DNA and a little more Ivar Giaever Rensselaer Polytechnic Institute and Applied BioPhysics, Inc. Troy, NY 12180 and Oslo Universitetet Blindern, Oslo Cloning Cloning is not a very precise term. It used to mean: take DNA from an adult cell, now when you read about it, stem cells are often used. Some plants are easy to clone, for example potatoes. McIntosh apples are grafts from ONE Canadian tree Nobel Prize 1962 Jim Watson 1928- Francis Crick 1916- On April 25, 1953, Crick and Watson published in Nature the famous paper: "Molecular Structure of Nucleic Acids“ Now know as: The Double Helix The length of DNA in each cell is ~ 1 meter. A person has 1014 cells. The length of DNA in a single person:~1014 m Distance to moon is ~108 m, to the sun ~1011 m and to nearest star ~1016 m Probably the most famous sentence in science: “It has not escaped our notice that the specific pairing we have postulated immediately suggests a possible copying mechanism for the genetic material" Please note that there are no small men who put the parts together, it happens all by random diffusion. It is a self organizing system K. Eric Drexler describes the “assembler” An “assembler” can make everything, atom by atom, including making a copy of itself Bill Joy, founder and chief s scientist at Sun Microsystem, worries in the magazine WIRED about the “gray goo”, how robots could ravage the earth Cells are such machines, cells have ravaged the earth, changed the atmosphere to contain oxygen, and put “green goo” all over the surface e.coli Can we make cars this way? Big box full of parts that fit into each other. Shake it vigorously and….. Completed cars come out Double stranded DNA from a small virus. Individual molecules are not visible, and the double helix appears as a long thread The genome can be sequenced chemically: Bacteriophage phi-X174 Genome GAGTTTTATCGCTTCCATGACGCAGAAGTTAACACTTT CGGATATTTCTGATGA GTCGAAAAATTATCTTGATAAAGCAGGAATTACTACTGCTTGTTTACGAATTAAATCGAAGTGGACTGCTGGCGGAAAATGAGAAAATTCGACCTATCCTTGCGCAGCTCGAGAAGCTCTTACTTTGC GACCTTTCGCCATCAACTAACGATTCTGTCAAAAACTGACGCGTTGGATGAGGAGAAGTGGCTTAATATGCTTGGCACGTTCGTCAAGGACTGGTTTAGATATGAGTCACATTTTGTTCATGGTAGA GATTCTCTTGTTGACATTTTAAAAGAGCGTGGATTACTATCTGAGTCCGATGCTGTTCAACCACTAATAGGTAAGAAATCATGAGTCAAGTTACTGAACAATCCGTACGTTTCCAGACCGCTTTGGCC TCTATTAAGCTCATTCAGGCTTCTGCCGTTTTGGATTTAACCGAAGATGATTTCGATTTTCTGACGAGTAACAAAGTTTGGATTGCTACTGACCGCTCTCGTGCTCGTCGCTGCGTTGAGGCTTGCGT TTATGGTACGCTGGACTTTGTGGGATACCCTCGCTT THE SEQUENCE IS ALTOGETHER 5386 BASES (OR LETTERS) LONG IT CONTAINS 10 GENES, I.E. THE PHAGE MAKES 10 DIFFERENT PROTEINS TCCTGCTCCTGTTGAGTTTATTGCTGCCGTCATTGCTTATTATGTTCATCCCGTCAACATTCAAACGGCCTGTCTCATCATGGAAGGCGCTGAATTTACGGAAAACATTATTAATGGCGTCGAGCGTC CGGTTAAAGCCGCTGAATTGTTCGCGTTTACCTTGCGTGTACGCGCAGGAAACACTGACGTTCTTACTGACGCAGAAGAAAACGTGCGTCAAAAATCACTTTATGCGGACACTTCCTACAGGTAGC GTTGACCCTAATTTTGGTCGTCGGGTACGCAATCGCCGCCAGTTAAATAGCTTGCAAAATACGTGGCCTTATGGTTACAGTATGCCCATCGCAGTTCGCTACACGCAGGACGCTTTTTCACGTTCTG GTTGGTTGTGGCCTGTTGATGCTAAAGGTGAGCCGCTTAAAGCTACCAGTTATATGGCTGTTGGTTTCTATGTGGCTAAATACGTTAACAAAAAGTCAGATATGGACCTTGCTGCTAAAGGTCTAGG AGCTAAAGAATGGAACAACTCACTAAAAACCAAGCTGTCGCTACTTCCCAAGAAGCTGTTCAGAATCAGAATGAGCCGCAACTTCGGGATGAAAATGCTCACAATGACAAATCTGTCCACGGAGTGC TTAATCCAACTTACCAAGCTGGGTTACGACGCGACGCCGTTCAACCAGATATTGAAGCAGAACGCAAAAAGAGAGATGAGATTGAGGCTGGGAAAAGTTACTGTAGCCGACGTTTTGGCGGCGCAA CTCAAATTTATGCGCGCTTCGATAAAAATGATTGGCG TATCCAACCTGCA CCTGTGACGACAAATCTG Electrophoresis: the most used method in biology Restriction enzymes (Magic scissors) Example of restriction sites Everybody has a PERSONAL “barcode” According to DNA analysis, OJ’s blood was all over the crime scene and further more his finger was cut. But the jury did not understand science and he was found not guilty. 300.000 Generations since we split from chimpanzees. We are all descendants from a woman who lived in Africa 10.000 generations ago Women and men are not alike, no matter how much we pretend that they are You are not what you eat, you are shaped by your genes, both physically and mentally Survival of the fittest Dinosaurs are extinct because they could not compete. Charles Darwin 1806-1889 The real competition is not between various species but between DNA sequences, the lucky ones survive.