Bedömning av skriftlig rapport (Examensarbeten, grundnivå VT2013) Blanketten lämnas /skickas till Arja Kramsu Patologen F58 för dokumentation av resultat. Betyget förs in på pingpong. Studentens namn Period Projekttitel Spatio-­‐temporal expression and subcellular localisation of MEF2D in developing nervous systems Abstrakt (2.6a) 1. ☐Sammanfattning saknas och/eller motsvarar inte studiens innehåll (U). ☐Sammanfattning/abstrakt på engelska finns och motsvarar studiens innehåll (G). ☒Sammanfattning/abstrakt på engelska finns och motsvarar studiens innehåll. Lätt att få grepp på studiens syfte, upplägg, resultat samt slutsats efter en enda genomläsning (VG). Introduktion och syfte (1.1, 2.1, 2.2, ) 2. ☐Bakgrunden är bristfällig och har svag anknytning till tidigare forskning. Centrala begrepp fattas eller är bristfälligt redovisade (U). ☐Bakgrunden baseras på och relateras till tidigare forskning/litteratur inom det valda området (G). ☒Bakgrunden är välstrukturerad och baseras på och relateras till tidigare forskning/litteratur inom det valda området. Det framgår tydligt hur det bredare sammanhanget för studien förvandlas genom tydliga, i litteratur förankrade steg till det specifika området för studien samt kunskapsluckan som ska studeras (VG). 3. ☐Litteraturgenomgången innehåller ett fåtal referenser eller referenser som är hämtade ur källor som inte är centrala utifrån ämnesvalet (U). ☒Litteraturgenomgången innehåller för ämnet centrala referenser (G). 4.
☐Beskrivning av problem/eller forskningsfrågor saknas eller är ej grundade i bakgrunden (U). 5.
☒Problem och/eller forskningsfrågor är beskrivna och grundade i bakgrunden (G). ☐Syfte fattas eller är ofullständigt eller oklart (U). ☒Syftet är tydligt, avgränsat och relevant för forskningsområdet /ämnesområdet (G). Material och metod (1.2, 2.3) 6. ☐Metoderna är ytligt och osammanhängande beskriven (U). ☒Metoderna är tydligt och grundligt beskriven så det går att upprepa försöken (G). 7. ☐ Urval av materialet är ytligt beskrivna och/eller ej relevanta och tillämpbarra i förhållande till syftet med arbetet (U). ☒ Urval av materialet är beskrivna samt relevanta och tillämpbara i förhållande till syftet med arbetet (G). 8. ☐ Metod för dataanalys är ytligt beskriven och/eller ej relevant och tillämpbar i förhållande till vald datainsamlingsmetod (U). ☒ Metod för dataanalys (tex. statistik) är beskriven samt relevant och tillämpbar i förhållande till vald datainsamlingsmetod (G). Etiska överväganden (3.1b) 9. ☐ Relevanta etiska aspekter är inte beaktade eller är otillräckligt beskrivna och inte motiverade (U). ☒ Relevanta etiska aspekter är beskrivna och beaktade (G). Resultat (2.5a) 10. ☐Resultatredovisningen är otydlig och/eller ostrukturerad, ologisk och/eller osaklig (U). ☒Resultatredovisningen överensstämmer med undersökningens syfte och är välstrukturerad, logisk och saklig med illustrationer där så bör. Bearbetade data redovisas enligt gängse normer i tabeller och figurer med beskrivande text (G). 11. ☐Resultaten redovisas på ett subjektivt sätt med egna tolkningar (U). ☐Resultaten redovisas på ett objektivt sätt (G). ☒Resultaten redovisas på ett tydligt och objektivt sätt, där relationen samt progressionen mellan de olika resultaten tydligt och logiskt framgår. Figurer och tabeller ska vara tydliga och självständiga (VG). Diskussion och slutsatser (2.4, 2.5b, 2.6a, 3.1b, 3.3) 12. ☐Diskussion kring resultaten saknas eller är bristfällig. Hänvisningar till aktuell forskning saknas eller är Bristfälliga i diskussionen (U). ☐Egna resultat diskuteras i förhållande till studiens syfte och aktuell forskning (G). ☒Egna resultat diskuteras i förhållande till studiens syfte och aktuell forskning. Jämförelse av resultat med annan forskning inom mrådet och utifrån andra forskningsperspektiv diskuteras (VG). 13. ☐Diskussion om studiens styrkor och svagheter saknas eller är bristfällig. Styrkor och svagheter i metoderna i förhållande till resultaten redovisas inte eller är bristfälligt redovisade (U). ☒Studiens styrkor och svagheter, t.ex. begränsningar i vald metod, redovisas och diskuteras (G). 14. ☐Redovisning av resultatens betydelse saknas eller är ytlig. Diskussion om möjligheter till fortsatt forskning saknas. Jämförelse av resultat med annan forskning inom området och utifrån andra forskningsperspektiv, liksom diskussion av resultaten, är bristfällig och/eller saknas. Diskussion kring nytta och tillämpning är ytlig och/eller saknas. Slutsatser saknas eller är bristfälligt underbyggda (U). ☐Resultatens nytta, tillämpning och betydelse redovisas. Möjligheter till fortsatt forskning diskuteras utifrån resultaten. Slutsatserna är relevanta utifrån resultaten (G). ☒Resultatens nytta, tillämpning och betydelse redovisas och diskuteras. Möjligheter till fortsatt forskning diskuteras utifrån resultaten. Slutsatserna är relevanta utifrån resultaten och dears generaliserbarhet i ett bredare sammanhang redovisas på ett tydligt sätt samt motiveras med hänvisning till litteratur (VG). Vetenskapligt skrivande (2.6b, 3.1a) 15. ☐ Arbetet följer inte de formella ramar som angivits för uppsatsen avseende struktur omfattning etc (U). ☒ Arbetet följer de formella ramar som angivits för uppsatsen avseende struktur omfattning etc (G). 16. ☐ Strukturen är ologisk och osammanhängande. Språket har bristfällig grammatik och stavning (U). ☒ Logiska samband (den röda tråden) markeras språkligt, satserna är fullständiga och formuleringarna exakta. Studenten följer gällande skrivregler och behärskar hanteringen av vetenskapliga termer (G). 17. ☐ Språket är vardagligt och inte adekvat använt för vetenskaplig text. Studenten följer inte gällande skrivregler och behärskar inte vetenskapliga begrepp. Arbetet följer inte de formella ramar som angivits för uppsatsen (U). ☐Studenten använder ett formellt vetenskapligt språk. Arbetet följer de formella ramar som angivits (G). ☒Studenten använder ett formellt vetenskapligt språk. Arbetet följer de formella ramar som angivits. Språket är tydligt och texten är lättläst, koncis, sammanhängande och intresseväckande i ett vetenskapligt sammanhang (VG). 18. ☐Källorna är inte klart angivna och det går inte eller är svårt att skilja ut vad som är författarens egna slutsatser, resonemang och tolkningar (U). ☒Texten är självständigt formulerad och egna slutsatser, resonemang och tolkningar är baserade på egna data (G). 19. ☐Otillräcklig förankring i litteraturen beroende på för få eller inadekvata referenser för forskningsområdet eller teorin. Referenserna i löpande text har brister och oklarheter (U). ☒Relevant litteratur refereras till i löpande text enligt valt referenshanteringssystem (G). 20. ☐Referenslistan har brister eller saknas (U). ☒Referenslista finns och är konstruerad enligt anvisningarna (G). Helhet (1.1) 21. ☐ Röd tråd och logisk struktur saknas i arbetet som helhet. Kritisk reflektion saknas genomgående (U). ☐ Röd tråd och logisk struktur framgår av arbetet som helhet. Formellt vetenskapligt språk och kritisk reflektion framgår genomgående (G). ☒ Röd tråd och genomtänkt tydlig struktur framgår av arbetet som helhet. Formellt vetenskapligt språk som är tydligt och koncist. Kritisk reflektion framgår genomgående (VG). Layout 22. ☐ Layouten av titelsida och abstrakt följer inte angivna instruktioner (U). ☒ Titelsida och abstrakt är utformade enligt KI:s modell (G). Rekommenderad helhetsbedömning av examinerande lärare på skriftligrapport • För godkänt krävs att samtliga punkter uppnår G. • För VG på skriftliga rapporten krävs VG på samtliga punkter med VG nivå (dvs punkt 1, 2, 11, 12, 14 och 17) och G på resterande moment. ☐ U ☐ G ☒ VG Institutionen för laboratoriemedicin/Dept. of Laboratory Medicine
