Microbiology (2010), 156, 2354–2365
DOI 10.1099/mic.0.035956-0
Morphological differentiation and clavulanic acid
formation are affected in a Streptomyces
clavuligerus adpA-deleted mutant
M. Teresa López-Garcı́a,1,2 Irene Santamarta1,2 and Paloma Liras1,2
Correspondence
1
Paloma Liras
paloma.liras@unileon.es
2
Received 29 October 2009
Revised
3 May 2010
Accepted 5 May 2010
Área de Microbiologı́a, Facultad de Ciencias Biológicas y Ambientales, Universidad de León,
24071 León, Spain
Instituto de Biotecnologı́a, INBIOTEC, Parque Cientı́fico de León, Avda. Real no 1, 24006 León,
Spain
The TTA codon-containing adpA gene of Streptomyces clavuligerus, located upstream of ornA, is
in a DNA region syntenous with the homologous region of other Streptomyces genomes. Deletion
of adpA results in a medium-dependent sparse aerial mycelium formation and lack of sporulation.
Clavulanic acid formation in this mutant decreases to about 10 % of the wild-type level depending
on the medium, whereas its production is strongly stimulated by increasing the adpA copy
number. Quantitative transcriptional analysis indicates that expression of the clavulanic acid
regulatory genes ccaR and claR decreases seven- and fourfold, respectively, in the DadpA
mutant, resulting in a large decrease in expression of genes encoding biosynthesis enzymes for
the early steps of clavulanic acid formation and a smaller decrease in the expression of genes for
the late steps of the pathway. An ARE box, 59-TCTCATGGAGACATAGCGGGGCATGC-39, is
present upstream of adpA and efficiently binds S. clavuligerus Brp protein, as shown by
electrophoretic mobility shift assay (EMSA) analysis. The transcription level of adpA is higher in
the absence of Brp, as shown in S. clavuligerus Dbrp, suggesting a connection between adpA
expression and the c-butyrolactone system in S. clavuligerus.
INTRODUCTION
Streptomycetes are of particular interest as producers of a
variety of well-known enzymes and secondary metabolites
of commercial value, such as antibiotics, anti-tumour
agents, immunosuppressors and enzyme inhibitors. Secondary metabolite production is specifically regulated at
several levels of control, involving a regulatory network
with different degrees of complexity. In some cases the
regulatory network affects the production of one of the
antibiotics produced by the strain, while in other cases the
production of several antibiotics along with morphological
development is affected.
A well-characterized regulatory cascade of Streptomyces
griseus controls morphological and biochemical differentiation to secondary metabolism (Ohnishi et al., 2005). Afactor, a microbial hormone active at about 100 nM
concentration, binds the cytoplasmic receptor protein
ArpA and releases it from specific DNA sequences named
ARE boxes. An ARE box, located upstream of the
pleiotropic regulator gene adpA, is responsible for the
negative control exerted by ArpA on adpA expression.
Derepression of adpA results in the formation of AdpA, a
Abbreviation: EMSA, electrophoretic mobility shift assay.
2354
member of the AraC/XylS-type regulatory protein subfamily, which activates a gene regulon. This includes genes
(adsA, ssgA) for morphogenesis and spore formation
(Yamazaki et al., 2000, 2003), and for chymotrypsin,
trypsin, serine proteases and metalloendopeptidases (sprA,
B, D, T, U; sgmA) (Kato et al., 2002, 2005; Tomono et al.,
2005b) with multiple functions in cell development. In
addition, in S. griseus, AdpA activates expression of
pathway-specific regulatory genes (strR, griR), triggering
streptomycin and grixazone biosynthesis and resistance
(Higashi et al., 2007; Tomono et al., 2005a). Genes
belonging to the AdpA regulon possess, upstream of their
promoters, specific AdpA-binding sequences, such as 59TGGCSNGWWY-39 in S. griseus, where S5G/C, W5A/T,
Y5T/C and N is any nucleotide (Ohnishi et al., 2005;
Yamazaki et al., 2004).
In the model micro-organism Streptomyces coelicolor,
adpAc (previously bldH) is not essential for undecylprodigiosin production but is required for actinorhodin
formation (Takano et al., 2003). In addition, adpAc is
normally expressed in butyrolactone non-producing scbAand scbR-disrupted mutants (ScbR being orthologous to
ArpA and Brp in S. griseus and Streptomyces clavuligerus,
respectively). Therefore, ArpA control over adpA expression appears to be different in S. coelicolor. The lack of
Downloaded from www.microbiologyresearch.org by
035956 G 2010 SGM
IP: 78.47.19.138
On: Sat, 01 Oct 2016 03:37:31
Printed in Great Britain
The adpA gene of Streptomyces clavuligerus
antibiotic production and sporulation by adpA-negative
mutants of Streptomyces ansochromogenes has been related
to the presence of multiple AdpA-binding sites in the
upstream region of sanG, a gene encoding the specific
activator protein for nikkomycin production (Pan et al.,
2009).
All adpA genes contain a TTA codon translated in
Streptomyces by the rare bldA-encoded tRNAleu (Chater &
Chandra, 2008; Lawlor et al., 1987). TTA codons are
present in many antibiotic-specific regulators, which
explains the non-producing phenotype of S. coelicolor
bldA mutants (Fernández-Moreno et al., 1991; White &
Bibb, 1997). The inability to translate adpA also explains
the bald phenotype of the S. coelicolor bldA mutant
(Nguyen et al., 2003; Takano et al., 2003), in which aerial
mycelium formation is restored by complementation with
a TTA-free adpA gene (Nguyen et al., 2003).
In S. clavuligerus, cephamycin C and clavulanic acid
production are activated by the CcaR regulator (PérezLlarena et al., 1997). CcaR formation is modulated by
regulatory proteins such as Brp, a butyrolactone receptor
protein, and AreB, an IclR-like protein that connects
primary and secondary metabolism (Santamarta et al.,
2005, 2007). In addition, clavulanic acid production is
specifically activated by ClaR, a regulator under CcaR
control (Paradkar & Jensen, 1998; Pérez-Redondo et al.,
1999).
In this paper we report that S. clavuligerus AdpA is part of a
regulatory cascade that controls antibiotic production
and study whether its involvement in biochemical and
morphological differentiation is similar to that found in S.
griseus.
METHODS
Bacterial strains, plasmids and culture conditions. The bacterial
strains and plasmids used in this study are listed in Table 1.
Escherichia coli strain DH5a was maintained on Luria broth agar
plates (Sambrook et al., 1989) and grown in Luria broth liquid
medium at 37 uC. Cultures of plasmid-bearing cells were supplemented with ampicillin (50 mg ml21), chloramphenicol (25 mg ml21),
kanamycin (25 mg ml21) or apramycin (50 mg ml21) as appropriate.
E. coli Ess22-35 and Klebsiella pneumoniae ATCC 29665 were used in
cephamycin C and clavulanic acid bioassays, respectively (Liras &
Martı́n, 2005).
