Carboxyl-Proximal Regions of Reovirus
Nonstructural Protein µNS Necessary and
Sufficient for Forming Factory-Like
Inclusions
Updated information and services can be found at:
http://jvi.asm.org/content/79/10/6194
These include:
REFERENCES
CONTENT ALERTS
This article cites 47 articles, 23 of which can be accessed free
at: http://jvi.asm.org/content/79/10/6194#ref-list-1
Receive: RSS Feeds, eTOCs, free email alerts (when new
articles cite this article), more»
Information about commercial reprint orders: http://journals.asm.org/site/misc/reprints.xhtml
To subscribe to to another ASM Journal go to: http://journals.asm.org/site/subscriptions/
Downloaded from http://jvi.asm.org/ on February 27, 2014 by PENN STATE UNIV
Teresa J. Broering , Michelle M. Arnold, Cathy L. Miller,
Jessica A. Hurt, Patricia L. Joyce and Max L. Nibert
J. Virol. 2005, 79(10):6194. DOI:
10.1128/JVI.79.10.6194-6206.2005.
JOURNAL OF VIROLOGY, May 2005, p. 6194–6206
0022-538X/05/$08.00⫹0 doi:10.1128/JVI.79.10.6194–6206.2005
Copyright © 2005, American Society for Microbiology. All Rights Reserved.
Vol. 79, No. 10
Carboxyl-Proximal Regions of Reovirus Nonstructural Protein ␮NS
Necessary and Sufficient for Forming Factory-Like Inclusions
Teresa J. Broering,1,2†‡ Michelle M. Arnold,1,3† Cathy L. Miller,1 Jessica A. Hurt,4
Patricia L. Joyce,2§ and Max L. Nibert1,3,4*
Received 1 September 2004/Accepted 14 January 2005
Mammalian orthoreoviruses are believed to replicate in distinctive, cytoplasmic inclusion bodies, commonly
called viral factories or viroplasms. The viral nonstructural protein ␮NS has been implicated in forming the
matrix of these structures, as well as in recruiting other components to them for putative roles in genome
replication and particle assembly. In this study, we sought to identify the regions of ␮NS that are involved in
forming factory-like inclusions in transfected cells in the absence of infection or other viral proteins. Sequences
in the carboxyl-terminal one-third of the 721-residue ␮NS protein were linked to this activity. Deletion of as
few as eight residues from the carboxyl terminus of ␮NS resulted in loss of inclusion formation, suggesting that
some portion of these residues is required for the phenotype. A region spanning residues 471 to 721 of ␮NS
was the smallest one shown to be sufficient for forming factory-like inclusions. The region from positions 471
to 721 (471-721 region) includes both of two previously predicted coiled-coil segments in ␮NS, suggesting that
one or both of these segments may also be required for inclusion formation. Deletion of the more amino-terminal one of the two predicted coiled-coil segments from the 471-721 region resulted in loss of the phenotype, although replacement of this segment with Aequorea victoria green fluorescent protein, which is known to weakly
dimerize, largely restored inclusion formation. Sequences between the two predicted coiled-coil segments were
also required for forming factory-like inclusions, and mutation of either one His residue (His570) or one Cys
residue (Cys572) within these sequences disrupted the phenotype. The His and Cys residues are part of a small
consensus motif that is conserved across ␮NS homologs from avian orthoreoviruses and aquareoviruses,
suggesting this motif may have a common function in these related viruses. The inclusion-forming 471-721
region of ␮NS was shown to provide a useful platform for the presentation of peptides for studies of proteinprotein association through colocalization to factory-like inclusions in transfected cells.
mic face of the endoplasmic reticulum (32, 36), and flock house
virus (ssRNA genome, family Nodaviridae) on the cytoplasmic
face of mitochondria (27). The basis and consequences of such
specific localizations are the subjects of active investigations in
many laboratories. We anticipate that studies of mammalian
orthoreovirus (reovirus) factories in our own laboratory will
provide new insights into the still poorly characterized mechanisms for RNA packaging and replication by these and other
viruses in the family Reoviridae, as well as on the general
significance and mechanism of concentrating viral replication
at particular sites within cells.
In early studies, reovirus factories were determined to contain fully and partially assembled viral particles, viral proteins,
double-stranded RNA, microtubules, and “kinky” filaments
proposed to be intermediate filaments but not membranebound structures or ribosomes (10, 11, 23, 33, 37, 39, 41). The
factories have a peculiarly dense consistency that distinguishes
them from the adjacent cytoplasm and causes them to appear
highly refractile by phase-contrast microscopy. At least part of
this property appears to reflect a protein matrix that suffuses
the factories. The determinants or features of one or more
viral proteins that would make it capable of forming such a
matrix are not well understood but might involve a variety of
different types of intersubunit interactions, as well as interactions with cellular factors.
Results from our laboratory and others have recently shown
Viruses with ten-segmented, double-stranded RNA genomes from the family Reoviridae, genus Orthoreovirus, are believed to replicate in distinctive, cytoplasmic inclusion bodies
(7, 10, 11, 13, 23, 24, 30, 33, 37–39, 41, 44, 45). These inclusions
are commonly called viral factories (13, 30) or viroplasms (45)
and are similar to cytoplasmic inclusions formed by other viruses in the same family. In cells infected by rotaviruses or
orbiviruses, for example, these structures are called viroplasms
(12, 40) or viral inclusion bodies (8, 43), respectively.
Many viruses sequester their replication machinery within
localized structures or surfaces in infected cells: for example,
herpes simplex virus (double-stranded DNA genome, family
Herpesviridae) in nuclear inclusions (reviewed in reference 35),
vaccinia virus (double-stranded DNA genome, family Poxviridae) in cytoplasmic inclusions (also called viral factories [reviewed in reference 29]), brome mosaic virus (single-stranded
RNA [ssRNA] genome, family Bromoviridae) on the cytoplas* Corresponding author. Mailing address: Department of Microbiology and Molecular Genetics, Harvard Medical School, 200 Longwood Ave., Boston, MA 02115. Phone: (617) 645-3680. Fax: (617) 7387664. E-mail: mnibert@hms.harvard.edu.
† T.J.B. and M.M.A. contributed equally to this study.
‡ Present address: Massachusetts Biologic Laboratories, Jamaica
Plain, MA 02130.
§ Present address: Department of Radiation Oncology, University
of North Carolina at Chapel Hill, Chapel Hill, NC 27599.
6194
Downloaded from http://jvi.asm.org/ on February 27, 2014 by PENN STATE UNIV
Department of Microbiology and Molecular Genetics, Harvard Medical School, Boston, Massachusetts 021151;
Department of Biochemistry, University of Wisconsin-Madison, Madison, Wisconsin 537062; and Ph.D.
Programs in Virology3 and Biological and Biomedical Sciences,4 Division of Medical Sciences,
Harvard University, Cambridge, Massachusetts 02138
VOL. 79, 2005
INCLUSION FORMATION BY REOVIRUS ␮NS PROTEIN
morphology of filamentous viral factories. Aside from any effects of ␮2, however, ␮NS also requires microtubules for
undergoing condensation of its smaller inclusions into larger
ones, as shown by the effects of the microtubule-depolymerizing drug nocodazole. This probably reflects a role for microtubule-based transport in the formation of ␮NS inclusions and
the determination of viral factory morphology (7, 30).
By forming the matrix of viral factories, as well as recruiting
other components to these structures, the reovirus ␮NS protein could serve to concentrate the components for viral replication and assembly, to arrange the components in specific
ways to promote replication and assembly, and/or to sequester
the components and their mediated functions from antiviral
factors in the cellular environment. To better understand the
role of ␮NS in forming the matrix of viral factories, we engineered constructs to express a panel of ␮NS truncations and
point mutants and thereby determined the regions of this
protein that are involved in forming factory-like inclusions
in transfected cells. The results identified several different sequences in the C-terminal one-third of ␮NS that are necessary
and sufficient for this activity of ␮NS.
MATERIALS AND METHODS
Cells and antibodies. CV-1 cells were maintained in Dulbecco modified Eagle
medium (Invitrogen Life Technologies) containing 10% fetal bovine serum (HyClone Laboratories) and 10 ␮g of gentamicin solution (Invitrogen Life Technologies) per ml. Goat anti-mouse immunoglobulin G (IgG) and goat anti-rabbit
IgG conjugated to Alexa 488 or Alexa 594 were obtained from Molecular Probes.
Rabbit polyclonal antisera to ␮NS or ␮2 have been described previously (5, 7,
30). For some experiments, we used protein A-purified rabbit anti-␮NS or
anti-␮2 IgG conjugated to Texas Red, Oregon Green, Alexa 488, or Alexa 594 by
using kits obtained from Molecular Probes. Mouse monoclonal antibody (MAb)
FK2 against conjugated ubiquitin (14) was purchased from Medical & Biological
Laboratories. Mouse MAb JL8 against Aequorea victoria green fluorescent protein (GFP) was purchased from BD Biosciences. Mouse MAb HA.11 against an
immunodominant epitope of influenza A virus hemagglutinin (HA) was purchased from Covance. Mouse MAb 3E10 specific for reovirus ␴NS protein (3)
was a gift from T. S. Dermody and coworkers (Vanderbilt University). All
antibodies were titrated to optimize signal-to-noise ratios.
Expression constructs. Reovirus proteins were expressed from genes cloned
into the mammalian expression vector pCI-neo (Promega). pCI-M3(T1L) and
pCI-M3(T3D) to express ␮NS from type 1 Lang (T1L) or type 3 Dearing (T3D)
reovirus have been described previously (7), as have pCI-M3(41-721) to express
␮NS residues 41 to 721 (7), pCI-M1(T1L) to express ␮2 (30), and pCI-S3(T1L)
to express ␴NS (26). Vent polymerase, which was used for all PCRs, and other
enzymes were from New England Biolabs unless otherwise stated.