Biomedicinska analytikerprogrammet/( Programme in Biomedical Laboratory Science)
Examensarbete C-nivå, 15 poäng/Degree project, C-level, 15 points
Biomedicinsk laboratorievetenskap/ Biomedical Laboratory Science
Spring term 2013 Spatio-temporal expression and
subcellular localization of
MEF2D in the developing
nervous system
1 Table of contents
Table of contents ...................................................................................................................2
1. Abbreviations ....................................................................................................................3
2. Summary............................................................................................................................4
3. Introduction .......................................................................................................................5
4. Material and methods .......................................................................................................9
4.1 Materials ......................................................................................................................9
4.2 Immunohistochemical staining ..................................................................................9
4.3 Quantitative real-time PCR .....................................................................................11
4.4 Western blotting ........................................................................................................12
4.5 Processing data ..........................................................................................................13
5. Results ..............................................................................................................................14
5.1 Validation of antibodies against human MEF2D on rat tissue .............................14
5.2 Expression profiling in the developing and adult DRGs and brain .....................16
6. Discussion ........................................................................................................................19
7. Acknowledgments ...........................................................................................................23
8. References ........................................................................................................................24
2 1. Abbreviations
CNS
Central nervous system
CMA
Chaperone-mediated autophagy
CP
Cortical plate
CY
Carbocyanine
DA
Dopaminergic
DRG
Dorsal root ganglion
E
Embryonic days
ERK5
Extracellular-signal regulated kinase 5
GAPDH
Glyceraldehyde 3-phosphate dehydrogenase
HPA
Human protein atlas
IZ
Intermediate zone
MADS
minichromosome maintenance 1-agamous-deficiens-serum response factor
MEF2D
Myocyte enhancer factor 2D
ND6
NADH dehydrogenase 6
NSC
Neural stem cell
P
Postnatal days
PD
Parkinson’s disease
PKA
Protein kinase A
PNS
Peripheral nervous system
VZ
Ventricular Zone
3 2. Summary
MEF2 (A-D) proteins are members of the MADS family of transcription factors and
regulate the development of various tissues, including the nervous system. MEF2
transcription factors govern differentiation, survival and synaptogenesis of neurons during
development. In the present study the spatial-temporal expression and subcellular
localization of MEF2D in the developing and adult rat dorsal root ganglion (DRG) and
cortex were examined. In order to define the distribution of MEF2D, different methods
such as immunohistochemistry, real-time PCR and Western blot were used. The results of
this study indicate that MEF2D is highly expressed at early developmental stages in the
cortex and DRGs whereas the expression decreases gradually during embryonic
development. Expression of MEF2D at early developmental stages coincides with the
proliferation and differentiation of the neurons in the deeper layers of the cortex. Early
postnatal MEF2D appears to be expressed by cells in the deeper layers of the cortex where
it is mainly located in the nucleus. In the adult DRGs and cortex, MEF2D is mainly
cytosolic in contrast to the embryonic stages. These observations, made from early
embryonic and postnatal cortex and sensory nervous system, suggest a role of MEF2D in
the proliferation, differentiation and maturation of neurons.
Keywords: MEF2D, development, cortex, DRG, localization
4 3. Introduction
The neural system is among the first organs to develop during early development. The
formation of the notochord, a cylinder formed of mesodermal cells, in gastrulation is very
important for the development of the nervous system. By sending inductive signals such as
hormones to the overlying cell layer, the ectoderm, cells begin to differentiate into neural
stem cells (NSC). The midline ectoderm that contains these cells will later give rise to the
neuronal tube that eventually gives rise to the central nervous system (CNS). NSCs, in
response to different signals, could give rise to neurons or glia cells (1). The neurons that
form the cortex in the adult brain arise from the NSCs located in the ventricular zone (VZ),
which is adjacent to the lumen of the neural tube (Figure 1). During corticogenesis, the
NSCs in the VZ undergo their terminal division and the newborn neurons radially migrate
through different layers, to reach the cortical plate (CP), where they differentiate. The CP
enlarges continuously during development to form the cortex in the adult brain. The adult
cortex consists of six layers; layer I, the molecular layer, layer II the external granular
layer, layer III the external pyramidal layer, layer IV the internal granular layer, layer V the
internal pyramidal layer and layer VI the multiform layer. The layers comprise different
types of cells and are formed in an inside-out manner (2) which means that the first
newborn neurons to reach CP form the deepest layer and the next newborn cells migrate
passed this layer to form a new layer.
Neurons in the peripheral nervous system (PNS) arise from neural crest cells, which are
multipotent, migratory cells that originate from a zone between the neural tube and
epidermis of the embryo (Figure 1). In response to specific signaling cues, these cells
similar to NSCs, give rise to different types of cells including sensory neurons in the dorsal
root ganglion (DRG) (1).
