Effect of lactoferrin on the growth performance, intestinal morphology, and expression of PR-39 and protegrin-1 genes in weaned piglets1 Y. Wang,2 T. Shan, Z. Xu, J. Liu, and J. Feng Institute of Feed Science, Zhejiang University, The Key Laboratory of Molecular Animal Nutrition, Ministry of Education, No. 164 Qiutao North Road, Hangzhou 310029, P. R. China ABSTRACT: A total of 90 weaned female pigs (Duroc × Landrace × Yorkshire) were used in a 15-d growth experiment to investigate the effect of lactoferrin on growth performance, intestinal morphology, and expression of PR-39 and protegrin-1 genes. The pigs were allocated on the basis of BW and litter to 3 dietary treatments in a randomized complete block design. There were 3 replicate pens per treatment, and the pigs were grouped with 10 pigs per pen. The dietary treatments were (1) basal diet; (2) basal diet + 20 mg of flavomycin/kg + 110 mg of aureomycin/kg; (3) basal diet + 1.0 g of lactoferrin/kg. Six pigs, randomly selected from each treatment (2 piglets/pen) were slaughtered for intestinal morphology and expression of PR-39 and protegrin-1 genes at the end of the experiment. Supplementation with lactoferrin improved growth performance; it increased ADG by 41.80% (P < 0.01) and efficiency of gain (G:F) by 17.20% (P < 0.05). Intestinal villus height was increased by 15.30% (P < 0.05), and crypt depth was decreased by 9.60% (P < 0.05). Supplemental lactoferrin increased the relative abundance of mRNA for PR-39 and protegrin-1 by 143% (P < 0.01) and 217% (P < 0.01), respectively. The use of lactoferrin as an additive to improve nonspecific immunity and strengthen host defenses would be good a method of defending weaned pigs from infections and weanling stress. Key words: antimicrobial peptide, gene expression, growth performance, intestinal morphology, lactoferrin, weaned pig ©2006 American Society of Animal Science. All rights reserved. INTRODUCTION The many changes associated with weaning expose young piglets to many potentially harmful stressors. The biggest change is from a rich liquid diet to a dry pelleted form during a time when the digestive and immune systems of the young pigs are still undergoing maturation. The sudden changes can result in postweaning lag, a time of depressed feed intake and growth performance and of increased disease and mortality. The prevalence of postweaning stress has led to a search for feed additives that boost the immune systems of young pigs during weaning. Lactoferrin (LF) is a multifunctional glycoprotein that has been attributed many physiological roles including 1 This work was supported by Program for New Century Excellent Talents in University (NCET-04-0543), the National Natural Science Foundation of China (30571348) and National Basic Research Program of China (2004CB 117506). 2 Corresponding author: yzwang@zju.edu.cn Received September 24, 2005. Accepted May 25, 2006. J. Anim. Sci. 2006. 84:2636–2641 doi:10.2527/jas.2005-544 protection against microbial infection (Dial et al., 1998; Pyong et al., 2001), regulation of immune function (Mattsby-Baltzer, 1996; Lee, 1998), and promotion of transcriptional activation (He and Furmanski, 1995; Kanyshkova et al., 1999). The immunomodulatory effects of LF include influence of the production and release of cytokines such as tumor necrosis factor-α (Choe and Lee, 1999), IL-1β (Crouch et al., 1992; Son et al., 2002), IL-8 (Shinoda et al., 1996), nitric oxide (Sorimachi et al., 1997), and granulocyte macrophage-colony stimulating factor (Penco et al., 1995). Recent studies have also shown that some antimicrobial peptides of the cathelicidin family are inducible (Frohm et al., 1997; Agerberth et al., 2000; Wu et al., 2000). Because LF regulates the expression of immune factors (Sorimachi et al., 1997; Son et al., 2002), it might also be involved in the stimulation of cathelicidins such as 39-residue proline–arginine-rich peptide (PR-39) and protegrin-1. However, there are no data of the regulatory effects of LF on PR-39 or protegrin-1. Therefore, this