To express ␮NS residues 1 to 683, site-directed mutagenesis was used to
introduce a stop codon at nucleotides 2068 to 2070, followed by a Bsu36I site.
QuikChange site-directed mutagenesis (Stratagene) was used according to the
manufacturer’s protocol with pFastBac-M3(T1L) (5) as a template, forward
primer 5⬘-GGATACGATGAACTAACCTCAGGCTAAATCATTGCG-3⬘, and
reverse primer 5⬘-CGCAATGATTTAGCCTGAGGTTAGTTCATCGTATC
C-3⬘ (double underline, nucleotide change to add the stop codon; single underline, nucleotide change to add the restriction site). The region containing the
desired mutations was excised by digestion with HindIII and then ligated to
pFastBac-M3(T1L) that had been cut with HindIII to remove the same region,
generating pFastBac-M3(1-683). The subcloned region was sequenced to confirm its correctness. The M3 gene was removed from pFastBac-M3(1-683) by
digestion with SalI and NheI and then ligated to pCI-neo that had been cut with
the same enzymes, generating pCI-M3(1-683).
To generate other ␮NS truncations, start and stop codons and restriction sites
were introduced at different positions in the M3 gene by PCR amplification of
the desired M3 region. The truncations were made in either T1L or T3D M3. We
have found no difference in inclusion formation with T1L and T3D ␮NS (7, 26),
suggesting that the truncations from these allelic ␮NS proteins are directly
comparable. In addition, the T1L and T3D ␮NS proteins are ⬃96% identical
(25). Each PCR was performed with pGEM-4Z-M3(T1L) or pGEM-4Z-M3
(T3D) (5) as a template, and the primers are listed in Table 1. Each PCR product
Downloaded from http://jvi.asm.org/ on February 27, 2014 by PENN STATE UNIV
that a single reovirus protein, ␮NS, is sufficient for forming
phase-dense globular inclusions in the cytoplasm of transfected
cells (4, 7). The inclusions formed by ␮NS in such experiments
are notably similar in appearance to globular reovirus factories
formed in infected cells, as visualized by either phase-contrast
or immunofluorescence (IF) microscopy (4, 7, 30), suggesting
that ␮NS forms the matrix of the factories (7). Moreover, ␮NS
can associate with several other reovirus proteins and recruit
them to these inclusions in transfected cells. To date, the viral
proteins that have been reported to be recruited to inclusions
formed by reovirus ␮NS are microtubule-binding core protein
␮2 (7); nonstructural and ssRNA-binding protein ␴NS (4, 26);
and the core surface proteins ␭1, ␭2, and ␴2 (6). Whole core
particles released into the cytoplasm during cell entry are also
recruited to ␮NS inclusions (6). Indirect evidence suggests that
␮NS may possess ssRNA-binding activity as well, which may be
important for recruiting the viral plus-strand RNAs to the
factories and/or retaining them there for replication and packaging in infected cells (1). However, the ssRNA-binding activity of ␴NS is more firmly established (15–17, 19, 34, 42) and
may play the more important role in ssRNA recruitment to or
retention within the factories (4, 6, 26). Recent studies on the
␮NS homolog from avian orthoreoviruses have reached conclusions similar to these regarding the roles of ␮NS in forming
the factory matrix and recruiting other viral proteins to the
factories (44, 45). We explicitly specify in the present study
when we intend a statement to encompass results for avian
orthoreovirus; otherwise, we use the abbreviated name reovirus to represent mammalian orthoreovirus only.
The 80-kDa ␮NS protein is not a component of mature
virions but is expressed to high levels in infected cells and is
concentrated in the reovirus factories (7, 49). Other previous
findings about ␮NS include its association with transcriptionally active particles isolated from infected cells (28), its binding
to the surfaces of purified core particles in vitro (5), and its
capacity to recruit entering core particles to inclusions (6). The
␮NS protein has two predicted coiled-coil segments in the
carboxyl-terminal one-third of its sequence (25), but the oligomeric status of ␮NS has not been demonstrated. Little else
is known about the structure of ␮NS, although domains have
been predicted from the pattern of conserved and variable
regions of sequence among the ␮NS alleles from different
reovirus isolates (25). An isoform of ␮NS lacking ⬃5 kDa from
its amino terminus and called ␮NSC is also present in virusinfected cells (22, 46). The origin of ␮NSC is not certain, but
it is proposed to result from either secondary initiation or
cleavage near Met41 in ␮NS. A recombinant protein engineered to lack the first 40 residues of ␮NS, ␮NS(41-721),
which should be similar to ␮NSC, also forms phase-dense
globular inclusions in transfected cells (7).
Involvement of microtubules in forming reovirus factories
has also been demonstrated. The M1 segment, which encodes
the structurally minor core protein ␮2, has been shown to
determine both the timing of factory formation (24) and the
morphology of factories (30). The filamentous morphology of
factories formed by most reovirus strains has been attributed to
microtubule association of the ␮2 protein (30). When ␮NS and
␮2 are coexpressed in cells without other viral proteins, ␮NS is
redistributed with ␮2 to filamentous inclusions (7), suggesting
that these two proteins together determine the formation and
6195
6196
BROERING ET AL.
J. VIROL.
TABLE 1. Construction of plasmids with truncated M3 genes
Construct
a
CGGGATCCTCGAGCTAATCAATCAGGTCAGCAGCGCCGTCG
CGGGATCCTCGAGCTAAGTGGCTGATAGAAGGGAGGG
GGGGTACCTATCGTTCTAGAAAGAGCACCT
GGGGTACCTAAGAAGTAATGGAAATCACTTGCG
GGGGTACCTAATCATGAGTTGTCTGAATATCAGCAGCC
GGGGTACCTAGGTTGAAGCAAGCCTCTCG
CGGGATCCGTCATGGCTACCAGCGTGTCCGTCAGGAC
CGGGATCCGTCATGGCTGATGTCCATTTGGCACCAGG
CGGGATCCGTCATGGCTGCTTTAAAGTGGGTGG
CGGGATCCGTCATGGCTTCCAATGACGTGACAGATGG
Primer 2c
Enzymesd
1021-1040
1021-1040
778-796
T7 promoter
T7 promoter
T7 promoter
Reverse 1513-1533
Reverse 1513-1533
Reverse 1717-1735
Reverse 2191-2209
BstEII, BamHI
BstEII, BamHI
AvaI, KpnI
StyI, KpnI
BamHI, KpnI
BamHI, KpnI
AvaI, BamHI
AvaI, BamHI
BsmI, BamHI
BsmI, BamHI
Each construct was designed to contain the portion of the M3 gene encoding the indicated amino acid residues of ␮NS.
For each C-terminal truncation construct, primer 1 is in the reverse orientation relative to the coding strand, and the added stop codon is double underlined. For
each N-terminal truncation construct, primer 1 is in the forward orientation relative to the coding strand, and the added start codon cassette is double underlined. The
BamHI or KpnI restriction enzyme site added near the 5⬘ end of each primer is single underlined; for the 1-470, 1-362, 1-221, and 1-173 constructs, the restriction site
overlaps the stop codon by one nucleotide.
c
Primer 2 for each PCR reaction comprised the indicated nucleotides in the M3 gene plus strand, the 18 nucleotides in the T7 promoter of pGEM-4Z, or the reverse
complement of the indicated nucleotides in the M3 gene plus strand.
d
Each PCR product was digested with the indicated enzymes for cloning.
a
b
was cut with the restriction enzymes listed in Table 1 and then ligated to a
plasmid that had been cut with these same enzymes, the plasmid being either
pGEM-4Z (for pGEM-4Z-M3(1-173) and pGEM-4Z-M3(1-221) or the template
plasmid (for all other constructs). The correctness of each construct was confirmed by sequencing. The truncated M3 genes were subcloned into pCI-neo by using the restriction enzymes listed in Table 2. Each construct was named for the residues of ␮NS that the expressed protein should ultimately contain (Tables 1 and 2).
The pEGFP-N1 and pEGFP-C1 vectors (BD Biosciences) were respectively
used to express fusions of enhanced A. victoria GFP to the C or N terminus of the
desired ␮NS region. pEGFP-N1-M3(T1L) was previously constructed to express
GFP fused to the C terminus of ␮NS (␮NS/GFP) (7). To express GFP fused to
the N terminus of ␮NS residues 471 to 721, pGEM-4Z-M3(471-721) was cut with
SalI and KpnI, and the excised fragment was then ligated to pEGFP-C1 that had
been cut with the same enzymes, generating pEGFP-C1-M3(471-721). To express GFP fused to the N termini of even smaller C-terminal regions of ␮NS, an
EcoRI site was introduced at the desired position in the M3 gene during PCR
amplification. Each PCR was performed with pGEM-4Z-M3(T1L) (5) as a
template, the forward primers listed in Table 3, and a reverse primer complementary to the 3⬘ end of the M3 coding strand with an added BamHI site
(underlined) (5⬘-GCAGGGGATCCGATGAATGGGGGTCGGGAAGGCTT
AAGGG-3⬘). Each PCR product was cut with EcoRI and BamHI and was then
ligated to pEGFP-C1 that had been cut with the same enzymes. The correctness
of each construct was confirmed by sequencing, and the construct was named for
the residues of ␮NS that the expressed protein contains (Table 3).