The formation of specialized cell types and their integration into different tissues and
organs requires reception of extracellular signals resulting in the activation of transcription
factors. Transcription factors regulate gene expression and control spatial and temporal
expression of different genes throughout development. They also mediate genetic programs
that control cell differentiation, proliferation, survival and apoptosis
5 Figure 1. Development of the nervous system. The ectodermal cell layer in the gastrulation gives rise to the
entire nervous system which is divided into CNS and PNS. The CNS, which includes the brain and spinal
cord, arise from the NSCs in the neural tube and the PNS, which includes the neurons outside the CNS, arise
from the neural crest cells. The cortical neurons arise from the NSCs, which migrate through different layers
to reach the CP where they differentiate and form the six layers of the adult cortex.
Source: http://glycoforum.gr.jp/science/hyaluronan/HA30/HA30E.html
http://apbrwww5.apsu.edu/thompsonj/Anatomy%20&%20Physiology/2010/2010%20Exam%20Reviews/Exam%201%20Review/CH04%20
General%20Terms%20and%20Membranes.htm
The transcription factor family Myocyte enhancer factor 2 (MEF2) (A-D), which belongs to
minichromosome maintenance 1-agamous-deficiens-serum response factor (MADS) family
of transcription factors (3), is a central regulator of diverse developmental programs. MEF2
proteins consist of three domains. The first domain is a conserved DNA-binding domain
(MADS domain) followed by a second, highly conserved MEF2 domain, which provides
DNA-binding affinity and cofactor interactions. The third domain is a transactivation
domain, which diverges between the four MEF2 proteins (Figure 2). MEF2 proteins were
first identified as a regulator of skeletal, cardiac and smooth muscle gene expression (4).
Expression of MEF2 isoforms also occurs in tissues other than muscle, including the
nervous system.
In the developing mouse brain, MEF2 mRNA is expressed in spatially and temporally
specific pattern during development (5). MEF2 mRNA is not detected in the ectoderm or
neural tissues before embryonic day (E) 11.5 with the exception of neural crest cells in mice
embryos (5,6). MEF2 has also been identified in NSCs derived from embryonic and adult
brain in vitro and the study reports expression of MEF2 in both proliferating embryonic
6 NSCs and differentiating neuronal cells. During the course of differentiation, cells with high
MEF2D expression adopt neuronal phenotype (7). These findings suggest a role of MEF2 in
differentiation and maturation of neurons.
MEF2 proteins promote survival through different signaling pathways including Ca2+ and
neutrophin signaling (8–10). They are calcium-dependent transcription factors and
downstream targets of intracellular Ca2+ levels (8). Increased levels of intracellular Ca2+ in
neurons activate several signaling pathways including the cAMP-protein kinase A (PKA)
pathway. This pathway activates MEF2 by phosphorylation of the threonine residue in the
MADS domain and enhances MEF2 transcriptional activity as shown in cortical and
cerebellar granule neuron cultures. Inhibition of MEF2 phosphorylation by PKA inhibition
in these cell cultures prevents MEF2 activity and stimulates apoptosis, suggesting a role of
MEF2 in neuronal survival (11).
Decreased intracellular Ca2+ levels cause hyper-phosphorylation of MEF2D in vitro. The
phosphorylated MEF2D become transcriptionally inactive and is cleaved between the Nand C-terminus by caspases. Increased levels of the N-terminal fragments, the DNA binding
domain of MEF2D, inhibits DNA binding activity of constitutively MEF2D-VP16 fusion
protein and promotes apoptosis (12). Recent studies show that Cyclin dependent kinase 5
(Cdk5) phosphorylates MEF2D in the C-terminal in cortical neuron cultures (13–15). By
inducing oxidative stress, Cdk5 phosphorylates MEF2D in the nucleus, inducing MEF2D
degradation and resulting in apoptosis. Phosphorylation of MEF2D by Cdk5 facilitates the
sumoylation of this protein in vitro (15), which also reduces MEF2D activity. Additionally,
there is growing evidence that Ca2+ signaling activates calcineurin, a calcium-dependent
phoaphatase, which dephosphorylates MEF2D at the C-terminus. The dephosphorylation by
calcineurin in return enhances the transcriptional activity of MEF2D by blocking the caspase
cleavage and sumoylation (16,17). Subsequently, this activation is shown to play a role in
regulation of synaptogenesis and number of synapses in hippocampal and cerebellar neuron
cultures (16). In vivo analysis with a deletion of MEF2A, C and D in transgenic mice
confirmed the role of MEF2 in synapse regulation (18).
Neutrophin signaling evokes different cellular response, including cell support and survival.
MEF2D mediates neutrophin signaling through the ERK5 pathway in granule neurons in
cerebellum and sensory neurons in DRG (9,10) . Phosphorylation of MEF2D by ERK5
7 enhances transcriptional activity (19) and promotes survival. In DRGs, activated MEF2D
promotes survival via up-regulation expression of the anti-apoptotic protein, bcl-w.
Figure 2. MEF2 domains and regulatory modifications. MEF2 proteins are composed of three domains: Nterminal MADS domain, the MEF2 domain and the C-terminus transactivation domain. Posttranscriptional
modifications that regulate MEF2 activity are shown below the box diagram. Phosphorylation (P) occurs in
serine (S) or Threonine (T) residues. Modifications that enhance or repress MEF2 dependent-transcription are
shown in grey and black, respectively.
Recent studies report that MEF2D is not only localized in the nucleus, despite the fact that it
is a transcription factor (20,21). Chaperone mediated autophagy (CMA) is shown to degrade
MEF2D in a mouse dopaminergic (DA) cell line (20) and regulate its levels in the cell.
Inhibition of CMA degradation by a Parkinson’s disease (PD) toxicant, leads to
accumulation of MEF2D in neuron cytosol. MEF2D has also been linked to PD in another
study that demonstrates the importance of MEF2D in mitochondrial gene expression in DA
neurons (21). MEF2D induces transcription of NADH dehydrogenase 6 (ND6), which
encodes a necessary component of the complex I enzyme of the oxidative phosphorylation
system. By treating DA cell cultures with PD relevant toxins, the DNA binding activity of
MEF2D decrease specifically in the mitochondria. As a consequence, the activity of
complex I decrease and causing stress-induced neuronal cell death.
Expression profiling and subcellular localization of transcription factors in non-mammalian
species can provide an understanding for their role in development and different diseases in
human. The aim of the study is to firstly validate three Human Protein Atlas antibodies
(http://www.proteinatlas.org) generated for human MEF2D against rat embryonic MEF2D
and to use these antibodies to analyze the spatial-temporal expression and subcellular
localization of MEF2D in developing rat brain and DRGs.
8 4. Material and methods
4.1 Materials
Adult rats and rat embryos at different embryonic stages were used in this study. All animal
experiments were reviewed and approved (N382/11) by the Regional Ethical Review Board
in Stockholm, Sweden.
