Biotechnology Letters 23: 1205–1208, 2001.
© 2001 Kluwer Academic Publishers. Printed in the Netherlands.
1205
A single band does not always represent single bacterial strains in
denaturing gradient gel electrophoresis analysis
Hiroyuki Sekiguchi1,2 , Noriko Tomioka1 , Tadaatsu Nakahara2 & Hiroo Uchiyama1,∗
1 National
Institute for Environmental Studies, 16-2 Onogawa, Ibaraki 305-8506, Japan
of Applied Biochemistry, University of Tsukuba, 1-1-1 Tennodai, Tsukuba, Ibaraki 305-8577, Japan
∗ Author for correspondence (Fax: 81-298-50-2576; E-mail: huchiyam@nies.go.jp)
2 Institute
Received 23 April 2001; Revisions requested 2 May 2001; Revisions received 21 May 2001; Accepted 22 May 2001
Key words: bias, DGGE, microbial community, PCR, 16S rDNA
Abstract
DNA in a denaturing gradient gel electrophoresis (DGGE) band that could not be sequenced after recovery from
the gel was cloned into a TA cloning vector and a library was constructed and then 13 clones randomly picked up
from the library was sequenced. Although the excised DNA from the DGGE gel showed a single band, the library
consisted of several different sequences phylogenetically. This phenomenon was also observed in several other
DGGE bands. Therefore, this suggests that a single DGGE band does not always represent a single bacterial strain
and a new bias for quantitative analyses based on band intensities has been identified.
Introduction
The structure of the bacterial community in the environment has been investigated by culture-dependent
methods for many years. However, since it is difficult
to culture most bacteria in samples from the environment (Jannasch & Jones 1959, Amann et al. 1995),
evaluation of changes in the structure of bacterial communities using only culturing methods is inadequate.
Recently, analyses of the structure of bacterial communities that do not depend on cultivation techniques
have been carried out (Amann et al. 1995, Head et al.
1998). As one of the culture-independent methods, denaturing gradient gel electrophoresis (DGGE) analysis
of the 16S rRNA gene segment has been widely used
to identify complex microbial communities and to determine the phylogenetic affiliation of the community
members (Ferris et al. 1996, Watanabe et al. 2000).
DGGE was originally developed to detect specific
mutations within genomic genes due to one base mismatch (Myers et al. 1985). Since Muyzer et al. (1993)
applied this method to environmental microorganisms,
analyses of microbial communities using DGGE have
become increasingly popular. DGGE allows the simultaneous analysis of multiple samples and the compar-
ison of microbial communities based on temporal and
geographical differences. Furthermore, the method enables sequence data to be obtained on the DNA of
dominant species from individual bands. Although
this tool has many advantages, as mentioned above,
a few biases derived from PCR and heterogeneity of
copy number of 16S rDNA among bacterial species
have been reported (Muyzer 1998, Lionel et al. 2000).
In this paper, we have identified a new bias associated with the co-migration of phylogenetically heterogeneous bands in a DGGE gel and have attempted to
alleviate this shortcoming in the method.
Materials and methods
DNA source, extraction, amplification, and
purification
Water sample collected from a river was filtered using a 0.2 µm pore size filter (25 mm diam. Type
JG, Millipore, New Bedford, MA) to trap bacterial cells. Total DNA was extracted from the bacterial cells on the filter using Fast DNA kit (BIO101,
Vista, CA). For DGGE analysis, the V3 region of
1206
Sequencing of DGGE band
Fig. 1. DGGE analysis showing the profiles of original PCR amplicon (A), purified DNA until a single band was observed by repeating
DGGE 3 times after excision of the band from the original profile
(B), and migrations of inserted region in the clones (1–13). Excised
DGGE band is indicated by an arrow.
16S rDNA was amplified by using 357F-GC (5 -CGCCCGCCGCGCGCGGCGGGCGGGGCGGGGGC
ACGGGGGGCCTACGGGAGGCAGCAG-3 ) and
518R (5 -GTATTACCGCGGCTGCTGG-3 ) as PCR
primers (Muyzer et al. 1993), and a temperature program was implemented with touch down program
(Muyzer et al. 1993). The amplicon was applied
to a 2% agarose gel and DNA in a band was excised and purified using a DEAE-cellulose membrane
(DE81, Whatman International Ltd., Maidstone, UK),
and applied to DGGE. For the control experiment,
Arthrobacter atrocyaneus ATCC13752T was used as
standard strain. After cultivation in YG medium, the
cells were collected by centrifugation at 4 ◦ C, and
DNA extraction and purification at the following steps
were performed in the same way as described above.
