In-Depth Analysis of Bacteriophage Esperanza
Kelsey Veldkamp and Randall DeJong, Ph.D., Calvin College
Sequencing Analysis
Introduction
o  Bacteriophages (phages) are viruses that infect bacteria
o  3 phages were isolated in the summer of 2012. However, after
sequencing the phages were found to be a single phage.
o  Phages have a huge potential for use in medical research
o  Phages have the potential to alter bacterial DNA without causing
an adverse reaction in either the bacteria or the person
o  Phages were sequenced using Ion Torrent sequencing technology
o  Biomphalaria glabrata snails are intermediate hosts for Schistosoma
mansoni, a parasite that causes the human disease Schistosomiasis
o  GeneDoc was used to align all three sequences and #nd di"erences,
consed was used to view the regions which contained di"erences and
determine whether they were legitimate di"erences or sequencing
artifacts.
o  Minor di"erences among the genomes prompted a closer analysis.
o  The long-term goal of this project is to be able to insert a gene into
a bacterium that causes the bacterium to interfere with the
parasite before the parasite can be passed on to humans
o  Most di"erences were identi#ed as sequencing artifacts and were
corrected.
o  Using phages to accomplish this goal would eliminate the need for
harmful toxins or powerful chemicals. Cercariae exit
snail in search
of human host
Adults live in
mesenteric veins of
humans
Homopolymer
What is it?
o  Quantitative Polymerase Chain Reaction is designed to detect the number
of copies of a speci#c DNA sequence present in a reaction mixture.
o  One of the main goals for the lab was to use qPCR to detect the level of
Esperanza in di"erent snail strains and individual snails.
How Does it Work?
o  There is a dye that $uoresces when bound to double stranded DNA
o  As the unique target sequence is ampli#ed, the $uorescence increases
o  The intensity of the $uorescence correlates to the amount of the speci#c
DNA sequence in the reaction mixture.
Good curve,
well spaced,
regular. Ampli#cation Curve:
shows the
increasing amount
of $uorescence as
DNA is ampli#ed.
Poor curve,
starts too
early, too
much DNA
in sample.
Produce eggs
Good curve,
dissociation
at a single
temperature.
GeneDoc, a genome alignment tool, showing one
legitimate di"erence and the beginning of the
transposable element sequence (explained below).
Find Biomphalaria
snail host
Quantitative PCR
Hatch into
miriacidia
Consed, DNA sequence alignment and
#nishing software, showing varying quality
sequences in a homopolymer.
Most of our results looked like those on the right. While the assay
clearly indicated the presence of phage in most individual snails,
quantitation of phage was unfortunately not possible.
Transposable Element
Lifecycle of a Schistosoma mansoni parasite. The long-term goal of this project is to #nd a phage
that can alter the bacterial community in the gut of the snail in such a way that it is no longer a
suitable host for the parasite, e"ectively cutting o" the lifecycle.
o  DNA Master revealed an extra gene in one copy of the genome
o  The added gene was a Transposable Element (TE); a sel#sh bit of DNA
that is able to move around within and between genomes.
Esperanza: A Quick Look
Transposable Element
o  Isolated from Citrobacter sp. and Enterobacter sp. residing in the gut of
a Biomphalaria glabrata snail
o  The genome was sequenced using Ion Torrent technology
Poor curve,
multiple
peaks = more
than one DNA
sequence
ampli#ed.
Dissociation Curve:
The peak shows a
change in
$uorescence.
Metagenomics
o  Metagenomic sequencing is the isolation and sequencing of all viral
particles in a sample.
o  Eliminates the need to culture the bacterial hosts to #nd phages
o  Presents an opportunity to #nd phages whose bacterial hosts are
un-cultivatable
o  The technique uses ultracentrifugation and a CsCl gradient to separate
the viral particles by density.
o  Viral particles at the target density are removed from the tube, and
their DNA is isolated and sequenced.
o  Esperanza has a conventional genome structure, with structural genes
grouped at the beginning of the genome.
o  Genome length: 33.1kb (34.2kb with transposable element)
o  Contains 50 genes (51 with transposable element)
DNA Master showing the 921 bp Transposable Element present in one copy of the Esperanza
genome.
o  Includes 12 genes of unknown function
o  Has an integrase gene, and therefore is able to incorporate itself into
its host’s DNA
o  Myoviridae phage (has contractile tail)
o  TE’s typically have direct and inverted repeats in their DNA sequences
o  We found both types of repeats in our TE.
