (PEDF) on
Stat3 activation. Stat3 is a pro-metastatic transcription factor that requires
phosphorylation at Tyr-705 in order to dimerize, translocate to the nucleus, and
bind DNA. In cases of metastatic uveal melanoma, the most common form of eye
cancer in adults, the liver is the predominant site of metastasis. PEDF is a secreted
protein in the liver that inversely correlates with metastatic tumor growth as shown
in PEDF-/- C57BL/6 mice. We hypothesize that PEDF has an inhibitory effect on
Stat3 phosphorylation thus preventing metastatic melanoma growth.
Methods: Using bovine retinal endothelial cells (BREC) in serum-free media, an
Copyright 2012 by the Association for Research in Vision and Ophthalmology, Inc., all rights reserved. For permission to reproduce any abstract, contact the ARVO Office at pubs@arvo.org.
ARVO 2012 Annual Meeting Abstracts by Scientific Section/Group – Biochemistry/Molecular Biology (BI)
established cell line for studying Stat3, phosphorylation of Stat3 at Tyr-705 was
induced by one hour in hypoxic conditions at 1% O2. Control cells were grown at
20% O2. Cells were treated with 50ng/mL PEDF, either for 30minutes prior to
hypoxia or at the midpoint of 1 hour in hypoxia. Separately, Stat3 was activated by
20ng/mL VEGF for 30 minutes versus non-treated control cells. To test the effect
of PEDF on VEGF-mediated Stat3 phosphorylation, cells were pre-treated with
50ng/mL PEDF for 5 minutes before VEGF treatment. Additionally, cells were
treated with 50ng/mL PEDF alone for either 5, 15, 30, or 60 minutes. Protein was
collected, and western blots were performed.
Results: Hypoxia and VEGF treatment both upregulated Stat3 phosphorylation
versus control. PEDF treatment, both before and during hypoxia, and before VEGF
treatment, returned phospho-Stat3 to control levels. PEDF alone, however,
upregulated Stat3 phosphorylation versus control.
Conclusions: PEDF has an inhibitory effect on Stat3 activation in both hypoxic
and VEGF-rich culture conditions. Conversely, PEDF alone promotes Stat3
activation. Thus, PEDF treatment may not have an anti-metastatic effect unless the
system is hypoxic or if VEGF is already present.
Commercial Relationships: John Lattier, None; Chaunte Stampley,
None; Hua Yang, None; Manuela Bartoli, None; Hans Grossniklaus, None
Support: NIH EY007092
Program Number: 5309 Poster Board Number: A144
Presentation Time: 3:45 PM - 5:30 PM
Genomic Stability in Sleeping Beauty transposon-mediated transfection of
RPE cells with the gene for PEDF
Anna Katharina Röpke1, Sandra Johnen2A, Matthias Fuest1, Peter Walter2B,
Gabriele Thumann2B. 1Ophthalmology, RWTH Aachen, Aachen, Germany; AIZKF
Aachen, BDepartment of Ophthalmology, 2RWTH Aachen University, Aachen,
Germany.
Purpose: The frequent intravitreal injections of VEGF inhibitors necessary to
control choroidal neovascularization in exudative AMD patients are accompanied
by side effects such as scleral hemorrhage, endophthalmitis, retinal tears, and
retinal detachment. To deliver a continuous level of a VEGF inhibitor subretinally,
we have transfected RPE cells with the gene for PEDF, an anti-angiogenic and
neuroprotective factor, for eventual transplantation to the subretinal space.
Transfection was accomplished using the hyperactive Sleeping Beauty (SB100X)
transposon system, which results in transgene integration into the host cell’s
genome. Here we have analyzed the expression of important genes to insure that
the integration of the PEDF gene does not alter the expression of genes critical to
RPE function.
Methods: Using the SB100X transposon system we transfected ARPE-19 cells with
the PEDF gene with 30% efficiency. Quantitative Real-Time PCR was performed
to analyze expression levels of genes essential for RPE function, specifically the
genes for PEDF, the cytokeratins KRT8 and KRT18, the tight junction protein ZO1, the angiogenic factor VEGF-A, cathepsin D, the nuclear transcription factor NFkB, the proto-oncogene c-ABL, the cellular tumor antigen p53, the stress-activated
protein kinase JNK1, the visual cycle protein CRALBP, and the apoptosis regulator
Bcl-2.
Results: As expected, PEDF gene expression was increased in the transfected
cells, which secreted 12.54 ± 0.85 ng/h/105 cells, whereas non-transfected ARPE19 cells secreted detectable levels that could not be quantified. No significant
changes in expression levels for KRT8, KRT18, ZO-1, VEGF-A, cathepsin D, NFkB, c-ABL, the cellular tumor antigen p53, JNK1, CRALBP, and Bcl-2 were
observed.
Conclusions: Transfection with the hyperactive SB100X transposon system insures
that the transgene becomes integrated into the host cell’s genome. Here we have
shown that the expression of the PEDF gene is increased without any significant
alteration in the expression of a number of genes essential for the normal RPE cell
function.
Commercial Relationships: Anna Katharina Röpke, None; Sandra Johnen,
None; Matthias Fuest, None; Peter Walter, None; Gabriele Thumann, None
Support: None
Program Number: 5310 Poster Board Number: A145
Presentation Time: 3:45 PM - 5:30 PM
Arpe-19 Cells Survive During Tgf-β Induced EMT by Adopting Survivin
Jungeun Lee1A, Jae Il Ahn1A, Jung-Ha Choi1A, Choun-Ki Joo1A,1B. ACatholic
Institutes of Visual Science, BDepartment of Ophthalmology & Visual Science,
College of Medicine, 1The Catholic University of Korea, Seoul, Republic of Korea.
Purpose: Members of the transforming growth factor (TGF-β) superfamily are
multifunctional cytokines that regulate cellular processes, including cell-cycle
arrest, differentiation, morphogenesis, and apoptosis. TGF-β promotes extracellular
matrix production and suppresses cell proliferation. Morphogenetic responses to
TGF-β members include cell migration and epithelial-mesenchymal transitions
(EMTs), which are critical during embryogenesis, development of fibrotic diseases,
and advanced carcinoma spreading. The purpose of this study were to clarify how
can survive human retinal pigment epithelial cells during TGF-β induced EMT.
Methods: Serum-starved ARPE-19 cells were incubated with vehicle alone or
10ng/ml TGF-β1 and we screened the expression of Survivin using RT-PCR and
Western blot analysis in TGF-β1 treated cells. Furthermore, we confirmed this
event using the Proteom profiler. Using siRNA targeting for Survivin, we show that
these proteins are critical to TGF-β1 induced EMT.
Results: RT-PCR, Western analysis and Proteom profiler was revealed that the
expressions of survivin in ARPE-19 cells treated with TGF-β1. Using siRNA
targeting for Survivin, we show that EMT marker is down regulated in TGF-β1
treated ARPE-19 cells lacking survivin compared to control cells treated with TGFβ1 only.
Conclusions: In conclusion, we showed that induction of EMT in human RPE cells
led to up-regulation of Survivin expression, and inhibition of Survivin limited the
development of EMT. We demonstrate that Survivin involves in the Transforming
Growth Factor β1-mediated Epithelial-Mesenchymal Transition of retinal pigment
epithelial cells.
Commercial Relationships: Jungeun Lee, None; Jae Il Ahn, None; Jung-Ha
Choi, None; Choun-Ki Joo, None
Support: National Research Foundation of Korea(NRF) Grant 2011-0013562
Program Number: 5311 Poster Board Number: A146
Presentation Time: 3:45 PM - 5:30 PM
Inflammatory Cytokines Decrease the Expression of RDH5 and RDH10 Genes
in Human Retinal Pigment Epithelial Cells in Culture
R K. Kutty1A, A. Cherukuri1A, C N. Nagineni1B, W. Samuel1A, T. Duncan1A, C.
Jaworski1A, J J. Hooks1B, T M. Redmond1A. ALaboratory of Retinal Cell and
Molecular Biology, BLaboratory of Immunology, 1National Eye Institute, National
Institutes of Health, Bethesda, MD.
Purpose: Atrophy of the retinal pigment epithelium (RPE) which is often
associated with age-related macular degeneration (AMD) could stem from the
impaired response of the RPE to the inflammatory mediators produced by
infiltrating lymphocytes and macrophages. The inflammatory mediators could elicit
their effect by perturbing the expression of important genes such as those involved
in the retinoid metabolism in the RPE cells. The objective of the present study is to
identify genes whose expression in the human RPE cells is modulated by the
inflammatory cytokines IFN-γ, TNF-α and IL-1β.
Methods: Confluent cultures of adult human RPE cells established from donor
eyes were treated with the inflammatory cytokine mixture (IFN-γ + TNF-α + IL1β) in a serum free medium for various time intervals. The total RNA fraction was
then isolated for microarray analysis of gene expression with Affymetrix GeneChip
arrays. Real-time PCR analysis was performed using TaqMan reagents (Applied
Biosystems) with GAPDH as an endogenous control.
Results: Microarray analysis showed that the human RPE cells in culture respond
to the inflammatory cytokines (IFN-γ, TNF-α and IL-1β) by markedly decreasing
the expression of retinol dehydrogenase genes RDH5 and RDH10. Real-time PCR
analysis showed that the cytokine treatment resulted in more than 90% reduction in
the expression of both RDH5 and RDH10. The decrease in the expression of these
genes was both time- and concentration-dependent, and was observed even when
the cells were treated for 16 hours with concentrations of IFN-γ, TNF-α and IL-1β
as low as 1 unit/ml, 0.1 ng/ml and 0.1 ng/ml, respectively. IFN-γ, TNF-α or IL-1β
when tested individually showed similar ability to decrease the RDH5 and RDH10
expression in the RPE cells, however, the combination of IFN-γ with either TNF-α
or IL-1β elicited the maximum response. The human RPE cell line ARPE-19 also
responded to the cytokine mixture by drastically decreasing the expression of
RDH5 and RDH10.
Conclusions: We have shown that the inflammatory cytokines could adversely
affect the expression of retinol dehydrogenase genes RDH5 and RDH10 in the
human RPE cells. The enzyme encoded by the RDH5 gene is thought to catalyze
the conversion of 11-cis-retinol into 11-cis-retinal in the RPE cell, a key step in the
regeneration of the visual pigment, and mutations in this gene are known to cause
fundus albipunctatus. Thus, the inflammatory cytokines could cause RPE
dysfunction by their ability to potentially impair visual function by targeting the
RDH5 gene.
Commercial Relationships: R. K. Kutty, None; A. Cherukuri, None; C. N.
Nagineni, None; W. Samuel, None; T. Duncan, None; C. Jaworski, None; J. J.
Hooks, None; T. M. Redmond, None
Support: Intramural Research Program of the National Eye Institute, National
Institutes of Health
Program Number: 5312 Poster Board Number: A147
Presentation Time: 3:45 PM - 5:30 PM
Ceramide And Cytokine In Light-induced Retinal Degeneration
Isabelle Ranchon-Cole1A, christine Cercy1A, Marjolaine Vareille1B, Michel Doly1A.
A
Biophysique des Handicaps Sensoriels, BLaboratoire d'immunologie, 1Universite d
Auvergne, Clermont-Ferrand, France.
Purpose: Recent studies have defined the sphingomyelin signal transduction
pathway as an upstream mechanism for mediating apoptosis for several cell surface
receptors and environmental stresses. In addition, ceramide accumulation mediates
inflammation and cell death. In the present study, we have evaluated the level of
ceramide and cytokines during light-induced retinal degeneration with a particular
Copyright 2012 by the Association for Research in Vision and Ophthalmology, Inc., all rights reserved. For permission to reproduce any abstract, contact the ARVO Office at pubs@arvo.org.
ARVO 2012 Annual Meeting Abstracts by Scientific Section/Group – Biochemistry/Molecular Biology (BI)
interest at 4 hours of light exposure which is the last time point before apoptotic
nuclei can be detected in the retina.
Methods: Albinos Wistar rats were raised in dim cyclic light. At the age of 7-8
weeks they were dark-adapted overnight before being exposed to 3400 lux for up to
24 hours. Retinas were harvested before exposure to the damaging light, at 4 hours
of light exposure, at the end of light exposure and 1 or 3 days after the end of light
exposure. Neutral lipids molecular species and ceramide-sphingomyelin were
analysed by gas-liquid chromatography. IL-6, IL-23 and TNF-α were quantified by
ELISA Kit.
Results: At 4 hours of light-exposure, there was a significant decrease of the total
neutral lipids compared to unexposed retinas. The total monoglycerides,
cholesterol, total diacylglycerol, sphingomyelin and ceramide were significantly
decreased but there was no significant variation in the total esterified-cholesterol or
total triglycerides. IL-6 could not be detected in the retina except at the end of the
24 hours of light-exposure with 3 ± 2 pg/mg proteins. TNF-α did not vary
significantly at any experimental time point. In contrary, IL-23 was detected in the
un-exposed retinas and significantly increased by 256% at the end of light-exposure
(24h) and stay at a high level up to 7 days after light exposure.
Conclusions: Ceramide or cytokines do not seem to play a role in the initiation of
apoptosis but IL-23 may be involved in the sustained of the process.
Commercial Relationships: Isabelle Ranchon-Cole, None; christine Cercy,
None; Marjolaine Vareille, None; Michel Doly, None
Support: None
Program Number: 5313 Poster Board Number: A148
Presentation Time: 3:45 PM - 5:30 PM
Effect Of The PPARγ Agonist On The Fibrotic Change In Primate Retinal
Pigment Epithelial Cells
Hiroki Hatanaka1, Naoki Okumura2, Noriko Koizumi2, Eri Mizuhara2, Junji
Hamuro1, Shigeru Kinoshita1. 1Ophthalmology, Kyoto Prefectural Univ of Med,
Kyoto, Japan; 2Biomedical Engineering, Faculty of Life and Medical Science,
Doshisha university, Kyotanabe, Japan.
Purpose: Proliferative eye diseases such as proliferative vitreoretinopathy and
proliferative diabetic retinopathy are a major cause of blindness. These diseases are
mainly caused by the fibrotic change of retinal pigment epithelial cells (RPEs). The
purpose of this present study was to examine the effect of the peroxisome
proliferator-activated receptor γ (PPARγ) agonist on the anti-fibrotic effect of
primary cultured primate RPEs.
Methods: Monkey RPEs (MRPEs) were isolated from the eyes of 10 cynomolgus
monkeys and then subcultured with culture medium containing 2% fetal bovine
serum. As a fibrotic group, MRPEs were cultured with medium containing TGF-β2
(3ng/ml) for 48 hours. As a PPARγ agonist-treated group, MRPEs were cultured
with medium containing TGF-β2 and PPARγ agonist (30 µM). Culture medium
without TGF-β2 was used as a control. The phenotype of MRPEs was evaluated by
phase contrast microscopy and by immunohistochemical analysis of functionrelated markers ZO-1, Na+/K+-ATPase, and RPE65. The production of extracellular
matrix was determined by quantitative real-time polymerase chain reaction (PCR)
for collagen type-1 mRNA. The phosphorylation of Smad2 protein was examined
by Western blot analysis.
Results: MRPEs were cultured as a monolayer and with a hexagonal cell shape,
and positive expression of ZO-1, Na+/K+-ATPase, and RPE65 was confirmed. Cell
morphology and the expression of those markers were maintained in the PPARγ
agonist-treated group. In the fibrotic group, the cells were elongated with evident
stress fibers and the expression of markers was found to be decreased. The level of
collagen type-1 mRNA was found to be decreased in the PPARγ agonist-treated
group, however, it was increased in the fibrotic group (94.3% and 151.5% vs
control, respectively). Western blot assay demonstrated that phosphorylation of
Smad2 protein induced by TGFβ2 was suppressed by the PPARγ agonist.
Conclusions: The findings of this study demonstrate that the PPARγ agonist
inhibits the fibrotic change of RPE through the suppression of TGFβ signaling. We
speculate that the PPARγ agonist might be an applicable and effective
pharmaceutical treatment for proliferative eye diseases.
Commercial Relationships: Hiroki Hatanaka, None; Naoki Okumura,
None; Noriko Koizumi, None; Eri Mizuhara, None; Junji Hamuro,
None; Shigeru Kinoshita, None
Support: None
Program Number: 5314 Poster Board Number: A149
Presentation Time: 3:45 PM - 5:30 PM
Cyclic Stretch And Hypertension Increase Retinal Succinate And Fumarate:
Potential Mechanisms For Exacerbation Of Ocular Neovascularization By
Mechanical Stress
Hirofumi Kinoshita1, Kiyoshi Suzuma1, Toshihide Maki2, Makiko Matsumoto1, Mao
Kusano1, Masafumi Uematsu1, Takashi Kitaoka1. 1Ophthalmology, Nagasaki Univ
School of Medicine, Nagasaki, Japan; 2Joint Research Center, Nagasaki University,
Nagasaki, Japan.
Purpose: Recently it is suggested that posterior vitreomacular adhesion is a
potential risk factor for exudative age-related macular degeneration (AMD) and the
succinate receptor GPR91 in neurons has a major role in retinal angiogenesis. We
evaluated the expression of succinate in retinal pigment epithelial (RPE) cells
undergoing clinically relevant cyclic stretch to reveal role of succinate and
mechanical stress in AMD.