study examined the effect of LF on the growth performance of weanling pigs and on the expression of PR-39 and protegrin-1 genes in the bone 2636 2637 Effect of lactoferrin on weaned piglets Table 1. Ingredient and chemical composition of the basal diet on an as-fed basis Ingredient Maize Soybean meal Wheat middling Yeast Fish meal Stone meal Dicalcium phosphate Premix of the microelement1 Premix of vitamin2 Premix of growth promotant additive Nutrition composition % 59.0 25.0 5.0 1.0 4.0 1.0 2.0 1.0 1.0 1.0 DE,3 MJ/kg Crude protein, % Calcium, % Phosphorus, % Lysine, % Methionine, % 14.46 19.50 0.80 0.66 1.35 0.33 1 The mineral premix provided (per kilogram of feed): Fe (FeSO4ⴢ7H2O), 100 mg; Cu (CuSO4ⴢ5H2O), 6 mg; Mn (MnSO4ⴢH2O), 4 mg; Zn (ZnSO4ⴢ7H2O), 100 mg; I (KI), 0.14 mg; and Se (Na2SeO3), 0.30 mg. 2 The vitamin premix provided (per kilogram of feed): vitamin A, 2,200 IU; vitamin D, 220 IU; vitamin E, 16 mg; vitamin K3, 0.50 mg; thiamine, 1.50 mg; riboflavin, 4.00 mg; pyridoxine, 2.0 mg; cobalamin, 0.020 mg; niacin, 20 mg; D-pantothenic acid, 12.00 mg; biotin, 0.08 mg; and folic acid, 0.30 mg. 3 DE was based on calculated values. marrow. The effect of LF on the villus height and crypt depth of small intestine was also studied. MATERIALS AND METHODS Materials Lactoferrin was provided by the Institute of Feed Science, Zhejiang University, Hangzhou, China. Lactoferrin was isolated from milk (iron saturation is about 17%), with a purity of approximately 90%. Flavomycin and aureomycin were obtained from the National Institute for the Control of Pharmaceutical and Biological Products (NICPBP, Beijing, China). Animals and Experimental Design All procedures were approved by the University of Zhejiang Institutional Animal Care and Use Committee. All the animal experiments were done according to the guidelines for animal experiments at the National Institute of Animal Health. A total of 90 weaned female pigs (Duroc × Landrace × Yorkshire; 16 litters), with an average initial BW of 7.05 kg, were allocated on the basis of BW and litter to 3 dietary treatments in a randomized complete block design for 15 d. There were 3 replicate pens per treatment, and pigs were grouped with 10 pigs per pen. The dietary treatments were (1) basal diet, (2) basal diet + 20 mg of flavomycin/kg + 110 mg of aureomycin/kg, (3) basal diet + 1.0 g of LF/kg. Diets were formulated to meet or exceed NRC guidelines (1998) for 10- to 20-kg pigs. The basal diet did not include antibiotics (Table 1). Pigs were housed in temperature-controlled nursery rooms and grouped in elevated pens with wire flooring. Room temperature was maintained at 29°C. Feed and water were available to the pigs ad libitum. The pigs were weighed individually, and feed consumption per pen was measured weekly throughout the study. Growth performance results, such as ADG, ADFI, and G:F, were subsequently determined for each pen. At the end of the experiment, 6 pigs randomly selected from each treatment (2 piglets per pen) were slaughtered under general anesthesia. Specimens from the middle part of the small intestine were excised, flushed with physiological saline, and fixed in 10% formalin for intestinal morphology. Bone marrow samples from left femur of pigs were aseptically removed and immediately frozen in liquid nitrogen for RNA isolation. Histomorphometry For each intestinal sample, 3 cross-sections were prepared after staining with hematoxylin and eosin using standard paraffin-embedding and staining procedures (Xu et al., 2003). A total of 10 intact, well-oriented cryptvillus units were selected in triplicate for each intestinal cross-section (30 measurements for each sample; total of 180 measurements per dietary treatment). Villus height and crypt depth were determined using an image processing and analysis system (version 1, Leica Imaging Systems Ltd., Cambridge, UK). Total RNA Extraction Total RNA was isolated from the bone marrow using Trizol Reagent (Invitrogen Life Technologies, Carlsbad, CA), according to the