S. clavuligerus ATCC 27064 and S. clavuligerus mutant strains were
maintained on 2 % agar TSB medium (30 g l21 tryptic casein soy
Table 1. Bacterial strains and plasmids used in this study
Strain or plasmid
Strains
S. clavuligerus
S. clavuligerus
S. clavuligerus
S. clavuligerus
ATCC 27064
DadpA
DbldA
DadpA [pCPA2]
S. clavuligerus pMS83
S. clavuligerus pIJ699
S. clavuligerus pIJadpA
E. coli ET12567
E. coli ET12567(pUZ8002)
E. coli Ess22–31
E. coli DH5a
E. coli pGEX2T-brp
K. pneumoniae ATCC 29665
Plasmids
pBluescript II KS(+)
pTC192-Km
pIJ773
pIJ699
pMS83
pIJadpA
pDadpA
pPadpA
pCPA2
Relevant features*
Wild-type; cephamycin C and clavulanic acid producer
adpA-deleted mutant
bldA-deleted mutant
adpA-deleted mutant complemented with adpA and its own
promoter region
Wild-type strain containing the integrative vector pMS83
Wild-type strain transformed with the multi-copy vector pIJ699
Wild-type strain transformed with pIJadpA
Methylation-deficient
Methylation-deficient; transfer functions from pUZ8002
b-Lactam antibiotic-supersensitive
General cloning host
Brp protein heterologous expression host
Indicator strain for clavulanic acid bioassay
E. coli general cloning vector; Ampr
pUC19-derived vector containing Kan-resistance gene (aphII)
from Tn5 transposon
Aprr cassette in pIJ699
Multi-copy Streptomyces vector containing Thio-resistance gene
Integrative vector used for adpA-deleted mutant complementation.
adpA and its promoter region in pIJ699
adpA : : acc-inactivation construct
adpA and its promoter region (448 bp) in pBluescript II KS(+)
adpA genetic complementation vector
Reference or source
ATCCD
This study
Trepanier et al. (2002)
This study
This study
This study
This study
Kieser et al. (2000)
Kieser et al. (2000)
Romero et al. (1984)
Stratagene
Santamarta et al. (2005)
Romero et al. (1984)
Stratagene
Rodrı́guez-Garcı́a et al. (2006)
Gust et al. (2003)
Kieser & Melton (1988)
M. Smith, University of Aberdeen
This study
This study
This study
This study
*Amp, ampicillin; Apr, apramycin; Kan, kanamycin; Thio, thiostrepton.
DATCC, American Type Culture Collection.
http://mic.sgmjournals.org
Downloaded from www.microbiologyresearch.org by
IP: 78.47.19.138
On: Sat, 01 Oct 2016 03:37:31
2355
M. T. López-Garcı́a, I. Santamarta and P. Liras
broth) at 28 uC. ME medium, containing (in g l21) MOPS (21),
glucose (5), yeast extract (0.5), meat extract (0.5), caseine peptone
(1), agar (20), pH 7.0 (Sánchez & Braña, 1996), or TBO medium,
containing (in g l21) tomato paste (20), oat flakes (20), agar (20),
pH 6.5 (Higgens et al., 1974), were used to test the morphological
differentiation and spore formation ability of Streptomyces mutant
strains when compared with the wild-type strain. For antibiotic
production studies and transcriptional analysis, SA defined or TSB
complex medium was used (Lorenzana et al., 2004; Paradkar &
Jensen, 1998). Strains were grown in 500 ml baffled flasks containing
100 ml TSB medium at 28 uC and 220 r.p.m. for 24 h. Five millilitres
of the culture were harvested, and the mycelium was washed with
0.9 % NaCl and used to inoculate SA medium. Triplicate cultures
were incubated at 28 uC and 250 r.p.m. The growth rate was
determined by measuring the DNA concentration using the
diphenylamine reaction (Burton, 1968).
Construction of pJadpA to amplify the copy number of adpA.
Nucleic acid manipulations. General DNA manipulations were
performed using standard techniques (Sambrook et al., 1989).
Streptomyces genomic and plasmid DNA preparations, S. clavuligerus
conjugation with E. coli ET1257/pUZ8002 as donor strain, and
Streptomyces protoplast transformation were done following standard
methods (Kieser et al., 2000). Nucleic acid hybridizations were
performed following the DIG system protocol (Roche), and
colorimetric detection was carried out with nitro blue tetrazolium
(NBT) and 5-bromo-1-chloro-3-indolyl phosphate (BCIP).
Immunodetection of ApdA
RNA samples from S. clavuligerus strains were prepared using RNeasy
Mini spin columns (Qiagen), as previously described by Santamarta
et al. (2005), and treated with DNase I (Qiagen) and Turbo DNase
(Ambion) to eliminate chromosomal DNA contamination. PCR
and RT-PCR were performed in a T-gradient (Biometra) thermocycler. Plasmids and oligonucleotides used in this work are shown in
Tables 1 and 2, respectively.
Plasmid construction
Construction of pDadpA for adpA deletion. DNA fragments
upstream (UP-adpA, 1983 bp) and downstream (D-adpA, 2267 bp)
of adpA were amplified by PCR using oligonucleotides UpadpA-O1
and UpadpA-O2, and DWadpA-O1 and DWadpA-O1, respectively.
Once sequenced, fragment UP-adpA was subcloned into the EcoRV
site of pBluescriptII KS to form pUP-adpA. The apramycin-resistance
cassette from pIJ773, containing the origin for conjugation (oriT) and
the apramycin-resistance gene, was ligated into a filled blunt HindIII
site of pUP-adpA, to obtain the vector pU : aac; the PCR-amplified DadpA fragment was subcloned into a filled blunt ClaI site of vector
pU : aac to give plasmid pU : acc:D in such a way that the apramycinresistance gene was expressed divergently from the ornA gene. After
SpeI linearization, pU : acc:D was ligated to the 1.4 kb XbaI DNA
fragment containing the aphII gene for kanamycin resistance, isolated
from plasmid pTC192-Km, leading to plasmid pDadpA. This plasmid was conjugated into S. clavuligerus, and apramycin-resistant
transconjugants were subjected to sporulation on solid soy-mannitol
medium in the absence of antibiotic and then plated onto antibioticsupplemented medium. Apramycin-resistant kanamycin-sensitive
gene adpA-replacement mutants were confirmed by Southern
hybridization.
Construction of pCPA2 to complement S. clavuligerus DadpA. The
adpA gene with its own promoter (1580 bp) was PCR-amplified using
oligonucleotides PadpA-O1 and PadpA-O2. The amplified fragment
was subcloned into the EcoRV site of pBluescriptII KS, giving pPadpA.
PvuII digestion of pPadpA produced a 2034 bp fragment that was
ligated into the EcoRV site of pMS83, leading to pCPA2. Plasmid
pMS83 derives from pMS82 and uses the integration site for
Streptomyces phage WBT1 (Gregory et al., 2003).
2356
The adpA gene with its own promoter was amplified using
oligonucleotides PadpA-O1 and PadpA-O2. The amplified and
sequenced fragment was subcloned in the DraI site of the highcopy-number plasmid pIJ699, producing plasmid pIJadpA, used to
overexpress adpA in S. clavuligerus.
Mobility shift assays. The AREadpA-containing probe was isolated as
a 448 bp AvaI fragment from plasmid pIJadpA. Once labelled with
DIG-11-dUTP (DIG Gel Shift kit, 2nd generation, Roche) for
chemiluminiscence detection it was applied to DNA-binding assays
using pure rBrp protein (0.5 mg) (Santamarta et al., 2005). Once
electrophoretic mobility shift assays (EMSAs) had been performed
(Santamarta et al., 2007), gels were transferred in 0.56 TBE buffer to
Hybond-N+ membranes (GE Healthcare) and developed for
detection of DIG-11-dUTP-labelled fragments.
Generation of antibodies. A peptide corresponding to amino acids
385–399 of the AdpA sequence (NH2-CAGHGRPSLPGQRSAPCOOH) was commercially synthesized (NeoMPS, Strasbourg,
France). To raise polyclonal antibodies, the peptide (3 mg) was
resuspended in 1 ml PBS (pH 7.5) and thoroughly mixed with
Freund’s complete adjuvant. The solution was injected subcutaneously at multiple sites in New Zealand rabbits. The injections
were repeated after 2 and 4 weeks using 1 mg peptide only. A blood
sample was taken 1 week after the final injection. After allowing the
blood to clot at room temperature, the serum was collected by
centrifugation and stored at –20 uC until further use. To purify
antibodies, the immunizing peptide was coupled to CNBr-activated
Sepharose 4B according to the supplier’s instructions. The serum was
passed through the affinity column and washed with PBS (pH 7.5).
Antibodies were eluted by washing the column with 0.1 M glycine
(pH 3.0) and collected fractions (1 ml) were immediately neutralized
by the addition of 1 M Tris and stored at –20 uC until use.
Western-blotting assays. AdpA was immunodetected in S.
clavuligerus cell-free protein extracts as follows. Mycelium from a
36 h culture was washed with and resuspended in lysis buffer (10 mM
Tris/HCl, 1 mM EDTA, pH 7.5). After disruption by sonication, cell
debris was removed by centrifugation at 4 uC and 14 000 r.p.m. for
30 min. Samples (5 mg protein) were electrophoretically separated by
12 % SDS-PAGE and blotted to a PVDF membrane (Immobilon-P,
Millipore) for inmunodetection using an alkaline phosphataseconjugated anti-rabbit secondary antibody.