Methods: Succinate extracted from ARPE19 cells, a human RPE cell line, in
culture undergoing mechanical stretch was evaluated. Cells were seeded on sixwell flexible-bottom plates coated with collagen1. When cells were cultured to near
confluency, cells were subjected to a 5, 10 or 15% cyclic stretch maintained for 148 hours using a computer-controlled vacuum stretch apparatus (Flexcer Cell Strain
Unit; Flexcel). The medium was decanted and cells lysed directly in the culture
plates with TNE buffer. Succinate concentration was assessed by enzymatic
analysis of succinate and high performance liquid chromatography mass
spectrometry (HPLC/MS), and normalized with total protein quantity. Moreover
succinate concentration after treatment with pharmacological inhibitors was
evaluated to speculate the pathway of succinate activity in cells. And fumarate
concentration, Krebs cycle intermediate, was also assessed by HPLC/ MS. In vivo,
Succinate concentration in retina and vitreous body of SHR; Spontaneously
Hypertensive rat (hypertensive model; non-treatment group and captopril treated
group), WKY; Wistar Kyoto rat (normal model) were also evaluated.
Results: 10% cyclic stretch maximally increased succinate (mg)/ total protein (g)
after 2 hours (25.3 ± 5.7mg/g; P<0.05 Tukey test). BAPTA/AM, an intracellular
calcium chelator, inhibited stretch-induced succinate increase in cells significantly
(17.2 ± 6.2mg/g) by 86.9%. Succinate concentration in retina and vitreous body of
SHR (non-treatment group) were significantly increased compared to that in WKY
rat, SHR (captopril treated group)(16.5 ± 3.3mg/g versus 12.7 ± 3.3mg/g, 12.4 ±
1.7mg/g respectively; P<0.05 Tukey test). Fumarate concentration in retina and
vitreous body of SHR (non-treatment group) was significantly increased compared
to that in WKY rat (P<0.05 Tukey test), as well succinate concentration.
Conclusions: Cyclic stretch increased intracellular succinate concentration in
cultured RPE cells through a calcium dependent pathway. Our data suggest that
succinate has a role in pathology of AMD, and may be a target for medical
treatment.
Commercial Relationships: Hirofumi Kinoshita, None; Kiyoshi Suzuma,
None; Toshihide Maki, None; Makiko Matsumoto, None; Mao Kusano,
None; Masafumi Uematsu, None; Takashi Kitaoka, None
Support: None
504 Retinal Biochemistry and Gene Expression
Thursday, May 10, 2012, 8:30 AM - 10:15 AM
Room 305 Paper Session
Program #/Board # Range: 5583-5589
Organizing Section: Biochemistry/Molecular Biology
Program Number: 5583
Presentation Time: 8:30 AM - 8:45 AM
The N-fatty Acyl Group In A Bovine Guanylyl Cyclase Activating Protein-1
Provides Intramolecular Tuning Of Its Calcium Sensitivity And Interaction
With The Effector Enzyme
Igor V. Peshenko1, Elena V. Olshevskaya1, Sunghyuk Lim2, James B. Ames2,
Alexander M. Dizhoor1. 1Pennsylvania College of Optometry, Salus University,
Elkins Park, PA; 2Department of Chemistry, University of California, Davis, CA.
Purpose: Guanylyl cyclase activating protein 1 (GCAP1), N-myristoylated
neuronal calcium sensor protein, regulates retinal guanylyl cyclase (RetGC) in
response to light-dependent changes in free calcium concentrations in
photoreceptors. We studied how the interactions between myristoyl group and
protein surrounding affected functional properties of GCAP1.
Methods: Mutations were introduced to the hydrophobic pocket formed by the
parts of EF-hand 1 and 2 and the C-terminal alpha-helix in order to modulate
interactions of the N-myristoyl residue with the surrounding amino acid side
chains. We tested the stoichiometry of Ca2+ binding, Ca2+-sensitive activation of
RetGC1, and the intrinsic tryptophan fluorescence of the mutated GCAP1 in the
presence and in the absence of the N-myristoyl group. The position of the myristoyl
moiety inside the hydrophobic pocket of GCAP1 between different functional
states was verified by NMR-spectroscopy.
Results: The absence of myristoyl moiety did not unfold GCAP1, but decreased
Ca2+ sensitivity of GCAP1, its apparent affinity for RetGC, and the maximal level
of cyclase activation. The myristoyl residue surrouned by EF hands 1 and 2
critically affected Ca2+ binding in the opposite part of the molecule formed by EF
hands 3 and 4. According to NMR spectra, myristoyl remained constrained inside
the EF1/EF2 semi-globule both in the Ca2+-bound (RetGC inhibitor) and Mg2+bound (RetGC activator) states in L80F/L176F/V180F mutant. This mutant
displayed much higher than wild type affinity for the cyclase, but much lower than
the wild type sensitivity to Ca2+. The Phe176 drastically increased the apparent
affinity of GCAP1 for the cyclase and also altered Ca2+-sensitivity of the RetGC
regulation by shifting it to a higher than normal range of free Ca2+. In comparison
with mutations at the mid-portion of the fatty acyl group, substitutions at the
bottom and the top of the hydrophobic cavity affected the regulatory properties of
GCAP1 to a lesser extent.
Conclusions: The fatty acyl group in GCAP1, through its interaction with the C-
Copyright 2012 by the Association for Research in Vision and Ophthalmology, Inc., all rights reserved. For permission to reproduce any abstract, contact the ARVO Office at pubs@arvo.org.
ARVO 2012 Annual Meeting Abstracts by Scientific Section/Group – Biochemistry/Molecular Biology (BI)
terminal helix that bridges the N- and the C-proximal portions of the molecule,
creates a dynamic tug that tunes GCAP1 into the optimal conformation as a cyclase
regulator, by balancing the effectiveness of the interaction with the target enzyme
with the optimal Ca2+ sensor function.
Commercial Relationships: Igor V. Peshenko, None; Elena V. Olshevskaya,
None; Sunghyuk Lim, None; James B. Ames, None; Alexander M. Dizhoor,
None
Support: EY11522, EY012347, Pennsylvania Department of Health
retina.
Program Number: 5584
Presentation Time: 8:45 AM - 9:00 AM
Alzheimer Retina Pathology in a Novel Animal Model of Neuropathology in
Diabetes
Peter Frederikse1, Raj Kaswala2, William Klein3, Chinniswamy Kasinathan2.
1
Phamacology & Physiology, UMD New Jersey Medical School, Newark, NJ;
2
Oral Biology, UMD New Jersey Dental School, Newark, NJ; 3Neurobiology &
Physiology, Northwestern University, Evanston, IL.
Purpose: Alzheimer pathology in retinal degeneration and diabetic retinopathy is
key to understanding neuropathological mechanisms in this neural tissue in aging
and diabetes. Considerable epidemiological, cell biology & clinical evidence links
Alzheimer’s disease (AD) Abeta pathology with diabetes & insulin dysfunction.
However, suitable animal models were cited as a block to understanding these
relationships. We report on Alzheimer pathology in retina in diabetic genetically
unmodified rabbits. The rabbit model includes system-wide physiological AbetaPP
expression that normally generates human-sequence Abeta, which is key in AD
studies, with relatively rapid onset of substantial pathology.
Methods: wt 4 mos-old NZ white rabbits were induced to become diabetic with
alloxan and examined after 15 wks sustained blood glucose >350mg/dl. anti-Abeta
peptide and oligomer-specific antibodies detected pathology in situ. Anti-RAGE
detected Receptors for Advanced Glycation End-products, that increase with high
glucose stimulated glycation reactions that also generate reactive oxygen species.
Results: Substantial Abeta and RAGE accumulation occurred in ganglion cell and
inner nuclear cell layers of diabetic retinas, with spontaneous production and
accumulation of Abeta oligomers overlapping with Abeta in diabetic retinas. Abeta
distribution in diabetic retinas was remarkably similar to accumulations in retina at
14 mos in classic Tg2576 AD mice, shown by others.
Conclusions: Substantial Abeta pathology was produced in the retina in a novel
model of diabetic retinopathy in genetically unmodified rabbits, due to diabetes
alone. Abeta oligomers, shown to be a key neurotoxic form of Abeta, were
spontaneously produced in diabetic retinas and accumulated in ganglion cell and
inner nuclear cell layers. Our study identifies emergence of Alzheimer pathology in
the retina as a major consequence of diabetes; implicating dysfunctional insulin
signaling in the relationship between Abeta neurotoxins and retinal degeneration in
aging and diabetes, similar to brain. AD-type pathology in genetically unmodified
rabbits calls attention to the considerable potential of the model for investigations
of Alzheimer pathogenesis, diagnostics and therapeutics in the
Commercial Relationships: Peter Frederikse, NJMS 10-16 (P); Raj Kaswala,
None; William Klein, None; Chinniswamy Kasinathan, NJMS 10-16 (P)
Support: EY015855
Program Number: 5585
Presentation Time: 9:00 AM - 9:15 AM
Rescue Of Photoreceptor Degeneration In Rd1 Mice By Systemic Treatment
With Valproic Acid
Kenneth P. Mitton, Edward E. Guzman, David Byrd, Trung Tran, Jason Sotzen.
Eye Research Institute, Oakland University, Rochester, MI.
Purpose: Valproic acid (VPA) is an anticonvulsant, and a histone deacetylase
inhibitor, that will be evaluated for neuroprotection in new RP clinical trials in the
United States and Korea. Unfortunately, few studies exist to evaluate the effects of
systemic VPA, good or bad, with animal models of retinal degeneration. We
examined photoreceptor loss and neurotrophic gene expression in retinas of Rd1
mice treated with systemic VPA .
Methods: Rd1 mice were treated with daily doses of VPA (IP) during the post
natal period of rapid photoreceptor (rod) loss that is characteristic of this model. To
Copyright 2012 by the Association for Research in Vision and Ophthalmology, Inc., all rights reserved. For permission to reproduce any abstract, contact the ARVO Office at pubs@arvo.org.
ARVO 2012 Annual Meeting Abstracts by Scientific Section/Group – Biochemistry/Molecular Biology (BI)
determine if systemic VPA (non-ocular) can change retinal gene expression, we
measured the expression of Bdnf, Gdnf and Cntf after single and multiple doses of
VPA in Rd1 and wild-type mice.
Results: A single IP injection of VPA, caused a substantial increase and decrease
in retinal neurotrophic factor gene expression (Gdnf, Cntf) in the post-natal retina
within 18 hrs. There were no apparent differences in neurotrophic factor gene
expression in the normal maturing neural retina after multiple days of dosing.
Expression of these genes were not affected in the normal adult neural retina after a
single VPA dose (IP). Daily injections with VPA (P9-P19) rescued a significant
number of rod photoreceptors in Rd1 mice. At P20, VPA injected mice had several
extra rows of photoreceptor nuclei, compared to their PBS injected litter mates that
had a single row of nuclei at P20. Dosing much later from P14 to P19 also rescued
a significant number of photoreceptors.
Conclusions: Single doses of VPA (IP), can cause significant changes to
neurotrophic factor gene expression within in the neural retina. These differences
vanish after multiple daily dosing. Systemic daily dosing with VPA significantly
slowed the loss of photoreceptors in the Rd1 model of rapid retinal degeneration.
Thus systemic VPA might have beneficial effects for specific forms of retinal
degeneration. VPA can increase or decrease the expression of different
neurotrophic genes in the neural retina. Thus, we must also caution that VPA's
effects on individual genes are clearly unpredictable, may vary in context (normal
or disease), and should be explored for all genes and in many available RP models.
Commercial Relationships: Kenneth P. Mitton, None; Edward E. Guzman,
None; David Byrd, None; Trung Tran, None; Jason Sotzen, None
Support: ROPARD, CBR-Oakland University, NIHNEI
Program Number: 5586
Presentation Time: 9:15 AM - 9:30 AM
GSK3-Mediated Phosphorylation Regulates the Stability of NRL
Jerome E. Roger, Keerthi Ranganath, Hannah Breit, Jessica Chang, Anand
Swaroop. Neurobiol-Neurodegnt'n Rep Lab, NEI / National Institutes of Health,
Bethesda, MD.
Purpose: Transcription factor activity can be modulated by post-translational
modifications (PTM) such as phosphorylation, SUMOylation, and acetylation.
Neural Retina Leucine zipper (NRL) is a basic motif-leucine transcription factor
necessary for rod photoreceptor differentiation. Our previous work demonstrated
the importance of PTM in regulating NRL transcriptional activity (such as
SUMOylation on K20 and phosphorylation on S50). In addition, mutations of
codon 50 (S50T) and 51 (P51S) that alter phosphorylation are associated with
human autosomal dominant retinitis pigmentosa (ADRP). This study was
undertaken to identify the kinase(s) that control NRL phosphorylation and
investigate the consequence on NRL function.
Methods: HEK293T cells were transfected with different NRL phosphorylation
mutants. Cell extracts were analyzed by immunoblotting or immunocytochemistry.
In some experiments, transfected cells were treated with MG132 and/or
cyclohexamide. In vitro kinase assays were performed.
Results: In silico analysis suggested sequential phosphorylation of NRL by
glycogen synthase kinase 3-beta (GSK3β) on S46, T42 and S38. We demonstrated
that mutations of S38 through S50 decreased the number of phosphorylated NRL
isoforms, and complete phosphorylation of NRL required a priming
phosphorylation of S50 by a kinase yet to be identified. We showed by in vitro
kinase assay that GSK3β directly phosphorylated NRL. Co-transfection of Nrl
mutants with GSK3β confirmed the sequential phosphorylation of NRL from S46
to S38. GSK3β-dependent phosphorylation triggered NRL poly-ubiquitination and
degradation by the proteasome, which was blocked with S50 and S38 NRL
mutants. Human mutations S50T and P51S showed a longer half-life compared to
wild-type (WT) NRL, confirming GSK3β’s role in regulation of NRL protein
stability. Exposure of dark-adapted WT mice to bright light (10,000 Lx) for 1 hour
caused a rapid decrease in NRL protein but no change in amount of transcript.
Conclusions: Our study suggests that regulation of NRL stability by
phosphorylation participates in preserving photoreceptor integrity in the retina
under specific stress conditions.
Commercial Relationships: Jerome E. Roger, None; Keerthi Ranganath,
None; Hannah Breit, None; Jessica Chang, None; Anand Swaroop, None
Support: NIH/NEI Intramural funding
Program Number: 5587
Presentation Time: 9:30 AM - 9:45 AM
Aberrent Regulation of NFkB Activity in Immunoproteasome-deficient
Retinal Pigment Epithelial Cells
Deborah A. Ferrington, Marcela Maldonado, Marcia R. Terluk, Rebecca J.
Kapphahn, Neal D. Huess, Dale S. Gregerson, Ching Yuan. Ophthalmology,
University of Minnesota, Minneapolis, MN.
Purpose: The immunoproteasome is a protease that is abundant in cells of the
immune system, found in non-immune tissues, and known to generate peptides for
presentation on MHC class I molecules. Recent evidence supports a novel role in
the cellular stress response. Activation of the NFkB pathway, which is controlled
by proteasomal degradation of NFkB regulators, is the primary response to a
myriad of stressors. The current study tests the hypothesis that immunoproteasome
assists in regulating NFkB.
Methods: Retinal pigment epithelial (RPE) cells derived from WT and KO mice
lacking either one (L2, lmp2-/-) or two (L7M1, lmp7-/-/mecl-/-) catalytic subunits of
the immunoproteasome were used. Phagocytic activity was evaluated by flow
cytometric-detection of internalized one micron fluorescent-labeled beads.
Immunohistochemistry, qRT-PCR, and Western blotting were used to evaluate
morphological characteristics and expression of prototypic epithelial cell markers,
including pigment epithelium derived factor (PEDF) and RPE65. Cells were
incubated with TNFa to activate NFkB. Activation of NFkB family members (p65,
p50, p52, cRel, RelB) was evaluated from their nuclear localization using Western
blotting and the ELISA-based TransAM Activation Assay. Expression of NFkBregulated genes was monitored by ELISA for the secreted protein IL6 or
quantitative real-time PCR for IL6, COX2, iNOS, and IkBa.
Results: Cultured RPE cells from WT and KO mice maintain their phagocytic
activity, epithelial morphology, and expression of PEDF and RPE 65. Incubation of
RPE with TNFa showed significant differences in response between WT and
immunoproteasome-deficient cells. Comparing levels of secreted IL6 and COX2
expression, L7M1-deficient RPE cells were hyper responsive to TNFa compared
with WT and L2-deficient RPE. L2-deficient cells exhibited no upregulation of
iNOS and IkBa compared to the robust response from WT cells. Activation of
NFkB showed early nuclear translocation for p65 and p52 and a late response for
RelB in all cells. However, responses unique to L2-deficient cells include
activation of p50 and a dramatic decrease in cRel.
Conclusions: These results show aberrant regulation of NFkB activity in
immunoproteasome- deficient RPE and suggest a key role for immunoproteasome
in regulating NFkB signaling.