manufacturer’s instructions. Briefly, after pulverization and homogenization of the tissue, RNA was extracted from the homogenate with chloroform and then precipitated by isopropanol. The resulting pellets were dissolved in ultrapure water, and the quantity and the quality of total RNA were measured with a spectrophotometer at 260 and 280 nm. Reverse Transcription Two micrograms of total RNA and 2 L of random primers (500 g/mL, Promega Corporation, Madison, WI) were denatured at 70°C for 5 min. The following 2638 Wang et al. Table 2. Specific primers for the PR-39, Protegrin-1, and β-actin genes Gene Accession number Primer source PR-39 L23825 Pig Protegrin-1 X79868 Pig β- actin U07786 Pig Length, bp Oligonucleotide sequence 5′ - CGCTGGTCACTGTGGCTTCT - 3′ (sense primer) 5′- CTGCTTCACTCGCCCATTCT - 3′ (antisense primer) 5′ - CCGTGCTTCGTGCTGTGGA -3′ (sense primer) 5′ - TGCCGTCGCAACCGTCAT -3′ (antisense primer) 5′ - CGGGACCTGACCGACTACCT - 3′ (sense primer) 5′ - GGCCGTGATCTCCTTCTGC - 3′ (antisense primer) components were added in order: 5 L of 5× Reaction Buffer (250 mM Tris-HCl, pH 8.3; 375 mM KCl; 15 mM MgCl2; 50 mM dithiothreitol), 2 L of dNTP mix (10 mM each of dATP, dCTP, dGTP, and dTTP), 1 L of M-MLV reverse transcription (200 U/L, Promega), 0.5 L of rRNasin ribonuclease inhibitor, and nuclease-free water to a final volume of 25 L. The reaction was gently mixed by flicking the tube and was then incubated at 37°C for 60 min. Determination of the Number of PCR Cycles The appropriate number of cycles was established so that the amplification product was not only still in the exponential range but also clearly visible and quantifiable on an agarose gel. One microliter of cDNA solution, obtained by reverse transcription total RNA, was used as the template for PCR amplification in a total volume of 50 L. The optimum PCR primer concentration, Mg2+ concentration, and annealing temperature that would result in linear amplification of each transcript were determined in a preliminary experiment (data not shown). The PCR assay mixture contained the following components: 37.5 L of nuclease-free water, 5 L of 10× PCR reaction buffer, 3 L of MgCl2 (25 M), 1 L of dNTP mix, 1 L of sense primer (20 M), 1 L of antisense primer (20 M), and 0.5 L of Taq DNA polymerase (2 U/L, Promega). All subsequent amplification reaction steps were performed using a GeneAmp PCR System 9600 (Perkin-Elmer, Fremont, CA). The PCR profiles for PR-39, protegrin-1, and β-actin consisted of denaturation at 94°C for 2 min, followed by a varied number of cycles with denaturation at 94°C for 45 s, annealing at 58°C for 45 s, and extension at 72°C for 50 s, and a final extension at 72°C for 10 min. Oligonucleotide primers (ShangHai Sangon Biological Engineering Technology and Service Company, ShangHai, China) specific for porcine PR-39, protegrin-1, and βactin were based on known sequences deposited in GenBank and are listed in Table 2. The PCR amplification products were predicted to be 285 bp for PR-39, 355 bp for protegrin-1, and 411 bp for β-actin. The appropriate number of cycles for each target was determined by assaying amplification products after 23, 25, 27, 29, 31, 33, and 35 cycles, and all other variables remained constant. Polymerase chain reaction products were seen for PR39 (285 bp), protegrin-1 (355 bp), and β-actin (411 bp) 285 355 411 after amplification of bone marrow cDNA using pigletspecific primers. Twenty-nine cycles of amplification were sufficient to allow visualization of products before a plateau was reached. Consequently, 29 cycles were used for the semiquantitative analysis of PR-39, protegrin-1, and β-actin. Reverse-Transcription-PCR Assay The relative concentrations of PR-39 and protegrin-1 mRNA in the bone marrow of different treatment groups were determined by semiquantitative reverse-transcription-PCR (Marone et al., 2001). An equal volume of PR39, protegrin-1, and β-actin cDNA was amplified in 29 cycles with the cycling parameters used during cycle number optimization. A 5-L portion of