Nuclear and cytoplasmic fractions of the PC12 cell line, which is a rat neuronal cell line,
were previously collected in the lab and used in this study.
4.2 Tissue sectioning
4.2.1Embryonic tissues
Pregnant rats were sacrificed by cervical dislocation and embryos at E12.5, E14.5 and E18.5
were dissected out. Embryos were fixed in paraformaldehyde 4 % in PB (0.1 M NaH2PO4
and 0.1 M Na2HPO4 pH 7.4) at 4 °C for 24 hours. Embryos were processed for freezing and
sectioning when incubated in 30 % sucrose in PBS at 4 °C. The embryos were then
incubated in 30 % sucrose solution in PBS and OCT (Histolab) with a dilution factor of 1:1
at room temperature overnight. The embryos were then frozen in OCT embedding medium
in a bath of dry ice and isopentane. Embryonic tissues were sectioned sagittally and sliced at
14 µm on a MICROM HM 500 M cryostate (Cellab). The sections were stored at -20 °C
until further processing.
4.2.2 Postnatal and adult tissues
Postnatal and adult brain and DRG tissues were previously collected in the lab and used in
the study. These tissues were preserved by perfusion before freezing and sectioning and
were sectioned coronally and sliced at 14 µm. The sections were stored at -20 °C until
further processing.
4.2 Immunohistochemical staining
4.2.1 Immunohistochemistry of embryonic sections and adult DRGs
Sections from rat embryos at different developmental stages and adult DRGs were encircled
by DAKO pen (DAKO) and kept at room temperature to dry for one hour. Then the samples
were incubated in 0.03 % H2O2 in PBS for 30 minutes at room temperature. The following
primary antibodies were used: HPA anti-MEF2D (004807, 007114, 007068, rabbit-IgG,)
with a concentration of 1 µg/ml and anti-β tubulin (Promega, mouse-IgG, diluted 1:1500).
9 The primary antibody solutions were prepared using the antibody mix buffer (5 % BSA, 0.1
% NaN3, and 0.3 % Triton X 100 and 0.1 M PB). The sections were covered and incubated
with the primary antibody solution at 4 °C over-night. The following day, the antibody
solution was discarded and the sections were washed with 0.05 % tween in TBS (TBST)
(0.1 M Tris, 0.15 M NaCl pH 7.3-7.5) for 3 x 5 minutes. Before adding the secondary
antibody solution, the sections were blocked with TNB buffer (0.5 g blocking reagent in 0.1
M Tris, 0.15 M NaCl, pH 7.3-7.5) at room temperature for 30 minutes. The following
secondary antibodies were used: horseradish peroxidase (HRP) conjugated swine anti-rabbit
(DAKO, diluted 1:200 in TNB buffer) and carbocyanine (CYTM3) conjugated donkey antimouse (Jackson Immuno Research, diluted 1:200 in TNB buffer) in the dark for 90 minutes.
The sections were then washed with 0.05 % TBST at room temperature for 3 x 5 minutes in
the dark. TSATMPlus Fluorescens Kit (PerkinElmer, Stockholm, Sweden) was used to
amplify the fluorescence signal. The sections were incubated with Tyramide Signal
Amplification system (TSA) (diluted 1:100 in amplification buffer) at room temperature for
exactly 15 minutes in the dark. After the washes in 0.05 % TBST, the sections were
incubated with 10 mg/ml Hoechst (Biotrium, diluted 1:10000 in PBS buffer), a nuclear dye,
at room temperature for 10 minutes in the dark. The barrier formed with DAKO pen was
removed and the sections were mounted with 2.5 % PVA-DABCO (glycerol,
polyvinylkohol (Sigma), 0.2 M Tris-Hcl pH 8-8.5, DABCO (Sigma)). Immunoreactivity was
evaluated with a fluorescence-scanning microscope (Metasystems, Alltlussheim, Germany)
with filters optimized for the detection of Hoechst (465nm), Fluorescein (515 nm) and Cy3
(619 nm).
4.2.2 Immunohistochemistry of postnatal and adult brain
Coronal sections from perfused brain from postnatal day (P) 5, P19 and adult brain were
treated as described in last paragraph but with certain changes. For this study only
HPA007068 with a concentration of 0.1 µg/ml was used as a primary antibody. CYTM3.5
conjugated Alexaflour®594 donkey anti-mouse was used instead of CYTM3 conjugated
donkey anti-mouse. After incubating with Hoechst, the sections were incubated with 70 %
Ethanol for 5 minutes at room temperature in the dark. The sections were then incubated in
Sudan Black (1 % Sudan black in 70 % Ethanol) for 10 minutes at room temperature in the
dark. The sections were washed with 70 % Ethanol and the barrier formed with DAKO pen
was removed. The filter used for detection of CY3.5 was 617 nm.
10 4.3 Quantitative real-time PCR
4.3.1 RNA purification
Total RNA from fresh brain tissues (E12.5, E14.5 and E18.5) and adult hippocampus was
purified using RNeasy Mini Kit (QIAGEN, Stockholm, Sweden). The tissues were
disrupted and homogenized using 350 µl RLT (1 % mercacaptoethanol). The samples were
centrifuged for 3 minutes at 14, 000 x g. The supernatant was removed and 70 % ethanol
was added to the lysate and mixed by pipetting. The lysates were transferred to an RNeasy
spin column and centrifuged for 15 seconds at 8, 000 x g. Columns were washed using
RW1 buffer and 2 x 500 µl RPE with centrifugation as above in between. Each column was
placed in new 2 ml tubes and centrifuged for 1 minute at 8, 000 x g. 30 µl RNase-free water
was added to each column and centrifuged for 1 minute at 8, 000 x g to elute the RNA. The
RNA concentration (at 260 nm) and purity (260 nm/280 nm) for each sample was
determined using Nanovue PlusTM (GE Healthcare, Sweden). Samples with RNA purity
values between 2.0 ± 0.2 were used for PCR experiments.
4.3.2 Reverse transcript PCR
The cDNA synthesis was performed using iScriptTM Select cDNA Synthesis Kit (BIORAD,
Stockholm, Sweden). The samples from RNA purification were diluted resulting in a total
amount of 1 µg RNA per reaction. A master mix containing 1x iScript select reaction mix,
Oligo(dT)20 primer and iScript reverse transcriptase was prepared and added to each
reaction in 0.2 ml PCR tubes. Different volume of DNase-free water was added to each
reaction to get a final volume of 20 µl.