Commercial Relationships: Deborah A. Ferrington, None; Marcela
Maldonado, None; Marcia R. Terluk, None; Rebecca J. Kapphahn, None; Neal
D. Huess, None; Dale S. Gregerson, None; Ching Yuan, None
Support: NIH grant EY013623 and an unrestricted grant to the Dept of
Ophthalmology from Research to Prevent Blindness
Program Number: 5588
Presentation Time: 9:45 AM - 10:00 AM
Cis-regulation of Lif mRNA stability in Muller cells
Cavit Agca, Ghislaine Traber, Christian Caprara, Christel Beck, Isabelle MariePaule Meneau, Christian Grimm. Ophthalmology, University of Zurich, Zurich,
Switzerland.
Purpose: Leukemia inhibitory factor (LIF) is an important endogenous factor for
photoreceptor protection. Lif is known to be upregulated both in induced and
inherited disease models of photoreceptor degeneration only in a subset of Muller
cells, however little is known about its regulation during a photoreceptor injury.
Since Lif is induced in Muller cells in response to photoreceptor injury, we studied
its regulation in Muller cells both in vivo and in vitro and elucidated cis-regulatory
elements that are responsible for the post-transcriptional regulation of Lif
transcripts as well as the upstream factors that are potentially involved. We have
also generated a BAC-transgenic mouse expressing a LIF::EGFP fusion protein to
study the Lif-expressing subset of Muller cells in vivo.
Methods: Reporter constructs, which carry fragments of the Lif 3′UTR fused to the
luciferase gene are utilized to test the effects on mRNA stability. The rMC-1 cells
were transfected with unstable Luciferase expressing constructs. Relative
Luciferase levels were determined by Luciferase assays. Mice were injected
intravitreally with recombinant TNF-alpha and an inhibitor of P38 MAPK to
determine their effects on Lif expression in vivo. Retinas were collected and Lif
levels were determined by RT-PCR.
Results: Mouse Lif has several AU-rich elements that are dispersed within its 3`
UTR. Two of the tested elements induced a significantly higher instability, which
was verified by deletion and insertion experiments. Sequence comparison of these
non-coding regions showed a strong conservation between vertebrates, suggesting a
common mechanism for Lif regulation. These results are also consistent with our
previous (unpublished) data showing that the Lif mRNA turnover is influenced by
H2O2 in rMC-1 cells. Moreover, intravitreal injections of TNF-alpha induced Lif
upregulation in a similar fashion to our in vitro studies and blocking the P38
MAPK pathway inhibits this upregulation.
Conclusions: These results strongly argue that mouse Lif mRNA is at least
partially regulated by its 3`UTR region and that P38 MAPK pathway may be
involved through a redox-dependent pathway. The identified AU-rich elements
which are responsible for the high instability of Lif transcripts reside in highly
conserved regions among vertebrates. This suggests that the post-transcriptional
regulation of Lif transcripts is evolutionarily conserved and that these elements
may also be functional in other vertebrates including humans. Since Lif has been
shown to be an integral part of retinal endogenous protective pathway , these
results will contribute to a better understanding of neuroprotection in retinal
diseases.
Commercial Relationships: Cavit Agca, None; Ghislaine Traber,
None; Christian Caprara, None; Christel Beck, None; Isabelle Marie-Paule
Meneau, None; Christian Grimm, None
Support: Velux stiftung
Copyright 2012 by the Association for Research in Vision and Ophthalmology, Inc., all rights reserved. For permission to reproduce any abstract, contact the ARVO Office at pubs@arvo.org.
ARVO 2012 Annual Meeting Abstracts by Scientific Section/Group – Biochemistry/Molecular Biology (BI)
Program Number: 5589
Presentation Time: 10:00 AM - 10:15 AM
Tet3 is an Essential Epigenetic factor for Eye development
Stephen P. Sugrue1, Guoliang Xu2, Yoichi Kato3, Yufei Xu4, Y. Geno Shi4.
1
Anatomy & Cell Biology, University of Florida, Gainesville, FL; 2Institute of
Biochemistry and Cell Biology, Chinese Academy of Sciences, Shanghai, China;
3
Department of Biomedical Sciences, Florida State University College of Medicine,
Tallahassee, FL; 4Endocrinology Division, Brigham and Women's Hospital,
Boston, MA.
Purpose: Epigenetic mechanisms in ocular tissue represent exciting new areas of
research that will potentially open a new horizon for understanding eye
development and eye-related diseases or disorders. However, it has been a
challenge to characterize changes in epigenetic processes such as histone
modification and DNA methylation that impact ophthalmic health and disease,
mainly because no clear-cut epigenetic regulators have been identified to play an
essential role in eye development or ocular disease. In this study, we aim to
characterize the essential role and its mechanism of action of one of the newly
identified epigenetic regulator TET family of DNA methylation hydroxylases, tet3,
in eye formation and development.
Methods: We used Xenopus as a model organism to study the tet3 function and its
mechanism of action in early eye development. This study involves morpholino
gene inactivation, gene overexpression, DNA hydroxylase activity assay, functional
rescue, embryo biology, domain deletion analysis and Chromatin
immunoprecipitation approaches.
Results: We show that tet3 is an active 5mC hydroxylase and a CXXC domaincontaining CpG DNA-binding protein. Overexpression of the tet3 genes in the
embryo cause a severe cyclopia and small cement gland of the animal.
Conversely, depletion of tet3 in Xenopus embryos causes severe defects in eye
formation that resemble eyeless phenotype. These tet3 depeltion defects are
associated with the reduced expression of key developmental genes pax6, rx and
six3 and inhibition of sonic hedgehog (shh) signaling pathway. Importantly, we
show that both the CXXC domain and enzymatic activity of tet3 are critical for the
regulation of targeted gene expression and eye development.
Conclusions: These findings highlights the critical roles of tet family proteins in
eye development and shed significant light on the molecular mechanisms of tet3
functions in epigenetic regulation of eye-essential genes during early eye formation
and development.
Commercial Relationships: Stephen P. Sugrue, None; Guoliang Xu,
None; Yoichi Kato, None; Yufei Xu, None; Y. Geno Shi, None
Support: NIH Grant EY07883
535 Biochemistry and Molecular Biology of Glaucoma
Thursday, May 10, 2012, 11:15 AM - 1:00 PM
Room 305 Paper Session
Program #/Board # Range: 6314-6320
Organizing Section: Biochemistry/Molecular Biology
Program Number: 6314
Presentation Time: 11:15 AM - 11:30 AM
Innate Immune Network in the Retina Activated by Optic Nerve Crush
Eldon E. Geisert1, Justin Templeton1, John M. Nickerson2, XiangDi Wang1, Monica
M. Jablonski1, Robert W. Williams1, Tonia S. Rex1. 1Ophthalmology, Univ of
Tennessee Health Sci Ctr, Memphis, TN; 2Ophthalmology, Emory University,
Atlanta, GA.
Purpose: We have used a systems biology approach along with microarray
technology to identify an innate immune network that is present in the normal
retina, activated by optic nerve crush (ONC). This network also plays a role in
human disease, glaucoma and age-related macular degeneration (AMD).
Methods: Using a recombinant inbred (RI) mouse strain set (BXD, C57BL/6
crosses with DBA/2J mice), we defined genetic networks in the normal mouse
retina and genetic networks activated by ONC. The normal dataset is constructed
from 80 strains and 326 Illumina microarrays (each with 44,000 probes). The ONC
data set (2 days post crush) contains data from 79 strains represented in 234
Illumina microarrays. These massive datasets are hosted by GeneNetwork.org
along with a series of powerful bioinformatic tools.
Results: The most novel and exciting network activated by ONC is an innate
immune response network. In the ONC Database the top 100 correlates to C4b
have correlations above r = 0.8. Some genes within the top 100 include C4b, C3,
H2-Q2, H2-Tk23, Cd74, C1q and Cfi. Of the top 500 genes in the C4b network 30
are found in the Retnet database (RetNet.org), and these C4b network genes are
associated with retinal disease in humans. For example, many of the genes in the
C4b network cause AMD, including C3, EFEMP1, MCDR2, CFB, TLR4, HTA1
and C1QTNF5. The surprising number of human disease genes within the C4b
network indicates that this network plays a prominent role in the normal
functioning of the retina, for when genes within this network are not functioning
normally there is a loss of vision. The evidence suggests that the C4b network as
defined by the expression pattern in the 80 BXD RI mouse strains represents an
intrinsic network within the retinal cells themselves. In the normal retina, the genes
within the network are highly expressed, above the mean expression level for
mRNA in the retina. An examination of the network for cellular markers reveals
that most of the cell markers are glial markers like Gfap and some are markers for
photoreceptor, like Abca4.
Conclusions: Given the genes in the C4b network and their role in injury/disease,
it is likely that this network plays a central role in the retina. It is activated by
injury including ONC and glaucoma. When members of this network are not
functional due to mutation it results in diseases like AMD. This mouse network
may open the door to understanding retinal injury and retinal disease.
Commercial Relationships: Eldon E. Geisert, None; Justin Templeton,
None; John M. Nickerson, None; XiangDi Wang, None; Monica M. Jablonski,
None; Robert W. Williams, None; Tonia S. Rex, None
Support: NEI Grant R01EY017841; Unrestricted Grant from Research to Prevent
Blindness, Inc.
Program Number: 6315
Presentation Time: 11:30 AM - 11:45 AM
Hmgb-1 Induces Apoptosis In Retinal Ganglion Cells And Intraretinal
Inflammation By Activation Of Tlr4 And Cytokine Release
Maurice Schallenberg1, Harutyun Melkonyan2, Solon Thanos2. 1Department of
Ophthalmology, University Hospital Essen, Essen, Germany; 2Institute of
Experimental Ophthalmology, University of Muenster, Muenster, Germany.
Purpose: To study high mobility group box 1 (HMGB1) which is a non-histone
chromosomal protein implicated in a variety of biologically important processes,
including transcription, differentiation, development, glaucomatous
neurodegeneration, regeneration and inflammation.
Methods: We focused on the proteomic analysis of HMGB-1 protein during retinal
ganglion cell (RGC) degeneration and regeneration. 2-D-SDS-PAGE profiles from
normal and glaucomatous rat retina, regenerating and non-regenerating rat retina
after optic nerve crush and lens injury were compared, respectively. Western blots
were performed to verify these results. RGC-5 cells were incubated either in
presence or absence of HMGB1 protein. The supernatant of the medium was
collected to examine the cytokine level within the medium. The cleaved caspase 3,
Bcl-2, Bad and pBad expression of HMGB1 treated RGC-5 were examined by
Western blot. RGC-5 cells and explanted retina were incubated in a pressure
chamber and the HMGB1, Bcl-2, Bax, TLR4 and RAGE receptor expression was
measured with Western blot and RT-PCR, respectively. The supernatant of the
medium was collected to examine the HMGB1 concentration.
Results: HMGB1 was differentially expressed throughout the experiments. In
glaucomatous retina the HMGB1 expression was strongly up-regulated compared
to normal retina. When the retina regenerates after optic nerve crush and lens
injury, expression of HMGB1 is nearly abolished. The Cytokine Array revealed a
down-regulation of CNTF and up-regulation of TNF-α and VEGF. Western blot
analysis of HMGB1 treated RGC revealed an increased cleaved caspase 3 activity
and a decreased Bcl-2 and pBad expression while the Bad expression remains
unaffected. Incubation under pressure showed an increased HMGB1, Bax and
TLR4 expression and decreased RAGE receptor expression on mRNA and protein
level, respectively. The Bcl-2 expression remains unaffected. The HMGB1
concentration in the medium was increased.
Conclusions: Our data suggest that HMGB1 promotes inflammation and
participates in the pathogenesis of neurodegenerative disease of the eye by
mediating apoptosis in retinal ganglion cells. HMGB1 may play a key role in
ongoing damage of retinal ganglion cells after an initial injury.
Commercial Relationships: Maurice Schallenberg, None; Harutyun
Melkonyan, None; Solon Thanos, None
Support: DFG, grant Th386 16-1; 16-2 to S.T., IMF grant NA110503, and the
Medical Faculty of the University of Muenster
Program Number: 6316
Presentation Time: 11:45 AM - 12:00 PM
Lipidomics of glaucomatous optic nerve tissue via MALDI Imaging
Franz H. Grus, Nils Boehm, Oliver W. Gramlich, Norbert Pfeiffer. Experimental
Ophthalmology, University Medical Center, Mainz, Germany.
Purpose: Several studies uncovered alterations of the genome and the proteome in
glaucomatous tissues, thus providing new insights into processes involved into
glaucomatous neurodegeneration. However, up to now nothing is known about the
constitution and lipid composition of neuronal membranes in glaucoma patients.
Facing the fact that cell membranes represent an important link to the extracellular
space and their involved in important signaling pathways, we conducted a study
comparing the lipid composition of optic nerve tissues from healthy subjects and
glaucoma patients.
Methods: Lipidomic analysis of human optic nerve tissue samples (CTRL: N=5;
glaucoma: N=5) was performed using a high performance MALDI-Imaging
approach. Optic nerve cryo sections were embedded into HCCA matrix using
ImagePrep robotic station. Local distribution of lipids within the tissue was
analyzed using a solariX 12 T FTMS (Bruker Daltonics), reaching a spatial
distribution of 40 µm. Lipids were detected within a mass range m/z 400-1500.
Data analysis and quantification of lipid abundances was performed using
DataAnalysis 4.0 and FlexImaging 3.0 (Bruker Daltonics). For detection of lipids
with differential abundances in glaucomatous tissues principal component analysis
Copyright 2012 by the Association for Research in Vision and Ophthalmology, Inc., all rights reserved. For permission to reproduce any abstract, contact the ARVO Office at pubs@arvo.org.
ARVO 2012 Annual Meeting Abstracts by Scientific Section/Group – Biochemistry/Molecular Biology (BI)
was performed. Findings were validated using immunohistochemistry.
Results: Using MALDI-Imaging technology we enabled a high-resolution insight
into the spatial distribution of different lipid species in human optic nerve tissues.
Further the comparison of healthy and glaucomatous subjects revealed a strong
alteration of the lipid composition of cells within the optic nerve of glaucoma
patients. Several lipids were found to be strongly in increased in glaucomatous
tissues. E.g. C18:1 sphingomyelin revealed a 2.5 fold increase (CTRL: ME=0.3E07±0.2E-07; glaucoma: ME=0.8E-07±0.25E-07). Other, so far unidentified lipids
(881.75 Da; 928.83 Da) could only be detected in tissue sections of healthy subjects
and are completely absent from optic nerve sections from glaucoma patients.
Conclusions: The increase of sphingomyelin in glaucomatous tissues suggests an
involvement of the sphingomyelin/ceramide pathway. This pathway is triggered by
external stresses such as oxidative stress or messenger proteins like Il-1 and heat
shock proteins. Downstream signaling involves proteins like Bad/BCL-2, Erk-1 and
14-3-3 - proteins which are well known to be involved in glaucomatous
neurodegeneration. In summary this pathway could provide an additional link in
glaucoma pathogenesis, bringing together and explaining findings from several
previous studies.
Commercial Relationships: Franz H. Grus, None; Nils Boehm, None; Oliver
W. Gramlich, None; Norbert Pfeiffer, None
Support: None
Program Number: 6317
Presentation Time: 12:00 PM - 12:15 PM
Amyloid Fibril Formation By The Olfactomedin Domain Of Myocilin
Raquel L. Lieberman1A, Susan D. Orwig1A, Christopher W. Perry1A, Laura Y.
Kim1B, Katherine C. Turnage1A, Rong Zhang2, Douglas Vollrath2, Ingeborg
Schmidt-Krey1B. ASchool of Chemistry & Biochemistry, BSchool of Biology,
1
Georgia Institute of Technology, Atlanta, GA; 2Department of Genetics, Stanford
University School of Medicine, Palo Alto, CA.
Purpose: Myocilin is found in the trabecular meshwork, the anatomical region of
the eye involved in regulating intraocular pressure. Wild-type (WT) myocilin has
been associated with steroid-induced glaucoma, and variants of myocilin have been
linked to early-onset, inherited glaucoma. Elevated levels and aggregation of
myocilin are linked to a hastening of increased intraocular pressure and glaucomacharacteristic vision loss due to irreversible damage to the optic nerve. In spite of
the reports of intracellular accumulation of mutant and WT myocilin in vitro, cell
culture and model organisms, these aggregates have not been structurally
characterized. We now provide biophysical evidence for the hallmarks of amyloid
fibrils in aggregated forms of WT and mutant myocilin, localized to the C-terminal
olfactomedin (myoc-OLF) domain.
Methods: Recombinant expression of the myoc-OLF domain in E. coli followed
by affinity purification; tinctorial affinity for the thioflavin T (ThT) dye in vitro and
in mammalian cell culture; resistance to proteolysis by the promiscuous protease
proteinase K; visualization by transmission electron microscopy; recognition by a
protofibril-specific antibody; electrophoretic mobility in SDS-PAGE; spontaneous
and seeded kinetics.
Results: WT myoc-OLF can spontaneously form fibrils that appear as intertwined
ropes within days, in the nucleation-specific manner expected of an amyloid when
incubated under physiological conditions. Destabilizing conditions form ThTpositive fibrils that exhibit a familiar signature by circular dichroism, and these
seeds accelerate myoc-OLF fibril. The less stable myoc-OLF(Y437H) variant
forms fibrils more readily than WT. Cross-seeding reactivity with WT is suggestive
of a common amyloidogenic peptidic core that can recruit new monomer. ThTpositive amyloid fibrils accumulate intracellularly when full-length myocilin,
particularly the P370L variant, is expressed in mammalian cells.