each PCR product was subjected to electrophoresis on a 1% agarose gel with ethidium bromide. Polymerase chain reaction products were normalized according to the amount of β-actin detected in the same cDNA sample. Electrophoresis band intensities of the PCR products in agarose gels were quantified using Image Master VDS software (Amersham Pharmacia Biotech, Uppsala, Sweden). Mean relative abundance of mRNA for PR-39 and protegrin-1 were normalized against relative abundance of mRNA for β-actin and presented as absolute integrated optical density. Data Analysis Data were analyzed as a randomized complete block using the GLM procedure (SAS Inst. Inc., Cary, NC). A pen of pigs served as the experimental unit for all data. The relative abundance of mRNA for PR-39 and protegrin-1 in piglet bone marrow after different treatments was compared on the basis of the PR-39/β-actin and protegrin-1/β-actin ratios. Differences between treatments were analyzed according to the Bonferroni/Dunn method (Duncan, 1955). Effects were considered significant at P < 0.05. RESULTS Growth Performance Growth performance was improved by LF supplementation (Table 3). Compared with the control, LF treatment increased the ADG by 41.80% (P < 0.01) and increased the efficiency of gain (G:F) by 17.20% (P < 0.05). Effect of lactoferrin on weaned piglets 2639 Table 3. Effect of lactoferrin on growth performance of weaning pigs1 Item Control Antibiotic Lactoferrin SEM Ending BW, kg ADG, g ADFI, g G:F 10.4 239.7a 275.6a 0.87a 11.2 293.4ab 308.1ab 0.95ab 11.8 340.0b 333.1b 1.02b 0.54 20.49 25.40 0.04 a,b Means within a row with different superscript letters differ (P < 0.05). 1 Each mean represents 30 pigs. Control = basal diet; Antibiotic = basal diet + 20 mg of flavomycin/kg + 110 mg of aureomycin/kg; Lactoferrin = basal diet + 1.0 g of lactoferrin/kg. Effect of LF on the Small Intestinal Morphology Compared with the control, supplementation with LF increased villous height by 15.30% (P < 0.05) and decreased crypt depth by 9.60% (P < 0.05; Table 4). Supplementation with antibiotic did not change intestinal villus height or crypt depth (P > 0.05; Table 4). Effect of LF on the Gene Expression of PR-39 Supplemental LF and antibiotic significantly increased the relative abundance of PR-39 by 143% (P < 0.01) and 151% (P < 0.01), respectively, compared with the control group (Figure 1). The difference between LF and antibiotic treatments was not significant. Effect of LF on the Gene Expression of Protegrin-1 Supplemental LF and antibiotic increased the relative abundance of protegrin-1 by 217% (P < 0.01) and 147% (P > 0.05), respectively, compared with the control group (Figure 2). No difference was observed between the LF and antibiotic treatment groups. DISCUSSION At weaning, the digestive system of piglets must adapt to a dry pellet diet instead of liquid milk from the sow. As a consequence, the newly weaned pig is subject to a myriad of stressors that contribute to outbreaks of diarrhea (Pluske et al., 1997) and depressed feed intake and growth (Okai et al., 1976). The results of this study reveal that supplemental LF can effectively increase the Table 4. Effect of lactoferrin on intestinal villus height and crypt depth1 Item Control Antibiotic Lactoferrin SEM Villus height, m Crypt depth, m 213.1a 235.3a 229.1ab 233.0ab 245.6b 212.7b 7.06 6.64 a,b Means within a row with different superscript letters differ (P < 0.05). 