To generate HA-tagged fusions, epitope-encoding forward primer 5⬘-CGTA
GCTAGCGTCATGGCTTACCCATACGACGTCCCAGACTACGCTCTCG
AGATGC-3⬘ and reverse primer 5⬘-GCATCTCGAGAGCGTAGTCTGGGAC
GTCGTATGGGTAAGCCATGACGCTAGCTACG-3⬘ (underlining indicates
NheI and XhoI sites added to each primer) were annealed by boiling in 1⫻ SSC
(150 mM NaCl plus 15 mM sodium citrate [pH 7.0]), followed by cooling at room
temperature for 1 h. The duplex oligonucleotide and vector pCI-neo were then
digested with NheI and XhoI, and the products were ligated to generate pCIneo-HA. The region encoding ␮NS(561-721) was amplified by PCR from the
template pCI-M3(T1L) by using forward primer 5⬘-GCTAGAATTCATGTAG
TCTGGATATGTATTTGAGACACCAC-3⬘ and reverse primer 5⬘-GATCGA
TCCCGGGTCGGGAAGGCTTAAGGGATTAGGGCAA-3⬘ (underlining indicates an EcoRI or SmaI site added to each primer). The PCR product and
vector pCI-neo-HA were then sequentially digested with SmaI and EcoRI, and
the products were ligated to generate pCI-neo-HA-M3(561-721). The region
encoding ␮NS(471-721) was amplified by PCR from the template pCI-M3(T1L)
by using the forward primer 5⬘-AGCTCTCGAGGTCATGTCCAGTGACATG
GTAGACGGGATTAAAC-3⬘ (underlining indicates an added XhoI site) and
reverse primer 5⬘-CGAAGCATTAACCCTCAC-3⬘. The PCR product and vector pCI-neo-HA were then digested with XhoI and NotI, and the products were
ligated to generate pCI-neo-HA-M3(471-721). To generate untagged ␮NS(561721), PCR was performed by using the template pCI-M3(T1L), forward primer
5⬘-AGCTGAATTCGTCATGGCTTGTAGTCTGGTATGTATTTGAGACA
C-3⬘ (underline indicates an added EcoRI site), and reverse primer 5⬘-CGAAG
CATTAACCCTCAC-3⬘. The PCR product and vector pCI-neo were then di-
gested with EcoRI and NotI, and the products were ligated to generate pCI-neoM3(561-721). The correctness of the final constructs was confirmed by sequencing.
To generate a ␮NS(471-721) or full-length ␮NS protein with residues His569
and His570 changed to glutamine and Cys572 changed to serine, QuikChange
site-directed mutagenesis was used according to the manufacturer’s protocol
with pCI-M3(471-721) or pCI-M3(T3D) as a template, forward primer 5⬘-GG
ATATGTATCTGCGACAACAAACTTCCATTAATGGTCATGC-3⬘, and reverse primer 5⬘-GCATGACCATTAATGGAAGTTTGTTGTCGCAGATACA
TATCC-3⬘ (double underlines, nucleotide changes to provide amino acid changes; single underline, nucleotide change to remove a DdeI site for screening
purposes). After the QuikChange protocol, the mutated pCI-M3(471-721) or
pCI-M3(T3D) plasmid was prepared for subcloning by cutting with NheI and
EcoRI or by cutting with BlpI and NotI, respectively. The excised fragments were
then ligated to pCI-neo or pCI-M3(T3D), respectively, that had been cut with the
same respective pair of enzymes, generating the final versions of pCI-M3(471721)QQS and pCI-M3(T3D)QQS. The correctness of these constructs was confirmed by sequencing. To generate a full-length ␮NS protein with Cys561 or Cys572
changed to Ser or His569, His570, or His576 changed to Gln, QuikChange sitedirected mutagenesis was used according to the manufacturer’s protocol with
pCI-M3(T3D) as a template and the primers listed in Table 4. According to the
QuikChange protocol, each mutated plasmid was prepared for subcloning by
cutting with BlpI and NotI. In each case, the excised fragment was then ligated
TABLE 2. Construction of plasmids to express ␮NS truncations
Constructa
Enzymesb
Size (kDa)c
pCI-M3(1-713)
pCI-M3(1-700)
pCI-M3(1-683)
pCI-M3(1-470)
pCI-M3(1-362)
pCI-M3(1-221)
pCI-M3(1-173)
pCI-M3(173-721)
pCI-M3(221-721)
pCI-M3(363-721)
pCI-M3(471-721)
XhoI, NheI
XhoI, NheI
SalId, NheI
KpnI (blunt), SalI
KpnI (blunt), SalI
KpnI (blunt), SalI
SacI (blunt), SalI
EcoRI, SalI
EcoRI, SalI
EcoRI, SalI
EcoRI, SalI
79.3
78.0
76.1
52.0
39.9
23.9
18.7
61.6
56.4
40.3
28.2
a
Each construct was designed to express a truncated ␮NS protein comprising
the indicated amino acid residues.
b
Unless otherwise noted, pGEM-4Z plasmids from Table 1 were digested with
the indicated enzymes to remove the truncated M3 genes. In some cases, one of
the resulting fragment termini was converted to a blunt end (blunt) with T4 DNA
polymerase before ligation to pCI-neo.
c
Expected size of the expressed ␮NS truncation.
d
pCI-M3(T3D)(1-683) was subcloned from pFastBac-M3(T1L)(1-683) as described in Materials and Methods.
Downloaded from http://jvi.asm.org/ on February 27, 2014 by PENN STATE UNIV
pGEM-4Z-M3(1-713)
pGEM-4Z-M3(1-700)
pGEM-4Z-M3(1-470)
pGEM-4Z-M3(1-362)
pGEM-4Z-M3(1-221)
pGEM-4Z-M3(1-173)
pGEM-4Z-M3(173-721)
pGEM-4Z-M3(221-721)
pGEM-4Z-M3(363-721)
pGEM-4Z-M3(471-721)
Primer 1b (5⬘ to 3⬘)
INCLUSION FORMATION BY REOVIRUS ␮NS PROTEIN
VOL. 79, 2005
6197
TABLE 3. Construction of plasmids to express ␮NS-GFP fusions
Construct
a
pEGFP-C1-M3(471-721)
pEGFP-C1-M3(561-721)
pEGFP-C1-M3(614-721)
pEGFP-C1-M3(625-721)
pEGFP-C1-M3(695-721)
Forward primerb (5⬘ to 3⬘)
Expressed proteinc
Size (kDa)d
Not applicable
CGGAATTCGTGTAGTCTGGATATGTATTTGAGACACCAC
CGGAATTCGGAAGCGGCTGCCAAATGCCAAACTG
CGGAATTCGATGGACTTGACTCAGATGAATGGAAAGC
CGGAATTCGATGGCCTCCCTTCTATCAGCCACTCCT
GFP/␮NS(471-721)
GFP/␮NS(561-721)
GFP/␮NS(614-721)
GFP/␮NS(625-721)
GFP/␮NS(695-721)
57.1
46.3
40.1
39.1
31.1
Each construct was designed to express a GFP fusion including the indicated amino acid residues of ␮NS.
The EcoRI site added near the 5⬘ end of each is underlined.
In each of these proteins, GFP was fused to the N terminus of the ␮NS region.
d
That is, the expected size of the expressed fusion protein.
a
b
c
Immunoblot analysis. CV-1 cells were transfected as described for IF, and
whole-cell lysates were collected 18 to 24 h posttransfection (p.t.). CV-1 cells
(1.2 ⫻ 106) were washed briefly in PBS and then scraped into 1 ml of PBS and
pelleted. The pelleted cells were resuspended in 30 ␮l of PBS containing protease inhibitors (Roche Biomedicals), lysed into sample buffer, boiled for 10 min,
and subjected to SDS-polyacrylamide gel electrophoresis (SDS-PAGE). Proteins
were electroblotted from the gels to nitrocellulose in 25 mM Tris and 192 mM
glycine (pH 8.3). Binding of antibodies was detected with alkaline phosphatasecoupled goat anti-mouse IgG (Bio-Rad Laboratories) and the colorimetric reagents p-nitroblue tetrazolium chloride and 5-bromo-4-chloro-3-indolylphosphate p-toluidine salt (Bio-Rad Laboratories).
Sequence comparisons. The following ␮NS and ␮NS-homolog sequences, each
designated as complete coding sequences in GenBank, were compared: ␮NS of
mammalian orthoreoviruses T1L (accession no. AAF13169), type 2 Jones (accession no. AAF13170), and T3D (accession no. AAF13171); ␮NS of avian orthoreoviruses 1733 (accession no. AAQ81873), S1133 (accession no. AAS78987),
1017-1 (accession no. AAS78988), 2408 (accession no. AAS78990), 601G (accession no. AAS78991), 750505 (accession no. AAS78992), 916SI (accession no.
AAS78993), 918 (accession no. AAS78994), 919 (accession no. AAS78995), OS161
(accession no. AAS78996), R2 (accession no. AAS78997), and T6 (accession
no. AAS78998); and NS1 of aquareoviruses grass carp 873 (accession no.
AAM92735) and golden shiner (accession no. AAM92747). Sequences were
compared by using the Bestfit and Pretty programs from the Genetics Computer
Group Wisconsin package. The Multicoil program (http://multicoil.lcs.mit.edu
/cgi-bin/multicoil) (48) was used for predicting coiled-coil regions.
RESULTS
The C terminus of ␮NS is required for forming factory-like
inclusions. We have previously shown that a truncated ␮NS
protein lacking the N-terminal 40 residues, ␮NS(41-721), collects in cytoplasmic, factory-like inclusions in transfected cells,
similarly to full-length ␮NS (7). The N terminus of ␮NS is thus
not required for forming these structures. To determine whether the C terminus of ␮NS is required, we engineered M3 gene
constructs to express a series of truncated ␮NS proteins that
lacked increasing numbers of residues from the C terminus (Ta-
TABLE 4. Construction of plasmids to express ␮NS point mutants
Primer (5⬘ to 3⬘)b
Mutationa
C561S
H569Q
H570Q
C572S
H576Q
Forward
Reverse
CAAGTCAGCTCAATCATCTAGCTTGGATATCTATC
GATATGTATCTGCGACAACACACTTGCATTAATGG
GATATGTATCTGCGACACCAAACTTGCATTAATGG
GATATGTATCTGCGACACCACACTTCCATTAATGGTC
CCACACTTGCATCAATGGTCAAGCTAAAGAAGATG
GATACATATCCAAGCTAGATGATTGAGCTGACTTG
CCATTAATGCAAGTGTGTTGTCGCAGATACATATC
CCATTAATGCAAGTTTGGTGTCGCAGATACATATC
GACCATTAATGGAAGTGTGGTGTCGCAGATACATATC
CATCTTCTTTAGCTTGACCATTGATGCAAGTGTGG
a
Desired mutation at the indicated amino acid position of ␮NS. Amino acid residues are written in single-letter code as follows: wild-type residue, position number,
and mutant residue.
b
In each primer, the nucleotide change to give the desired amino acid change is double underlined. For the C561S mutant, this change also caused loss of a BfaI
restriction enzyme site useful for screening. For the other mutants, an additional nucleotide change was made to cause loss of a restriction enzyme site (single
underline); the lost site is DdeI for H569Q, H570Q, and C572S and MseI for H576Q.