Conclusions: WT myoc-OLF is a stable, monomeric globular domain with high βsheet content that can be converted to a fibrillar morphology under mild conditions.
Mutations or reagents that destabilize myoc-OLF accelerate fibril formation. Our
observations of ThT-positive aggregates in cell culture link our conclusions in vitro
to the body of studies that point to the disease-relevance of myocilin aggregation.
Commercial Relationships: Raquel L. Lieberman, None; Susan D. Orwig,
None; Christopher W. Perry, None; Laura Y. Kim, None; Katherine C.
Turnage, None; Rong Zhang, None; Douglas Vollrath, None; Ingeborg
Schmidt-Krey, None
Support: AHAF (RLL), The Glaucoma Foundation (DV) NIH R01EY021205
(RLL) and R01EY011405 (DV), DOE GAANN (SDO), Beckman Foundation
(CWP)
Program Number: 6318
Presentation Time: 12:15 PM - 12:30 PM
Clusterin in Age-Related Ocular Exfoliation Syndrome
Jorge Ghiso1, Ivo Doudevski1, Mary Cowman2, Jeffrey Liebmann3, Celso Tello3,
Christopher Teng3, Robert Ritch3, Agueda Rostagno1. 1Pathology, New York
University School of Medicine, New York, NY; 2Chemical and Biological
Sciences, Polytechnic Institute of New York University, New York, NY; 3Einhorn
Clinical Research Center, New York Eye and Ear Infirmary, New York, NY.
Purpose: Exfoliation syndrome (XFS) has been recognized as the most common
identifiable cause of glaucoma. In addition to the complex mixture of extracellular
matrix glycoproteins and proteoglycans heavily cross-linked and assembled in a
supramolecular fibrillar structure that compose XFS deposits, our proteomic studies
demonstrated that the extracellular protein clusterin was particularly
overrepresented. The present study was conducted to assess the topographical
distribution of clusterin in XFS deposits and evaluate its concentration levels in the
anterior chamber in an effort to provide insight into the disease pathogenesis.
Methods: Using anterior lens capsules and aqueous fluid collected at the time of
surgery from glaucoma patients with and without XFS we conducted
ultrastructural, immunohistochemical and biochemical studies using a combination
of high resolution atomic force microscopy, confocal microscopy, capture ELISA
and Western blot analysis.
Results: XFS fibers were located only in the anterior surface of the lens whereas
no fibrils were detected in the epithelial side in the samples tested. Individual fiber
width measured an average of 40 nm (range: 30-50 nm) displaying a banding
periodicity of 10 nm while the length of many individual fibers extended over
several microns. Clusterin co-localized with the XFS fibrils and was absent in the
epithelial side of the lenses. In non-XFS glaucoma specimens both sides of the lens
were devoid of fibrils as well as of clusterin. Analysis of aqueous humor from 53
XFS glaucoma patients in comparison with 76 non-XFS glaucoma cases revealed
over two-fold elevation of the clusterin levels (p<0.0002). No evidence of disrupted
blood-aqueous barrier permeability was detected; Western blot analysis indicated
the absence of plasma-specific proteins in aqueous fluid.
Conclusions: The elevated levels of clusterin in the aqueous fluid of XFSglaucoma patients together with the absence of specific plasma proteins strongly
suggest a local response to cellular stress conditions. The co-localization with XFS
fibrils highlights the ability of clusterin to bind to a wide variety of misfolded
proteins, including many biochemically diverse amyloid fibrils. Consistent with
finding in amyloid disorders, this extracellular chaperone fails to completely inhibit
a large-scale misfolding process in spite of protein availability in the anterior
chamber.
Commercial Relationships: Jorge Ghiso, None; Ivo Doudevski, None; Mary
Cowman, None; Jeffrey Liebmann, None; Celso Tello, None; Christopher
Teng, None; Robert Ritch, None; Agueda Rostagno, None
Support: NIH grant EY019129; The Glaucoma Foundation, New York, NY; the
Joseph M Cohen Research Fund of the New York Glaucoma Research Institute,
New York, NY
Program Number: 6319
Presentation Time: 12:30 PM - 12:45 PM
LOXL-1-Associated Pathomechanisms in Exfoliation Syndrome
Katalin Csiszar1, Rozalia Laczko1, Kornelia Molnarne Szauter1, Robert Ritch2.
1
John A. Burns School of Medicine, University of Hawaii, Honolulu, HI; 2Einhorn
Clinical Research Center, New York Eye and Ear Infirmary, New York, NY.
Purpose: Strong genetic linkage has been consistently demonstrated in populations
world-wide for LOXL1 gene alleles that predispose to a high risk for exfoliation
syndrome (XFS) and exfoliation glaucoma (XFG). In this study we aimed to
determine ocular epithelia-specific LOXL1 functions and the mechanism by which
LOXL1 risk alleles may contribute to XFS/XFG pathology.
Methods: An epithelial cell model was used to determine LOXL1 synthesis,
processing, activation, nuclear and extracellular matrix (ECM) localization, and
LOXL1 functional parameters. A LOXL1 risk-allele overexpressing cell system
and immune-detection were applied to monitor cell phenotype changes and Ecadherin levels. LOXL1-Snail interactions were tested with co-immune
precipitation using whole cell lysates and Snail or LOXL1-specific antibodies.
Results: In epithelial cells, high levels of LOXL1 were produced, localized within
the nuclei, and secreted into the media. The secreted LOXL1 appeared in various
processed forms of molecular masses between 42 and 55 kD of which the 42 kD
form proved specific for epithelial cell types. In ARPE-19 retinal epithelial cells,
the 42 kD form was highly abundant, while this was not a feature in HEK293
kidney epithelial cells. LOXL1 risk-allele overexpression in HEK293 cells resulted
in high levels of active LOXL1 that did not visibly alter morphology or migration,
however, significantly reduced E-cadherin expression. Immune-precipitation
experiments identified interaction of LOXL1 with the transcription regulator Snail.
In LOXL1 overexpressing HEK293 cells, Snail interacted with the full-length
LOXL1, an interaction that was not detectable in native HEK293 cells or in vector
transfected cells. In contrast, interaction of LOXL1 with Snail occurred in native
ARPE-19 cells. Furthermore, this interaction involved the processed and epitheliaspecific 42 kD LOXL1. In functional tests, the activity of LOXL1 did not prove
critical in Snail-mediated LOXL1 functions in ARPE-19 cells as inhibition of
LOXL1 activity using BAPN or catalase-mediated depletion of H2O2, a byproduct
of LOXL1 activity, did not significantly alter E-cadherin levels.
Conclusions: In XFS/XFG, LOXL1-associated epithelial pathology appears to
involve both altered ECM cross-linking activity and cellular mechanisms with a
significant role for LOXL1 in direct interactions with Snail, a transcriptional
regulator of epithelial to mesenchymal transition, resulting in reduced E-cadherin
expression, compromised epithelial cell adhesion, and a potential shift towards
fibrogenic cell phenotypes.
Commercial Relationships: Katalin Csiszar, None; Rozalia Laczko,
None; Kornelia Molnarne Szauter, None; Robert Ritch, None
Copyright 2012 by the Association for Research in Vision and Ophthalmology, Inc., all rights reserved. For permission to reproduce any abstract, contact the ARVO Office at pubs@arvo.org.
ARVO 2012 Annual Meeting Abstracts by Scientific Section/Group – Biochemistry/Molecular Biology (BI)
Support: The Glaucoma Foundation, New York, NY, and the Matthew and Lee
Sabatine Research Fund of the New York Glaucoma Research Institute, New York,
NY
Program Number: 6320
Presentation Time: 12:45 PM - 1:00 PM
Analysis Of HSP70B’ As A Potential Direct Target Gene Of The FOXC1
Transcription Factor
Yoko Ito1A, Fred Berry1B, Michael Walter1A. AMedical Genetics, BSurgery, 1Univ of
Alberta, Edmonton, AB, Canada.
Purpose: FOXC1 mutations cause Axenfeld-Rieger Syndrome, an autosomaldominant disorder that is characterized by anterior segment abnormalities and
glaucoma. The FOXC1 transcription factor has been shown to be important for
resistance to oxidative stress in cultured human trabecular meshwork (HTM) cells.
Although the TM is subjected to constant stress, healthy TM cells have protective
mechanisms to adapt. However, chronic exposure to stress may overwhelm these
mechanisms, resulting in progressive diseases such as glaucoma. The identification
of stress-responsive target genes of FOXC1 is essential in understanding how
disruptions in FOXC1 affect the ability of cells to respond and adapt to stress.
Previous work in our laboratory identified Heat Shock Protein 70 (HSP70B’) as a
potential FOXC1 target. HSP70 proteins typically protect cells during stress
response. Here, the transcriptional regulation of HSP70B’ by FOXC1 is examined
to further elucidate the role FOXC1 plays in stress response.
Methods: To validate HSP70B’ as a target gene of FOXC1, FOXC1 was knocked
down in HTM cells using siRNA technology and HSP70B’ RNA and protein levels
were analyzed. Also, Chromatin Immunoprecipitation (ChIP) was carried out to
identify FOXC1 binding sites in the HSP70B’ promoter. To examine the role of
FOXC1 regulation of HSP70B’ in response to oxidative stress, HTM cells were
treated with hydrogen peroxide (H2O2).
Results: HSP70B’ was confirmed as a FOXC1 direct target gene by examining
HSP70B’ RNA levels in HTM cells and ChIP analysis. HSP70B’ RNA levels are
decreased by 1.6 fold when FOXC1 is knocked down (P<0.05). Under H2O2induced oxidative stress conditions, there is at least four times as much HSP70B’
RNA compared to normal conditions, suggesting that HSP70B’ is stressresponsive. HTM cells are less resistant to oxidative stress when FOXC1 is
knocked down, confirming that FOXC1 is involved in stress response.
Interestingly, FOXC1 knockdown resulted in a 1.6 fold increase in HSP70B’
protein levels (P<0.05) in stressed HTM cells. In fact, the highest level of apoptosis
was observed in cells expressing the highest levels of HSP70B’.
Conclusions: This study identified HSP70B’ as a novel direct target gene of
FOXC1. Furthermore, FOXC1 plays an important role in mediating the stress
response pathway through the transcriptional regulation of HSP70B’.
Commercial Relationships: Yoko Ito, None; Fred Berry, None; Michael
Walter, None
Support: CIHR Grant
546 AMD Disease Mechanisms II
Thursday, May 10, 2012, 11:15 AM - 1:00 PM
Hall B/C Poster Session
Program #/Board # Range: 6463-6510/A389-A436
Organizing Section: Biochemistry/Molecular Biology
Program Number: 6463 Poster Board Number: A389
Presentation Time: 11:15 AM - 1:00 PM
Establishing a Human AMD Interactome
Paul Wong1, Deborah A. Ferrington2, Timothy W. Olsen1,2. 1Ophthalmology,
Emory University, Atlanta, GA; 2Ophthalmology, University of Minnesota,
Minneapolis, MN.
Purpose: Age related macular degeneration (AMD) is a leading cause of visual
impairment in the developed world. AMD presents as a complicated progressive
disorder involving multiple genetic and environmental factors. Understanding how
proteins that are expressed over the course of AMD progression in the
neurosensory macula (NSM) and the RPE are relevant to understanding the disease
process. We took a meta-analysis approach at examining this issue.
Methods: Average protein or activity levels were mined from published studies
examining AMD tissues graded using the Minnesota Grading system (MGS),
which separates AMD tissue into 4 grades defining AMD grades 1 to 4. In total 32
abundant non-redundant AMD NSM expressed proteins and 29 AMD RPE
expressed non-redundant proteins were ascertained. Proteins with significant fold
changes were used to define each AMD transition stage (1: MGS 1-2; 2: MGS 2-3;
3: MGS 3-4). Protein lists were submitted to IPA analysis (Ingenuity Pathway
Systems, Redwood City, CA) to define trends, biological pathways, and functional
interactions over the course of AMD progression. Data retrieved from the
informatic analyses were submitted to standard statistical analyses.
Results: A single network interactome was established for both the AMD NSM
and the AMD RPE list of proteins. Seven common proteins were found in both
networks. In both cases a high number of proteins are involved with cell death
and/or cell proliferation processes. Tests for homogeneity of biofunction terms
demonstrated that the distribution of terms in NSM macula and RPE were
independent of each other. Comparative analysis of proteins with significant fold
differences at each AMD transition in a given tissue demonstrated that unique
protein expression profiles define each AMD transition period.
Conclusions: The current networks generated provide a direct approach at
illustrating how a diverse group of proteins that are expressed over AMD
progression are functionally related. It illustrates at the molecular level how subtle
alterations to the network might have an impact on the final phenotype. Finally it
serves as a reference point from which additional proteins could be added to the
network to refine our perspective of each AMD transition period over the course of
disease progression.
Commercial Relationships: Paul Wong, None; Deborah A. Ferrington,
None; Timothy W. Olsen, None
Support: Unrestricted Grants from Research to Prevent Blindness (PW, TWO,
DF), Fraser Parker Foundation (PW), NIH NEI P30EY006360 (PW, TWO)
Program Number: 6464 Poster Board Number: A390
Presentation Time: 11:15 AM - 1:00 PM
Zinc Supplementation Affects Lesion Characteristics in a Spontaneous CNV
Mouse Model
Neda Barzegar-Befroei1, Tunde Peto2, Yin Shan Eric Ng1, David T. Shima1, Imre
Lengyel1. 1Ocular Biology and Therapeutics, UCL Institute of Ophthalmology,
London, United Kingdom; 2Research & Development, Moorfields Eye Hospital,
London, United Kingdom.
Purpose: Zinc supplementation is one of the most widely used preventative
strategies for choroidal neovascularisation (CNV) in age-related macular
degeneration (AMD). However, the mechanism with which zinc exerts its effect is
largely unknown. In this study a mutant mouse model for early bilateral
spontaneous CNV (JR5558) was supplemented with zinc to examine how this
treatment affects the condition.
Methods: A group of JR5558 mice supplemented with zinc in drinking water from
birth were compared with a control group with regular lab water. In the zinc group,
the mothers were placed on 10 mg/L zinc carbonate and 0.25mg/L copper chloride
on the day of birth to allow zinc supplementation of the litter through breast milk.
The copper was added to avoid zinc induced copper deficiency. Following weaning
the pups continued to receive zinc supplemented water. CNV was assessed by
fluorescent angiography (FA) on day 25, a time point at which all control mice
show definitive CNV. The images were analysed for number, size and degree of
leakage of lesion using Image J software.
Results: Following the analysis of 6 control eyes and 12 eyes in the zinc group, the
number of lesions was shown to be reduced in the zinc group by ~50% (p <0.01).
While, the sizes of lesions at early AF images were larger by ~20% (p < 0.07) and
more defined in the zinc group the leakage of the CNV was reduced by ~20%
(p<0.07) compared to the controls.
Conclusions: Zinc supplementation appeared to cause a reduction in both the
number and leakage of CNV lesions in our model system. Further analysis of
morphological features by light, fluorescent and electron microscopy and changes
at the molecular level will help to understand the mechanisms involved in the
beneficial effects of zinc supplementation in CNV. It is intriguing to speculate
whether a combination of anti-VEGF-A therapy with zinc supplementation might
be the way forward to increase efficacy of treatment for CNV associated with
AMD.
Commercial Relationships: Neda Barzegar-Befroei, None; Tunde Peto,
None; Yin Shan Eric Ng, None; David T. Shima, None; Imre Lengyel, None
Support: Henry Smith Charity
Program Number: 6465 Poster Board Number: A391
Presentation Time: 11:15 AM - 1:00 PM
Inflammatory Reactions Complicating Exudative Age-Related Macular
Degeneration (AMD)
Alena Reznik1, Charles H. Weber2, David G. Telander3, Lawrence S. Morse4,
Susanna S. Park5, Charles E. Thirkill6. 1UC Davis Eye Center, UC Davis Eye
Center, Sacramento, CA; 2Eye Center, University of California Davis, Sacramento,
CA; 3Ophthalmology, University of California, Davis, Sacramento, CA;
4
Ophthalmology, Univ of California-Davis, Sacramento, CA; 5Ophthalmology &
Vision Science, Univ of California Davis Eye Ctr, Sacramento, CA; 6Research Lab
1220 Surge III, UC Davis, Davis, CA.
Purpose: The efficacy of “wet” AMD treatment may be limited by secondary and
superimposed inflammatory reactions to the retina or retinal pigment epithelium
(RPE). Therefore we hypothesize that exudative AMD patients that do not respond
to anti-vascular endothelial growth factor (VEGF) therapy may have increase
inflammatory reactions to the retina and RPE. We examined both dry (40) and wet
(30) AMD patients and correlated serum anti-retinal and anti-RPE reactions to
AMD disease and response to therapy.
Methods: Serum samples were collected from patients in 4 categories: normal (30
patients), non-exudative AMD (40 patients), and exudative AMD (30 patients)
including poor-responder to anti-VEGF therapy. Patients with exudative AMD
were enrolled for 6 months of anti-VEGF (randibizumab) therapy and serum was
collected at on enrollment and at months 3 and 6. Poor-responders were defined as
Copyright 2012 by the Association for Research in Vision and Ophthalmology, Inc., all rights reserved. For permission to reproduce any abstract, contact the ARVO Office at pubs@arvo.org.