1 Each mean represents 6 pigs. Control = basal diet; Antibiotic = basal diet + 20 mg of flavomycin/kg +110 mg of aureomycin/kg; Lactoferrin = basal diet + 1.0 g of lactoferrin/kg. Figure 1. Effect of lactoferrin on the expression of PR-39 in the bone marrow of weanling pigs. A) Electrophoresis results of reverse-transcription-PCR for PR-39 and β-actin in bone marrow. Lane 1: control group; lane 2: antibiotic group; lane 3: lactoferrin (LF) group. B) The integrated optical density (IOD) ratio of each band of PR-39 and βactin for the control group, antibiotic group, and LF group. Densitometric analysis of porcine PR-39 gene expression was normalized to β-actin and shown as PR39/β-actin ratios. Each column represents the mean of 6 individual pigs ± SEM. *P < 0.05. ADG and G:F. The reason for this improved growth performance may be related to the functions of LF. Lactoferrin is an important component of the nonspecific immune system and has antimicrobial, antifungal, and antiviral properties (van der Strate et al., 2001). Our results showed that LF could improve small intestinal morphology and increase PR-39 and protegrin-1 gene expression to some extent, promoting digestion and absorption of nutrition, regulating and enhancing the immunity of 2640 Wang et al. Figure 2. Effect of lactoferrin on the expression of protegrin-1 in the bone marrow of weanling pigs. A) Electrophoresis results of reverse-transcription-PCR for protegrin-1 and β-actin in bone marrow. Lane 1: control group; lane 2: antibiotic group; lane 3: lactoferrin (LF) group. B) The integrated optical density (IOD) ratio of each band of protegrin-1 and β-actin for the control group, antibiotic group, and LF group. Densitometric analysis of porcine protegrin-1 gene expression was normalized to β-actin and shown as protegrin-1/β-actin ratios. Each column represents the mean of 6 individual pigs ± SEM. *P < 0.05. neonatal pigs and thereby partially accounting for the improved growth during weaning. The structure of the intestinal mucosa can reveal some information on gut health. Changes in intestinal morphology such as shorter villus and deeper crypts have been associated with the presence of toxins (Xu et al., 2003). After weaning, villus height is generally reduced and crypt depth increased, which are primarily related to reduced feed intake immediately after weaning (Pluske et al., 1996). In the current study, increases in villus height and decreases in crypt depth at the small intestinal mucosa of the pigs supplemented with LF were observed. Pigs supplemented with LF had greater villus height and lower crypt depth at the small intestinal mucosa, which may contribute to improved growth performance. Antimicrobial peptides are gene-encoded natural antibiotics with potent and broad antimicrobial capabilities that function as a first line of defense in the innate immunity of the host (Ganz, 2002; Lehrer and Ganz, 2002; Zasloff, 2002). A large family of antimicrobial peptides, the cathelicidins, is present in humans, mice, and guinea pigs, and is particularly well represented in domestic animals (Zanetti et al., 2000; Zhang et al., 2000; Ramanathan et al., 2002). Cathelicidin genes contain 4 exons and a 5′-flanking region with clusters of potential transcriptional regulatory motifs such as nuclear factorκB (NF-κB), nuclear factor-IL-6 (NF-IL-6), IL-6-response element (IL-6-RE), selective promoter factor 1 (Sp1), activating protein 2 (Ap-2), and lipopolysaccharide (Wu et al., 2002; Ramanathan et al., 2002). Moreover, it has been shown that some cathelicidins, such as PR-39, are inducible (Agerberth et al., 2000; Wu et al., 2000). Recent research shows that LF can act as a transcription factor and regulator of granulopoiesis and DNA synthesis in some cell types (Kanyshkova et al., 2001). It has been suggested that LF is a member of a novel class of transcription factors that are secreted from 1 cell, taken up by a target cell, and are transported to the nucleus where they bind specific DNA sequence to activate transcription (He and Furmanski, 1995). Therefore, the focus of the current study was to examine the effect of LF on the gene expression of PR-39 and protegrin-1 in weanling pigs. The finding that supplemental LF significantly improves the relative abundance of mRNA for PR-39 and protegrin-1 suggests that LF can regulate the expression of the 2 cathelicidins in the bone marrow of weanling piglets. Whether the effect of LF on the gene expression of PR-39 and protefrin-1 is direct or not is a subject for further study. However, it has been shown that LF binds to specific DNA consensus sequences and can upregulate