Downloaded from http://jvi.asm.org/ on February 27, 2014 by PENN STATE UNIV
to pCI-M3(T3D) that had been cut with the same enzymes, generating the
constructs as named in Table 4. The correctness of each subcloned region was
confirmed by sequencing.
To generate a fusion of ␮NS residues 1 to 41 to the N terminus of GFP and
␮NS residues 471 to 721 to the C terminus of GFP, DNA encoding residues 1 to
41 of ␮NS and a large portion of GFP was removed from pEGFP-N1-M3(1-41)
(7) by digestion with NheI and BsrGI. pEGFP-C1-M3(471-721) was also cut with
these enzymes, and the two DNA fragments were ligated to generate pEGFPM3(1-41)/GFP/M3(471-721). To generate a fusion of ␮NS residues 1 to 12 to the
N terminus of GFP and ␮NS residues 471 to 721 to the C terminus of GFP,
forward primer 5⬘-AATTC ATGGCTTCATTCAAGGGATTCTCCGTCAACA
CTGTTGCG-3⬘ and reverse primer 5⬘-GATCCGCAACAGTGTTGACGGAG
AATCCCTTGAATGAAGCCATG-3⬘ were annealed to generate a small duplex
encoding ␮NS residues 1 to 12 and having BamHI and EcoRI overhangs at the
respective ends (underlined). This small duplex and plasmid pEGFP-N1 were
both digested with BamHI and EcoRI and then ligated to yield pEGFP-N1M3(1-12). This plasmid was then digested with NheI and BsrGI, and the excised
fragment was ligated to pEGFP-C1-M3(471-721) that had been digested with the
same enzymes, generating plasmid pEGFP-M3(1-12)/GFP/M3(471-721). The
correctness of the resulting construct was confirmed by sequencing.
Transfections and IF microscopy. Cells were seeded the day before transfection at a density of 1.5 ⫻ 104 per cm2 in six-well plates (9.6 cm2 per well)
containing glass coverslips (19 mm). Cells were transfected with 2 ␮g of DNA
and 7 ␮l of Lipofectamine 2000 (Invitrogen Life Technologies) or 1.5 ␮l of DNA
and 10 ␮l of Polyfect (Qiagen) according to the manufacturer’s directions. Cells
were further incubated for 18 to 24 h at 37°C before fixation for 10 min at room
temperature in 2% paraformaldehyde in phosphate-buffered saline (PBS; 137
mM NaCl, 3 mM KCl, 8 mM Na2HPO4, 1 mM KH2PO4 [pH 7.5]) or 3 min at
⫺20°C in ice-cold methanol. Fixed cells were washed three times with PBS,
permeabilized, and blocked in PBS containing 1% bovine serum albumin and
0.1% Triton X-100 (PBSAT). Primary antibodies were diluted in PBSAT and
incubated with cells for 25 to 40 min at room temperature. After three washes in
PBS, secondary antibodies diluted in PBSAT were added and incubated with
cells for 25 min at room temperature. Coverslips were incubated with 300 nM
4,6-diamidino-2-phenylindole (DAPI; Molecular Probes) in PBS for 5 min to
counterstain cell nuclei, briefly washed in PBS, and mounted on glass slides with
Prolong (Molecular Probes). Samples were examined by using a TE-300 inverted
microscope (Nikon) equipped with phase and fluorescence optics, and images
were collected digitally as described elsewhere (30). All images were processed
and prepared for presentation by using Photoshop (Adobe Systems).
6198
BROERING ET AL.
J. VIROL.
ble 2). Each of these plasmids was transfected into CV-1 cells,
and the cell lysates were subjected to SDS-PAGE, followed by
immunoblotting with polyclonal anti-␮NS serum (5). The
results verified the expression of an appropriately sized,
␮NS-derived protein from each construct (data not shown).
To determine the intracellular distribution of the C-termi-
nally truncated ␮NS proteins, CV-1 cells were separately transfected with each of the plasmids and later fixed and immunostained with polyclonal anti-␮NS antibodies (Fig. 1A, left and
right columns). In addition, the cells were coimmunostained
with MAb FK2, which recognizes conjugated ubiquitin (14), to
determine whether any of these proteins were substantially
Downloaded from http://jvi.asm.org/ on February 27, 2014 by PENN STATE UNIV
FIG. 1. IF microscopy of C- terminally truncated ␮NS proteins. CV-1 cells were transfected with plasmids to express the indicated proteins. The
cells were then fixed at 18 h p.t. for subsequent immunostaining. Nuclei were counterstained with DAPI (blue). Scale bars, 10 ␮m. (A) The cells
were immunostained both with rabbit anti-␮NS IgG conjugated to Texas red (left column, red in right column) and with mouse MAb FK2 for
conjugated ubiquitin (cUb), followed by goat anti-mouse IgG conjugated to Alexa 488 (center column, green in right column). (B) The cells were
immunostained both with rabbit anti-␮NS IgG followed by goat anti-rabbit IgG conjugated to Alexa 594 (left column, red in right column) and
with rabbit anti-␮2 IgG conjugated to Alexa 488 (center column, green in right column).
VOL. 79, 2005
INCLUSION FORMATION BY REOVIRUS ␮NS PROTEIN
FIG. 2. Summary of ␮NS truncations and their activities. The fulllength ␮NS protein is indicated by a horizontally elongated black bar
spanning residues 1 to 721 (positions numbered above and below). The
␮NS truncation mutants are also shown as black bars spanning the
approximate portion of ␮NS that each represents. Enhanced A. victoria GFP fused to the N or C terminus of ␮NS in some cases is represented by an open bar. An influenza virus HA epitope fused to the N
terminus of ␮NS in some cases is represented by an open circle.
Approximate extents of the coiled-coil segments predicted by Multicoil
are indicated by vertically elongated gray bars. The capacity of each
protein to form factory-like inclusions in transfected cells (Inc) and to
colocalize with T1L ␮2 in transfected cells (␮2) is indicated as positive
(⫹), negative (⫺), or not determined (nd). Localized structures that
costained for conjugated ubiquitin were concluded to be aggregates of
misfolded protein (agg). The results for ␮NS(1-721), ␮NS(1-721)/GFP,
␮NS(1-41)/GFP, ␮NS(14-721), and ␮NS(41-721) have been reported
previously (7, 26).
with ␮2 (7, 26). From the results summarized in Fig. 2, we
conclude that ␮NS residues 471 to 721 are a sufficient part of
␮NS for forming factory-like inclusions. These residues encompass the two predicted coiled-coil segments of ␮NS, the
intervening “linker” between these segment, and the C-terminal “tail” that follows the second predicted coiled-coil segment
(25). Given the altered morphologies of the inclusions formed
by ␮NS proteins lacking more than the 40 N-terminal residues,
we also conclude that some portion of residues 41 to 172 plays
a distinguishable role in modulating inclusion morphology.
Residues 561 to 721 of ␮NS are sufficient for allowing a
GFP-tagged protein, but not an HA-tagged or untagged protein, to form factory-like inclusions. To determine whether a
region of ␮NS smaller than residues 471 to 721 may be sufficient for inclusion formation, and also to allow more ready
Downloaded from http://jvi.asm.org/ on February 27, 2014 by PENN STATE UNIV
misfolded and targeted for degradation by the ubiquitin-proteasome system (Fig. 1A, center and right columns). Each of
the C-terminally truncated proteins was diffusely distributed in
the cytoplasm and nucleus, in clear contrast to full-length ␮NS,
which collected in globular inclusions as expected (Fig. 1A and
data not shown). We conclude that all of these truncated proteins are negative for forming factory-like inclusions (summarized in Fig. 2) and thus that some portion of the smallest
region we deleted from the C terminus of ␮NS, residues 714 to
721, is required for inclusion formation. None of the truncated
proteins appeared to be aggregated or strongly colocalized
with conjugated ubiquitin (Fig. 1A and data not shown), suggesting that they were not substantially misfolded.
All of the C-terminally truncated ␮NS proteins appeared to
be partially localized to the nucleus (Fig. 1A, left column),
even though ␮NS(1-683), ␮NS(1-700), and ␮NS(1-713) were
above the 60-kDa limit for passive diffusion through nuclear
pores (reviewed in reference 31) (Table 2). In addition, at least
some of the truncated proteins appeared to be excluded from
nucleoli (Fig. 1A, left column). The relevance of this nuclear
pattern is unclear because full-length ␮NS is not detected in
the nuclei of infected or M3-transfected cells (7, 30). When
coexpressed with ␮2(T1L), each of the C-terminally truncated
proteins strongly colocalized with ␮2 on microtubules (Fig. 1B
and data not shown; summarized in Fig. 2). This was expected
because each protein included ␮NS residues 1 to 41, which are
known to be sufficient for association with ␮2 (7, 26).