PCR, RT-PCR analysis and real-time RT-PCR. Total DNA of S.
clavuligerus was used to amplify: (i) the complete adpA ORF
(1206 bp) using oligonucleotides adpA-O1/adpA-O2; (ii) adpA
downstream (2267 bp) and upstream (1983 bp) regions using
DWadpA-O1/DWadpA-O2 and UpadpA-O1/UpadpA-O2, respectively; (iii) a fragment containing the adpA promoter region and
ORF using the oligonucleotides PadpA-O1/adpA-O2. Every PCR
(20 ml) was performed as described by Kieser et al. (2000) and
contained 300 ng DNA template, 0.5 mM each oligonucleotide,
28 mM each dGTP and dCTP, 12 mM each dATP and dTTP, 1 mM
MgCl2, 5 % DMSO and 0.8 U Platinum Pfx DNA Polymerase
(Invitrogen). With small variations of annealing temperature, the
PCR program was as follows: after the first step at 95 uC for 30 s, the
annealing temperature was reduced in a touch-down of 1 uC from 65
to 58 uC in one cycle, and an annealing temperature of 58 uC was
used in the next 25 cycles with an extension step of 2 min at 72 uC.
The PCR products were confirmed for size and purity by agarose gel
electrophoresis, isolated from the gel using the Qiagen II DNA
Cleanup System (Qiagen) and sequenced.
Downloaded from www.microbiologyresearch.org by
IP: 78.47.19.138
On: Sat, 01 Oct 2016 03:37:31
Microbiology 156
The adpA gene of Streptomyces clavuligerus
Table 2. Oligonucleotide pairs used in this study
Oligonucleotide
adpA-O1
adpA-O2
DWadpA-O1
DWadpA-O2
UpadpA-O1
UpadpA-O2
adpA-O3
adpA-O4
adpA-ornA-O1
adpA-ornA-O2
bls2-O1
bls2-O2
brp-O1
brp-O2
brp-O3
brp-O4
car-O1
car-O2
car-O3
ccaR-O1
ccaR-O2
ccaR-O3
ccaR-O4
ceaS2-O1
ceaS2-O2
ceaS2-O3
ceaS2-O4
claR-O1
claR-O2
claR-O3
claR-O4
cas2-O1
cas2-O2
cas2-O3
cas2-O4
cyp-fd-O1
cyp-fd-O1
cyp-O3
cyp-O4
gcaS-O1
gcaS-O2
gcaS-O3
gcaS-O4
hrdB-O1
hrdB-O2
oat2-O1
oat2-O2
oat2-O3
oat2-O4
oppA1-O1
oppA1-O2
oppA2-O1
oppA2-O2
oppA2-O3
oppA2-O4
orf12-O1
http://mic.sgmjournals.org
Sequence (5§A3§)
Description
GGATCCATGAGTCAGGACTCCGC
TTATGGCGCGCTCCGCTG
GTGCTCGGCGAAGGGGTGGACA
CGGCAGTGCTCCGCTCCAGTG
GTACTCCCGGCCGACTTCCT
ATGCCCCGCTATGTCTCCA
GGCGGCCCCATTTTTGAGAGTTC
CGTGCCGGCCGAGGTGAGC
GGCCCTCGTCCGTCCCTCCTG
AGCCTTCCCCGGTTCCCTCACAT
GAGATCTACAACCGGGACGA
AGGTCATAGCGTTCCAGCAG
GGCGCTCTACTTCCACTTCGGT
CCAGCGCGGGCATCAGA
AGGGGGCGCTCTACTTCCACTTC
TCGCCTCATCGATCGCCTCCT
GCCGGGGCGAAGGTCCAT
ATCCGCTGCTCGTACATCTCCTT
GGTGTCGATCATCCGGGTCCAGT
CCGGGCCAGGTCATCTCC
CCGCGTAGTAGGCCTTCATCAG
TCGCGGACTCCATCGACCTCTT
GGCGGGCCCCTTCCACAG
TGGGGAAGGTGTTTGGGGTTGT
GGTTTCGCCGGGGTGTTCG
GCCGAGCGCCTGAACATCC
GCGGTCCACCGGGGCAACAT
GCCGGGCGGCGGTTCTTC
GCCCGGCCAGCTGGAAGACAC
CGGGCGGCGGTTCTT
TCGTCGAGCAGGGGTTCC
CGCAAGCGGCTGGTGATGGAG
GGTCGTTCGCGTCCCCGTAGAGC
GCAAGCGGCTGGTGATGG
GGTCTCCGAGGACAGGTAGTGC
GCTGTCGGCGGGCAACC
CGGGCACAGCTCGGCACAG
ACGAACTCGACGGCTATCTG
ACATCGGGACCATCTCCTC
GCCGGCCGCCTTCCTATG
GCAGCCGGTCCTTCTCGTTC
GGTCAACTGGAGCCTGTGTA
CCGCGAACTTGGCATAGTC
CGCGGCATGCTCTTCCT
AGGTGGCGTACGTGGAGAAC
GACGCCCCGGGGATTCGTGGT
TCGCCCCGCCGACGCTGA
CACCGTCCTCGCCTCCAC
CGTTCTCCTCGCCCTCCAG
CGGGGTACGGGGAGTGG
CGGAGGAAGTTCCAGGTGTA
CCCACGGGTTGCGGAAGT
CACCCAGCGGGGCAAGTT
GCAAGCGGCTGGTGATGG
GCAGTACGCGGCGGACAAGAT
GGCGATGGGGCTGCTGAC
Forward for adpA cloning
Reverse for adpA cloning
Forward for adpA downstream region
Reverse for adpA downstream region
Forward for adpA upstream region
Reverse for adpA upstream region
Forward for adpA RT-PCR
Reverse for adpA RT-PCR
Forward for intergenic region adpA–ornA RT-PCR
Reverse for intergenic region adpA–ornA RT-PCR
Forward for bls2 RT-PCR and quantitative RT-PCR
Reverse for bls2 RT-PCR and quantitative RT-PCR
Forward for brp RT-PCR
Reverse for brp RT-PCR
Forward for brp quantitative RT-PCR
Reverse for brp quantitative RT-PCR
Forward for car RT-PCR
Reverse for car RT-PCR and quantitative RT-PCR
Forward for car quantitative RT-PCR
Forward for ccaR RT-PCR
Reverse for ccaR RT-PCR
Forward for ccaR quantitative RT-PCR
Reverse for ccaR quantitative RT-PCR
Forward for ceaS2 RT-PCR
Reverse for ceaS2 RT-PCR
Forward for ceaS2 quantitative RT-PCR
Reverse for ceaS2 quantitative RT-PCR
Forward for claR RT-PCR
Reverse for claR RT-PCR
Forward for claR quantitative RT-PCR
Reverse for claR quantitative RT-PCR
Forward for cas2 RT-PCR
Reverse for cas2 RT-PCR
Forward for cas2 quantitative RT-PCR
Reverse for cas2 quantitative RT-PCR
Forward for cyp and fd RT-PCR
Reverse for cyp and fd RT-PCR
Forward for cyp quantitative RT-PCR
Reverse for cyp quantitative RT-PCR
Forward for gcaS RT-PCR
Reverse for gcaS RT-PCR
Forward for gcaS quantitative RT-PCR
Reverse for gcaS quantitative RT-PCR
Forward for hrdB quantitative RT-PCR
Reverse for hrdB quantitative RT-PCR
Forward for oat2 RT-PCR
Reverse for oat2 RT-PCR
Forward for oat2 quantitative RT-PCR
Reverse for oat2 quantitative RT-PCR
Forward for oppA1 RT-PCR and quantitative RT-PCR
Reverse for oppA1 RT-PCR and quantitative RT-PCR
Forward for oppA2 RT-PCR
Reverse for oppA2 RT-PCR
Forward for oppA2 quantitative RT-PCR
Reverse for oppA2 quantitative RT-PCR
Forward for orf12 RT-PCR and quantitative RT-PCR
Downloaded from www.microbiologyresearch.org by
IP: 78.47.19.138
On: Sat, 01 Oct 2016 03:37:31
2357
M. T. López-Garcı́a, I. Santamarta and P. Liras
Table 2. cont.