4.3.3 Quantitative real-time PCR
Quantitative real-time PCR was performed using an iQTMSYBR® Green Supermix kit
(BIORAD, Stockholm, Sweden). The reference gene used in the experiment was
Glyceraldehyde 3-phosphate dehydrogenase (GAPDH). Primers for MEF2D gene and
GAPDH gene in rattus norvegicus were designed by using Primer 3. The Primers for
MEF2D were designed for exon-exon junction 438/532 with a product length of 95 base
pairs. The sequence for the forward primer was AAGGACCCCTGGAGAAGATG (Tm
= 60.45), and the sequence for reverse primer was AAACTTCCGCTTGGTGAATG (Tm
= 60.11). The primers designed for GAPDH were for the exon-exon junction 6/100 and the
product length was 95 base pair. The sequence for the forward primer for GAPDH was
11 CTCTCTGCTCCTCCCTGTTCT (Tm = 60.14) and the sequence for the reverse primer
was TCCGTTCACACCGACCTT (Tm = 60.09). The primers were diluted to a final
concentration of 100 nM. Four different master mixes were prepared, two for each primer
pair. The master mixes contained primer pair for each gene, iQ SYBR Green Supermix
(1X) and sterile water. 2 µl DNA template from each sample was added to the plate first,
and then the prepared master mixes were added to each sample. The total volume of each
well was 20 µL. Thermocycling protocol was 95 °C 3 minutes, 95 °C 10 seconds, 60 °C 5
seconds, 72 °C 10 seconds. A total of 34 cycles was programed on the PCR-machine
BioRad CFX96 Real- Time System, C1000 Thermal Cycler. The conditions for the melt
curves were 65 °C 5 seconds followed by 95 °C 5 seconds.
4.4 Western blotting
4.4.1 Protein concentration determination by Bradford method
Hippocampus from adult brain was homogenized using lysis buffer (10 x TNE (100 mM
Tris; 2.0 M NaCl; 10 mM EDTA; pH 7.4), 1 % β-octyl-glucoside, 20 % Tx-100) with 1 %
protease inhibitor (BIORAD). The samples were incubated on ice for 30 minutes and the
tube was regularly shaken during the 30 minutes. The samples were centrifuged at 14, 000
rpm for 30 minutes and the supernatant was collected. Nuclear and cytoplasmic fractions of
the PC12 cell line (neuronal cell line) were previously collected in the lab and used in the
study. The total protein concentration for each sample was determined using a Bradford
assay (22) and a standard curve of known protein concentration. For the standard curve,
0.5, 1, 2, 3 and 4 µg Bovine Serum Albumin (BSA) (2 mg/ml) was allowed to react with
200 µl Dye Reagent 1x (BIORAD). The samples were diluted 1:10 and 1:100 and
incubated with the same dilution of the dye reagent. The protein concentration for the
samples and standard curves were measured in 96 well plates using Spectramax 250 plate
reader at 595 nm.
4.4.2 SDS polyacrylamide gel electrophoresis (SDS-PAGE)
The samples were diluted with 1x TNE and 5x Laemmli sample buffer (1.5 M Tris-HCl pH
6.8, glycerol, 20 % β-mercaptoethanol, SDS and 1 % Bromophenol Blue) to a final protein
concentration of 1 µg/µl. The protein samples were denatured by incubating at 95 °C for 5
minutes. Precasted polyacrylamide gels (4-20 %) (BIORAD) were used and the chamber
was filled with the electrophoresis running buffer 1x (15 mM Tris, 0.1 M glycine, 1 %
12 SDS). 20 µl of each sample and 5 µl Precision Plus Protein™ All Blue Standards
(BIORAD) was loaded onto the gels. The running condition for the electrophoresis was 100
V for 90 minutes. The gels were transferred to the PVDF-membranes using Trans-blot
Turbo system (BIORAD). The running condition for the transfer was 18 V for 7 minutes.
4.4.3 Protein immunodetection
The membranes were first blocked with blocking buffer (5 % milk in 0.05 % tween in TBS
plus 0.02 % NaN3) at 4 °C overnight. The membranes were then incubated with primary
antibody solution for 2 hours at room temperature. Following primary antibodies were
used: rabbit anti-MEF2D (HPA007114 (0.103 mg/ml), 007068 (0.153 mg/ml),
004807(0.190 mg/ml) diluted 1:1000) and mouse anti-β actin diluted 1:6000. The primary
antibodies were diluted in blocking buffer. The membranes were washed with 0.05 %
TBST for 3 x 15 minutes at room temperature. Blots were probed with HRP conjugated
swine anti-rabbit (Dako, diluted 1:5000 in blocking buffer) for 1 hour at room temperature.
Membranes were washed and incubated with peroxidase-substrate for enhanced
chemiluminescence (BIORAD) for 1 minute in the dark. The bands were detected using
Chemidoc MP Imaging system (BIORAD). After the detection of MEF2D protein, the
membranes were washed and incubated with peroxidas-conjugated donkey anti-mouse
(Jackson Immuno Research diluted 1:5000 in blocking buffer) for 1 hour at room
temperature. The membranes were then washed and analyzed as described above.
4.5 Processing data
The images from immunohistochemistry were treated equally. The same scanning settings,
brightness and contrast enhancements were used for all of the images. The images were
scanned and processed using the program Meta Viewer.
13 5. Results
5.1 Validation of antibodies against human MEF2D on rat tissue
HPA antibodies (HPA007114, 007068, 004807) directed against MEF2D were tested on rat
embryonic tissues by immunohistochemistry and Western blot. The immunohistochemical
staining in embryonic tissues with these three antibodies revealed similar staining pattern in
the entire body as seen in three rat embryos for each antibody. The heart is an example,
where the antibodies showed an almost identical nuclear staining in cardio myocytes
(Figure 3). The specificity of the antibodies was further validated by Western blot using
adult hippocampus samples and nuclear and cytoplasmic fractions of PC12 samples. All
antibodies immunoreacted with a protein of expected molecular weight (56 kDa) in
hippocampal and PC12 samples. However, only HPA007114 and HPA007068 detected
MEF2D in cytoplasmic fraction of PC12 cell line. An additional band was observed with
HPA007068 at lower molecular weight than expected in the cytoplasmic fraction of PC12
cell line (Figure 3). Based on the immunohistochemistry and Western blot results
HPA007068 was used as the primary antibody for the detection of MEF2D in tissues.
14 A HPA007114
HPA007068
HPA004807
E12.5
E14.5
E18.5
B Figure 3. Validation of HPA antibodies against rat MEF2D.
The specificity of the HPA antibodies against rat MEF2D was validated by immunohistochemistry and
Western blot. (A) Embryonic tissues at different embryonic stages (E12.5, E14.5 and E18.5) were stained
with the HPA antibodies. The images show the heart of the embryos and are representative for the
distribution of antibody staining in three rat embryos for each antibody. Scale bar: 100 µm. (B) Western blot
analysis performed on adult Hippocampus (HI) and PC12 cell line, nuclear (Nuc) and cytoplasmic (Cyto)
fraction. The first membrane was incubated with HPA007068, second with HPA007114 and the third with
HPA004807. The arrows in the membranes show bands at expected molecular weight (56 kDa).