Denaturing gradient gel electrophoresis (DGGE)
DGGE was performed using a D-Code system (BioRad Laboratories, Inc., Hercules, CA). Acrylamide
gel (8%) was prepared and run with 0.5× TAE buffer
(1× TAE = 0.04 M Tris base, 0.02 M sodium acetate,
and 10 mM EDTA; pH adjusted to 7.4). DGGE gel
consisted of a 20–70% gradient of urea and formamide
in the direction of electrophoresis as denaturant, a
condition common in many studies. The 100% denaturant consisted of 40% (v/v) formamide and 7 M urea.
DGGE was conducted at a constant voltage of 100 V
at 60 ◦ C for 4 h. The gel was stained with SYBR Gold
(Molecular Probes, Eugene, OR) and photographed.
The band in the DGGE gel was carefully excised
with a razor blade under UV illumination, and then
placed in 100 µl TE buffer. DNA was extracted from
the gel piece by overnight incubation at 4 ◦ C, and
then 0.5 µl supernatant was used as template DNA
in the re-amplification by PCR using 357F-GC and
518R primers. The resulting amplicon was run again
on DGGE gel to verify its position with the original
band. This operation was repeated until the band appeared to be single. Thereafter, PCR using GC-2 (5 GAAGTCATCATGACCGTTCTGGCACGGGGGGC
CTA-3 , Watanabe et al. 1998) and 518R primers was
performed to obtain a sufficient amount of template
DNA for sequencing. Thereafter, the amplicon was
purified with Wizard PCR preps (Promega, Madison,
WI) and sequenced directly by using BigDye terminator cycle sequencing kit (Applied biosystems, Foster
City, CA). When the resultant sequencing failed due
to the presence of many ambiguous peaks, DNA in the
band was cloned by using TA-cloning kit (Invitrogen,
Carlsbad, CA), and a clone library was constructed.
Phylogenetic analysis
A phylogenetic tree was constructed by the neighborjoining method (Saito & Nei 1987) with the
CLUSTAL X software packages (Thompson et al.
1994, Jeanmougin et al. 1998).
Results and discussion
In our previous study on bacterial community structure by DGGE, unreadable sequences from repeatedly
purified bands were often observed. To address this
problem, we constructed a clone library of an unreadable band DNA and sequenced 13 clones picked
randomly from the library. As shown in Figure 1, although the excised DNA gave a single band (Band B),
the migrations of the inserted region of the clones on
DGGE were not the same, and the clone library consisted of several different sequences phylogenetically.
Especially for the clones no. 2–5, 9, 11, 12, and 13,
the migrations were almost identical. As for the clones
no. 1, 6–8, and 10, the migrations apparently differed
from those of band B, and also phylogenetically. These
results suggested that, although the repeatedly purified
band appeared as a single band, it may include a small
amount of heterogeneous DNA on DGGE.
1207
Fig. 2. Phylogenetic tree showing the relationship of the sequences obtained from the excised band clone library (A) and control experiment
using Arthrobacter atrocyaneus (B). Shading in tree A indicates phylogenetically independent groups estimated based on the variation of
shading in tree B. The scale bar represents the percentage of divergence.
The heterogeneity of the excised single band may
be ascribed to mis-incorporation or mis-reading during
the PCR and sequencing steps. To determine whether
the clone library was artificially heterogeneous due
to these steps, we performed a control experiment
and verified the error rate by using the V3 region of
16S rDNA of Arthrobacter atrocyaneus ATCC13752T
which had the same region as that described above.
Amplified V3 region of 16S rDNA of A. atrocyaneus was applied to DGGE three times as described
in Materials and methods, and then a clone library
was constructed and sequenced. Consequently, among
11 clones, the sequences from nine clones were completely the same as those of the reference sequence
of A. atrocyaneus recorded in GenBank, and for two
clones, only one base pair was mismatched in each
clone (their phylogenetic tree is shown in Figure 2B).
