Chap. 8. Problem 1.
Hydrogen bonds can potentially be formed to each of the four
nitrogen atoms in a purine ring (N-1, N-3, N-7, and N-9). Since
N-1 is involved in Watson-Crick base pairing to cytosine in DNA,
and N-9 is tied up in the N-glycosyl linkage to deoxyribose in the
nucleotides of DNA and has very limited hydrogen bonding ability,
only N-3 and N-7 are freely available to form other hydrogen
bonds.
Chap. 8. Problem 2.
The base sequence of a DNA strand complementary to a written
sequence is conventionally written in the left-to-right (5’ to 3’)
direction, even though its sequence runs right-to-left relative to
the printed sequence. The sequence of the complementary
strand therefore is
(5’)GCGCAATATTTTGAGAAATATTGCGC(3’).
As shown by writing the double-helical sequence of this DNA,
this DNA segment contains a palindrome, which is underlined.
(5’)GCGCAATATTTCTCAAAATATTGCGC(3’)
(3’)CGCGTTATAAAGAGTTTTATAACGCG(5’)
A single DNA strand containing this sequence therefore has the
potential to form a hairpin structure. The two strands together
in double-helical DNA could form a cruciform structure.
Chap. 8. Problem 5.
Both single-stranded DNAs and RNAs will form hairpin structures
if they contain complementary regions. In the double-helical
parts of both DNA and RNA hairpins, the nucleic acid strands
are oriented antiparallel to one another. However, RNA is unable
to form a B-form double helix, and exists instead in an A-form
helix. DNA hairpins adopt standard B-form helices. The reason
for this difference is that the 2’-hydroxyl groups in the ribose
residues of RNA make it sterically impossible for a double-helical
RNA molecule to adopt a B-form type of helix.
Chap. 8. Problem 6.
Eukaryotic DNAs contain large amounts (about 5%) of 5methylcytosine residues at CpG sequences due to methylation
processes that are involved in the regulation of gene expression.
When 5-methylcytosine undergoes spontaneous deamination to
thymine, a G/T mismatch pair is produced. Because 5methylcytosine is prevalent in DNA, G/T mismatches are common.
Therefore, a specialized system that repairs G/T mismatches to
G/C (and not A/T) base pairs has evolved.
Chap. 8. Problem 8.
As a result of the loss of the purine base at an apurinic (AP)
site, structural changes occur that lead to destabilization of
double-helical DNA. First, the deoxyribose formerly holding the
purine base can open to its linear aldehyde form. Second, base
stacking interactions between the apurinic nucleotide and its
neighbors are lost. These changes destabilize the local structure
of the double helix in the affected region.
Chap. 8. Problem 10.
The bases in double-helical DNA are stacked on top of one
another inside the helix. In this environment, they are less
exposed to light directed upon them. However, when DNA is
denatured, the bases of the individual single strands move out of
the interior of the double helix and are more exposed to light
focused on the solution. For this reason, a hyperchromic effect
is observed where the absorption of UV light by the solution
containing the denatured DNA increases.
Chap. 8. Problem 13.
If dCTP were omitted from the “C” sequencing reaction, ddCTP
would be incorporated into the growing chain synthesized by the
DNA polymerase as soon as it encountered the first G residue in
the template. No chains longer than this product would be made,
and only one band corresponding to this product would appear in
the sequencing gel. Under these conditions, the C reaction would
not work correctly.
Chap. 8. Problem 16.
(a) Water participates directly
in DNA damaging reactions such
as depurination. It also is the
solvent in which mutationcausing enzymes operate. Thus
the low water content of spores
is protective against the
accumulation of mutations in
DNA.
(b) Cyclobutane dimers are
formed by the absorption of UV
light by adjacent pyrimidines in
DNA. Spores of B. subtilis are
constantly at risk of being
exposed to UV light when the soil
is disturbed and spores are lifted
into the air and deposited on the
soil surface. The SASP proteins
therefore have evolved to help
protect the genetic information
stored in spore DNA.