ARVO 2012 Annual Meeting Abstracts by Scientific Section/Group – Biochemistry/Molecular Biology (BI)
those patients with residual cystoid macular edema or subretinal fluid at month 4
and having less than 100 microns improvement of central retinal thickness by OCT.
Western blot reactions on extracts of pig retina and in vitro cultivated human retinal
pigment epithelium (ATCC ARPE-19) were used in the evaluations of patient’s
antibody activity with the protein components of these tissues.
Results: We found a series of abnormal antibody reactions to both retinal and RPE
protein antigens correlating with exudative AMD and poor-response to therapy. In
addition, specific reactions were noted that were previously described by others as
being associated with, or suspected of being associated with immune-mediated loss
of vision.
Conclusions: Evidence of abnormal immunological activity within the eyes of
treatment-refractive AMD patients may explain their failure to respond to
conventional treatments is due to immunological complications suspected to be
autoimmune in nature. Modifying treatments to accommodate these findings could
prove beneficial in some cases of refractory AMD, especially with those involving
abnormal antibody activity with recognized ocular autoantigens.
Commercial Relationships: Alena Reznik, None; Charles H. Weber,
None; David G. Telander, None; Lawrence S. Morse, None; Susanna S. Park,
None; Charles E. Thirkill, None
Support: Research to prevent blindness.
investigate interactions between iron and MLF as a source of oxidative stress and
compare it with melanosomes (MS) and lipofuscin (LF).
Methods: MLF, MS and LF granules were isolated from human RPE from cadaver
eyes above 60 years old. Concentration of melanin radicals and melanin-bound
Fe(III) was determined by electron spin resonance (ESR) spectrometry. Pigment
granules with and without exogenous unsaturated lipids were exposed to Fe-ADP
in the presence or absence of electron donors (ascorbate or NADPH) and/or
hydrogen peroxide in dark or during exposure to visible light. Oxidation was
monitored by ESR oximetry and generation of hydroxyl radicals - by ESR spin
trapping.
Results: Incubation of MLF in the presence of 0.05 mM Fe-ADP resulted in
oxygen uptake which rate was over 3 and 7-fold greater than for MS and LF,
respectively. During concomitant exposure to ascorbate or visible light, the rate of
oxidation in suspension of MLF increased by a factor of ~2 and ~6, respectively.
When MLF was irradiated in the presence of both Fe-ADP and ascorbate the rate of
oxygen uptake was further increased and was ~5.8 times greater than for samples
incubated in dark. MLF effectively inhibited Fe-catalysed formation of hydroxyl
radicals from decomposition of hydrogen peroxide but was less efficacious than
MS in inhibiting Fe-catalysed lipid peroxidation. During exposure to light, MLF
was a substantial source of hydroxyl radicals and this effect was exacerbated in the
presence of Fe ions.
Conclusions: In the presence of iron ions melanolipofuscin is more reactive that
melanosomes and lipofuscin. Reactivity of melanolipofuscin is further exacerbated
in the presence of physiological reductants and by exposure to visible light.
Melanolipofuscin in the aged retina with weakly chelated iron ions provides a
greater source of oxidative stress than melanosomes or lipofuscin granules. This
effect is further exacerbated during exposure to visible light. Therefore,
melanolipofuscin is likely to play a significant role in the development and
progression of AMD.
Commercial Relationships: Malgorzata B. Rozanowska, None; Ruth Edge,
None; Floriana Tuna, None
Support: The EPSRC UK National Electron Paramagnetic Resonance Service at
the University of Manchester
Program Number: 6466 Poster Board Number: A392
Presentation Time: 11:15 AM - 1:00 PM
Properdin and Malondialdehyde (MDA) effects on the APOE4 mouse model of
Age-Related Macula Degeneration (AMD)
Una L. Kelly1A, Marybeth Groelle1A, Jindong Ding1A, Wen-Chao Song2, Catherine
Bowes Rickman1B. AOphthalmology, BOphthalmology and Cell Biology, 1Duke
University Medical Center, Durham, NC; 2School of Medicine, University of
Pennsylvania, Philadelphia, PA.
Purpose: Aged human apolipoprotein E4 targeted replacement (APOE4) mice on a
high fat, cholesterol-enriched (HFC) diet are a recognized mouse model of AMD.
This study was designed to further interrogate aspects of the roles of each of the
essential components of the model on the subsequent development of an AMD-like
phenotype. Specifically, we examined the effect of the HFC diet on properdin
levels and studied the effects of aging and expression of human APOE4 on plasma
levels of MDA-adducted proteins.
Methods: Two sets of mice were used for this study: a) 70 week old mice fed a
HFC diet for 16 weeks. Western blot analysis was used to measure plasma
properdin levels throughout the course of exposure to the HFC diet (blood was
taken at day 0 and 1, and weeks 1, 4, 8 and 16) and C3a desArg was measured by
ELISA and b) 4 strains of mice (cfh-/-, sCrry, APOE4 and APOE4/sCrry) all on a
C57/Bl6 background and normal diet had blood taken at 6, 30, 57, and 72 weeks of
age. Western blot analysis of these plasma samples using an anti-MDA antibody
was performed.
Results: Plasma properdin levels rose in the plasma in mice by 1 week on the HFC
diet, reaching a maximum concentration by 8 weeks and remaining at this level for
16 weeks. C3a desArg levels also increased with the HFC diet. On immunoblots of
plasma obtained from APOE4 mouse strains an additional band was detected by the
anti-MDA antibody and the concentration of this band and another dominant band
were higher in these mice than in the other strains. We are currently investigating
the identity of these bands. All of the mice showed an age-related increase in levels
of detected MDA.
Conclusions: Increased levels of plasma properdin, which stabilizes the C3
convertase, C3bBb, and thereby activates complement, could be a contributing
factor to the increased complement activation (increased C3a desArg) detected in
the APOE4 mouse model. Furthermore, the increased MDA-adducted proteins in
the plasma of the aged APOE4 mice suggest that these mice are less able to tolerate
oxidative stress associated with aging. These findings further support a role for
complement activation and oxidative stress in the development of the phenotype
seen in this AMD mouse model as has been proposed for the pathogenesis of
AMD.
Commercial Relationships: Una L. Kelly, None; Marybeth Groelle,
None; Jindong Ding, None; Wen-Chao Song, None; Catherine Bowes Rickman,
None
Support: NIH Grant EY019038, P30 EY005722, Research to Prevent Blindness,
Inc., Ruth and Milton Steinbach Fund, Macular Vision Research Foundation
Program Number: 6468 Poster Board Number: A394
Presentation Time: 11:15 AM - 1:00 PM
Therepeutic Effects Of Fenofibrate On Laser-induced Choroidal
Neovascularization
Yang Hu1A, Ying Chen2, Jian-Xing Ma1B. AOUHSC BSEB 300, BHarold Hamm
Oklahoma Diabetes Ctr, 1Univ of Oklahoma Hlth Sci Ctr, Oklahoma City, OK;
2
Physiology, OUHSC, Oklahoma City, OK.
Purpose: Choroidal neovascularization (CNV) is a severe complication of agerelated macular degeneration (AMD). Recent studies have shown that fenofibrate, a
potent PPAR-α agonist, has therapeutic effect on diabetic retinopathy. The purpose
of this study is to evaluate the therapeutic effect of fenofibrate on laser-induced
CNV.
Methods: Adult Brown Norway rats were photocoagulated using a diode laser to
induce CNV. Immediately after the photocoagulation, laser-induced CNV rats were
fed with fenofibrate chow or regular chow. Pro-angiogenic and pro-inflammatory
factors in the eyecup were measure by Western blot analysis one week after
photocoagulation with or without fenofibrate treatment. The fundus angiographs
were examined at 1, 2 and 3 weeks post fenofibrate treatment, and the neovascular
areas of lesions were quantified by FITC-dextran angiography on choroidal flat
mount.
Results: Both of mRNA and protein levels of PPAR-α were significantly decreased
in the eyecup of laser-induced CNV rats, as compared to those in un-treated
controls, suggesting suppressed PPAR-α signaling. Fenofibrate treatment resulted
in significant reductions of pro-angiogenesis and pro-inflammatory factor levels in
the eyecup of the CNV rats, compared to the CNV group with normal diet group.
Fenofibrate decreased pathologically vascular leakage from the CNV lesions and
reduced the neovascular area in the laser-induced CNV rats.
Conclusions: The PPAR-α signaling pathway is down-regulated in laser-induced
CNV rats, and fenofibrate has therapeutic effect on laser-induced CNV.
Commercial Relationships: Yang Hu, None; Ying Chen, None; Jian-Xing Ma,
None
Support: EY018659, EY012231, EY019309, P20RR024215
Program Number: 6467 Poster Board Number: A393
Presentation Time: 11:15 AM - 1:00 PM
Pro-oxidant Properties of Human Retinal Melanolipofuscin in the Presence of
Iron Ions; Comparison with Lipofuscin and Melanosomes
Malgorzata B. Rozanowska1, Ruth Edge2A, Floriana Tuna2B. 1Optom & Vis
Science, Cardiff University, Cardiff, United Kingdom; AChemistry, BEPSRC
National Service for EPR Spectroscopy, 2University of Manchester, Manchester,
United Kingdom.
Purpose: Both melanolipofuscin (MLF) and iron accumulate with age in the
human retinal pigment epithelium (RPE). Accumulation of iron is further increased
in age-related macular degeneration (AMD). The purpose of this study was to
Program Number: 6469 Poster Board Number: A395
Presentation Time: 11:15 AM - 1:00 PM
Mechanism Of All-Trans-retinal Toxicity: Implications For Stargardt’S
Disease And Age-related Macular Degeneration
Yu Chen1A, Kiichiro Okano1A, Tadao Maeda1A,1B, Vishal Chauhan1A,2, Marcin
Golczak1A, Akiko Maeda1A,1B, Krzysztof Palczewski1A. APharmacology,
B
Ophthalmology, 1Case Western Reserve University School of Medicine,
Cleveland, OH; 2Ophthalmology, Case Western Reserve University, Cleveland,
OH.
Purpose: Compromised clearance of all-trans-retinal (atRAL), a component of the
retinoid cycle, increases the susceptibility of mouse retina to acute light-induced
Copyright 2012 by the Association for Research in Vision and Ophthalmology, Inc., all rights reserved. For permission to reproduce any abstract, contact the ARVO Office at pubs@arvo.org.
ARVO 2012 Annual Meeting Abstracts by Scientific Section/Group – Biochemistry/Molecular Biology (BI)
photoreceptor degeneration. Abca4_/_Rdh8_/_ mice featuring defective atRAL
clearance were used to examine the underlying molecular mechanism(s) because
bright light exposure causes severe photoreceptor degeneration in these animals.
Methods: Various pharmacological agents were tested and evaluated using
morphological, biochemical and functional approaches in Abca4_/_Rdh8_/_ mouse
model.
Results: Bright light exposure of Abca4-/-Rdh8-/- mice increased atRAL levels in
the retina that induced rapid NADPH oxidase-mediated overproduction of
intracellular reactive oxygen species (ROS). Moreover, such ROS generation was
inhibited by blocking phospholipase C and IP3-induced Ca2+ release, indicating that
activation occurs upstream of NADPH oxidase-mediated ROS generation. Because
multiple upstream G protein-coupled receptors (GPCRs) can activate
phospholipase C, we then tested the effects of antagonists of serotonin 2A (5HT2AR) and M3-muscarinic (M3R) receptors and found they both protected Abca4-/Rdh8-/- mouse retinas from light-induced degeneration.
Conclusions: A cascade of signaling events appears to mediate the toxicity of
atRAL in light-induced photoreceptor degeneration of Abca4-/-Rdh8-/- mice. A
similar mechanism may be operative in human Stargardt’s disease and age-related
macular degeneration.
Commercial Relationships: Yu Chen, None; Kiichiro Okano, None; Tadao
Maeda, None; Vishal Chauhan, None; Marcin Golczak, None; Akiko Maeda,
None; Krzysztof Palczewski, None
Support: EY009339, EY021126, EY019031, EY019880 and P30 EY11373 from
the National Institutes of Health, the Research to Prevent Blindness Foundation,
and the Ohio Lions Eye Research Foundation.
Program Number: 6470 Poster Board Number: A396
Presentation Time: 11:15 AM - 1:00 PM
Early Thinning Of The Retina Correlates With Increased Expression Of
Immune Response Genes In The Harlequin Mouse
Justin G. Mayers1, Kathleen A. Hill1, Cindy M. Hutnik2. 1Biology, University of
Western Ontario, London, ON, Canada; 2Ophthalmology, Ivey Eye Institute,
London, ON, Canada.
Purpose: The prevalence of age-related retinal degenerative disorders is rising as
the North American population becomes increasingly aged. The genetic basis of
human aging has a mouse model in the harlequin (hq) mouse which features an
early retinal degenerative phenotype. The hq disease mutant features vision deficits
at 2 months and structural losses at 4 months and is characterized by an 80%
downregulation of the Apoptosis-inducing factor (Aif) gene. Early-onset retinal
degeneration is hypothesized as a result of parainflammatory pathway activation
resulting in upregulation of the Major Histocompatibility Complex I (MHC-I)
genes (H2-K1, B2M).
Methods: The Taqman® real-time polymerase chain reaction assay was used to
quantify changes in gene expression of n=3 wild type and n=3 hq disease mice at 7
weeks, 4 months and 7 months of age. In vivo imaging was performed with the
Heidelberg Spectralis® Spectral Domain Optical Coherence Tomography (OCT) on
n=3 wild type and n=3 hq disease mice at 7 weeks, 4 months and 7 months of age.
Retinal layer thickness was measured with the Heidelberg Eye Explorer® software.
Results: At 7 months of age, MHC I genes H2-K1 and B2M show a 10-fold and 5fold significant increase in gene expression in the hq disease mouse compared to
wild type (p < 0.001). H2-K1 is significantly upregulated 2-fold at both 7 weeks
and 4 months compared to wild type (p < 0.05). B2M is significantly upregulated 2fold at 4 months of age compared to wild type (p < 0.05). At 7 months of age, in
vivo imaging of the hq disease mouse shows the outer nuclear layer and retina are
significantly thinner than the wild type (p < 0.05).
Conclusions: Changes in gene expression indicate that the immune response is
highly active in the hq disease mouse between 4 months and 7 months of age. The
increase of MHC-I gene expression is significantly upregulated when compared to
the wild type mouse. In vivo imaging with Spectralis® identified the earliest
evidence of significant retinal thinning assessed in vivo of the hq mouse. Cellular
response to immune system activation will be confirmed by in situ tracking of
microglial migration. Thinning of the retina is seen in normal human aging, and
these results establish a time frame correlated to changes in immune response gene
expression. This time frame is ideal to test potential drug targets to prevent or treat
retinal degeneration.
Commercial Relationships: Justin G. Mayers, None; Kathleen A. Hill,
None; Cindy M. Hutnik, None
Support: None
Program Number: 6471 Poster Board Number: A397
Presentation Time: 11:15 AM - 1:00 PM
Alu Rna Induced Rpe Degeneration Via Il18-myd88-caspase-3 Signaling
Valeria Tarallo, Yoshio Hirano, Bradley D. Gelfand, Nagaraj Kerur, Benjamin J.
Fowler, Jayakrishna Ambati. Ophthalmology, University of Kentucky, Lexington,
KY.
Purpose: Geographic atrophy (GA), an advanced form of age-related macular
degeneration that causes blindness in millions of people worldwide, results from
death of retinal pigmented epithelium (RPE) cells. We recently identified that
human eyes with GA exhibit reduced levels of DICER1 and accumulation of
cytotoxic Alu repeat RNAs. Yet, it was unclear how Alu RNA caused RPE
degeneration considering that it does not activate any TLR receptors. Therefore we
sought to determine the mechanism of Alu induced cell-death.
Methods: The ability of Alu RNA to induce IL-18 secretion was analyzed. The
effect of MyD88 knockdown to prevent RPE degeneration was tested in mice and
in cell viability assay. The phosphorylation of IRAK1 and IRAK4 was assessed on
western blot. Caspase 3 activation was monitored by fluorimetric assay.
Results: Alu RNA induces IL-18 secretion by human RPE cells. In wild-type mice,
intravitreous IL-18 induces RPE degeneration, and a neutralizing antibody against
IL-18 protects from pAlu-induced RPE degeneration. Alu RNA does not induce
degeneration in Il18r1-/- or Myd88-/- mice. Genetic or pharmacological inhibition
of MyD88, which prevents phosphorylation of the IL-1R-associated kinases
IRAK1 and IRAK4, protects RPE from Alu RNA-induced cytotoxicity. IL-18
induces Caspase-3 activation via a MyD88-dependent manner.
Conclusions: These data provide new therapeutic targets to prevent Alu RNAinduced cell death in GA.
Commercial Relationships: Valeria Tarallo, None; Yoshio Hirano,
None; Bradley D. Gelfand, None; Nagaraj Kerur, None; Benjamin J. Fowler,
None; Jayakrishna Ambati, iVeena (E), University of Kentucky (P)
Support: None
Program Number: 6472 Poster Board Number: A398
Presentation Time: 11:15 AM - 1:00 PM
Regulation Of Choroidal Neovascularization By MicroRNAs
Qinbo Zhou, William Anderson, Rafael Ufret-Vincenty, Shusheng Wang.