These results suggested that since mis-incorporation
or mis-reading rates were very low they could not
account for the diversity of the clones shown in Figure 2A. Based on Figures 2A and 2B, it was considered that there would be at least seven groups in this
clone library (no. 2–6; no. 11; no. 10; no. 12, 13; no. 7;
no. 1; no. 9; no. 8)
The heterogeneity was also ascribed to the presence of faint bands, which were located very to or
overlapped the target band. However, with the current
DGGE method, it is difficult to rule out this possibil-
ity and a higher resolution DGGE method would need
to be developed. These results suggested that a single DGGE band does not represent a single bacterial
strain and that the band which migrated to the same
position in different lanes may consist of different
bacteria. Therefore, we considered that a quantitative
analysis of each band based on the intensity should be
performed carefully due to the bias identified in this
study, in addition to the other biases already reported.
Until now, cloning analysis of 16S rDNA and fluorescence in situ hybridization, in addition to DGGE, had
also been used to study microbial communities. Therefore, it will be important to evaluate the characteristics
of respective techniques and cross-check the results
obtained by these approaches to analyze the genuine
microbial community structure.
References
Amann RI, Ludwig W, Schleifer K-H (1995) Phylogenetic identification and in situ detection of individual microbial cells without
cultivation. Microbiol. Rev. 59: 143–169.
Ferris MJ, Muyzer G, Ward DM (1996) Denaturing gradient gel
electorophoresis profiles of 16S rRNA-defined populations inhabiting a hot spring microbial mat community. Appl. Environ.
Microbiol. 62: 340–346.
Head IM, Saunders JR, Pickup RW (1998) Microbial evolution,
diversity, and ecology: a decade of ribosomal RNA analysis of
uncultivated microorganisms. Microb. Ecol. 35: 1–21.
1208
Jannasch HW, Jones GE (1959) Bacterial populations in sea water as determined by different methods of enumeration. Limnol.
Oceanogr. 4: 128–139.
Jeanmougin F, Thompson JD, Gouy M, Higgins DG, Gibson TJ
(1998) Multiple sequence alignment with Clustal X. Trends
Biochem. Sci. 23: 403–405.
Lionel R, Franck P, Sylvie N (2000) Monitoring complex bacterial
communities using culture-independent molecular techniques:
application to soil environment. Res. Microbiol. 151: 167–177.
Muyzer G (1998) Structure, function and dynamics of microbial
communities: the molecular biological approach. In: Carvalho
GR, ed. Advances in Molecular Ecology. Amsterdam: IOS Press,
pp. 157–187.
Muyzer G, de Waal EC, Uitterlinden AG (1993) Profiling of
complex microbial populations by denaturing gradient gel electrophoresis analysis of polymerase chain reaction-amplified
genes coding for 16S rRNA. Appl. Environ. Microbiol. 59:
695–700.
Myers RM, Fischer SG, Lerman LS, Maniatis T (1985) Nearly
all single base substitutions in DNA fragments joined to a GC-
clump can be detected by denaturing gradient gel electrophoresis. Nucl. Acids Res. 13: 3131–3145.
Saito N, Nei M (1987) The neighbor-joining method: a new method
for reconstructing phylogenetic trees. Mol. Biol. Evol. 4: 406–
425.
Thompson JD, Higgins DG, Gibson TJ (1994) CLUSTAL W:
improving the sensitivity of progressive multiple sequence alignment through sequence weighting, positions-specific gap penalties and weight matrix choice. Nucl. Acids Res. 22: 4673–4680.
Watanabe K, Teramoto M, Futamata H, Harayama S (1998) Molecular detection, isolation, and physiological characterization of
functionally dominant phenol-degrading bacteria in activated
sludge. Appl. Environ. Microbiol. 64: 4396–4402.
Watanabe K, Watanabe K, Kodama Y, Syutsubo K, Harayama S
(2000) Molecular characterization of bacterial populations in
petroleum-contaminated groundwater discharged from underground crude oil storage cavities. Appl. Environ. Microbiol. 66:
4803–4809.