Oligonucleotide
orf12-O1
orf13-O1
orf13-O1
orf14-O1
orf14-O2
ornA-O1
ornA-O2
pah2-O1
pah2-O2
pah2-O1
pah2-O2
PadpA-O1
Sequence (5§A3§)
GTGCGCGACGGGGTGGTA
CTGCGCTGGCTGCTGGTGTA
CTGCCGCCGGGAGATGC
CGAACGACGACGAAACG
CGAGCGAGCCGACCATGT
GATCGACTGGAGATGACC
CACGATGTCCACCCCTTC
TCGACGCCGGGGACATCAAT
CCGCTGGCCGACCTTCTC
CCTACGACGGGGGCACCAG
TCATGTCGAACGGCGTCAGATTG
CCCATTGCGACGCTCGCAC
Gene expression analysis by RT-PCR and real-time RT-PCR was
performed as previously described by Santamarta et al. (2007).
Negative controls to confirm the absence of contaminating DNA on
RT-PCR amplification were carried out with each set of primers and
Platinum Taq DNA polymerase (Invitrogen). When real-time RTPCR was performed, controls were included using RNA to preclude
the amplification of chromosomal DNA. Relative quantification of
gene expression was performed by the 2{DDCt method.
cDNAs for real-time RT-PCR analysis were synthesized using
SuperScript III reverse transcriptase (Invitrogen). In total, 1 mg
RNA was annealed at 70 uC for 5 min with 250 pmol random
primers (Invitrogen) and 1 ml 10 mM dNTPs in a final volume of
14 ml. The mix was then supplemented with 4 ml 56 First-Strand
buffer, 1 ml 0.1 M DTT and 1 ml SuperScript III reverse transcriptase,
and kept at 25 uC for 5 min and 55 uC for 1 h. The retrotranscription
reaction was stopped by heating at 70 uC for 15 min. Real-time RTPCRs were carried out on a StepOnePlus thermocycler (Applied
Biosystems). Reactions contained 2 ml cDNA reaction mixture diluted
1 : 3, 10 ml SYBR Green PCR Master Mix (Applied Biosystems) and
300 nM specific primers in a volume of 20 ml, and were performed in
triplicate. The hrdB-like gene, encoding the major sigma factor in S.
coelicolor A3(2) (Aigle et al., 2000; Buttner et al., 1990), was used as an
Description
Reverse for orf12 RT-PCR and quantitative RT-PCR
Forward for orf13 RT-PCR and quantitative RT-PCR
Reverse for orf13 RT-PCR and quantitative RT-PCR
Forward for orf14 RT-PCR and quantitative RT-PCR
Reverse for orf14 RT-PCR and quantitative RT-PCR
Forward for ornA RT-PCR and quantitative RT-PCR
Reverse for ornA RT-PCR and quantitative RT-PCR
Forward for pah2 RT-PCR
Reverse for pah2 RT-PCR
Forward for pah2 quantitative RT-PCR
Reverse for pah2 quantitative RT-PCR
Forward for adpA and promoter region cloning
internal control to quantify the relative expression of the target genes.
PCR conditions were as follows: 2 min at 50 uC, 10 min at 90 uC, 30
cycles of 15 s at 95 uC, and 1 min at 60–64 uC, depending on the
primer pair. Specific product amplification was checked by the
melting curve and agarose gel electrophoresis. In parallel, control
PCRs were performed using RNA as template to preclude amplification of chromosomal DNA. Two biological replicates were employed
for each strain; the efficiencies of the primers were measured by serial
dilutions of genomic DNA as template.
RESULTS
Organization of the S. clavuligerus adpAcontaining DNA region
A 5 kb DNA sequence containing the adpA gene was
provided by DSM (Delft, The Netherlands). The DNA
sequence and ORFs present in the fragment (Fig. 1a) totally
coincide with those later published by the Broad Institute
and will be named with the published nomenclature.
Fig. 1. Organization of the adpA-carrying region in S. clavuligerus. (a) Gene organization of a 5 kb DNA fragment of S.
clavuligerus carrying the adpA gene. (b) Organization of the same region in S. clavuligerus DadpA mutants. (c) Pattern of
hybridization of AccI-, SalI- and SmaI-digested DNA from S. clavuligerus 27064 (1), S. clavuligerus DadpA1 (2) and S.
clavuligerus DadpA2 (3).
2358
Downloaded from www.microbiologyresearch.org by
IP: 78.47.19.138
On: Sat, 01 Oct 2016 03:37:31
Microbiology 156
The adpA gene of Streptomyces clavuligerus
S. clavuligerus adpA encodes a 399 amino acid protein with
84–88 % identity to those of S. griseus, Streptomyces
avermitilis and S. coelicolor. Like other AdpA orthologous
proteins, it possesses two helix–turn–helix motifs (amino
acids 238–280 and 286–330), characteristic of the AraC/
XylS family of proteins, a domain pfpI/DJ-1 (amino acids
55–193) for dimerization, and a UUA codon-translated
leucine residue (Leu223).
Upstream, divergent and separated from adpA by a 1.7 kb
non-coding region is SSCG_05478, which encodes a protein
of the universal stress family; 83 nt downstream of
SSCG_05478 and in the opposite orientation is located a
gene encoding a glutamine–D-fructose-6-phosphate amidotransferase. Downstream of adpA and separated by 10 nt is
SSCG_05473, encoding an oligoRNase with 88 % identity
to OrnA from S. coelicolor and S. griseus. Next to it,
SSCG_100047 encodes a tRNAHis, followed 823 nt downstream and in the opposite orientation by an incomplete ORF
(SSCG_05472) for a histidine kinase (Fig. 1a). Thus, there is a
considerable synteny between this S. clavuligerus DNA region
and the homologous ones in S. coelicolor and S. griseus.
To understand the effect of AdpA on morphological
differentiation and antibiotic production in S. clavuligerus,
we proceeded to disrupt the adpA gene by using plasmid
pDadpA. The plasmid was constructed to delete 151 bp of the
promoter region and 812 bp of the 59 end of adpA (Fig. 1b).
Plasmid pDadpA was transferred to S. clavuligerus by
conjugation and two of 28 recombinant colonies were
apramycin-resistant and kanamycin-sensitive. These exconjugants were analysed by Southern hybridization using a
1.2 kb DNA probe containing the whole adpA gene. The
hybridization pattern obtained (Fig. 1c) is consistent with the
deletion of the expected 963 bp region in both exconjugants,
which were named S. clavuligerus DadpA1 and DadpA2.
Morphological differentiation in S. clavuligerus
DadpA mutants depends on culture media
Growth, aerial mycelium formation and sporulation of S.
clavuligerus ATCC 27064 and the two DadpA mutants were
studied. In TBO medium, S. clavuligerus ATCC 27064
produced aerial mycelium after 3–4 days of growth, and the
characteristic grey-green colour of the spores was observed
after 7 days. Only a sparse aerial mycelium was developed by
the mutants after 10 days and no spores were formed even
after longer incubation times (Fig. 2c). However, in ME
medium, an excellent sporulation medium for S. clavuligerus
ATCC 27064, the DadpA mutants were able to form aerial
mycelium and to sporulate. Since the genetic characterization and morphological behaviour of both exconjugants
were identical (data not shown), all the work was performed
with exconjugant DadpA1, named S. clavuligerus DadpA.