15 5.2 Expression profiling in the developing and adult DRGs and brain
Immunohistochemistry and real-time PCR were used to examine MEF2D expression and
subcellular localization in the developing nervous system.
5.2.1 Expression profiling in embryonic and adult DRGs
At E12.5 MEF2D expression was most abundant in the entire nervous system and
decreased gradually till E18.5 (Figure 4A-C). The DRGs, which belong to the PNS, were
examined more closely. MEF2D was highly expressed in the DRGs at early embryonic
stages (Figure 4D) but decreased progressively during embryonic development (Figure 4EF). The gradual decrease of MEF2D expression, during embryonic development, coincided
with a shift in subcellular localization from nuclear to cytosolic (Figure 4H-I). The
expression of MEF2D was also detectable in the adult DRGs, where MEF2D was mainly
localized in the cytosol (Figure 4G, K). Pictures shown in figure 4 are representative for
cells in the area.
MEF2D/β-­‐tubulin/Hoechst Figure 4. Distribution of MEF2D in the developing DRGs.
Immunohistochemistry on rat embryonic and adult tissues was performed with HPA007068 as primary
antibody to identify the expression profiling of MEF2D. MEF2D is stained in green, β-tubulin stains
differentiated neurons red and Hoechst stains nucleus blue. (A-C) Expression of MEF2D in rat embryonic
tissues at three embryonic stages (E12.5, E14.5 and E18.5). Scale bar: 500 µm. (D-F) Show higher
magnification of the boxes in (A-C). Sensory neurons in the DRGs express MEF2D highly at E12.5 whereas
at E14.5 and E18.5, the expression decreases. Scale bar: 100µm (G) MEF2D expression is also detectable in
the sensory neurons in the adult DRGs. Scale bar: 100µm. (H-K) Show higher magnification of the boxes in
(D-G), which show the subcellular localization of MEF2D in the embryonic and adult DRGs. Scale bar:
10µm. Unfilled arrows show nuclear MEF2D and filled arrows show cytosolic MEF2D. The pictures are
representative for cells in the area.
16 5.3 Expression profiling in the developing and adult brain
Similar expression dynamics as they have been observed in embryonic DRGs were seen in
the developing cortex. Expression was highest in the entire brain at E12.5 (Figure 4A-C).
This was also confirmed by real-time PCR that established robust expression of MEF2D
mRNA at E12.5 whilst decreased expression at E14.5 and E18.5 (Figure 5).
Figure 5. Normalized expression of MEF2D mRNA in embryonic brains relative to GAPDH.
MEF2D mRNA expression in the brain tissues was normalized by using GAPDH as housekeeping gene.
Error bars show ± standard deviation of mean. (n = 2)
As it can be seen in figure 6, the cortex is one of the brain regions with most dramatic
change in MEF2D expression during embryonic brain development (Figure 6A-6C). At
E12.5 MEF2D was detected in the nuclei of both NSCs in the VZ/IZ (Figure 6D) and
differentiated neurons in the developing CP (Figure 6E). At E14.5, the expression in NSCs
in VZ/IZ decreased (Figure 6F) but still detectable in the differentiated neurons in the CP
(Figure 6G). Expression of MEF2D continued to decline in the NSCs during the next four
days. At E18.5, the migrating neurons in the IZ and the superficial cell layer of CP did not
express MEF2D (Figure 6H&J). However differentiated neurons in the deeper layer of CP
showed MEF2D immunoreactivity (Figure 6I). By P5 the 6 layers of cortex could be
identified (Figure 6K). MEF2D was still highly expressed in P5 and was strongly reduced
at P19 and adult cortex (Figure 6K-M). At P5 MEF2D was mainly located in the nucleus of
cells in layer IV, V and VI (Figure 6N). Subsequently, the expression decreased during the
next two weeks and in these layers. At P19, the subcellular localization became mainly
cytosolic (Figure 6O). No clear difference in expression or subcellular localization was
noted between P19 and adult the cortex (Figure 6P).
17 MEF2D/β-­‐tubulin/Hoechst Figure5: Distribution of MEF2D in the developing cortex.
Immunohistochemistry on rat embryonic, postnatal and adult brain tissues was performed with HPA007068
as primary antibody to analyze the expression profiling of MEF2D in the cortex. MEF2D is stained in green,
β-tubulin stains differentiated neurons red and Hoechst stains nucleus blue. (A-C) Show higher magnification
of the boxes in (Figure 4A-C), which demonstrate the developing cortex at different embryonic stages. Scale
bar: 100 µm. (D-J) Show higher magnifications of the boxes in (A-C), which show the expression and
subcellular localization of MEF2D in the different layers of the developing cortex. Scale bar: 10 µm.
(K-M) Show MEF2D expression in the postnatal and adult cortex. The six different layers of the cortex can
be distinguished and are referred as L1/2, L3, L4, L5 and L6. Scale bar: 100 µm. (N-P) Show higher
magnification of boxes shown in (K-M), which show the subcellular localization of MEF2D in the postnatal
and adult cortex. Scale bar: 10 µm. The pictures are representative for cells in the area.
18 6. Discussion
In this study we validated three HPA antibodies against rat embryonic MEF2D.
Subsequently, we have analyzed the spatial-temporal expression and subcellular
localization of MEF2D in rat embryonic and adult cortex and DRGs. The techniques used
for the validation were immunohistochemistry and Western blot. Immunohistochemistry
was also used for the expression profiling of MEF2D in addition to real-time PCR.
There are different techniques for the detection of protein expression and mRNA
expression in tissues including immunohistochemistry, Western blot, real-time PCR and in
situ hybridization. Considering that both expression pattern and subcellular localization of
MEF2D protein was of interest, immunohistochemistry was a relevant technique to use.
MEF2D mRNA in embryonic brain was determined by real-time PCR. In real-time PCR,
the expression of the housekeeping gene must be stable in every sample to have a reliable
normalized expression. Since the gene expression is not stable during development, the
expression of GAPDH as a housekeeping gene may have not been stable in the samples.
This may have affected the normalized expression of MEF2D mRNA relative to GAPDH
negatively. Therefore, other techniques as in situ hybridization could have been used
instead of real-time PCR.