The N-terminal 470 residues of ␮NS are not required for
forming factory-like inclusions but affect inclusion shape. To
identify the minimal region of ␮NS required for inclusion formation, we engineered M3 gene constructs to express a series
of truncated ␮NS proteins that lacked increasing numbers of
residues from the N terminus (Table 2). Each of these plasmids
was transfected into CV-1 cells, and the cell lysates were subjected to SDS-PAGE, followed by immunoblotting with the
anti-␮NS serum (5). The results verified expression of an appropriately sized, ␮NS-derived protein from each construct
(data not shown).
The intracellular distribution of each of the N-terminally
truncated ␮NS proteins was determined as described above for
the C-terminal truncations, including coimmunostaining with
MAb FK2. With the exception of ␮NS(363-721), which showed
a distinctly aggregated pattern and strongly colocalized with
conjugated ubiquitin (Fig. 3), each of the N-terminally truncated proteins collected in globular inclusions (Fig. 3, left and
right columns, and data not shown). However, the proteins
missing more than the 40 N-terminal residues of ␮NS often
formed inclusions with more elongated shapes and enclosed
fenestrations than those formed by full-length ␮NS or ␮NS(41721) (Fig. 3, left and right columns). Although these inclusions
had altered morphologies, they did not colocalize with conjugated ubiquitin (Fig. 3, center and right columns), suggesting
that these truncated proteins were not substantially misfolded.
The behavior of ␮NS(363-721), on the other hand, suggested
that it was in fact largely misfolded.
When coexpressed with ␮2(T1L), none of the N-terminally
truncated ␮NS proteins colocalized with ␮2 on microtubules
or in inclusions (data not shown; summarized in Fig. 2). This
was expected because each of these proteins lacks ␮NS residues 14 to 40, which are known to be required for association
6199
6200
BROERING ET AL.
J. VIROL.
detection of these smaller proteins, we next generated constructs to express GFP fused to the N terminus of selected ␮NS
truncations (Table 3). Each of these plasmids was transfected
into CV-1 cells, and the cell lysates were subjected to SDS-PAGE,
followed by immunoblotting with GFP-specific MAb JL-8. The
results verified production of an appropriately sized, GFP- and
␮NS-derived fusion protein from each construct (Fig. 4A).
To determine the intracellular distribution of each fusion
protein, CV-1 cells were transfected and later immunostained
with the GFP-specific MAb. Nonfused GFP was diffusely distributed in the cytoplasm and nucleus, and GFP fused to the C
terminus of full-length ␮NS (␮NS/GFP) collected in globular
inclusions as previously shown (7) (also see Fig. 4B). GFP
fused to the N terminus of ␮NS(471-721) [GFP/␮NS(471-721)]
also collected in inclusions (Fig. 4B), which appeared similar to
those formed by ␮NS(471-721) (Fig. 3) or ␮NS/GFP (Fig. 4B).
GFP fused to the N terminus of ␮NS(561-721) collected in
inclusions as well, although a small fraction of the transfected
cells (⬃13%) displayed a diffuse distribution of this protein
(Fig. 4B and data not shown). In contrast, GFP fused to the N
terminus of ␮NS(614-721), ␮NS(625-721), or ␮NS(695-721)
was diffusely distributed in the cytoplasm and nucleus of most
or all cells expressing them (Fig. 4B and data not shown). From
these results, we conclude that residues 561 to 721 are a sufficient part of ␮NS in GFP fusions for forming factory-like
inclusions (summarized in Fig. 2), albeit at a lower efficiency
than full-length ␮NS or ␮NS(471-721). The first predicted
coiled-coil segment (25) is thus dispensable for inclusion formation by a ␮NS-GFP fusion. On the other hand, some portion of residues 561 to 613, in the linker between the two
predicted coiled-coil segments, is required.
Given that A. victoria GFP is known to weakly dimerize (9)
and also that GFP/␮NS(561-721) was less efficient at forming
factory-like inclusions than was GFP/␮NS(471-721), we hypothesized that the GFP tag may partially complement an
otherwise-required contribution of the first predicted coiledcoil segment of ␮NS for forming inclusions. We therefore
tested another version of ␮NS(561-721), this one fused to an
epitope of influenza virus HA (47) at its N terminus [HA/␮NS
(561-721)]. After expression in transfected CV-1 cells and im-
Downloaded from http://jvi.asm.org/ on February 27, 2014 by PENN STATE UNIV
FIG. 3. IF microscopy of N-terminally truncated ␮NS proteins. CV-1 cells were transfected with plasmids to express the indicated proteins. The
cells were then fixed and stained as described for Fig. 1A. Scale bars, 10 ␮m.
VOL. 79, 2005
INCLUSION FORMATION BY REOVIRUS ␮NS PROTEIN
6201
FIG. 4. Immunoblotting and IF microscopy of GFP-tagged derivatives of ␮NS. CV-1 cells were transfected with plasmids to express
GFP or ␮NS-GFP fusions as indicated and then analyzed at 18 h p.t.
by immunoblotting (A) or IF microscopy (B). Scale bars, 10 ␮m. (A)
Whole-cell lysates were separated by SDS-PAGE, transferred to nitrocellulose, and immunoblotted with mouse MAb JL8 for GFP followed by goat anti-mouse IgG conjugated to alkaline phosphatase.
Positions of molecular weight markers are indicated (in kilodaltons) to
the left of each panel. (B) After fixation, cells were immunostained
with mouse MAb JL8 for GFP, followed by goat anti-mouse IgG
conjugated to Alexa 488.
munostaining with tag-specific MAb HA.11, HA/␮NS(561-721)
was diffusely distributed in the cytoplasm and nucleus and thus
not concentrated in inclusions (Fig. 5). Fusion of the HA tag to
the N terminus of ␮NS(471-721) [HA/␮NS(471-721)], in contrast, caused little or no reduction in its capacity to form factory-like inclusions (Fig. 5). We also generated and tested a third
version of ␮NS(561-721), this one lacking any tag. After expression in transfected CV-1 cells and immunostaining with anti␮NS antibodies, untagged ␮NS(561-721) was diffusely distributed in the cytoplasm and nucleus and thus not concentrated
in inclusions (Fig. 5). Untagged ␮NS(471-721) tested in parallel formed factory-like inclusions (Fig. 5) as seen in the preceding experiments (see Fig. 3). Based on these results, we conclude that the more N-terminal predicted coiled-coil segment of
␮NS is required for inclusion formation in the absence of a
fusion tag such as GFP that can independently self-associate.
Putative metal-chelating residues His570 and Cys572 are
required for factory-like inclusion formation. In an effort to
identify specific residues in ␮NS that may be required for inclusion formation, we compared the deduced protein sequences of
␮NS homologs from mammalian and avian orthoreoviruses, as
well as from aquareoviruses (see Materials and Methods for
the GenBank accession numbers) (2, 25, 45). In all, the ␮NS
homologs derived from 17 isolates in the three groups: 3 mammalian isolates from the Orthoreovirus genus, 12 avian isolates
from the Orthoreovirus genus, and 2 piscine isolates from the
Aquareovirus genus. The overall identity scores for any two
␮NS homologs from separate groups are small: ⬍30% in each
case (2, 45) (the present study and data not shown). Despite
this degree of divergence, the C-terminal one-third of each of
these ␮NS homologs contains two predicted coiled-coil segments, of similar lengths and spacing, separated by a linker and
followed by a C-terminal tail (data not shown), as previously
described for the mammalian and avian isolates (25, 45).
Interestingly, in the linker between the predicted coiled-coil
Downloaded from http://jvi.asm.org/ on February 27, 2014 by PENN STATE UNIV
FIG. 5. IF microscopy of HA-tagged or untagged versions of ␮NS
(561-721) and ␮NS(471-721). CV-1 cells were transfected with plasmids
to express the proteins as indicated. The cells were then fixed at 18 h p.t.
and immunostained either with mouse MAb HA.11 for the influenza virus
HA epitope, followed by goat anti-mouse IgG conjugated to Alexa 488
(left panels), or with rabbit anti-␮NS IgG, followed by goat anti-rabbit
IgG conjugated to Alexa 594 (right panels). Scale bars, 10 ␮m.
6202
BROERING ET AL.
J. VIROL.
segments, we identified a small consensus motif common to
all of the examined ␮NS homologs (Fig. 6A). This sequence,
Ile/Leu-x-x-Tyr-Leu-x-x-His-Thr/Val-Cys-Ile/Val-Asn (where
“x” represents nonconserved positions), includes two residues
(underlined) with strong potential to chelate transition metal
ions such as Zn2⫹. The two residues correspond to His570 and
Cys572 in the mammalian orthoreovirus ␮NS proteins. Each of
the ␮NS homologs contains other His and/or Cys residues flanking the consensus motif, but the position and spacing of these
residues is not conserved among the examined sequences (Fig.
6A). In mammalian orthoreovirus ␮NS, the other conserved His
and Cys residues in this region are Cys561, His569, and His576.
The consensus motif spans residues 563 to 574 in the mammalian orthoreovirus ␮NS proteins and is thus near the beginning
of the minimal C-terminal region of ␮NS that we showed to be
sufficient for inclusion formation in GFP fusions (Fig. 4).
To determine whether the conserved residues with metalchelating potential in the consensus motif are important for
inclusion formation, we first generated constructs encoding
Gln (Q) substitutions for both His570 and the adjacent residue, His569, as well as a Ser (S) substitution for Cys572 (Fig.
6A). The constructs were generated with all three of these mutations in the setting of either full-length ␮NS or ␮NS(471-721).
We then transfected CV-1 cells with these mutant plasmids and
costained the cells with anti-␮NS antibodies and MAb FK2 for
conjugated ubiquitin. Both proteins, designated ␮NS(1-721)
QQS and ␮NS(471-721)QQS, were diffusely distributed in the
cytoplasm and nucleus (Fig. 6B and data not shown), and neither strongly colocalized with conjugated ubiquitin (data not
shown). This distribution was in sharp contrast to the inclusions in which both full-length ␮NS and ␮NS(471-721) concentrated (data not shown for this experiment, but see previous
figures), demonstrating that one or more of residues His569,
His570, and Cys572 is important for inclusion formation.