CCCTTGACTGG CTTTGTTGAATAAATC
ACCAAAAT
GG
AGATTTCGGGTAAGTCTCCCCCGTAGCGGGTTGTGTTTTCAGGCAATACGCACGCT
TTCAGGCATACCTGCTTTCGTCATTTTGTTCAGCGCTCGTACCAGGCCATAGCCTCCGCAACCTGACCATCGTAGTCACGCAGCGTCAGTGAACCCCCGAACAGCTGTTTTACCCGGTA
CATCGCCGTTTCCGCTATCGAGCGACGGTTGTAATCTGTTGTCCATTTCCACCGCGCATTACTCCCGGTCATTCGCTGATTAGCCACTGCACGGTTACGGTCTGCATATTCACCGGGCCA
GTAACCCGCACCTTTTCGGGGAGGGATAAGCGCGCTGATTTTCTTACGCCGCAGTTCATCGTGACATAGCCGGGTATCGTAAGCGCCATCGGCGGCGGCTGACCTGATTTTCCGGTGG
GTTTGCCGGATTAACCCGGGGAAGGCCTCTGAGTCCGTAACGTTGTTCAGCGACAGGTCAGCGCAGATGATTTCATGTGTTTTACTGTCAACGGCGAGATGCAGCTTACGCCAGATAC
GGCGGCGTTCCTGGCCATGCTTTTTGACTTTCCACTCGCCTTCACCGAAGACCTTCAGCCCGGTGGAATCAATTACCAGGTGTGCGATTTCACCCCGGGTGGGCGTTTTGAAACTGAC
ATTAACCGACTTTGCCCGCCTGCTGACACAGCTGTAATCCGGGCAGCGTAGCGGAACGTTCATCAGAGAAAAAATGGAATCAATAAAGCCCTGCGCAGCCCGCAGGGTCAGCCTGAA
TACGCGTTTAATGACCAGCACAGTAGTGATGGCAAGGTCAGAATAGCGCTGAGGTCTGCCTCGTGAAGAAGGTGTTGCTGACTCATACCAGGCCTGAATAGCTTCATCATCCAGCCAG
AAAGTTATGGAGCCACGGTTGATGAGGGCTTTATTGTAGGTGGGCCAGTTGGTGATTTTGAACTTTTGCTTTGCCACGGAACGGTCTGCGTTGTCGGGAAGATACGTGATCTGATCCTT
GATTTATTCAACAAAGCCCTTGACTGGTATAAATATTTATACCATTATGTTTTTCAC
CAACTCAGCAAAAGTTC
EM image of Esperanza taken at
Michigan State University
Biomphalaria glabrata snail
The sequence of the Transposable Element in Esperanza’s genome. The direct repeat is shown with green text
and arrows and the inverted repeat is shown with blue text and arrows. The second sequence of the inverted
repeat must be complemented and read from right to left in order for it to match.
Step 1: Biomphalaria
glabrata snails are
dissected, and their
guts are
homogenized.
Step 2: The snail gut
homogenate is loaded
onto a CsCl gradient and
spun at very high speeds
to separate particles by
density.
Step 3: The layer with
the target density is
removed, and the
DNA is extracted
from those viruses.
Step 4: The extracted
DNA is then
sequenced and
analyzed.
o  Samples are currently being processed for Biomphalaria snails,
Helisoma snails, and termites.
References & Acknowledgements
o  Calvin College Biology Department o  Michigan State University
o  Lori Keen
o  Van Andel Institute
o  Jansma Family Research Fellowship
o  Thurber, R. V., Haynes, M., Breitbart, M., Wegley, L., & Rohwer, F. (2009,
October 19). Laboratory procedures to generate viral metagenomes.
Nature Protocols, 4(4), 470-483