Expression of ornA in S. clavuligerus
The ornA gene, located downstream of and in the same
orientation as adpA, is not essential in S. griseus and S.
http://mic.sgmjournals.org
Fig. 2. Characterization of S. clavuligerus DadpA. (a)
Amplification of the S. clavuligerus ATCC 27064 intergenic
adpA–ornA region using oligonucleotides adpA-ornA-O1 and
adpA-ornA-O2. Lanes: 1, positive PCR control with DNA as
template; 2, RT-PCR amplification of the intergenic region; 3, RTPCR negative control reaction lacking retrotranscriptase. (b) RTPCR amplification of ornA using oligonucleotides ornA-O1 and
ornA-O2 with S. clavuligerus ATCC 27064 (lane 4) and S.
clavuligerus DadpA (lane 5). M, molecular mass standard. In the
scheme below is shown the location of oligonucleotides adpAornA-O1 and adpA-ornA-O2 (marked ‘a’ and ‘b’) and ornA-O1
and ornA-O2 (marked ‘c’ and ‘d’). (c) Growth, aerial mycelium
formation and sporulation in TBO medium of S. clavuligerus ATCC
27064 (1), S. clavuligerus [pMS83] (2), S. clavuligerus DadpA (3)
and S. clavuligerus DadpA [pCPA2] (4).
coelicolor, although its deletion partially affects growth and
aerial mycelium formation (Ohnishi et al., 2000; Sello &
Buttner, 2008). The small (10 bp) adpA–ornA intergenic
region present in S. clavuligerus suggests that both genes are
transcriptionally coupled in this strain. To assess whether
this was the case, oligonucleotides adpA-ornA-O1 and
adpA-ornA-O2 were designed to amplify by RT-PCR a
407 bp fragment corresponding to the intergenic region. In
addition, oligonucleotides ornA-O1 and ornA-O2 were
used to detect ornA expression in S. clavuligerus DadpA, in
which the promoter and 59 end of adpA are deleted. RNA
samples were isolated from 24 h (TSB medium) and 40 h
(SA medium) cultures. The amplification fragment
obtained (Fig. 2a, lanes 1 and 2) with oligonucleotides
adpA-ornA-O1 and adpA-ornA-O2 confirmed that the two
genes are transcriptionally coupled in the wild-type strain.
In addition, an amplified fragment corresponding to an
ornA transcript was detected in the wild-type and the
DadpA mutant using oligonucleotides ornA-O1 and ornAO2 (Fig. 2b, lanes 4 and 5); this result confirms the
presence of an additional monocistronic ornA mRNA.
Real-time RT-PCR, using ornA-O1 and ornA-O2, was
performed to quantify the ornA expression level in the
wild-type strain and the DadpA mutant. The relative
expression value obtained for ornA in S. clavuligerus DadpA
SA cultures grown for 40 h was 0.148, which indicates a
decrease in expression of 6.7-fold in the mutant compared
with the wild-type strain (relative expression value of 1).
Downloaded from www.microbiologyresearch.org by
IP: 78.47.19.138
On: Sat, 01 Oct 2016 03:37:31
2359
M. T. López-Garcı́a, I. Santamarta and P. Liras
This decrease in ornA expression can be explained through
the loss of ornA transcripts initiated from the adpA
promoter.
Brp specifically binds the adpA promoter region
Brp is a butyrolactone receptor protein, homologous to S.
griseus ArpA, and acts as a negative modulator of antibiotic
biosynthesis in S. clavuligerus. It recognizes and binds ARE
boxes present in the ccaR and brp promoter regions
(Santamarta et al., 2005). Bioinformatic analysis and
comparison of the adpA promoter region with the
AREccaR and AREbrp boxes indicated the presence 149 bp
upstream of the adpA start codon of a putative ARE
sequence, 59-TCTCATGGAGACATAGCGGGGCATGC-39.
This sequence possesses stretches of identity with S.
clavuligerus AREccaR and AREbrp, and with the ARE boxes
of regulatory gene promoters of other Streptomyces species,
including the ArpA-binding sequence in the S. griseus adpA
promoter (Fig. 3a).
To determine Brp binding to the adpA promoter region,
the electrophoretic mobility of a 448 bp AREadpA-containing
fragment in the presence of S. clavuligerus r-Brp was tested
by EMSAs. In parallel, the binding to the AREbrp and
Fig. 3. An ARE box is present upstream of adpA. (a) Location of
the ARE box upstream of the adpA gene in S. clavuligerus.
Sequence of the AREadpA box and comparison with AREccaR and
AREbrp boxes of S. clavuligerus, as well as with ARE sequences
present upstream of S. griseus adpA, Streptomyces pristinaespiralis papR and Streptomyces virginiae barA. (b) Gel shift
electrophoresis of a 448 bp DNA fragment carrying the AREadpA
box using pure recombinant S. clavuligerus r-Brp protein (0.5 mg).
Lanes: 1, free probe; 2 and 3, 0.5–4 mg r-Brp; 4 and 5, sequencespecificity assay using one- and 10-fold amounts of unlabelled
probe; 6, sequence-specificity assay using 10-fold amounts of a
heterologous unlabelled 445 bp PvuII DNA fragment isolated from
pBSKSII.
2360
AREccaR boxes was tested. A clear mobility shift of the
AREadpA-containing probe was observed using increasing
amounts of r-Brp protein, as shown in Fig. 3(b), lanes 2 and
3. The binding specificity of Brp for this sequence was tested
through direct-competition reactions by increasing the
amounts of competitor probe, which resulted in a
progressively reduced signal of the shifted labelled
AREadpA-containing probe (Fig. 3b, lanes 4 and 5), and by
using a heterologous competitor probe that did not disturb
the specific binding (Fig. 3b, lane 6). Therefore, the AREadpA
sequence is functional and specifically binds Brp.
Real-time RT-PCR quantification of adpA expression was
performed in the wild-type strain and the S. clavuligerus
Dbrp mutant. A consistent slight increase of 2.65-fold in
adpA expression was observed in S. clavuligerus Dbrp
cultures grown for 24 h in TSB medium. This suggests that
Brp acts as a negative modulator of adpA expression in S.
clavuligerus, as occurs in S. griseus.
The translation of adpA is regulated by bldA
The TTA codon-containing adpA gene of S. coelicolor is not
translated in the S. coelicolor DbldA mutant (Nguyen et al.,
2003; Takano et al., 2003). To test whether the same occurs
with the TTA codon located in S. clavuligerus adpA,
the presence of the AdpA protein was analysed in S.
clavuligerus ATCC 27064, S. clavuligerus DadpA and S.
clavuligerus DbldA cell extracts through immunodetection
assays using anti-AdpA antibodies. Repeatedly, an AdpA
inmunodetection signal was observed in 36 h TSB cell-free
extracts of S. clavuligerus ATCC 27064 (Fig. 4a, lane 1),
while this band was not present in S. clavuligerus DadpA or
in S. clavuligerus DbldA cell extracts (Fig. 4a, lanes 2 and 3).
Fig. 4. Immunodetection of AdpA in S. clavuligerus ATCC 27064
and derived mutants. (a) Western blotting with anti-AdpA
antibodies of cell extracts (5 mg protein each) of S. clavuligerus
ATCC 27064 (1), S. clavuligerus DadpA (2) and S. clavuligerus
DbldA (3). (b) RT-PCR amplification of adpA (left) and PCR to
confirm the absence of contaminating DNA (right).
Oligonucleotides adpA-O3 and adpA-O4 were used on mRNA
from 24 h TSB cultures of S. clavuligerus ATCC 27064 (1) or S.
clavuligerus DbldA (2).
Downloaded from www.microbiologyresearch.org by
IP: 78.47.19.138
On: Sat, 01 Oct 2016 03:37:31
Microbiology 156
The adpA gene of Streptomyces clavuligerus
To confirm that this lack of AdpA protein in the DbldA
mutant was not due to lack of expression, amplification
analysis of adpA was performed by RT-PCR. RNA from
24 h TSB cultures of S. clavuligerus ATCC 27064 and the
DbldA mutant was retrotranscribed using primers adpA-O3
and adpA-O4. The amplification of a DNA fragment
corresponding to the adpA transcript in S. clavuligerus
DbldA (Fig. 4b, lanes 1 and 2), confirmed that the absence
of AdpA is due to lack of mRNA translation.