expression of reporter genes (Garre et al., 1992). This implies that exogenous LF can be internalized and translocated to the nucleus (Brock, 1995; Fleet, 1995). The current study showed that LF could regulate transcription of IL-1β gene and may also regulate transcription of other natural genes containing the LF binding sites (Son et al., 2002). Therefore, a part of LF might be absorbed intact, affect bone marrow mRNA abundance, and improve gene expression of the 2 antimicrobial peptides. Antibiotic affected gene expression of PR-39 but did not significantly affect protegrin-1 gene expression. Components of the gut mucosal barrier and nonspecific immune factors, such as PR-39, are more important to growth and immunity of weanling pigs in the growing phase (Bosi et al., 2003). Lactoferrin is an important component of the nonspecific immune system and has been attributed many physiological roles, such as serving as a regulator of iron metabolism, a nonspecific mediator of inflammation and a component of the host defense system against infection. It is also well known that antimicrobial peptides are important and effective compo- Effect of lactoferrin on weaned piglets nents of innate immunity. Using LF to stimulate the expression of antimicrobial peptides and improve the nonspecific immune system to strengthen the host defenses is a good method of protecting the weanling pigs from infection and weanling stress. Increased production of the antimicrobial peptides may also contribute to improved growth performance. However, further studies are needed to determine if LF regulates other antimicrobial peptides and to find the specific LF binding sites in these peptides. This study showed that supplemental lactoferrin could affect the small intestinal morphology, effectively stimulate expression of PR-39 and protegrin-1, improve nonspecific immunity, and consequently, improve the growth performance of weaned pigs. Further work is needed to characterize the specific lactoferrin binding sites in the antimicrobial peptides. The molecular details would provide information needed for the use of lactoferrin in regulating peptide expression and improving nonspecific immunity in pigs as protection against infections and weanling stress. LITERATURE CITED Agerberth, B., J. Charo, J. Werr, B. Olsson, F. Idali, L. Lindbom, R. Kiessling, H. Jörnvall, H. Wigzell, and G. H. Gudmundsson. 2000. The human antimicrobial and chemotactic peptides LL-37 and α-defensins are expressed by specific lymphocyte and monocyte populations. Blood 96:3086–3093. Bosi, P., C. Gremokolini, and P. Trevisi. 2003. Dietary regulations of the intestinal barrier function at weaning. Asian-australas. J. Anim. Sci. 16:596–608. Brock, J. 1995. Lactoferrin: A multifunctional immunoregulatory protein. Immunol. Today 16:417–419. Choe, Y., and S. Lee. 1999. Effect of lactoferrin on the production of tumor necrosis factor-a and nitric oxide. J. Cell. Biochem. 76:30–36. Crouch, S. P. M., K. J. Slater, and J. Fletcher. 1992. Regulation of cytokine release from mononuclear cells by the iron-binding protein lactoferrin. Blood 80:235–240. Dial, E. J., L. R. Hall, H. Serna, J. J. Romero, J. G. Fox, and L. M. Lichtenberger. 1998. Antibiotic properties of bovine lactoferrin on Helicobacter pylori. Dig. Dis. Sci. 43:2750–2756. Duncan, D. B. 1955. Multiple range and multiple F test. Biometrics 11:1–42. Fleet, J. C. 1995. A new role for lactoferrin: DNA binding and transcription activation. Nutr. Rev. 53:226–231. Frohm, M., B. Agerberth, G. Ahangari, M. Stahle-Backdahl, S. Liden, H. Wigzell, and G. H. Gudmundsson. 1997. The expression of the gene coding for the antibacterial peptide LL-37 is induced in human keratinocytes during inflammatory disorders. J. Biol. Chem. 272:15258–15263. Ganz, T. 2002. Antimicrobial polypeptides in host defense of the respiratory tract. J. Clin. Invest. 109:693–697. Garre, C., G. Bianchi-Scarra, M. Sirito, M. Musso, and R. Ravazzolo. 1992. Lactoferrin binding sites and nuclear localization in K562 (S) cells. J. Cell. Physiol. 