Ophthalmology, UT southwestern, Dallas, TX.
Purpose: Choroidal neovascularization (CNV) is the hallmark of “wet” age-related
macular degeneration (AMD). In spite of the recent success in anti-VAGF therapy
for wet AMD, limited efficacy and potential safety concern necessitate the
development of additional therapeutic solutions. microRNAs (miRNAs, miRs) are
small endogenous RNAs which regulate the expression of genes in multiple
pathways post-transcriptionally. Our previous studies have suggested that miRNAs
are key regulators of angiogenesis. We found that manipulating miRNA levels was
sufficient to repress angiogenesis by in vitro and in vivo models, which have
inspired us to explore miRNA function in wet AMD. We recently reported that
inhibition of two miRNAs, miR-23 and miR-27, in the miR-23~27~24 families
significantly represses laser-induced CNV. This project focuses on further
dissecting miR-23/27/24 functional mechanisms in CNV individually and
cooperatively.
Methods: In vitro cell culture model and in vivo miRNA mimics/LNA-anti-miR
technologies were used to dissect the function of miR-23~27~24 family members
in angiogenesis and laser-induced CNV in mouse models.
Results: We found that, in addition to modulating angiogenic pathways, miR-23
and miR-27 also regulate inflammatory pathways involved in laser-induced CNV.
Moreover, miR-24 in the family also regulates angiogenesis by in vitro models.
Ongoing efforts are focused on testing the effect of a combination of miRNAs in
CNV and their safety profiles on retinal cells.
Conclusions: miR-23~27~24 family plays a critical regulatory role in CNV. Since
these miRNAs can regulate multiple pathways involved in CNV, they represent an
attractive therapeutic target for treatment of wet AMD and other vascular
retinopathies.
Commercial Relationships: Qinbo Zhou, None; William Anderson,
None; Rafael Ufret-Vincenty, None; Shusheng Wang, None
Support: None
Program Number: 6473 Poster Board Number: A399
Presentation Time: 11:15 AM - 1:00 PM
NR2E3, A Retina-specific Nuclear Receptor, Directly Regulates Transcription
Of The Antioxidant Enzyme PON1
Qiong Qin, Konstantin Petrukhin. Ophthalmology, Columbia University, New
York, NY.
Purpose: Oxidative stress plays significant role in pathogenesis of AMD.
Paraoxonase 1 (PON1) is a protective antioxidant enzyme responsible, among other
activities, for detoxification of peroxidized lipids. PON1 was found to be
differentially expressed in the rd7 retina, implying that it may be directly regulated
by retina-specific nuclear receptor NR2E3. In this study we provide evidence that
PON1 is a direct target for NR2E3.
Methods: Two-dimensional electrophoretic mobility shift assay (2D-EMSA) was
used to identify DNA fragments containing NR2E3 response elements in the
proximity of potential target genes. In silico analysis was employed for pinpointing
potential NR2E3 response elements (REs) in the DNA fragment trapped from the
BAC clone containing PON1. Conventional EMSA with double stranded synthetic
oligonucleotide containing the putative PON1 RE was used to establish direct
NR2E3 interaction with the potential response element. In order to confirm that
PON1 RE identified in 2D-EMSA is functional in a cellular context, a reporter
construct containing the trapped DNA fragment attached to a minimal promoter
was used to assess the effect of NR2E3 on a reporter gene transcription.
Copyright 2012 by the Association for Research in Vision and Ophthalmology, Inc., all rights reserved. For permission to reproduce any abstract, contact the ARVO Office at pubs@arvo.org.
ARVO 2012 Annual Meeting Abstracts by Scientific Section/Group – Biochemistry/Molecular Biology (BI)
Results: Analysis of the trapped 343-b.p. fragment located upstream of the classic
2.9 kb PON1 promoter revealed a response element combining two established
Knix2 and DR1 hexameric half sites. Conventional EMSA confirmed direct
NR2E3 interaction with the predicted RE. Transient transfections of the pGL4.10
reporter vector containing the 343-b.p. fragment confirmed that NR2E3 dosedependently repressed the transcription of the reporter gene indicating that RE
identified in 2D-EMSA is functional.
Conclusions: NR2E3 seems to directly regulate PON1 transcription. NR2E3mediated upregulation of the protective enzyme, PON1, with small molecule
NR2E3 modulators may potentially be used as a therapeutic approach for treatment
of dry AMD.
Commercial Relationships: Qiong Qin, None; Konstantin Petrukhin, None
Support: NIH Grant 1R21NS061718, the Peacock Trusts grant, and gifts from The
Burch Family Foundation, the Mary Jaharis-John Catsimatidis Scholarship Fund,
the Eye Surgery Fund, and the Kaplen Foundation.
Program Number: 6474 Poster Board Number: A400
Presentation Time: 11:15 AM - 1:00 PM
Microrna-335 Inhibits Sod2 Expression And Increases Oxidant-induced Rpe
Cell Injury
Haijiang Lin1A, Bernard F. Godley1B. AOphthalmology, BOphthal & Visual
Sciences, 1Univ of Texas Medical Branch, Galveston, TX.
Purpose: Increased production of reactive oxygen species (ROS) over time may be
associated with early pathogenesis of RPE cells in age-related macular
degeneration (AMD). The development of early AMD in manganese superoxide
dismutase (SOD2) knockdown mouse has provided more direct evidence of this
relationship. MicroRNAs (miRNAs) negatively regulate a wide variety of genes
through post-transcription inhibition. The purpose of this study is to investigate the
role of miR-335 in regulating SOD2 expression and modulating RPE cell survival
in response to oxidative damage.
Methods: Expression of miR-335 levels in macular RPE cells from normal young,
normal old and AMD patient donors were analyzed by qRTPCR. Cultured human
ARPE-19 cells were transfected with miR-335 mimic or inhibitor. Cell viability
was assessed by the MTT assay. Apoptosis was determined by incubating cells
with hydrogen peroxide (H2O2). DNA fragmentation was measured using an
enzyme linked immunosorbent assay. SOD2 protein level was analyzed using
Western blot.
Results: MiR-335 expression was remarkably up-regulated (P<0.05) in macular
RPE cells from old donors compared to RPE cell from young donors. The macular
RPE cells from AMD patients exhibited a higher expression level than that of
macular RPE cells from normal age-matched donors. H2O2-induced ARPE-19 cell
death and apoptosis were increased by miR-335 mimic and decreased by miR-335
inhibitor. Computational analysis found a putative target site of miR-335 in the
3’UTR of SOD2 mRNA, which was verified by luciferase reporter assay. Forced
over-expression of miR-335 decreased SOD2 expression level and increased H2O2
cell death. This effect was blocked by abrogation of miR-335.
Conclusions: The findings highlight that over-expression of miR335 inhibits the
expression of SOD2 and may play an important role in the development of AMD.
Therefore, miR335 may serve as a potential target for pharmaceutical intervention
in AMD.
Commercial Relationships: Haijiang Lin, None; Bernard F. Godley, None
Support: None
Program Number: 6475 Poster Board Number: A401
Presentation Time: 11:15 AM - 1:00 PM
The Inflammatory Response To Immune Complex Formation In The Retina
Salome Murinello1A, Andrew J. Lotery1B, V. Hugh Perry1A, Jessica L. Teeling1A.
A
Center for Biological Sciences, BFaculty of Medicine, 1University of
Southampton, Southampton, United Kingdom.
Purpose: A growing body of evidence suggests that immunologic events play a
crucial role in the pathogenesis of age-related macular degeneration (AMD). The
presence of anti-retinal antibodies, complement and activated
macrophages/microglia in drusen implicates immune complex mediated
inflammation in the disease. Immune complex responses in the eye have been
poorly characterised. We believe understanding the dynamics of immune complex
formation in the retina and their interaction with Fcγ receptor (FcγR) expressing
macrophages/microglia may delineate the mechanisms underlying drusen formation
and the development of pathology in AMD. In this study, we used the reverse
Arthus reaction to induce immune complexes in the murine retina and study their
effects on retinal inflammation and integrity.
Methods: Balb/C mice were immunized against ovalbumin (OVA), followed by an
intravitreal challenge of OVA or saline. Tissue was collected at various time points
following OVA challenge and analysed for the presence of IgG, C3, microglial
activation and neovascularisation by immunohistochemistry using both retinal
sections and whole-mounts. Cytokine and growth factor production was analysed
by qPCR.
Results: Immune complexes formed throughout the retina, including large deposits
in the subretinal space (Figure 1). These deposits were associated with changes to
the retinal immune system, including altered morphology of microglia and their
migration towards immune complexes, recruitment of macrophages from the
circulation and increased GFAP expression. In addition, a change to microglial
function was also evident as expression of MHCII, CD11b, CD68 and CD16/32
was increased and pro-inflammatory were cytokines elevated.
Conclusions: These results suggest that immune complexes formed in the retina
induce a potent inflammatory response with up-regulation of FcγRs on microglia
and macrophages and increased mRNA expression of pro-inflammatory cytokines.
This may be of relevance for retinal diseases such as AMD where immune
complexes form and could provide a possible mechanism by which
microglia/macrophage changes could contribute to the pathology of the
disease.
Commercial Relationships: Salome Murinello, None; Andrew J. Lotery,
None; V. Hugh Perry, None; Jessica L. Teeling, None
Support: Fight for Sight UK
Program Number: 6476 Poster Board Number: A402
Presentation Time: 11:15 AM - 1:00 PM
Elucidating the correlation between the levels of Macular Xanthophylls and
A2E In Normal Indian Donor Eyes
Srinivasan Senthilkumari1, Ravichandran Ranjith Kumar1, Ankita Kotnala2,
Thirumurthy Velpandian2. 1Department of Ocular Pharmacology, Aravind Medical
Research Foundation, Madurai, India; 2Department of Ocular Pharmacology &
Pharmacy, All India Institute of Medical Sciences, New Delhi, India.
Purpose: Age-related macular degeneration (AMD) is the leading cause of
blindness in the elderly. Accumulation of A2E, a major fluorophore of lipofuscin in
human retinal pigment epithelium is reported to be one of the causative factors in
the pathogenesis of AMD. The accumulated a2e acts as photo-sensitizer causing
damage and photoreceptor cell death in the macula leading to vision loss. Dietary
rich intake of macular xanthophylls is reported to protect macula from blue light
induced oxidative damage. Therefore, the present study was undertaken to elucidate
the relationship between macular xanthophylls and A2E in normal aging Indian
donor eyes.
Methods: Donor eyes (above 40 yrs; N=45) obtained after the removal of cornea
for transplantation were collected from the Lions' International Eye Bank of our
hospital with prior approval from the Standing Institute Human Ethics Committee.
Macular portion of neural retina and retinal pigment epithelium was dissected out
using 8mm punch. Macular xanthophylls were estimated in neural retina by HPLC
and A2E in retinal pigment epithelium using LC/MS/MS.
Results: The mean (+/- SEM) macular lutein and zeaxanthin concentration of
donors in the age group of 40-60 yrs was found to be 0.39 +/- 0.08 and 0.26 +/0.04 ng / mg tissue respectively. The aged donor eyes (60-80 yrs & > 80 yrs)
showed significantly high concentration of lutein (60-80 yrs group: 0.65 +/- 0.12 &
> 80 yrs group: 0.61+/-0.16 ng /mg) and zeaxanthin (60-80 yrs group: 0.44+/-0.04
& > 80 yrs group: 0.41+/- 0.07 ng / mg) as compared to 40-60 yrs donors group.
Interestingly, the older age group donors showed significant accumulation of A2E
(85%) as compared to 40-60 yrs age group donors.
Conclusions: A positive correlation was observed between the macular lutein and
A2E levels in normal aging Indian donor eyes. Considering this observation,
further studies are required to evaluate this relationship in the pathogenesis of
AMD in our population
Commercial Relationships: Srinivasan Senthilkumari, None; Ravichandran
Ranjith Kumar, None; Ankita Kotnala, None; Thirumurthy Velpandian, None
Support: Champalimaud Research Grant, AMRF
Program Number: 6477 Poster Board Number: A403
Presentation Time: 11:15 AM - 1:00 PM
Linking Retinoids To Clinical Patterns Of Amd
Zsolt Ablonczy1, Daniel Higbee1, Anne M. Hanneken2, Kevin L. Schey3, Yiannis
Koutalos1, Rosalie K. Crouch1. 1Ophthalmology, Medical University of South
Carolina, Charleston, SC; 2Molec & Exp Med, The Scripps Research Institute, La
Jolla, CA; 3Biochemistry, Vanderbilt University, Nashville, TN.
Purpose: Byproducts of the retinoid visual cycle can accumulate in the retinal
pigment epithelium (RPE) and contribute to both the fluorescence of lipofuscin and
Copyright 2012 by the Association for Research in Vision and Ophthalmology, Inc., all rights reserved. For permission to reproduce any abstract, contact the ARVO Office at pubs@arvo.org.
ARVO 2012 Annual Meeting Abstracts by Scientific Section/Group – Biochemistry/Molecular Biology (BI)
its toxicity during the development of age-related macular degeneration. Clinical
imaging has established a relationship between RPE fluorescence and hotoreceptor
damage. However, the apparent distribution of A2E, a major retinoid-derived
component of lipofuscin, disagrees with the clinical pattern of AMD. Therefore, the
molecular link between retinoids and disease is yet to be identified.
Methods: To understand the spatial distribution and relationships of lipofuscin and
retinoid-derived metabolites, fluorescence and matrix-assisted laser
desorption/ionization (MALDI) imaging was used in human tissue samples from
the entire lifespan. Selected samples were correlated with micrographs of the
fundus and prior clinical observations. To study the accumulation of retinoidderived metabolites and their contribution to lipofuscin, we utilized an in vitro
model system (fetal human RPE cells, fhRPE) that does not normally accumulate
lipofuscin and A2E. Then exogenous retinoids were supplied and the subsequent
accumulation of lipofuscin and retinoids was followed after extraction by
fluorescence or HPLC/MS/MS.
Results: The data show that lipofuscin correlates well with clinical observations
but there is little correlation between A2E and lipofuscin. Neither age nor clinical
diagnosis of dry- or wet-AMD changed the peripheral distribution of A2E and
other bis-retinoids. From phosphatidyl choline vesicles, fhRPE cells took up and
metabolized vitamin-A and all-trans retinal, however, bis-retinoids were not
generated. From phosphatidyl-ethanolamine containing vesicles the generation of
bis-retinoid precursors was observed. Feeding the cells with bleached rod outer
segments also resulted in the generation of lipofuscin and bis-retinoids.
Conclusions: The spatially inverse relationship of lipofuscin fluorescence and A2E
in the human eye implies that the retinoid and retinoid adduct metabolism varies
with the topography of the eye. However, it is still not clear whether A2E and
lipofuscin accumulate differently or if A2E is metabolized where lipofuscin is most
intense. The model system experiments are the first steps to understand the link
between retinoids and observed patterns of AMD. Elucidating this link is essential
for eliminating only the toxic components of lipofuscin instead of inhibiting the
entire visual cycle.
Commercial Relationships: Zsolt Ablonczy, None; Daniel Higbee, None; Anne
M. Hanneken, None; Kevin L. Schey, None; Yiannis Koutalos, None; Rosalie
K. Crouch, None
Support: NIH grants EY020661 (ZA/RKC), EY04939 (RKC), EY019065 (ZA),
EY013462 (KS) and RPB (RKC and Department of Ophthalmology at MUSC).
Program Number: 6478 Poster Board Number: A404
Presentation Time: 11:15 AM - 1:00 PM
Quantification Of CEP By LC MS/MS
Geeng-Fu Jang1, Lei Zhang1, Li Hong2, Hua Wang2, Robert G. Salomon2, John W.
Crabb1,2. 1Cole Eye Institute, Cleveland Clinic, Cleveland, OH; 2Department of
Chemistry, Case Western Reserve University, Cleveland, OH.
Purpose: Carboxyethylpyrrole (CEP) adducts are oxidative modifications derived
from docosahexaenoate-containing lipids and elevated in ocular tissues and plasma
in age-related macular degeneration (AMD). CEP stimulates angiogenesis in vivo,
and mice immunized with CEP develop an AMD-like phenotype. CEP adducts
offer AMD biomarker potential, however current ELISA-based CEP assays can
yield variable results. To improve accuracy and precision, we are developing an LC
MS/MS-based method for quantifying CEP adducts in plasma.
Methods: Authentic standards of CEP-lysine and CEP-BSA were prepared by
organic synthesis. Blood was collected from AMD and control donors at the Cole
Eye Institute and plasma was prepared. Plasma proteins were reduced and
alkylated. Because CEP is destroyed by acid hydrolysis, methods were developed
for the complete enzymatic digestion of plasma proteins in the presence of
butylhydroxytoluene (BHT). Hydrolysis efficiency was evaluated with several
combinations of proteases, including pepsin, pronase E, proteinase K, leucine
aminopeptidase and prolidase. Protein was quantified by amino acid analysis
(AAA). Post cleavage sample clean up and recovery was evaluated with several
solid phase extraction (SPE) cartridges. CEP-lysine was quantified by LC MS/MS
using a Waters UPLC, a Sciex API 3000 triple quadrupole mass spectrometer and
multiple reaction monitoring.