Clavulanic acid production is especially affected
in S. clavuligerus DadpA
Growth and antibiotic production by S. clavuligerus
ATCC 27064 and S. clavuligerus DadpA were analysed in
defined SA (Fig. 5, upper panels) and in complex TSB
media (Fig. 5, lower panels). Inactivation of adpA did not
have a significant effect on growth in either medium
(Fig. 5, left panels). Clavulanic acid production was
strongly reduced in S. clavuligerus Dadp to 14 % of the
wild-type level in TSB medium at 36 h and to 5 % at 60 h
in SA medium. Production of cephamycin C by the
DadpA mutant was almost at wild-type level in complex
TSB medium but decreased in SA medium after 36 h of
growth (Fig. 5, right panels). Both cephamycin C and
clavulanic acid were restored to control levels in S.
clavuligerus DadpA [pCPA2] (Fig. 6a), which carries the
adpA gene in the integrative plasmid pMS83. Introduction
of pCPA2 in the S. clavuligerus DadpA mutant also
restored aerial mycelium formation and sporulation in
TBO medium (Fig. 2c).
Multiple copies of adpA increase antibiotic
production levels in S. clavuligerus
To determine whether antibiotic production was affected
by increasing the adpA gene dosage, a DNA fragment
containing adpA with its own promoter was subcloned into
the multi-copy plasmid pIJ699, giving plasmid pIJadpA
(Table 1). Growth, cephamycin C and clavulanic acid
production of the transformant S. clavuligerus [pIJadpA]
and its control, S. clavuligerus [pIJ699], were analysed in
SA-grown cultures. The growth of both transformants was
reduced when compared with S. clavuligerus ATCC 27064,
probably due to the antibiotic added for plasmid selection.
However, production of cephamycin C and clavulanic acid
was clearly enhanced in the strain carrying multiple copies
of adpA (Fig. 6b). After 60 h of culture, clavulanic acid
production was of the order of 204 and 218 %, respectively,
compared with the control S. clavuligerus pIJ699.
Transcriptional analysis of genes involved in
clavulanic acid biosynthesis in an S. clavuligerus
DadpA mutant
Deletion of adpA in S. clavuligerus strongly affects
clavulanic acid production. To assess whether the pathway-specific regulators of clavulanic acid biosynthesis are
under AdpA control, ccaR and claR transcription was
analysed by RT-PCR in S. clavuligerus ATCC 27064 and in
S. clavuligerus DadpA (data not shown). Transcriptional
studies were performed using as template RNA samples
isolated after growth in SA medium for 40 h, at which
point the most drastic decrease in clavulanic acid
Fig. 5. Cephamycin and clavulanic acid production by S. clavuligerus DadpA. Growth (left panels), and production of
clavulanic acid (centre panels) and cephamycin C (right panels) by S. clavuligerus ATCC 27064 (open circles) and S.
clavuligerus DadpA (closed circles) grown in SA (upper panels) and TSB (lower panels) media.
http://mic.sgmjournals.org
Downloaded from www.microbiologyresearch.org by
IP: 78.47.19.138
On: Sat, 01 Oct 2016 03:37:31
2361
M. T. López-Garcı́a, I. Santamarta and P. Liras
Fig. 6. Complementation of the DadpA mutant and effect of additional copies of adpA in the control strain. (a)
Complementation of S. clavuligerus DadpA by the adpA-carrying pPCA2 integrative plasmid. Growth, and cephamycin C
and clavulanic acid production in SA medium of S. clavuligerus 27064 (open squares), S. clavuligerus DadpA (closed squares),
S. clavuligerus [pMS83] (open circles) and S. clavuligerus DadpA [pCPA2] (closed circles). (b) Effect of multiple copies of
adpA on growth, and cephamycin C and clavulanic acid production of S. clavuligerus ATCC 27064 (open squares), S.
clavuligerus [pIJ699] (open circles) and S. clavuligerus [pIJadpA] (closed circles) grown in SA medium.
production by the DadpA mutant was observed. No
significant differences in amplification of ccaR or claR
transcripts were observed between the analysed strains (data
not shown); therefore, the transcriptional analysis was
extended to the whole clavulanic acid cluster. The results
indicate that all the genes under study are expressed in the
mutant strain, in which clavulanic acid production is not
totally abolished. Only the amplification of ceaS2, bls2,
pah2, cas2, claR, car and oppA2 transcripts decreased slightly
in S. clavuligerus DadpA compared with the wild-type strain.
To confirm these differences, a relative quantification by
real-time RT-PCR was performed. The expression levels
obtained for the different genes in S. clavuligerus adpA in
relation to those of the wild-type strain (assigned a relative
value of 1) are shown in Fig. 7. Transcription levels of 0.14
and 0.24 were found for ccaR and claR, encoding positive
regulators for clavulanic acid biosynthesis (seven- and
fourfold less expression than in the wild-type strain,
respectively), while expression of brp was barely affected,
with a relative value of 0.67 (not shown).
All biosynthetic genes analysed appeared to be downregulated in the DadpA strain. The most dramatic decreases
2362
in expression levels were observed in the early biosynthetic
genes (ceaS2, bls2, pah2 and cas2), with relative values
ranging from 0.0098 (cas2) to 0.052 (pah2). This group of
four genes are co-transcribed from the ceaS2 promoter,
although cas2 has been described as also expressed in a
monocistronic transcript (Paradkar & Jensen, 1995). This
means a strong decrease in expression of the early genes, of
the order of 50-fold lower for ceaS2 and bls2.
The expression level of genes encoding late steps of the
pathway (car, gcaS2) in S. clavuligerus DadpA was variable,
since the relative value for car was 0.113 and that for gcaS2
was 0.379 (i.e. about eight- and threefold less than the
wild-type strain, respectively). Other essential genes of
unknown function in clavulanic acid biosynthesis, such as
cyp-fd, orf12 and orf13, showed relative values (0.132, 0.130
and 0.153, respectively) similar to those of car. Expression
of the oligopeptide permease-encoding gene oppA2 (0.080)
was strongly affected, while expression of oppA1, oat2 and
especially orf14 was less affected (0.215, 0.356 and 0.569,
respectively, i.e. about 4.6-, 3- and 1.7-fold lower). These
results allow us to explain the decrease in clavulanic acid
production observed in the DadpA mutant strain and
Downloaded from www.microbiologyresearch.org by
IP: 78.47.19.138
On: Sat, 01 Oct 2016 03:37:31
Microbiology 156
The adpA gene of Streptomyces clavuligerus
Fig. 7. Expression of clavulanic acid biosynthesis genes. The organization of the S. clavuligerus ATCC 27064 clavulanic acid
biosynthesis gene cluster is shown above. Transcriptional units are indicated with arrows. The quantitative RT-PCR of the
different genes using the oligonucleotides indicated in Table 2 is shown below. The relative values are referred to 1, the
assigned relative value for the expression of each gene in S. clavuligerus ATCC 27064. Error bars were calculated by
measuring the standard deviation among biological replicates of each sample. The mRNA templates were from 40 h cultures
grown in SA medium.
suggests that AdpA acts as a positive regulatory modulator
of clavulanic acid gene expression.
DISCUSSION
Depending on the culture medium, the AdpA-negative
mutants of S. clavuligerus are blocked in sporulation and
show sparse aerial mycelium formation. A similar mediumdependent, sporulation-negative phenotype has been
described in S. coelicolor adpA mutants; however, in other
Streptomyces species, adpA mutants display a fully bald
phenotype (Nguyen et al., 2003; Ohnishi et al., 1999; Pan et
al., 2009; Takano et al., 2003). Cephamycin C and
especially clavulanic acid formation is impaired in S.
clavuligerus DadpA. Expression of ornA, encoding an
oligoRNase involved in morphological differentiation
(Ohnishi et al., 2000; Sello & Buttner, 2008), is lower in
S. clavuligerus DadpA. However, the lack of sporulation
observed in S. clavuligerus DadpA is not due to the low
transcription of ornA, since the strain complemented in
trans, S. clavuligerus DadpA (pCPA2), which still has a low
expression of ornA, sporulates normally and produces
wild-type levels of cephamycin C and clavulanic acid.
Since all adpA genes described so far contain a TTA codon,
which is not translated in mutants blocked in the bldA
http://mic.sgmjournals.org
gene, it has been postulated that all the morphological
differences observed in S. coelicolor bldA mutants are due
to lack of adpA translation (Nguyen et al., 2003; Takano
et al., 2003). S. clavuligerus DbldA displays a bald phenotype but produces both cephamycin and clavulanic acid;
therefore, the S. clavuligerus DadpA and S. clavuligerus
DbldA mutants exhibit different phenotypes in relation to
aerial mycelium formation and antibiotic production.