The three HPA antibodies used in the study were generated against human MEF2D with
high homology across mammals within the framework of Human Protein Atlas program
(23). The antibodies are polyclonal and two of them recognize the same epitope
(HPA007068 and HPA007114), while the third one recognizes a different epitope. Still, all
epitopes are located in the transactivation domain of MEF2D. All three antibodies showed
almost identical immunohistochemcal staining in the rat embryonic tissues, which indicates
mono-specificity and that all three could be used for the detection of MEF2D in tissues. In
the Western blot analysis, all three antibodies immunoreacted with a protein of the
expected molecular weight (56kDa). These results suggest that all three antibodies
recognize MEF2D. However, an additional band with lower molecular weight was detected
by HPA007068, which is directed against the same epitope as HPA007114. This band
could indicate a cleaved form of MEF2D, which has been previously described (12). The
third antibody did not recognize MEF2D in the cytoplasmic fraction of PC12 cell line. An
explanation for this could be that this antibody is directed against a different epitope than
19 the others. Posttranslational modifications as phosphorylation (13–15) in this epitope could
cause conformational changes and block the binding epitope. In order to establish these
results, the Western blot should be repeated and other methods such as
immunoprecipitation or gene knockdown for the determination of antibody specificity
should be performed. HPA007068 was chosen as primary antibody in the study as it also
detected an additional band in the Western blot analysis, suggesting that this antibody
detects both cleaved and uncleaved MEF2D.
Immunohistochemistry staining with these antibodies showed expression of MEF2D in
different organs, including the nervous system in the embryonic tissues. The nervous
system is divided into the CNS and PNS, which arise from different cells. The expression
pattern of MEF2D in DRGs, which is a part of PNS and within the cortex, which is a
component of CNS, was similar throughout embryonic development. Neurogenesis is
initiated at E11.5 in developing mice and continues till E18-E20 (24). At E12.5, when the
neurogenesis has already begun, MEF2D was highly expressed in the entire nervous system
and the expression decreased progressively during embryonic development. As the
expression of MEF2D decreased during development, the numbers of differentiated
neurons increased in the developing cortex.
Cortical neurons are born through asymmetric division of NSCs in the VZ. They are
committed to their fate already in the VZ, before migrating (25,26). This means that before
the cells enter CP and differentiates to a specific type of cell that could form a layer of
cortex; they are predestined to what cells they will become and which layer they will form.
Since E15- E16 is the middle of the rat corticogenesis (27,28), the cells that form the
deepest layers of developing cortex are already produced at this time. Because MEF2D is
expressed in the entire developing cortex at E12.5 it may be required for the specification
of the neurons that could form the deepest layers of cortex. The reduction of MEF2D
expression in VZ/IZ at E14.5 may indicate that most of the cells that form the deepest
layers of cortex are already produced and MEF2D is not required in the same extent in the
VZ, but it drives and determines how the cortex develops. This theory is supported by the
fact that MEF2D is no longer expressed in the VZ at E18.5; when the cells for deepest
layers of cortex are already produced. The migrating neurons in the IZ, which are the newly
born neurons, and the neurons in the superficial layer of CP, which are the last neurons to
reach the CP do not express MEF2D at this stage either. These observations may indicate
20 that these neurons that do not express MEF2D at E18.5 could be the neurons forming the
superficial layers of cortex. Whereas the neurons that expressed MEF2D during earlier
embryonic stages were the neurons forming the deeper layers of cortex.
The expression of MEF2D in the VZ/IZ at E12.5/E14.5 also suggests a role of this
transcription factor in migration and survival of the newborn neurons. During development,
the neurons require different types of stimuli, signals to survive (29). These signals regulate
MEF2D activity (9,10) and promote survival in both sensory neurons and neurons in the
CNS. A hypothesis for why MEF2D is only expressed in the nuclei of differentiated
neurons in the IZ and CP could be that it is required for these neurons to survive during
migration till they reach their target. The high expression of MEF2D in sensory neurons by
E12.5 and E14.5 could also be due to that MEF2D is required for the survival of newly
born neurons, since shortly after neurogenesis different types of sensory neurons are
produced.
After birth, the VZ and IZ disappear and the different layers of cortex can be distinguished.
At P8, neuronal migration is completed and the neurons that form the different layers of
cortex have reached their destination (27). At P5 MEF2D was mostly expressed in the
nucleus of cells in layer VI, V and also layer IV. This observation further supports the
assumed role of MEF2D in proliferation, differentiation and migration of cells in the deeper
layers of cortex. The cells in the more superficial layers of cortex do not express MEF2D,
which in turn also supports the idea that the cells that form upper layers of cortex do not
need MEF2D for proliferation or differentiation. Subsequently in the P19 and adult cortex
the expression of MEF2D is down regulated in the deeper layers of cortex. In these stages
MEF2D is no longer nuclear and the subcellular localization is mainly cytosolic, which was
also observed in the adult DRGs. Also previous data from immunocytochemistry
performed by our group and the western blot results showed localization of MEF2D in both
cytoplasm and nucleus of PC12 cell line.
Since MEF2D becomes mainly cytosolic in the adult DRGs and cortex, it is possible that
MEF2D is not needed in the same extent in the nucleus anymore. Since the neurons have
already differentiated, migrated and survived the embryonic development, the nucleus
sends MEF2D out for degradation by CMA in the cytosol (20). Another explanation for
this localization could be the importance of MEF2D in the mitochondrial gene expression
21 (21). More study about MEF2D and its role in sensory neurons and cortex formation during
embryonic development is required to answer these questions. It would be interesting to
analyze the expression profiling and subcellular localization of MEF2D in the nervous
system in all embryonic days after E11.5 and postnatal days to capture the date when
MEF2D is down regulated and the expression becomes cytosolic to find an explanation for
the down regulation and the localization.
The limitations of the current study are limited repeats which leads to lack of statistics, lack
of tissues for the postnatal DRGs and the unavailability of a high-resolution microscope to
improve the results seen with the fluorescence microscope. We were not able to do
statistics because the number of samples and experiments were too few. However, we have
three different methods that all show the same result. Western blot supports that MEF2D is
localized in both nucleus and cytoplasm and real-time PCR supports the expression
profiling observed in the immunohistochemistry in the brain. Despite the limitations, the
main aim of the study, which was to analyze the expression profiling and subcellular
localization of MEF2D during development, was achieved.
In summary, MEF2D is expressed in the nuclei during embryonic development, whilst after
birth it becomes also cytosolic. This could suggest a role of MEF2D in proliferation,
differentiation and survival of neurons. However to be able to determine the role of
MEF2D in the development of the cortex more in vitro and in vivo studies must be
performed. Birth-dating experiments as 3H-Thymidine injections into developing brain
could show when cells are born and to which layer they migrate. Knockout studies of
MEF2D during embryonic development in the cortex could also show which role MEF2D
has in the development of deeper layers of cortex.
22 7. Acknowledgments
23 8. References
1.
Purves Dale, Augustine J. George, Fitzpatric David, Hall C. William, LaMantia
Anthony-Samuel, McNamara O. James WEL. Neuroscience. 4th ed. Sunderlands,
MA U.S.A; 2008. p. 857.
2.