Results: Optimum enzymatic hydrolysis of plasma proteins in the presence of BHT
was achieved with pronase E and leucine aminopeptidase over ~24 h. About 90%
efficiency of hydrolysis was obtained, as calculated by AAA of the enzymatic
hydrolysate before and after HCl hydrolysis. To date, the 1g Hypercarb SPE
cartridge has yielded the best recovery of protein and CEP-lysine (~60%) from
sample clean up; the 2g Hypercarb cartridges will be tested for improved yield.
Excellent resolution of CEP-lysine has been obtained on a Waters HSS C18
column using aqueous acetonitrile/heptafluorobutyric acid solvents. Current results
suggest the limits of detection for CEP-lysine by our LC MS/MS system is less
than 1 pmol.
Conclusions: We anticipate the technology described above will significantly
improve the accuracy and precision of quantifying CEP adducts. Application of the
improved technology in our AMD biomarker studies will be presented.
Commercial Relationships: Geeng-Fu Jang, None; Lei Zhang, None; Li Hong,
None; Hua Wang, None; Robert G. Salomon, SKS Ocular (P); John W. Crabb,
Allergan (C), SKS Ocular (P)
Support: GM21249, EY14239, EY16072, FFB Center Grant to Cole Eye Institute,
RPB Challenge Grant
Program Number: 6479 Poster Board Number: A405
Presentation Time: 11:15 AM - 1:00 PM
Cigarette Smoke Triggers Excessive Complement Activation in Human RPE
Cells: Involvement of Nrf2 signaling
Lei Wang, Kondo Naoshi, Katy B. Ebrahimi, Marisol D. Canol, James T. Handa.
Ophthalmology, Johns Hopkins Univ., School of Medicine, Baltimore, MD.
Purpose: Age-related macular degeneration (AMD) is a major cause of blindness
in the elderly, and cigarette smoke (CS), a powerful oxidant and potent inducer of
the innate immune response, is a strong epidemiologic risk factor. CS causes direct
oxidative damage to the fundus, and may facilitate an uncontrolled immune
response via complement and Toll-like receptor (TLR) activation, therefore
exacerbating tissue damage. Recent studies have shown that complement crosstalks and amplifies the effects of TLRs, possibly through the C5a receptor, and
together, they induce tissue injury. The purpose of our studies was to determine
whether CS triggers the C5a-C5aR pathway in RPE cells. Since AMD may be
linked to a decline in Nrf2 signaling, which regulates the inducible expression of
antioxidant genes, we also examined whether Nrf2 deficiency magnifies the CS
induced immune response.
Methods: ARPE19 cells were transfected with siRNA to Nrf2 or scrambled
control, after reaching 70% confluence, starved in serum free medium for 24h and
treated with 125 ug/ml CS extract (Murty Pharmacueticals) for another 24h. Cells
were subjected to DHE staining to measure superoxide, a measure of oxidative
stress. Total RNA was extracted for quantitative RT-PCR. Whole cell lysates were
prepared for western blot analysis.
Results: ARPE19 cells exposed to 125 ug/ml CS extract showed high levels of
intraceullar superoxide. Nrf2 knockdown decreased the expression of antioxidant
genes (Nqo1, Gclm and HO1), and caused an additional 1.2 fold increase in
superoxide levels in CS extract treated cells (p=0.015). 125 ug/ml CS extract also
increased C5 mRNA expression, which was elevated by Nrf2 knockdown, but
attenuated by the synthetic triterpenoid CDDO-Im, a potent activator of Nrf2
signaling. C5aR expression was detected in ARPE19 cells, both at the mRNA and
proteins levels, and its expression was increased by CS extract or Nrf2 knockdown.
The expressions of IL-1beta, IL6, IL8, MCP-1 mRNAs were induced by C5a,
indicating an active C5a-C5aR pathway in the RPE cells, and the pro-inflammatory
cytokines were increased by CS extract or Nrf2 knockdown.
Conclusions: CS extract not only triggers oxidative stress but also activates
complement via the C5aR in ARPE19 cells, and Nrf2 deficiency further magnifies
the complement activation. These factors may incrementally contribute to the onset
of AMD.
Commercial Relationships: Lei Wang, None; Kondo Naoshi, None; Katy B.
Ebrahimi, None; Marisol D. Canol, None; James T. Handa, None
Support: NIH EY14005, EY019904, Thome grant, Robert Bond Welch
Professorship, and an unrestricted grant to Wilmer from RPB
Program Number: 6480 Poster Board Number: A406
Presentation Time: 11:15 AM - 1:00 PM
Correlation of Renal Function and C-reactive Protein, with Disease Severity
and Progression In Eyes with Dry AMD
Mathew K. George, Carlos Alexandre A. Garcia Filho, Zohar Yehoshua, Giovanni
Gregori, William Feuer, Philip J. Rosenfeld. Bascom Palmer Eye Institute, Univ of
Miami Miller Sch of Med, Miami, FL.
Purpose: Genetic changes in the complement cascade have been associated with
AMD and rare renal diseases such as membranoproliferative glomerulonephritis
type 2. Since complement mediated inflammation and renal status may correlate
with disease severity and progression in age-related macular degeneration (AMD),
we investigated renal function and C-reactive protein levels in patients with dry
AMD enrolled in the COMPLement Inhibition with Eculizumab for the Treatment
of Non-Exudative Age-Related Macular Degeneration (COMPLETE) Study.
Methods: Two cohorts of dry AMD patients were enrolled in the COMPLETE
Study. Cohort-1 was comprised of eyes with GA measuring from 1.25 mm2 to 18
mm2 based on SDOCT fundus imaging. Cohort-2 was comprised of eyes with
drusen in the absence of GA, and the drusen had a volume of at least 0.03 mm3
within a 3 mm diameter circle centered on the fovea based on SDOCT imaging.
Drusen volume maps were obtained using SDOCT imaging (Cirrus, Carl Zeiss
Meditec Inc.), the 200x200 scan pattern, and a proprietary algorithm.
Ophthalmologic exams, ETDRS visual acuity testing, serologic testing, and
imaging studies were performed at baseline and at follow-up months 3, 6, 9, and
12. Serologic testing included assessment of glomerular filtration rate (GFR), and
C-reactive protein. Statistical analysis was performed using two-sample ttests,Pearson correlations,and analysis of covariance.
Results: A total of 60 patients were enrolled in the study. Only one eye of each
patient was included as a study eye, although fellow eyes meeting entry criteria
were evaluated as a secondary endpoint. In Cohort-1, mean age 80 (SD=6) years, a
total of 49 eyes met entry criteria: 30 study eyes and 19 fellow eyes. In Cohort-2,
mean age 71 (SD=7) years, a total of 43 eyes met entry criteria: 30 study eyes and
Copyright 2012 by the Association for Research in Vision and Ophthalmology, Inc., all rights reserved. For permission to reproduce any abstract, contact the ARVO Office at pubs@arvo.org.
ARVO 2012 Annual Meeting Abstracts by Scientific Section/Group – Biochemistry/Molecular Biology (BI)
13 fellow eyes. Mean GFR at baseline was 64.3 mL/min/1.73m2 (SD=17.0) in
Cohort-1 and 78.3 mL/min/1.73m2 (SD=19.3) in Cohort-2 (p=0.004) but was not
significant after adjusting for age (p=0.15). Mean C-reactive protein value at
baseline was 0.57 mg/dL (SD=0.50) in Cohort-1 and 0.60 mg/dL (SD=0.86) in
Cohort-2 (p=0.84). There were no significant correlations between the renal
function parameters or C-reactive protein levels and baseline area of GA or
baseline drusen volume (all p>0.25). The correlations between renal function and
C-reactive protein and growth rates of lesions are currently being evaluated.
Conclusions: At baseline, disease severity did not correlate with renal function or
C-reactive protein levels in each cohort. Whether these parameters are predictive of
disease progression in each cohort remains to be determined.
Commercial Relationships: Mathew K. George, None; Carlos Alexandre A.
Garcia Filho, Carl Zeiss Meditec, Inc. (F); Zohar Yehoshua, Carl Zeiss Meditec,
Inc. (F); Giovanni Gregori, Carl Zeiss meditec, Inc. (F, P); William Feuer,
Alexion (F); Philip J. Rosenfeld, Alexion (F), Carl Zeiss Meditec, Inc (F, R)
Support: Alexion Phamaceuticals; Macula Vision Research Foundation; NIH
center core grant P30EY014801; Research to Prevent Blindness; Department of
Defense (W81XWH-09-1-0675); Grant from Carl Zeiss Meditec Inc
Clinical Trial: http://www.clinicaltrials.gov, NCT00935883
Program Number: 6481 Poster Board Number: A407
Presentation Time: 11:15 AM - 1:00 PM
Amyloid-β Peptide Induces Angiogenesis In The Adult Zebrafish Retina
Khomthorn P. Cunvong1A, D. Joshua Cameron1B. AGraduate College of Biomedical
Sciences, BCollege of Optometry, 1Western University of Health Sciences,
Pomona, CA.
Purpose: Age-related macular degeneration (AMD) is a leading cause of
irreversible blindness. Amyloid-β peptide (Aβ), a hallmark of Alzheimer’s disease
and found within dense aggregates and plaques in the brain, has also been found in
drusen deposits in patients with AMD. Even though Aβ has been associated with
these two high-profile diseases for many years, its biological function remains
relatively unknown. The brain and eye possess similar neurodegenerative
pathways, because they are alike in their molecular and cellular structures.
Therefore, it would be correct to conclude that the eyes serve as a good indicator of
brain health, and vice versa. A recent hypothesis has suggested that Aβ interacts in
the Notch pathway and thereby affects angiogenesis. We are testing this hypothesis
in the adult zebrafish eye.
Methods: Tg (kdr:EGPF)s843 transgenic zebrafish, expressing GFP in vascular
endothelial cells, were maintained under standard conditions at 28.5°C on a 10 h
dark - 14 h light cycle. Fish were sedated using Tricaine and placed under a
dissecting microscope for injections, which were performed at the dorsal-most
aspect of the cornea, into the aqueous humor, using pulled glass capillary needles.
At 7 dpi, fish enucleated and fixed in 4% PFA at 4°C overnight. These eyes were
then re-hydrated in PBS before being dissected and flat-mounted on a slide.
Confocal images were taken of the retina and these images were joined together to
generate a map of the retinal vessels, which include the circumferential vein.
Results: Injection sites healed quickly, with no observable visual or physiological
defects. PBS injections did not affect the blood vessel branching in the eye,
whereas positive controls, injected with a γ-secretase inhibitor (GSI), showed
increased vessel branching. Fish eyes that were treated with Aβ developed
significantly more endothelial tip branches, as well as near the thin capillaries
leading to the circumferential vein.
Conclusions: These findings suggest that Aβ plays a role in angiogenesis.
Preliminary data suggests that Aβ specifically interacts with Notch genes, but needs
further elucidation. Aβ’s role in angiogenesis could shed light on AMD and
Alzheimer’s disease pathophysiology and offer new targets for therapeutic
intervention.
Commercial Relationships: Khomthorn P. Cunvong, None; D. Joshua
Cameron, None
Support: None
Program Number: 6482 Poster Board Number: A408
Presentation Time: 11:15 AM - 1:00 PM
Intense Physiological Light Upregulates VEGF and Promotes Choroidal
Neovascularization via PGC-1α/ERR-α Pathway
Takashi Ueta1, Tatusya Inoue1, Kentaro Yuda1, Takahisa Furukawa2, Yasuo
Yanagi1, Yasuhiro Tamaki1. 1Ophthalmology, Univ of Tokyo, School of Med,
Bunkyo-ku, Japan; 2Department of Developmental Biology, Osaka Bioscience
Institute, Suita, Osaka, Japan.
Purpose: Toxicity of intense light to facilitate the development of age-related
macular degeneration (AMD), especially neovascular AMD, is a major public
health concern although the mechanism remains unclear. We report the effects of
intense, but within physiological range, light on retinal pigment epithelium (RPE),
a major pathogenic origin of AMD.
Methods: In this study intense physiological light was defined as 15 lx visible light
because wild-type (WT) mice escaped from visible light with intensity of >10 lx.
Rhodopsin concentration in RPE was measured to compare the volume of
phagocytosed photoreceptor outer segments (OS) among different intensities of
light. rd1/rd1 mice and Crx−/− mice were used to evaluate the effect of light in
mice without OS. mRNA and protein level of vascular endothelial growth factor-A
(VEGF-A), Peroxisome proliferator-activated receptor γ coactivator-1α (PGC-1α)
and hypoxia-inducible factor 1 (HIF-1α) were evaluated by real-time RT-PCR and
western blotting. ARPE-19 cells and isolated porcine OS were used to investigate
the mechanism of OS-induced VEGF-A upregulation in RPE cells. PGC-1α−/−
mice and estrogen-related receptor-α (ERR-α)−/− mice were used to confirm the
involvement of PGC-1α/ ERR-α pathway in the light-induced VEGF-A
upregulation in RPE. The mouse model of laser-induced choroidal
neovascularization (CNV) was used to evaluate the effect of light.
Results: Intense physiological light upregulated VEGF-A mRNA and protein level
in RPE, independent of circadian rhythm, which led to the promotion of CNV in
mice. In this process the increased phagocytosis of OS by RPE cells was observed
in mice under intense physiological light, but not in mice under milder light. In
rd1/rd1 mice and Crx−/− mice VEGF-A was not upregulated by light. In RPE cells
phagocytosing more OS, increased expression of PGC-1α, not HIF-1α was
observed. The VEGF-A upregulation and CNV promotion were abrogated in PGC1α−/− mice and ERR-α−/− mice.
Conclusions: These results indicate that intense physiological light upregulates
VEGF in RPE and promotes CNV, which is mediated by increased phagocytosis of
OS by RPE and activation of PGC-1α/ ERR-α pathway. A direct evidence for the
association of light exposure and CNV facilitation is provided by this report.
Commercial Relationships: Takashi Ueta, None; Tatusya Inoue,
None; Kentaro Yuda, None; Takahisa Furukawa, None; Yasuo Yanagi,
None; Yasuhiro Tamaki, None
Support: None
Program Number: 6483 Poster Board Number: A409
Presentation Time: 11:15 AM - 1:00 PM
Genetic Association of Glucose Transporter Type 1 Variants with Age-Related
Macular Degeneration and its Direct Interaction with Complement Factor H
at the Protein Level
Elod Kortvely1, Anneke I. Den Hollander2, Matteo Gorza3, Valentina Cipriani4,
John R. Yates4,5, Caroline Hayward6, Alan F. Wright6, Sascha Fauser7, Carel C.
Hoyng2, Marius Ueffing8,3. 1Centre for Ophthalmology, University of Tuebingen,
Tuebingen, Germany; 2Department of Ophthalmology, Radboud University
Nijmegen, Medical Centre, Nijmegen, The Netherlands; 3Research Unit for Protein
Science, Helmholtz Zentrum München, German Research Center for
Environmental Health, Neuherberg, Germany; 4Institute of Ophthalmology,
University College, London, London, United Kingdom; 5Department of Medical
Genetics, University of Cambridge, Cambridge, United Kingdom; 6Institute of
Genetics and Molecular Medicine, MRC Human Genetics Unit, Edinburgh, United
Kingdom; 7University Eye Hospital Cologne, Cologne, Germany; 8Institute for
Ophthalmic Research, University Eye Hospital, Tuebingen, Germany.
Purpose: Mutations and polymorphic variants in complement factor H (CFH), the
main inhibitor of the alternative complement pathway, have been found to be
associated with age-related macular degeneration (AMD). In the present study, we
sought to identify proteins interacting with CFH that could provide new insights
into its (patho)physiological function.
Methods: A yeast two-hybrid screen was performed using the non-risk variant of
CFH as bait against a human placental cDNA library, in order to identify direct
interacting partners. The physiological interaction was confirmed by coimmunoprecipitation followed by mass spectrometry. Glucose transporter type 1
(GLUT1/SLC2A1), a protein identified with both methods as a binding partner of
CFH, was selected for further genetic association analysis. Nine tag SNPs were
genotyped in three independent cohorts including 1,888 AMD patients and 954
healthy controls.
Results: Using yeast two-hybrid analysis we found that CFH directly binds to
GLUT1, the key glucose transporter of the blood-retina barrier. The physical
interaction was also confirmed by co-immunoprecipitation experiments combined
with mass spectrometry. Further analyses suggest that GLUT1 engages CFH in
retinal pigment epithelium cells via its C-terminal exomembrane domains. Genetic
association studies detected a significant correlation of GLUT1 polymorphisms
(SNP rs3768029) with AMD. Compared to the reference CC-genotype, ORs of
1.339 (95% CI=1.113-1.611, p=0.001) and 1.344 (95% CI=1.067-1.694, p=0.01)
were obtained for carriers with CT- and TT-genotypes, respectively.
Conclusions: These results demonstrate a new role for GLUT1 in the localization
of CFH to the blood-retina barrier. Polymorphisms in the GLUT1 gene may
contribute to AMD risk.