This might be due to the expression or lack of expression of other still-uncharacterized genes; furthermore, S.
clavuligerus DbldA correctly translates the TTA codoncontaining ccaR gene, for the clavulanic acid/cephamycin
C-specific regulatory protein CcaR (Trepanier et al., 2002;
Santamarta, 2002).
The different behaviour of the S. clavuligerus bldA mutant with respect to adpA and ccaR translation might be
due to the differences in the TTA 59 flanking nucleotides (Trepanier et al., 2002). After comparison of all
Streptomyces bldA-dependent TTA codons it has been
suggested that TTAY sequences (where Y is C or T) are
susceptible to be bldA-dependent as is the case for the TTA
codon in adpA (TTAC), while TTAR sequences (where R is
G or A), such as in the TTA codon of ccaR (TTAG), are not
bldA-dependent. As shown above, the absence of AdpA
detection by immunoassays of S. clavuligerus DbldA supports the theory of Trepanier and co-workers.
Downloaded from www.microbiologyresearch.org by
IP: 78.47.19.138
On: Sat, 01 Oct 2016 03:37:31
2363
M. T. López-Garcı́a, I. Santamarta and P. Liras
The decrease of cephamycin C and, especially, of clavulanic
acid production in S. clavuligerus DadpA and their
overproduction in transformants carrying multiple copies
of adpA suggest that AdpA is a positive modulator in the
antibiotic regulatory cascade of S. clavuligerus. However,
the observed effect is more drastic in relation to clavulanic
acid production, probably reflecting differences in the
regulatory cascades for the two antibiotics (Paradkar &
Jensen, 1998). The transcription in the DadpA mutant of
clavulanic acid biosynthesis regulatory genes ccaR and claR
was about seven- and fourfold lower than in the wild-type
strain, which explains the strong decrease in expression of
genes ceaS2, bls2, pah2 and cas2 for the early steps of the
clavulanic acid pathway as well as the moderate decrease of
the late biosynthesis genes.
Direct AdpA binding to sequences in the pathway-specific
regulatory genes that control antibiotic production has
been demonstrated in S. griseus, S. ansochromogenes and S.
coelicolor (Higashi et al., 2007; Pan et al., 2009; Park et al.,
2009; Tomono et al., 2005a). The consensus sequence in S.
griseus is 59-TGGCSNGWWY-39, and two types of AdpA
binding have been described. In type I, the binding site
contains two consensus sequences, while in type II, AdpA
binds a single consensus sequence. In the intergenic cmcH–
ccaR region, between the ARE box and the tsp points
described for ccaR, two possible sequences for AdpA
binding are located: (i) 406 bp from the ATG start codon
there is a single (type II) sequence, 59-TGGCCGGATT-39;
and (ii) 565 nt upstream from the ATG there are two direct
sequences, 39-TGGCCCTTTT-14-TGGCCGCTGT-59. In
both cases, the sequences are located in the DNA strand
complementary to ccaR. Whether these sequences are true
sites for AdpA binding has not yet been confirmed, since
the purification of S. clavuligerus recombinant AdpA
has been hampered by the instability in E. coli of all
the expression vectors carrying adpA that have been
constructed.
The butyrolactone receptor Brp binds to the ARE boxcontaining probe, as shown by EMSA; in addition, it has
been reported that a Brp-disrupted strain produces 1.5- to
threefold more clavulanic acid and cephamycin C than the
wild-type strain (Santamarta et al., 2005). This work
demonstrates a connection between the butyrolactone and
AdpA regulation systems: Brp binds an ARE box present
upstream of adpA, which leads to repression of adpA in
the wild-type strain and to a 2.5-fold increase of adpA
transcript in the S. clavuligerus Brp-disrupted mutant. The
AdpA regulation pattern shown by S. clavuligerus resembles
that described for S. griseus (Ohnishi et al., 1999, 2005).
Thus, ccaR expression is controlled directly by Brp and
indirectly through the Brp-dependent AdpA regulator.
ACKNOWLEDGEMENTS
REFERENCES
Aigle, B., Wietzorrek, A., Takano, E. & Bibb, M. J. (2000). A single
amino acid substitution in region 1.2 of the principal sigma factor of
Streptomyces coelicolor A3(2) results in pleiotropic loss of antibiotic
production. Mol Microbiol 37, 995–1004.
Burton, K. (1968). Determination of DNA concentration with
diphenylamine. Methods Enzymol 12, 163–166.
Buttner, M. J., Chater, K. F. & Bibb, M. J. (1990). Cloning, disruption,
and transcriptional analysis of three RNA polymerase sigma factor
genes of Streptomyces coelicolor A3(2). J Bacteriol 172, 3367–3378.
Chater, K. F. & Chandra, G. (2008). The use of the rare UUA codon to
define ‘‘expression space’’ for genes involved in secondary metabolism, development and environmental adaptation in Streptomyces.
J Microbiol 46, 1–11.
Fernández-Moreno, M. A., Caballero, J. L., Hopwood, D. A. &
Malpartida, F. (1991). The act cluster contains regulatory and
antibiotic export genes, direct targets for translational control by
the bldA tRNA gene of Streptomyces. Cell 66, 769–780.
Gregory, M. A., Till, R. & Smith, M. C. (2003). Integration site for
Streptomyces phage WBT1 and development of site-specific integration
vectors. J Bacteriol 185, 5320–5323.
Gust, B., Challis, G. L., Fowler, K., Kieser, T. & Chater, K. F. (2003).
PCR-targeted Streptomyces gene replacement identifies a protein
domain needed for biosynthesis of the sesquiterpene soil odor
geosmin. Proc Natl Acad Sci U S A 100, 1541–1546.
Higashi, T., Iwasaki, Y., Ohnishi, Y. & Horinouchi, S. (2007). A-factor
and phosphate depletion signals are transmitted to the grixazone
biosynthesis genes via the pathway-specific transcriptional activator
GriR. J Bacteriol 189, 3515–3524.
Higgens, C. E., Hamill, R. L., Sands, T. H., Hoehn, M. M., Davis, N. E.,
Nagarajan, R. & Boeck, L. D. (1974). The occurrence of deacetylce-
phalosporin C in fungi and Streptomyces. J Antibiot 27, 298–300.
Kato, J. Y., Suzuki, A., Yamazaki, H., Ohnishi, Y. & Horinouchi, S.
(2002). Control by A-factor of a metalloendopeptidase gene involved
in aerial mycelium formation in Streptomyces griseus. J Bacteriol 184,
6016–6025.
Kato, J. Y., Chi, W. J., Ohnishi, Y., Hong, S. K. & Horinouchi, S. (2005).
Transcriptional control by A-factor of two trypsin genes in
Streptomyces griseus. J Bacteriol 187, 286–295.
Kieser, T. & Melton, R. E. (1988). Plasmid pIJ699, a multi-copy
positive-selection vector for Streptomyces. Gene 65, 83–91.
Kieser, T., Bibb, M. J., Buttner, M. J., Chater, K. F. & Hopwood, D. A.
(2000). Practical Streptomyces Genetics. Norwich, UK: John Innes
Foundation.
Lawlor, E. J., Baylis, H. A. & Chater, K. F. (1987). Pleiotropic
morphological and antibiotic deficiencies result from mutations in a
gene encoding a tRNA-like product in Streptomyces coelicolor A3(2).
Genes Dev 1, 1305–1310.
Liras, P. & Martı́n, J. F. (2005). Assay methods for detection and
This work was supported by Grants of the Spanish Ministry of Science
and Technology (BIO2006-14853), the Junta de Castilla y León
(GR117) and the European Community (Actinogen LSHMCT-20042364
005224). M. T. L.-G. received a fellowship from the Junta de Castilla y
León. We appreciate the S. clavuligerus DbldA strain, received from
Drs B. Leskiw and S. E. Jensen (Department of Biological Science,
University of Alberta, Canada), DNA sequences obtained from Dr
Wilbert Heijne (DSM, The Netherlands) and plasmid pMS83
obtained from Dr Maggie Smith (University of Aberdeen, UK)
quantification of antimicrobial metabolites produced by Streptomyces
clavuligerus. In Methods in Biotechnology, vol. 18, pp. 149–163. Edited
by J. L. Barredo. Totowa, NJ: Humana Press.