We next generated constructs encoding single mutations at
residues Cys561 (to Ser), His569 (to Gln), His570 (to Gln),
Cys572 (to Ser), or His576 (to Gln) within full-length ␮NS.
The mutant plasmids were transfected into CV-1 cells, and the
cells were costained with anti-␮NS antibodies and MAb FK2
for conjugated ubiquitin. Both ␮NS(1-721)H570Q and ␮NS(1721)C572S were diffusely distributed in the cytoplasm and nucleus (Fig. 6B). In contrast, ␮NS(1-721)C561S, ␮NS(1-721)
Downloaded from http://jvi.asm.org/ on February 27, 2014 by PENN STATE UNIV
FIG. 6. Sequence conservation in the “linker” region of ␮NS homologs and IF microscopy of ␮NS proteins with mutations at His and/or Cys
residues in the consensus motif. (A) Sequence conservation. Sequences are shown in single-letter code, with position numbers indicated at left and
right. The consensus motif was defined by comparing the illustrated region from the ␮NS homologs of 3 mammalian orthoreoviruses (mORV),
12 avian orthoreoviruses (aORV) (all identical in this region), and 2 aquareoviruses (AqRV) (both identical in this region). Conserved positions
are highlighted by being boxed. Asterisks indicate conserved positions corresponding to His570 and Cys572 in mammalian orthoreovirus ␮NS.
These and other His and Cys residues in or near the consensus motif are highlighted by being circled. (B) IF microscopy. CV-1 cells were transfected with plasmids to express the indicated proteins. The cells were then fixed at 18 h p.t. and immunostained both with rabbit anti-␮NS IgG
conjugated to Oregon Green and with mouse MAb FK2 for conjugated ubiquitin, followed by goat anti-mouse IgG conjugated to Alexa 594. Nuclei
were counterstained with DAPI. Only the anti-␮NS staining is shown since no colocalization with FK2 staining was apparent. Scale bars, 10 ␮m.
VOL. 79, 2005
INCLUSION FORMATION BY REOVIRUS ␮NS PROTEIN
6203
H569Q, and ␮NS(1-721)H576Q all collected in globular inclusions indistinguishable from those formed by wild-type ␮NS
(Fig. 6B). None of the mutant proteins strongly colocalized with
conjugated ubiquitin (data not shown). From these findings, we
conclude that His570 and Cys572 are specifically required for
␮NS to form factory-like inclusions in transfected cells.
␴NS recruitment to factory-like inclusions containing ␮NS
residues 1 to 12 connected by GFP to ␮NS residues 471 to 721.
We have previously shown that ␴NS colocalizes with fulllength ␮NS but not with ␮NS(41-721) or ␮NS(13-721) in cotransfected cells, indicating that the N terminus of ␮NS is
required for recruiting ␴NS (7, 26). Because both ␴NS and the
N-terminal 41 residues of ␮NS fused to the N terminus of GFP
[␮NS(1-41)/GFP] are diffusely distributed in cells, we encountered difficulties in using IF microscopy to determine whether
the N terminus of ␮NS is sufficient for association with ␴NS (7,
26). Upon finding in the present study that GFP/␮NS(471-721)
collected in factory-like inclusions in transfected cells (Fig.
4B), we recognized that this protein provided a new platform
on which to assay protein-protein associations through redistribution to its distinctive inclusions. When GFP/␮NS(471-721)
was coexpressed with ␴NS, ␴NS remained diffusely distributed
in the cytoplasm and nucleus and did not colocalize with the
GFP/␮NS(471-721) inclusions (Fig. 7A). This was expected,
Downloaded from http://jvi.asm.org/ on February 27, 2014 by PENN STATE UNIV
FIG. 7. IF microscopy of ␴NS coexpressed with ␮NS-GFP fusions. (A) CV-1 cells were transfected with plasmids to express the proteins
indicated. The cells were then fixed at 18 h p.t. and immunostained with ␴NS-specific mouse MAb 3E10, followed by goat anti-mouse IgG
conjugated to Alexa 594 (center column, red in right column). GFP-containing fusions were visualized directly (left column, green in right column).
Nuclei were counterstained with DAPI (blue). Scale bars, 10 ␮m. (B) Summary of the fusions and their activities. See Fig. 2 legend for explanations
of most details. Dashed lines indicate internally deleted regions of ␮NS. The capacity of each protein to colocalize with T1L ␴NS in transfected
cells (␴NS) is indicated as positive (⫹), negative (⫺), or unknown (?). The results for ␮NS(1-721), ␮NS(1-721)/GFP, ␮NS(1-41)/GFP, ␮NS(14721), and ␮NS(41-721) have been reported previously (7, 26).
6204
BROERING ET AL.
DISCUSSION
Numerous observations suggest that the inclusion bodies in
reovirus-infected cells are sites of viral replication and assembly (4, 6, 33, 38, 39). The roles of nonstructural protein ␮NS in
forming the matrix of these viral factories and recruiting other
components to them have become a focus of recent studies in
this field (4, 6, 7). Given the recent findings and the absence of
strong evidence for other functions of this protein, we hypothesize that the primary role of ␮NS in reovirus infection is to
build and organize the factories to promote replication and
assembly. We find it intriguing that reovirus may have a protein
dedicated to this role, and we therefore wish to learn more
about how the different regions of ␮NS carry out specific activities toward this end.
Current summary of ␮NS functional regions. Truncation
and deletion analyses have been a fruitful approach for identifying discrete regions of ␮NS involved in its different activities. For example, the current study demonstrated that the
C-terminal one-third of ␮NS (residues 471 to 721) is a sufficient part of this protein for forming factory-like inclusions in
transfected cells in the absence of infection or other viral
proteins. The present study also identified several smaller regions of sequence, and even single residues, within this third of
␮NS that are required for inclusion formation.
An otherwise-uncharacterized region of ␮NS (residues 41 to
172) affected the shape of the inclusions in the present study,
causing them to be more compact and less fenestrated when
present in the inclusion-forming protein. This effect could reflect a direct interaction of some portion of residues 41 to 172
with the C-terminal, inclusion-forming region of ␮NS or with
some cellular protein, which in an unknown manner produces
more compact inclusions. This effect could also reflect an indirect mechanism, such as a reduction in the turnover rate of
the inclusion-forming protein such that holes do not develop
within the inclusions.
Previous reports have shown that the N-terminal 40 residues
of ␮NS are involved in associations with at least two other reovirus proteins: microtubule-binding protein ␮2 and ssRNAbinding protein ␴NS (7, 26). Moreover, the specific residues
necessary or sufficient for these activities have been shown to
be separable. Residues 1 to 41 of ␮NS are sufficient for association with ␮2 (7), but only some portion of residues 14 to 40
of ␮NS is necessary for this activity (26). In contrast, some
portion of residues 1 to 13 of ␮NS is necessary for association
with ␴NS (26), and residues 1 to 12 of ␮NS may be sufficient
for this activity (the present study). Other, complementary evidence suggests the N-terminal 40 residues of ␮NS represent a
discrete domain. A form of ␮NS lacking ⬃5 kDa of N-terminal
sequence is produced in infected cells concomitantly with the
full-length protein (7, 46). Although the origin of this smaller
form, called ␮NSC, remains in question, the fact that it is similar to ␮NS(41-721), which lacks both ␮2 and ␴NS association
activities, suggests that it and full-length ␮NS may play distinguishable roles in infection. Interestingly, a ␮NSC-like form of
␮NS has been recently identified in avian orthoreovirus and
found not to associate with the avian orthoreovirus ␴NS protein as well, suggesting that the different activities of ␮NS and
␮NSC in this regard may be a conserved point of regulation for
reoviruses in general (45). The avian orthoreovirus ␮2 protein
has not yet been examined for ␮NS association.
Except for the modulation of inclusion shape described in
the present study and a predicted coiled-coil segment from
residues 518 to 561 (25), the large central portion of ␮NS
spanning residues 41 to 560 remains without well-characterized
activities. This region from positions 41 to 560 may contain the
residues responsible for ␮NS associations with other reovirus
components, including the individual core-surface proteins, ␭1,
␭2, and ␴2 and whole core particles (6, 7). In fact, these
activities are shared by ␮NS and ␮NSC, indicating they do not
require the N-terminal 40 residues of ␮NS. Further truncation/
deletion analyses are needed to determine whether each of the
individual core-surface proteins, as well as core particles, may
associate with ␮NS/␮NSC through a distinct set of residues,
such as those for ␮2 and ␴NS in the unique N-terminal region
of ␮NS.
Other components with which ␮NS/␮NSC may yet be shown
to associate include the reovirus RNA-dependent RNA polymerase ␭3, the reovirus outer-capsid proteins, the reovirus
RNA molecules, and any possible number of cellular factors.
For each of these potential associations, again, further truncation/deletion analyses could aid in ascertaining whether each
component may associate with ␮NS or ␮NSC through a distinct set of residues in ␮NS. In any case, the emerging picture
of ␮NS is one of a protein involved in multiple interactions to
Downloaded from http://jvi.asm.org/ on February 27, 2014 by PENN STATE UNIV
because some portion of ␮NS residues 1 to 13 is required for
recruiting ␴NS to ␮NS inclusions (26).