Commercial Relationships: Elod Kortvely, None; Anneke I. Den Hollander,
None; Matteo Gorza, None; Valentina Cipriani, None; John R. Yates,
None; Caroline Hayward, None; Alan F. Wright, None; Sascha Fauser,
None; Carel C. Hoyng, None; Marius Ueffing, None
Support: None
Program Number: 6484 Poster Board Number: A410
Presentation Time: 11:15 AM - 1:00 PM
On the Origin of Proteins in Human Bruch’s Membrane and Drusen
Copyright 2012 by the Association for Research in Vision and Ophthalmology, Inc., all rights reserved. For permission to reproduce any abstract, contact the ARVO Office at pubs@arvo.org.
ARVO 2012 Annual Meeting Abstracts by Scientific Section/Group – Biochemistry/Molecular Biology (BI)
Theo G. Gorgels1, Judith C. Booij1, Sovann Kaing1, Imre Lengyel2, Arthur A.
Bergen1. 1Molecular Ophthalmogenetics, Netherlands Inst Neuroscience,
Amsterdam, The Netherlands; 2Ocular Biology and Therapeutics, UCL Institute of
Ophthalmology, London, United Kingdom.
Purpose: To identify the cellular origin of proteins in the acellular human Bruch's
membrane (BM) and in drusen.
Methods: Gene expression profiling of laser micro dissected RPE, photoreceptor
and choroidal cells from selected human donor eyes was carried out using Agilent
microarrays. This provided detailed information of the transcriptomes of these three
cell layers: Information 1) on level of gene expression, by comparing with the
expression of other genes in the same cell layer, and, 2) on cell-layer specificity of
expression by comparing between cell layers. Expression data were confirmed by
RT-PCR and WWW database searches. Functional annotation was carried out
using DAVID and the Ingenuity knowledge database. A list of proteins present in
the BM and in drusen was compiled from the literature. In order to identify the
origin of these proteins, we then checked the presence or absence of the
corresponding genes in the transcriptomes of the adjacent RPE, choroidal and
photoreceptors cells and in the serum proteome.
Results: Most of the genes of Bruch’s membrane proteins, e.g. collagen, laminin
and fibronectin, are expressed both in the RPE and in the choroid. Yet, for most of
these proteins the RNA expression in the choroid is much higher than in the RPE.
We also found that 28 (22 %) out of 129 known drusen proteins are likely to have a
choroidal cell origin, 7 (5%) were primarily derived from the RPE and 2 (2%)
originated primarily from photoreceptor cells. Nine (7%) proteins occur both in
serum and drusen, but are low or not expressed in photoreceptor, RPE or choroidal
cells. For the other drusen proteins, the specific cellular origin(s) remained
undetermined, e.g. because their mRNA was detected in more than one cell layer.
Conclusions: We found that, in humans, choroidal cells and/or serum are important
suppliers of BM and drusen proteins. Since some of the drusen proteins are nuclear,
cytoplasmic of membrane proteins of RPE and choroidal cells, our study suggests
that drusen contain the remains of dead RPE and choroidal cells. The data may be
useful in the search for a (systemic) treatment for retinal disorders, such as agerelated macular degeneration (AMD).
Commercial Relationships: Theo G. Gorgels, None; Judith C. Booij,
None; Sovann Kaing, None; Imre Lengyel, None; Arthur A. Bergen, None
Support: NWO (948-00-013), ANVVB, LSBS, Netherlands Macula Society, Bill
Brown Charitable Trust Senior Research Fellowship UK (IL)
Program Number: 6485 Poster Board Number: A411
Presentation Time: 11:15 AM - 1:00 PM
Can Environmental Enrichment (EE) Prevent the Rodent Light-Induced
Retinopathy (LIR)?
Yasmin Kerouch1, Kristina Rousseau1, Mathieu Gauvin1, Mohammad Quaddoumi2,
Anna Polosa1, Pierre Lachapelle1. 1Ophthalmology and Neurology-Neurosurgery,
McGill University-Montreal Children's Hospital Research Institute, Montreal, QC,
Canada; 2Department of Applied Therapeutics, Kuwait University, Faculty of
Pharmacy, Kuwait.
Purpose: Environmental enrichment (EE) is claimed to reduce several pathogenic
mechanisms that are thought to promote retinal degenerative disorders, such as agerelated macular degeneration (AMD), presumably by augmenting retinal levels of
Brain Derived Neurotrophic Factor (BDNF), a neurotrophin implicated in the
neuroprotection of retinal cells. We investigated if prior EE exposure could protect
the retinal structure and function in our rodent model of LIR.
Methods: Adult female Sprague-Dawley rats were group housed (n=9) in an EE
consisting of a variety of toys, tubes, nesting material and running wheels in a large
mesh cage. Age-matched control rats (CR: n=4) were simultaneously raised in the
normal animal care facility (standard environment). After three consecutive weeks
of EE, animals were exposed to bright cyclic light of 1500 lux for 3 days to induce
the LIR, and then returned to their respective environment for one week. (ERGs)
were recorded to measure the efficiency of EE before rearing the animals in the EE
(w0) and subsequently (w2 and w3) and 1 (D1) and 7 days (D7) post-LIR.
Results: At w2 (during EE exposure), the EE group showed reduced scotopic aand b-wave amplitudes (-23.4% and -28.4% respectively) compared to CR group.
At D1 (following light exposure), there was an equal 34% reduction of the scotopic
a-wave and 22% of scotopic b-wave amplitudes in both groups. Of interest, while
in the CR group the a-wave increased by more than 34% between D1 and D7, in
EE rats, it increased by less than 9% (p<.05). During the same time interval, the
scotopic b-wave increased by 20% in the CR group while it was significantly
reduced by 12% in the EE group.
Conclusions: EE did not prevent or reduce the pathogenesis of LIR. If anything it
would appear to have exacerbated it. Furthermore, even before inducing the LIR,
EE had already hampered retinal function. One wonders if the 3 week EE exposure
could not have introduced an additional stress factor that could have enhanced
neuronal vulnerability to ensuing light-induced excitotoxicity.
Commercial Relationships: Yasmin Kerouch, None; Kristina Rousseau,
None; Mathieu Gauvin, None; Mohammad Quaddoumi, None; Anna Polosa,
None; Pierre Lachapelle, None
Support: FRSQ and Réseau Vision
Program Number: 6486 Poster Board Number: A412
Presentation Time: 11:15 AM - 1:00 PM
Characterisation Of The Large Macromolecular MMP Complex Of Human
Bruch’s Membrane With Respect To Stability, Activation And Effects Of
Ginseng Compounds
Yong Dol Shin1, Jae Hwan Seok2, Cheul Muu Sim3, Min Young Kang2, Hyeon Jea
Shim2, Yun Hee Lee2, Ali Hussain4. 1Jeonbuk National University, Jeonju-si,
Republic of Korea; 2GBioMix, Jeonju-si, Republic of Korea; 3Korean Atomic
Energy Research Institute, Dae Jeon, Republic of Korea; 4Division of Molecular
Therapy, UCL Institute of Ophthalmology, London, United Kingdom.
Purpose: The LMMC particle containing high molecular weight species
HMW1&2 and pro-MMP9 effectively sequesters free MMPs from the activation
process leading to diminished turnover of Bruch’s membrane in patients with agerelated macular degeneration (AMD). The stability of the LMMC complex together
with susceptibility for activation of its components with mercurial compounds was
assessed. The potential for ginseng saponin mediated dispersion of the LMMC
complex was also assessed.
Methods: LMMC particles were isolated from macerated Bruch’s-choroid
preparations from four eyes (of donors aged 72-84 years) by gel-filtration
chromatography on Sepharose CL-6B columns. Isolated LMMC particles were
activated with APMA (amino-phenyl mercuric acetate) by incubation for 1 hour
and the mixture re-chromatographed to assess stability of the complex. Elution
fractions were examined by gelatin zymography to determine if the MMP
components of the particles could be activated. Similarly, LMMC particles were
incubated with 4% ginseng for 24 hours and stability and nature of any MMP
conversion determined.
Results: Isolated intact LMMC particles contained only HMW2, HMW1 and proMMP9 species. Incubation of these particles for 24 hours at 37oC did not lead to
particle disintegration (as judged by gel filtration) but resulted in partial autoactivation of pro-MMP9. Incubation with ginseng did not affect the stability of the
particles but blocked the conversion of pro-MMP9 to its activated form. APMA
incubation resulted in complete disintegration of the LMMC particle with
hydrolysis of both HMW components. The released pro-MMP9 fraction was fully
activated but the corresponding pro-MMP2 (from HMW1&2 hydrolysis) was
resistant to activation.
Conclusions: The LMMC particle is labile with partial activation of the pro-MMP9
species. Since ginseng can block this conversion, it may be useful in inhibiting the
neovascularisation process. The study shows the potential for drug-based
disintegration of the LMMC complex in an attempt to increase the levels of active
MMPs to improve the dynamics of Bruch’s membrane.
Commercial Relationships: Yong Dol Shin, None; Jae Hwan Seok, GBioMix
(E); Cheul Muu Sim, None; Min Young Kang, GBioMix (E); Hyeon Jea Shim,
GBioMix (E); Yun Hee Lee, None; Ali Hussain, None
Support: None
Program Number: 6487 Poster Board Number: A413
Presentation Time: 11:15 AM - 1:00 PM
The oxysterol, 27-hydroxycholesterol, disrupts Estrogen Receptor and Liver X
Receptor signaling in Retinal Pigment Epithelial Cells
Bhanu C. Dasari, Othman Ghribi. Pharmacology Physiology & Therapeutics, Univ
of North Dakota, Grand Forks, ND.
Purpose: We demonstrated that the cholesterol oxidation product 27hydroxycholesterol (27-OHC) triggers pathological hallmarks relevant to both
Alzheimer’s disease (AD) and Age Related Macular Degeneration (AMD) in
retinal pigment epithelial cells. 27-OHC is an endogenous ligand of liver X
receptors (LXR) and also is a selective estrogen receptor modulator. Both Estrogen
receptors (ERs) and LXRs are suggested to be implicated in AMD development.
The purpose of our study was to determine the extent to which LXRs and ERs are
involved in 27-OHC-induced AD and AMD like pathological hallmarks.
Methods: ARPE-19 cells were grown until confluency for all experiments.
Estrogen responsive element and LXR responsive element transfections and Dual
Luciferase Assays were carried out for measuring transcriptional activities of ER
and LXR. Cytotoxicity, mitochondrial membrane potential, and reactive oxygen
species were determined with LDH, JC-1 and DCFH-DA assays respectively.
Changes in ERs and LXRs levels were determined with western blotting.
Results: Retinal pigment epithelial cells express LXRs and ERs and are
transcriptionally active. While 27-OHC induces LXR-mediated transcriptional
activity, it inhibits ER-mediated transcriptional activity. Treatment with ER agonist
estradiol (E2) and LXR antagonist ECHS protected cells from 27-OHC induced
cytotoxicity.
Conclusions: Increased 27-OHC levels following hypercholesterolemia can inhibit
ERs abrogating the protective effects of estrogen and activate LXR signaling
causing cell dysfunction. By disturbing both LXR and ER signaling, 27-OHC
might play role in the development of AMD.
Commercial Relationships: Bhanu C. Dasari, None; Othman Ghribi, None
Support: NIEHS/NIH to OG (R01ES014826)
Program Number: 6488 Poster Board Number: A414
Copyright 2012 by the Association for Research in Vision and Ophthalmology, Inc., all rights reserved. For permission to reproduce any abstract, contact the ARVO Office at pubs@arvo.org.
ARVO 2012 Annual Meeting Abstracts by Scientific Section/Group – Biochemistry/Molecular Biology (BI)
Presentation Time: 11:15 AM - 1:00 PM
Translational diffusion of ranibizumab and bevacizumab as measured by
Fluorescence Recovery after Photobleaching (FRAP)
Nishanthan Srikantha1A, Klaus Suhling1B, Tim Jackson1A. AOphthalmology,
B
Physics, 1Kings College London, London, United Kingdom.
Purpose:
Some clinical studies indicate that the 149,000 Dalton bevacizumab and 48,000
Dalton ranibizumab have similar therapeutic effects. It would be expected that
ranibizumab is more effective as its lower molecular weight should facilitate
diffusion through the vitreous body to the retina. This study aimed to determine the
diffusion coefficient of both drugs.
Methods: The translational diffusion of fluorescently labeled ranibizumab and
bevacizumab were determined using fluorescence recovery after photobleaching
(FRAP). The translational diffusion coefficient was used to calculate an
approximate size for both drugs, and to predict the speed of diffusion through
vitreous.
Results: Studies show that porcine vitreous is 6.29 ± 2.3centipoise (cp). At this
viscosity the diffusion coefficient for ranibizumab and bevacizumab is 2.08x1013
and 1.50x10-13 repectively. Based on translational diffusion coefficients,
ranibizumab has a molecular radius of 6.43nm and bevacizumab 9.00nm. These
results predict that ranibizumab would diffuse through vitreous 1.39 times faster
than bevacizumab.
Conclusions:
Ranibizumab is able to reach its target tissue faster than bevacizumab. The effects
on drug elimination is harder to predict, but the results are consistent with animal
studies showing that ranibizumab has a shorter half-life than bevacizumab. Further
studies are needed.
Commercial Relationships: Nishanthan Srikantha, None; Klaus Suhling,
None; Tim Jackson, None
Support: Fight for Sight
Program Number: 6489 Poster Board Number: A415
Presentation Time: 11:15 AM - 1:00 PM
Identifying the Roles of Interferon-Gamma Inducible Chemokines in
Progression of Age-related Macular Degeneration (AMD)
Syeda F. Absar1, Desirée Cyr1, Alan D. Proia2, Muhammad T. Malik1, Peter Bex1,
Kameran Lashkari1. 1Schepens Eye Research Institute, Massachusetts Eye and Ear,
Department of Opthalmology, Harvard Medical School, Boston, MA; 2Department
of Pathology, Duke University Medical Center, Durham, NC.
Purpose: Local and possibly systemic inflammation play important roles in AMD;
understanding the profile and activity of pro-inflammatory factors may elucidate
the underlying mechanisms that participate in AMD and identify individuals at
increased risk. We have previously identified interferon inducible factor-10 (IP-10)
as one of the pro-inflammatory chemokines in the sera of subjects with AMD. In
this study we have investigated the potential systemic cellular sources of interferoninducible chemokines (CXC) and their receptor, CXCR3. Other CXC chemokines
include monokine induced by interferon-gamma (MIG/CXCL9) and interferoninducible T-cell alpha chemoattractant (I-TAC/CXCL11).
Methods: Subjects with AMD were clinically classified as one of the following
phenotypes, AREDS stages 1 and 3, geographic atrophy, active and inactive
neovascular AMD. Buffy coats were derived from whole blood samples and
subjected to flow cytometry analysis for expression of MIG, IP-10, I-TAC and
CXCR3 in the circulating leukocytes. Matched postmortem eye and spleen samples
were collected. Expression of these chemokines was examined by
immunohistochemistry (IHC).
Results: Flow cytometry showed elevated levels of MIG, IP-10 and I-TAC in
patients of all AMD phenotypes as compared to controls. This shows that certain
circulating leukocytes express the CXC chemokine system and probably contribute
to their elevated serum levels. IHC of matched spleens of AMD donors showed that
CXC expression was elevated in spleen cells as early as early stage AMD.
Similarly, in postmortem eyes with early AMD, CXC expression was increased in
the RPE and subsequently in basal linear/laminar deposits in all other stages of
AMD.
Conclusions: Studies indicate that CXC chemokines are elevated in subjects with
AMD and may contribute as a systemic source to maintain a pro-inflammatory
state in subjects with AMD. CXC chemokines are also upregulated in RPE cells in
eyes with AMD. These chemokines and their receptor may be novel therapeutic
targets for anti-inflammatory treatment of AMD.
Commercial Relationships: Syeda F. Absar, None; Desirée Cyr, None; Alan D.
Proia, None; Muhammad T. Malik, None; Peter Bex, None; Kameran
Lashkari, None
Support: Schepens Scholars Fund
Program Number: 6490 Poster Board Number: A416
Presentation Time: 11:15 AM - 1:00 PM
Low Doses Of Proteasome Inhibitors Protect Against Oxidative Injuries Via
Ppar(α)-dependent Pathway In Arpe-19 Cells
Shengzhou Wu, Lin Sun, Jingjing Cai, Jia Qu. School of Optometry and
Ophthalmology, Wenzhou Medical College, Wenzhou, China.
Purpose: Oxidative processes have been proposed to play important roles in agerelated macular degeneration (AMD). Evidences indicated that the proteasomal
degradation pathway protects cells against oxidative stresses. Previous report
showed that low doses of proteasome inhibitors reduce injury from oxidative
damage in neuronal cultures via increasing proteasome activities. The objective of
this study was to determine whether low doses of proteasome inhibitors could save
ARPE-19 cells from oxidative stresses and its associated mechanisms.
Methods: The protective effects of low doses of reversible or irreversible
proteasome inhibitors in ARPE-19 cells were assessed by MTS assay. The same
method was also applied to test the effect of PPARalpha or PPARgamma
antagonists on the protective effects of MG-132 or clasto-lactacystinβ-lactone.
PPAR response element (PPRE) transactivity in ARPE-19 cells induced by low
doses of proteasome inhibitors was assayed by dual-luciferase assay.
Electrophoretic mobility shift assay(EMSA) was employed to confirm the results of
dual-luciferase. Super-shift analysis was used to detect the category of PPAR
transc