Downloaded from www.microbiologyresearch.org by
IP: 78.47.19.138
On: Sat, 01 Oct 2016 03:37:31
Microbiology 156
The adpA gene of Streptomyces clavuligerus
Lorenzana, L. M., Pérez-Redondo, R., Santamarta, I., Martı́n, J. F. &
Liras, P. (2004). Two oligopeptide-permease-encoding genes in the
Sambrook, J., Fritsch, E. F. & Maniatis, T. (1989). Molecular Cloning:
a Laboratory Manual, 2nd edn. Cold Spring Harbor, NY: Cold Spring
Harbor Laboratory.
clavulanic acid cluster of Streptomyces clavuligerus are essential for
production of the b-lactamase inhibitor. J Bacteriol 186, 3431–3438.
Sánchez, L. & Braña, A. F. (1996). Cell density influences antibiotic
Nguyen, K. T., Tenor, J., Stettler, H., Nguyen, L. T., Nguyen, L. D. &
Thompson, C. J. (2003). Colonial differentiation in Streptomyces
biosynthesis in Streptomyces clavuligerus. Microbiology 142, 1209–
1220.
coelicolor depends on translation of a specific codon within the adpA
gene. J Bacteriol 185, 7291–7296.
Santamarta, I. (2002). Control de la expresión de los genes de biosı́ntesis
Ohnishi, Y., Kameyama, S., Osaka, H. & Horinouchi, S. (1999). The
A-factor regulatory cascade leading to streptomycin biosynthesis in
Streptomyces griseus: identification of a target gene of the A-factor
receptor. Mol Microbiol 34, 102–111.
Ohnishi, Y., Nishiyama, Y., Sato, R., Kameyama, S. & Horinouchi, S.
(2000). An oligoribonuclease gene in Streptomyces griseus. J Bacteriol
182, 4647–4653.
Ohnishi, Y., Yamazaki, H., Kato, J. Y., Tomono, A. & Horinouchi, S.
(2005). AdpA, a central transcriptional regulator in the A-factor
regulatory cascade that leads to morphological development and
secondary metabolism in Streptomyces griseus. Biosci Biotechnol
Biochem 69, 431–439.
Pan, Y., Liu, G., Yang, H., Tian, Y. & Tan, H. (2009). The pleiotropic
regulator AdpA-L directly controls the pathway specific activator of
nikkomycin biosynthesis in Streptomyces ansochromogenes. Mol
Microbiol 72, 710–723.
Paradkar, A. S. & Jensen, S. E. (1995). Functional analysis of the gene
encoding the clavaminate synthase 2 isoenzyme involved in clavulanic
acid biosynthesis in Streptomyces clavuligerus. J Bacteriol 177, 1307–
1314.
Paradkar, A. S. & Jensen, S. E. (1998). A pathway-specific
transcriptional activator regulates late steps of clavulanic acid
biosynthesis in Streptomyces clavuligerus. Mol Microbiol 27, 831–843.
Park, S. S., Yang, Y. H., Song, E., Kim, E. J., Kim, W. S., Sohng, J. K.,
Lee, H. C., Liou, K. K. & Kim, B. G. (2009). Mass spectrometric
screening of transcriptional regulators involved in antibiotic biosynthesis in Streptomyces coelicolor A3(2). J Ind Microbiol Biotechnol 36,
1073–1083.
Pérez-Llarena, F. J., Liras, P., Rodrı́guez-Garcı́a, A. & Martı́n, J. F.
(1997). A regulatory gene (ccaR) required for cephamycin and
clavulanic acid production in Streptomyces clavuligerus: amplification
results in overproduction of both b-lactam compounds. J Bacteriol
179, 2053–2059.
de cefamicina C en Streptomyces clavuligerus por la proteı́na CcaR. PhD
thesis, Universidad de León (León).
Santamarta, I., Pérez-Redondo, R., Lorenzana, L. M., Martı́n, J. F. &
Liras, P. (2005). Different proteins bind to the butyrolactone receptor
protein ARE sequence located upstream of the regulatory ccaR gene of
Streptomyces clavuligerus. Mol Microbiol 56, 824–835.
Santamarta, I., López-Garcı́a, M. T., Pérez-Redondo, R., Koekman, B.,
Martı́n, J. F. & Liras, P. (2007). Connecting primary and secondary
metabolism: AreB, an IclR-like protein, binds the AREccaR sequence of
S. clavuligerus and modulates leucine biosynthesis and cephamycin C
and clavulanic acid production. Mol Microbiol 66, 511–524.
Sello, J. K. & Buttner, M. J. (2008). The oligoribonuclease gene in
Streptomyces coelicolor is not transcriptionally or translationally
coupled to adpA, a key BldA target. FEMS Microbiol Lett 286, 60–65.
Takano, E., Tao, M., Long, F., Bibb, M. J., Wang, L., Li, W., Buttner,
M. J., Bibb, M. J., Deng, Z. X. & Chater, K. F. (2003). A rare leucine
codon in adpA is implicated in the morphological defect of bldA
mutants of Streptomyces coelicolor. Mol Microbiol 50, 475–486.
Tomono, A., Tsai, Y., Yamazaki, H., Ohnishi, Y. & Horinouchi, S.
(2005a). Transcriptional control by A-factor of strR, the pathway-
specific transcriptional activator for streptomycin biosynthesis in
Streptomyces griseus. J Bacteriol 187, 5595–5604.
Tomono, A., Tsai, Y., Ohnishi, Y. & Horinouchi, S. (2005b). Three
chymotrypsin genes are members of the AdpA regulon in the A-factor
regulatory cascade in Streptomyces griseus. J Bacteriol 187, 6341–6353.
Trepanier, N. K., Jensen, S. E., Alexander, D. C. & Leskiw, B. K.
(2002). The positive activator of cephamycin C and clavulanic acid
production in Streptomyces clavuligerus is mistranslated in a bldA
mutant. Microbiology 148, 643–656.
White, J. & Bibb, M. (1997). bldA dependence of undecylprodigiosin
production in Streptomyces coelicolor A3(2) involves a pathwayspecific regulatory cascade. J Bacteriol 179, 627–633.
Yamazaki, H., Ohnishi, Y. & Horinouchi, S. (2000). An A-factordependent extracytoplasmic function sigma factor (sAdsA) that is
Pérez-Redondo, R., Rodrı́guez-Garcı́a, A., Martı́n, J. F. & Liras, P.
(1999). Deletion of the pyc gene blocks clavulanic acid biosynthesis
essential for morphological development in Streptomyces griseus.
J Bacteriol 182, 4596–4605.
except in glycerol-containing medium: evidence for two different
genes in formation of the C3 unit. J Bacteriol 181, 6922–6928.
Yamazaki, H., Ohnishi, Y. & Horinouchi, S. (2003). Transcriptional
Rodrı́guez-Garcı́a, A., Santamarta, I., Pérez-Redondo, R., Martı́n,
J. F. & Liras, P. (2006). Characterization of a two-gene operon epeRA
involved in multidrug resistance in Streptomyces clavuligerus. Res
Microbiol 157, 559–568.
Romero, J., Liras, P. & Martı́n, J. F. (1984). Dissociation of cephamycin
and clavulanic acid biosynthesis in Streptomyces clavuligerus. Appl
Microbiol Biotechnol 20, 318–325.
http://mic.sgmjournals.org
switch on of ssgA by A-factor, which is essential for spore septum
formation in Streptomyces griseus. J Bacteriol 185, 1273–1283.
Yamazaki, H., Tomono, A., Ohnishi, Y. & Horinouchi, S. (2004).
DNA-binding specificity of AdpA, a transcriptional activator in the Afactor regulatory cascade in Streptomyces griseus. Mol Microbiol 53,
555–572.
Edited by: C. W. Chen
Downloaded from www.microbiologyresearch.org by
IP: 78.47.19.138
On: Sat, 01 Oct 2016 03:37:31
2365