Angevine JB Jr SR. Autoradiographic study of cell migration during histogenesis of
cerebral cortex in the mouse. Nature. 1961;192:766–8.
3.
Yu YT, Breitbart RE, Smoot LB, Lee Y, Mahdavi V, Nadal-Ginard B. Human
myocyte-specific enhancer factor 2 comprises a group of tissue-restricted MADS
box transcription factors. Genes & Development. 1992 Sep 1;6(9):1783–98.
4.
Gossett LA, Kelvin DJ, Sternberg EA, Olson EN. A New Myocyte-Specific
Enhancer-Binding Factor That Recognizes a Conserved Element Associated with
Multiple Muscle-Specific Genes. Molecular and cellular biology. 1989;9(11):5022–
33.
5.
Lyons GE, Micales BK, Schwarz J, Martin JF, Olson EN. Expression of mef2 genes
in the mouse central nervous system suggests a role in neuronal maturation.
Neuroscience. 1995 Aug;15(8):5727–38.
6.
Edmondson DG, Lyons GE, Martin JF, Olson EN. Mef2 gene expression marks the
cardiac and skeletal muscle lineages during mouse embryogenesis. Development.
1994 May;120(5):1251–63.
7.
Lam BYH, Chawla S. MEF2D expression increases during neuronal differentiation
of neural progenitor cells and correlates with neurite length. Neuroscience letters.
2007 Nov 12;427(3):153–8.
8.
Mao Z. Neuronal Activity-Dependent Cell Survival Mediated by Transcription
Factor MEF2. Science. 1999 Oct 22;286(5440):785–90.
9.
Pazyra-Murphy MF, Hans A, Courchesne SL, Karch C, Cosker KE, Heerssen HM,
et al. A retrograde neuronal survival response: target-derived neurotrophins regulate
MEF2D and bcl-w. neuroscience. 2009 May 20;29(20):6700–9.
10.
Shalizi A, Lehtinen M, Gaudilliere B, Donovan N, Han J, Konishi Y, et al.
Characterization of a neurotrophin signaling mechanism that mediates neuron
survival in a temporally specific pattern. Neuroscience. 2003 Aug 13;23(19):7326–
36.
11.
Wang X, Tang X, Li M, Marshall J, Mao Z. Regulation of neuroprotective activity of
myocyte-enhancer factor 2 by cAMP-protein kinase A signaling pathway in neuronal
survival. The Journal of biological chemistry. 2005 Apr 29;280(17):16705–13.
12.
Li M, Linseman D a, Allen MP, Meintzer MK, Wang X, Laessig T, et al. Myocyte
enhancer factor 2A and 2D undergo phosphorylation and caspase-mediated
24 degradation during apoptosis of rat cerebellar granule neurons. Neuroscience. 2001
Sep 1;21(17):6544–52.
13.
Gong X, Tang X, Wiedmann M, Wang X, Peng J, Zheng D, et al. Cdk5-mediated
inhibition of the protective effects of transcription factor MEF2 in neurotoxicityinduced apoptosis. Neuron. 2003 Apr 10;38(1):33–46.
14.
Tang X, Wang X, Gong X, Tong M, Park D, Xia Z, et al. Cyclin-dependent kinase 5
mediates neurotoxin-induced degradation of the transcription factor myocyte
enhancer factor 2. Neuroscience. 2005 May 11;25(19):4823–34.
15.
Grégoire S, Tremblay AM, Xiao L, Yang Q, Ma K, Nie J, et al. Control of MEF2
transcriptional activity by coordinated phosphorylation and sumoylation. The Journal
of biological chemistry. 2006 Feb 17;281(7):4423–33.
16.
Flavell SW, Cowan CW, Kim T-K, Greer PL, Lin Y, Paradis S, et al. Activitydependent regulation of MEF2 transcription factors suppresses excitatory synapse
number. Science. 2006 Feb 17;311(5763):1008–12.
17.
Shalizi A, Gaudillière B, Yuan Z, Stegmüller J, Shirogane T, Ge Q, et al. A calciumregulated MEF2 sumoylation switch controls postsynaptic differentiation. Science.
2006 Feb 17;311(5763):1012–7.
18.
Akhtar MW, Kim M-S, Adachi M, Morris MJ, Qi X, Richardson J a, et al. In vivo
analysis of MEF2 transcription factors in synapse regulation and neuronal survival.
PloS one. 2012 Jan;7(4):e34863.
19.
Kato Y, Zhao M, Morikawa A, Sugiyama T, Chakravortty D, Koide N, et al. Big
mitogen-activated kinase regulates multiple members of the MEF2 protein family.
The Journal of biological chemistry. 2000 Jun 16;275(24):18534–40.
20.
Francisco S, Wood WB, River S, Mazur E, Hayes J, Simon H. Regulation of
Neuronal. Science. 2009;(January):124–7.
21.
She H, Yang Q, Shepherd K, Smith Y, Miller G, Testa C, et al. Direct regulation of
complex I by mitochondrial MEF2D is disrupted in a mouse model of Parkinson
disease and in human patients. Clinical investigation. 2011;121(3).
22.
Bradford MM. A rapid and sensitive method for the quantitation of microgram
quantities of protein utilizing the principle of protein-dye binding. Analytical
biochemistry. 1976 May 7;72:248–54.
23.
Uhlén M, Björling E, Agaton C, Szigyarto CA-K, Amini B, Andersen E, et al. A
human protein atlas for normal and cancer tissues based on antibody proteomics.
Molecular & cellular proteomics  : MCP. 2005 Dec;4(12):1920–32.
24.
Luskin MB, Pearlman a L, Sanes JR. Cell lineage in the cerebral cortex of the mouse
studied in vivo and in vitro with a recombinant retrovirus. Neuron. 1988
Oct;1(8):635–47.
25 25.
Reznikov KY. Anatomy and Embryology Mosaicism of the ventricular layer as the
developmental basis of neocortical columnar organization A 3H-thymidine
autoradiographic study in newborn mice. Anatomy and embryology. 1984;99–105.
26.
Rakic P. Neurins in Rhesus Monkey Visual Cortex: systemic relation between time
of origin and aventual disposition. Science. 1974;183:425–7.
27.
Walsh C, Cepko CL. Clonally Related Cortical Cells Show Several Migration
Patterns. Science. 1983;13–6.
28.
Arimatsu Y, Miyamoto M, Nihonmatsu I, Hirata K, Uratani Y, Hatanaka Y, et al.
Early regional specification for a molecular neuronal phenotype in the rat neocortex.
Proceedings of the National Academy of Sciences of the United States of America.
1992 Oct 1;89(19):8879–83.
29.
Alun M. davies HT& Y-A. Different factors from the central nervous sysytem and
periphery regulate the survivaö of sensory neurons. Nature. 1986;319:497–9.
26