To determine whether ␮NS residues 1 to 41 can direct recruitment of ␴NS to the inclusions of GFP/␮NS(471-721), we
constructed a plasmid to express these residues fused to the N
terminus of GFP/␮NS(471-721). When expressed in transfected CV-1 cells, this protein, ␮NS(1-41)/GFP/␮NS(471-721),
collected in inclusions similar to those formed by ␮NS(471721) or GFP/␮NS(471-721) (data not shown). When ␴NS was
coexpressed with ␮NS(1-41)/GFP/␮NS(471-721) and coimmunostained with anti-␴NS MAb 3E10 (3) and the anti-␮NS
serum, ␴NS strongly colocalized with the ␮NS(1-41)/GFP/␮NS
(471-721) inclusions (Fig. 7A). This was in stark contrast to
the diffuse distribution of ␴NS expressed alone (26) or coexpressed with GFP/␮NS(471-721) (Fig. 7A). When coexpressed
with ␮2, ␮NS(1-41)/GFP/␮NS(471-721) was redistributed to
filamentous inclusions (data not shown), as expected because
of the presence of ␮NS residues 14 to 40 (26) (also see Fig. 2
and 7B). These results newly demonstrate that ␮NS residues
41 to 470 are dispensable for recruiting ␴NS (summarized in
Fig. 7B).
We additionally constructed a plasmid to express ␮NS residues 1 to 12 fused to the N terminus of GFP/␮NS(471-721).
When expressed in transfected CV-1 cells, this protein, ␮NS
(1-12)/GFP/␮NS(471-721), collected in factory-like inclusions
(data not shown). Moreover, when coexpressed, ␴NS was
strongly recruited to the ␮NS(1-12)/GFP/␮NS(471-721) inclusions (Fig. 7A). When coexpressed with ␮2, ␮NS(1-12)/GFP/
␮NS(471-721) was not redistributed to filamentous inclusions
(data not shown), as expected because of the absence of ␮NS
residues 13 to 41 (26). These results demonstrate that ␮NS
residues 13 to 470 are dispensable for recruiting ␴NS (summarized in Fig. 7B) and suggest that ␮NS residues 1 to 12 may
be sufficient for this association.
J. VIROL.
VOL. 79, 2005
INCLUSION FORMATION BY REOVIRUS ␮NS PROTEIN
resulting from its deletion can be largely rescued by fusion to
GFP. We interpret this result to indicate that the role of the
first predicted coiled-coil segment is in self-association, which
GFP can also mediate (9), but we acknowledge that this interpretation requires further testing. Although the more C-terminal one of the two predicted coiled-coil segments in ␮NS has
not been directly tested for its role in inclusion formation, we
expect that at least part of it is also required. Coiled-coil interactions between ␮NS subunits could, for example, mediate
the formation of basal oligomers, which then interact through
other motifs to form the inclusions. Alternatively, one or both
of the coiled-coil segments could mediate hetero-oligomerization with a cellular protein. As noted in Results, predicted
coiled-coil segments are also found flanking the proposed
metal chelation sequences in each of the ␮NS homologs from
avian orthoreoviruses and aquareoviruses, suggesting a conserved function for these motifs.
Formation of ␮NS inclusions as a tool to study protein–
protein associations inside cells. The characteristic subcellular
localization of ␮NS and its inclusion-forming derivatives—in
cytoplasmic, phase-dense, globular inclusions—has proven a
potent tool for studying associations between ␮NS and other
viral proteins in infected or transfected cells (4, 6, 7). In
the present study, we acquired original evidence that GFP/
␮NS(471-721) may provide a useful platform for examining
possible associations between any two proteins in transfected
cells. In particular, full-length proteins or protein regions expressed as fusions to GFP/␮NS(471-721) should localize to the
distinctive, globular inclusions induced by the region from positions 471 to 721. The capacity of this fused protein or protein
region to associate with another, “test” protein can then be
assayed by examining cells in which the test protein has been
coexpressed with the inclusion-forming fusion protein. If the
test protein localizes to the globular inclusions, then it and the
fused protein or protein region can be concluded to associate.
Of course, nonfused GFP/␮NS(471-721) should be tested in
parallel as a negative control for the specificity of test protein
localization to the inclusions. A range of relative expression
levels of the two proteins could also be tested, in case relative
overexpression of the test protein may retard inclusion formation by the other. We are currently extending our studies of the
feasibility of this approach as a general one for studying protein-protein associations within the “native” cellular environment in which the proteins normally reside and function.
ACKNOWLEDGMENTS
We express our sincere gratitude to Elaine Freimont and Jason
Dinoso for laboratory maintenance and technical assistance and to
other members of our lab for helpful discussions. We also thank John
Patton and John Parker for reviews of a draft of the manuscript.
This study was supported in part by NIH grants R01 AI47904
(M.L.N.) and F32 AI56939 (C.L.M.) and by a junior faculty grant from
the Giovanni Armenise-Harvard Foundation (M.L.N.). T.J.B. and
M.M.A. were also supported by NIH grant T32 AI07245 to the Viral
Infectivity Training Program. J.A.H. was also supported by NIH grant
T32 GM07226 to the Biological and Biomedical Sciences Training
Program. At earlier stages of this work, C.L.M. was also supported by
NIH grant T32 AI07061 to the Combined Infectious Diseases Training
Program.
Downloaded from http://jvi.asm.org/ on February 27, 2014 by PENN STATE UNIV
form the factory matrix and to recruit other components to the
factories, with a modular organization of its primary sequence
for performing these many distinct activities.
How does ␮NS form factory-like inclusions? There are
many possible interactions that could be involved in forming
the three-dimensional structure that each inclusion likely represents, even before the addition of other viral components as
found in the factories in infected cells. For example, ␮NS-␮NS
interactions may be all that are required for forming factorylike inclusions. Alternatively, interactions of ␮NS with one or
more cellular factor may be necessary, with the cellular factor(s) acting as bridges between ␮NS monomers or oligomers.
The presence of predicted coiled-coil segments in ␮NS has led
to the suggestion that ␮NS forms a basal small oligomer, possibly a dimer, through ␣-helical coiled-coil interactions (25). If
so, then inclusions are likely built by linking these small oligomers together, with or without the help of cellular factors. In
any case, according to the new results, ␮NS(471-721) must be
capable of mediating or instigating all of the necessary interactions for inclusion formation. The smaller regions within
␮NS(471-721) that are required for forming inclusions might
be directly involved in these interactions.
The consensus motif that spans residues 563 to 574 of ␮NS
and that is partially conserved in the homologous proteins of
avian orthoreoviruses and aquareoviruses includes residues
His570 and Cys572, which are required for inclusion formation. Given that His and Cys residues have strong potential to
chelate transition metal ions such as Zn2⫹, we hypothesize that
metal chelation by His570 and Cys572 is a part of their role in
forming inclusions. Moreover, considering that His570 and
Cys572 are so closely spaced and that nearby residues with
the same potential for metal chelation—Cys561, His569, and
His576—are dispensable for inclusion formation, we hypothesize that His570 and Cys572 form half of an intermolecular
metal-chelating motif, similar to the zinc hook of Rad50 (18)
or the zinc clasp of CD4/8 and Lck (20, 21). The latter two
motifs provide four zinc-chelating residues, two from each
participating subunit, and contribute to homodimerization in
the case of Rad50 or heterodimerization in the case of CD4/8
and Lck. Of course, further work is needed to determine whether ␮NS residues His570 and Cys572 indeed chelate a metal ion
and, if so, whether this chelation may contribute to ␮NS homodimerization or ␮NS heterodimerization with a cellular protein, either of which could be required for inclusion formation.
Some portion of the C-terminal eight residues of ␮NS (PheSer-Val-Pro-Thr-Asp-Glu-Leu) is also required for inclusion
formation. Since this region contains no His or Cys residues, it
must contribute to forming inclusions by a mechanism distinct
from that hypothesized for His570 and Cys572. Although this
region is not highly conserved in the homologous proteins of
avian orthoreoviruses and aquareoviruses, each of the ␮NS
homologs terminates in Leu and has at least one acidic residue
and no basic residues in its C-terminal eight positions. Further
work is needed to determine whether these C-terminal residues may contribute to ␮NS-␮NS interaction or to ␮NS interaction with a cellular protein, either of which could be additionally required for inclusion formation.
Evidence in the present study suggests that the more Nterminal of the predicted coiled-coil segments in ␮NS (25) is
required for inclusion formation but that the loss of function
6205
6206
BROERING ET AL.
REFERENCES
24. Mbisa, J. L., M. M. Becker, S. Zou, T. S. Dermody, and E. G. Brown. 2000.
Reovirus ␮2 protein determines strain-specific differences in the rate of viral
inclusion formation in L929 cells. Virology 272:16–26.
25. McCutcheon, A. M., T. J. Broering, and M. L. Nibert. 1999. Mammalian
reovirus M3 gene sequences and conservation of coiled-coil motifs near the
carboxyl terminus of the ␮NS protein. Virology 264:16–24.
26. Miller, C. L., T. J. Broering, J. S. L. Parker, M. M. Arnold, and M. L. Nibert.
2003. Reovirus ␴NS protein localizes to inclusions through an association
requiring the ␮NS amino terminus. J. Virol. 77:4566–4576.
27. Miller, D. J., M. D. Schwartz, and P. Ahlquist. 2001. Flock house virus RNA
replicates on outer mitochondrial membranes in Drosophila cells. J. Virol.
75:11664–11676.
28. Morgan, E. M., and H. J. Zweerink. 1975. Characterization of transcriptase
and replicase particles isolated from reovirus-infected cells. Virology 68:
455–466.
29. Moss, B. 2001. Poxviridae: the viruses and their replication, p. 2637–2671. In
D. M. Knipe and P. M. Howley (ed.), Fields virology. Lippincott Williams &
Wilkins Co., Philadelphia, Pa.
30. Parker, J. S., T. J. Broering, J. Kim, D. E. Higgins, and M. L. Nibert. 2002.
Reovirus core protein ␮2 determines the filamentous morphology of viral
inclusion bodies by interacting with and stabilizing microtubules. J. Virol. 76:
4483–4496.
31. Quimby, B. B., and A. H. Corbett. 2001. Nuclear transport mechanisms. Cell.
Mol. Life Sci. 58:1766–1773.