153:477–482. He, J., and P. Furmanski. 1995. Sequence specificity and transcriptional activation in the binding of lactoferrin to DNA. Nature 373:721–724. 2641 Kanyshkova, T. G., V. N. Buneva, and G. A. Nevinsk. 2001. Lactoferrin and its biological functions. Biochemistry (Moscow) 66:1–7. Kanyshkova, T. G., D. V. Semenov, V. N. Buneva, and G. A. Nevinsky. 1999. Human milk lactoferrin binds two DNA molecules with different affinities. FEBS Lett. 451:235–237. Lee, W. L. 1998. The protective effects of lactoferrin feeding against endotoxin lethal shock in germ-free piglets. Infect. Immun. 66:1421–1426. Lehrer, R. I., and T. Ganz. 2002. Defensins of vertebrate animals. Curr. Opin. Immunol. 14:96–102. Marone, M., S. Mozzetti, D. D. Ritis, L. Pierelli, and G. Scambia. 2001. Semiquantitative RT-PCR analysis to assess the expression levels of multiple transcripts from the same sample. Biol. Proced. Online 3:19–25. Mattsby-Baltzer, I. 1996. Lactoferrin or a fragment thereof inhibits the endotoxin-induced interleukin-6 response in human monocytic cells. Pediatr. Res. 40:257–262. Okai, D. B., F. X. Aherne, and R. T. Hardin. 1976. Effects of creep and starter composition on feed intake and performance of young pigs. Can. J. Anim. Sci. 56:573–586. Pluske, J. R., I. H. Williams, and F. X. Aherne. 1996. Villous height and crypt depth in piglets in response to increases in the intake of cows’ milk after weaning. Anim. Sci. 62:145–158. Pyong, W. P., B. P. Gerald, T. H. Michael, and M. Bernfield. 2001. Exploitation of syndecan-1 shedding by Pseudomonas aeruginosa enhances virulence. Nature 411:98–102. Pluske, J. R., D. J. Hampson, and I. H. Williams. 1997. Factors influencing the structure and function of the small intestine in weaned pig: A review. Livest. Prod. Sci. 51:215–236. Ramanathan, B., E. G. Davis, C. R. Ross, and F. Blecha. 2002. Cathelicidins: Microbicidal activity, mechanisms of action, and roles in innate immunity. Microbes Infect. 4:361–372. Shinoda, I., M. Takase, Y. Fukuwatari, S. Shimamura, M. Koller, and W. Konig. 1996. Effects of lactoferrin and lactoferricin on the release of interleukin 8 from human polymorphonuclear leukocytes. Biosci. Biotechnol. Biochem. 60:521–523. Son, K. N., J. B. Park, C. K. Chung, D. K. Chung, D. Y. Yu, K. K. Lee, and J. Kim. 2002. Human lactoferrin activates transcription of IL-1β gene in mammalian cells. Biochem. Biophys. Res. Commun. 290:236–241. Sorimachi, K., K. Akimmoto, Y. Hattori, T. Ieiri, and A. Niva. 1997. Activation of macrophages by lactoferrin: Secretion of TNF-alpha, IL-8 and NO. Biotechnol. Biochem. 60:521–523. van der Strate, B. W. A., L. Beljaars, G. Molema, M. C. Harmsen, and D. K. F. Meijer. 2001. Antiviral activities of lactoferrin. Antiviral Res. 52:225–239. Wu, H., C. R. Ross, and F. Blecha. 2002. Characterization of an upstream open reading frame in the 5′ untranslated region of PR39, a cathelicidin antimicrobial peptide. Mol. Immunol. 39:9–18. Wu, H., G. Zhang, J. E. Minton, C. R. Ross, and F. Blecha. 2000. Regulation of cathelicidin gene expression: Induction by lipopolysaccharide, interleukin-6, retinoic acid, and Salmonella enterica serovar typhimurium infection. Infect. Immun. 68:5552–5558. Xu, Z. R., C. H. Hu, M. S. Xia, X. A. Zhan, and M. Q. Wang. 2003. Effects of dietary fructooligosaccharide on digestive enzyme activities, intestinal microflora and morphology of male broilers. Poult. Sci. 82:648–654. Zanetti, M., R. Gennaro, M. Scocchi, and B. Skerlavaj. 2000. Structure and biology of cathelicidins. Adv. Exp. Med. Biol. 479:203–218. Zasloff, M. 2002. Antimicrobial peptides in health and disease. N. Engl. J. Med. 347:1199–1200. Zhang, G., C. R. Ross, and F. Blecha. 2000. Porcine antimicrobial peptides: New prospects for ancient molecules of host defense. Vet. Res. 31:277–296.
0
You can add this document to your study collection(s)
Sign in Available only to authorized usersYou can add this document to your saved list
Sign in Available only to authorized users(For complaints, use another form )