32. Restrepo-Hartwig, M. A., and P. Ahlquist. 1996. Brome mosaic virus helicase- and polymerase-like proteins colocalize on the endoplasmic reticulum
at sites of viral RNA synthesis. J. Virol. 70:8908–8916.
33. Rhim, J. S., L. E. Jordan, and H. D. Mayor. 1962. Cytochemical, fluorescentantibody and electron microscopic studies on the growth of reovirus (ECHO
10) in tissue culture. Virology 17:342–355.
34. Richardson, M. A., and Y. Furuichi. 1985. Synthesis in Escherichia coli of the
reovirus nonstructural protein ␴NS. J. Virol. 56:527–533.
35. Roizman, B., and A. E. Sears. 2001. Herpes simplex viruses and their replication, p. 2231–2295. In D. M. Knipe and P. M. Howley (ed.), Fields virology.
Lippincott Williams & Wilkins Co., Philadelphia, Pa.
36. Schwartz, M., J. Chen, M. Janda, M. Sullivan, J. den Boon, and P. Ahlquist.
2002. A positive-strand RNA virus replication complex parallels form and
function of retrovirus capsids. Mol. Cell 9:505–514.
37. Sharpe, A. H., L. B. Chen, and B. N. Fields. 1982. The interaction of
mammalian reoviruses with the cytoskeleton of monkey kidney CV-1 cells.
Virology 120:399–411.
38. Silverstein, S. C., and S. Dales. 1968. The penetration of reovirus RNA and
initiation of its genetic function in L-strain fibroblasts. J. Cell Biol. 36:
197–230.
39. Silverstein, S. C., and P. H. Schur. 1970. Immunofluorescent localization of
double-stranded RNA in reovirus-infected cells. Virology 41:564–566.
40. Silvestri, L. S., Z. F. Taraporewala, and J. T. Patton. 2004. Rotavirus replication: plus-sense templates for double-stranded RNA synthesis are made
in viroplasms. J. Virol. 78:7763–7774.
41. Spendlove, R. S., E. H. Lennette, J. N. Chin, and C. O. Knight. 1964. Effect
of antimitotic agents on intracellular reovirus antigen. Cancer Res. 24:1826–
1833.
42. Stamatos, N. M., and P. J. Gomatos. 1982. Binding to selected regions of
reovirus mRNAs by a nonstructural reovirus protein. Proc. Natl. Acad. Sci.
USA 79:3457–3461.
43. Theron, J., H. Huismans, and L. H. Nel. 1996. Site-specific mutations in the
NS2 protein of epizootic haemorrhagic disease virus markedly affect the
formation of cytoplasmic inclusion bodies. Arch. Virol. 141:1143–1151.
44. Touris–Otero, F., M. Cortez–San Martin, J. Martinez-Costas, and J. Benavente. 2004. Avian reovirus morphogenesis occurs within viral factories and
begins with the selective recruitment of ␴NS and ␭A to ␮NS inclusions.
J. Mol. Biol. 341:361–374.
45. Touris-Otero, F., J. Martinez-Costas, V. N. Vakharia, and J. Benavente.
2004. Avian reovirus nonstructural protein ␮NS forms viroplasm-like inclusions and recruits protein ␴NS to these structures. Virology 319:94–106.
46. Wiener, J. R., J. A. Bartlett, and W. K. Joklik. 1989. The sequences of
reovirus serotype 3 genome segments M1 and M3 encoding the minor protein ␮2 and the major nonstructural protein ␮NS, respectively. Virology 169:
293–304.
47. Wilson, I. A., H. L. Niman, R. A. Houghten, A. R. Cherenson, M. L. Connolly,
and R. A. Lerner. 1984. The structure of an antigenic determinant in a
protein. Cell 37:767–778.
48. Wolf, E., P. S. Kim, and B. Berger. 1997. MultiCoil: a program for predicting
two- and three-stranded coiled coils. Protein Sci. 6:1179–1189.
49. Zweerink, H. J., M. J. McDowell, and W. K. Joklik. 1971. Essential and
nonessential noncapsid reovirus proteins. Virology 45:716–723.
Downloaded from http://jvi.asm.org/ on February 27, 2014 by PENN STATE UNIV
1. Antczak, J. B., and W. K. Joklik. 1992. Reovirus genome segment assortment
into progeny genomes studied by the use of monoclonal antibodies directed
against reovirus proteins. Virology 187:760–776.
2. Attoui, H., Q. Fang, F. M. Jaafar, J. F. Cantaloube, P. Biagini, P. De Micco,
and X. De Lamballerie. 2002. Common evolutionary origin of aquareoviruses and orthoreoviruses revealed by genome characterization of golden
shiner reovirus, grass carp reovirus, striped bass reovirus and golden ide
reovirus (genus Aquareovirus, family Reoviridae). J. Gen. Virol. 83:1941–
1951.
3. Becker, M. M., M. I. Goral, P. R. Hazelton, G. S. Baer, S. E. Rodgers, E. G.
Brown, K. M. Coombs, and T. S. Dermody. 2001. Reovirus ␴NS protein is
required for nucleation of viral assembly complexes and formation of viral
inclusions. J. Virol. 75:1459–1475.
4. Becker, M. M., T. R. Peters, and T. S. Dermody. 2003. Reovirus ␴NS and
␮NS proteins form cytoplasmic inclusion structures in the absence of viral
infection. J. Virol. 77:5948–5963.
5. Broering, T., A. McCutcheon, V. Centonze, and M. Nibert. 2000. Reovirus
nonstructural protein ␮NS binds to reovirus cores but does not inhibit their
transcription activity. J. Virol. 74:5516–5524.
6. Broering, T. J., J. Kim, C. L. Miller, C. D. Piggott, J. B. Dinoso, M. L. Nibert,
and J. S. L. Parker. 2004. Reovirus nonstructural protein ␮NS recruits viral
core surface proteins and entering core particles to factory-like inclusions.
J. Virol. 78:1882–1892.
7. Broering, T. J., J. S. L. Parker, P. L. Joyce, J. Kim, and M. L. Nibert. 2002.
Mammalian reovirus nonstructural protein ␮NS forms large inclusions and
colocalizes with reovirus microtubule-associated protein ␮2 in transfected
cells. J. Virol. 76:8285–8297.
8. Brookes, S. M., A. D. Hyatt, and B. T. Eaton. 1993. Characterization of virus
inclusion bodies in bluetongue virus-infected cells. J. Gen. Virol. 74:525–530.
9. Campbell, R. E., O. Tour, A. E. Palmer, P. A. Steinbach, G. S. Baird, D. A.
Zacharias, and R. Y. Tsien. 2002. A monomeric red fluorescent protein.
Proc. Natl. Acad. Sci. USA 99:7877–7882.
10. Dales, S. 1963. Association between the spindle apparatus and reovirus.
Proc. Natl. Acad. Sci. USA 50:268–275.
11. Dales, S., P. Gomatos, and K. C. Hsu. 1965. The uptake and development of
reovirus in strain L cells followed with labeled viral ribonucleic acid and
ferritin-antibody conjugates. Virology 25:193–211.
12. Eichwald, C., J. F. Rodriguez, and O. R. Burrone. 2004. Characterization of
rotavirus NSP2/NSP5 interactions and the dynamics of viroplasm formation.
J. Gen. Virol. 85:625–634.
13. Fields, B. N., C. S. Raine, and S. G. Baum. 1971. Temperature-sensitive
mutants of reovirus type 3: defects in viral maturation as studied by immunofluorescence and electron microscopy. Virology 43:569–578.
14. Fujimuro, M., H. Sawada, and H. Yokosawa. 1994. Production and characterisation of monoclonal antibodies specific to multi-ubiquitin chains of
polyubiquitinated proteins. FEBS Lett. 349:173–180.
15. Gillian, A. L., and M. L. Nibert. 1998. Amino terminus of reovirus nonstructural protein sigma NS is important for ssRNA binding and nucleoprotein
complex formation. Virology 240:1–11.
16. Gillian, A. L., S. C. Schmechel, J. Livny, L. A. Schiff, and M. L. Nibert. 2000.
Reovirus nonstructural protein ␴NS binds in multiple copies to singlestranded RNA and shares properties with single-stranded DNA binding
proteins. J. Virol. 74:5939–5948.
17. Gomatos, P. J., O. Prakash, and N. M. Stamatos. 1981. Small reovirus
particle composed solely of ␴NS with specificity for binding different nucleic
acids. J. Virol. 39:115–124.
18. Hopfner, K. P., L. Craig, G. Moncalian, R. A. Zinkel, T. Usui, B. A. Owen,
A. Karcher, B. Henderson, J. L. Bodmer, C. T. McMurray, J. P. Carney, J. H.
Petrini, and J. A. Tainer. 2002. The Rad50 zinc-hook is a structure joining
Mre11 complexes in DNA recombination and repair. Nature 418:562–566.
19. Huismans, H., and W. K. Joklik. 1976. Reovirus-coded polypeptides in
infected cells: isolation of two native monomeric polypeptides with affinity
for single-stranded and double-stranded RNA, respectively. Virology 70:
411–424.
20. Huse, M., M. J. Eck, and S. C. Harrison. 1998. A Zn2⫹ ion links the
cytoplasmic tail of CD4 and the N-terminal region of Lck. J. Biol. Chem. 273:
18729–18733.
21. Kim, P. W., Z. Y. Sun, S. C. Blacklow, G. Wagner, and M. J. Eck. 2003. A
zinc clasp structure tethers Lck to T-cell coreceptors CD4 and CD8. Science
301:1725–1728.
22. Lee, P. W. K., E. C. Hayes, and W. K. Joklik. 1981. Characterization of
anti-reovirus immunoglobulins secreted by cloned hybridoma cell lines. Virology 108:134–146.
23. Mayor, H. D. 1965. Studies on reovirus. 3. A labile, single-stranded ribonucleic acid associated with the late stages of infection. J. NCI. 35:919–925.
J. VIROL.