AN ABSTRACT OF THE THESIS OF
Cameron Jack for the degree of Master of Science in Horticulture presented on June
4, 2015.
Title: Colony Level Infection of Honey Bee Gut Pathogen, Nosema ceranae and
Role of Pollen Nutrition in Nosema ceranae Infection and Bee Survival
Abstract approved:
______________________________________________________
Ramesh R. Sagili
Honey bees are important pollinators for many agricultural systems throughout the
world. However, recent honey bee declines have caused great alarm, drawing
attention to the vulnerability of worldwide agriculture to pollinator loss. These
declines are often attributed to a combination of pests, pathogens, viruses, chemicals,
and a lack of proper nutrition. One of the main factors implicated in bee declines is
the fungal pathogen Nosema ceranae. There has been significant research conducted
to understand the effect of Nosema ceranae infection in individual bees, but currently
there is a gap in knowledge regarding Nosema ceranae infection at the colony level.
Also, little is known regarding the effects of bee nutrition on Nosema ceranae
infection and longevity of infected bees. Here I investigated the dynamics of colony
level infection of Nosema ceranae and determined the effects of pollen nutrition on
Nosema ceranae infection and survival of bees.
To understand the dynamics of Nosema ceranae infection at the colony level, I
examined the prevalence (proportion of infected bees) and intensity (number of
spores per bee) in two different field experiments with whole colonies. In the first
experiment, I compared Nosema infection information from bees of known ages to
the traditional method of colony infection diagnosis. In the second experiment, I
analyzed each individual bee from eight experimental nucleus colonies inoculated
with Nosema ceranae to determine the infection prevalence and intensity. I found that
the prevalence and intensity of Nosema ceranae infection was significantly
influenced by honey bee age. Both experiments showed that foraging-aged bees had a
higher prevalence of Nosema infection than younger bees. However, I found that
nurse bees may have spore intensities comparable to or greater than those of forager
bees. These results emphasize the limitations of the traditional Nosema sampling
methods in assessing the colony infection status. My findings are expected to assist in
development of reliable Nosema sampling protocols that could help beekeepers
realistically assess the need for colony treatment.
Nutrition has a profound effect on host-parasite relationships; hence it is imperitive to
understand how honey bee nutrition affects Nosema ceranae prevalence and intensity.
In this study, I examined effects of different concentrations of pollen on the
prevalence and intensity of Nosema ceranae as well as the longevity and nutritional
physiology of infected bees. Significantly higher spore intensities were observed in
treatments that received higher pollen concentrations when compared to treatments
that received relatively lower pollen concentrations. Interestingly, the bees in higher
pollen concentration treatments also had significantly higher survival despite higher
intensities of Nosema ceranae. I found that hypopharyngeal gland protein content was
significantly different between bees infected with Nosema ceranae and bees that were
not infected, but did not find any significant differences in total midgut enzyme
activity between infected and non-infected bees. My results demonstrate that optimal
pollen nutrition increases Nosema ceranae intensity, but also enhances the survival or
longevity of honey bees. The information from this study could be potentially used by
beekeepers to formulate appropriate protein feeding regimens for their colonies to
mitigate Nosema ceranae problems.
©Copyright by Cameron Jack
June 4, 2015
All Rights Reserved
Colony Level Infection of Honey Bee Gut Pathogen, Nosema ceranae and Role of
Pollen Nutrition in Nosema ceranae Infection and Bee Survival
by
Cameron Jack
A THESIS
submitted to
Oregon State University
in partial fulfillment of
the requirements for the
degree of
Master of Science
Presented June 4, 2015
Commencement June 2015
Master of Science thesis of Cameron Jack presented on June 4, 2015
APPROVED:
Major Professor, representing Horticulture
Head of the Department of Horticulture
Dean of the Graduate School
I understand that my thesis will become part of the permanent collection of Oregon
State University libraries. My signature below authorizes release of my thesis to any
reader upon request.
Cameron Jack, Author
ACKNOWLEDGEMENTS
I would like to express my sincere gratitude to my advisor Dr. Ramesh Sagili for
offering me innumerable opportunities to learn and gain experience. He has shown
me by example how to be a successful scientist, mentor, and educator. I would also
like to thank Dr. Jana Lee, Dr. Vaughn Walton, and Dr. Jennifer Parke for serving on
my graduate committee. Their support, advice, and guidance have been instrumental
to this thesis.
The research described in this thesis would have been impossible without the remarkable
members of the Sagili lab: Carolyn Breece, Ashrafun Nessa, Casey Cruse, Jon Dempster,
Chloe Donegan, Jared Jorgensen, Molla Nawsher, Josean Perez, Devon Prescott,
Elizabeth Renshaw, Andrew Richards, Matt Stratton, Ellen Topitzhofer, Wayne Walter,
and Ciera Wilson. I would like to extend my sincere gratitude to Hannah Lucas and
Stephanie Parreira for the amount of time they spent helping me edit and revise this thesis
in addition to their help with the research projects. The work ethic and sense of humor of
the lab members created an ideal work environment and many long-lasting friendships.
I would also like to thank the staff in the Horticulture Department for their continual
support. I would like to express my gratitude to Dr. Ryan Contreras, Dr. Louisa Hooven,
and Dr. Shawn Mehlenbacher for generously sharing their equipment and lab space. I
would especially like to thank Dr. Hiro Nonogaki and his lab members for their
substantial contributions of time and equipment to my research.
Finally, I would like to acknowledge my family for their continuous love. I thank my
Grandpa Gary for teaching me the important role of honey bees and to appreciate the art
of beekeeping. Lastly, I thank my dear companion Kelsey for her never ending
encouragement and support through all adversity.
CONTRIBUTION OF AUTHORS
Conceived and designed the experiments: Cameron Jack, Ramesh Sagili.
Performed the experiments: Cameron Jack, Hannah Lucas.
Analyzed the data: Cameron Jack, Sai Sree Uppala.
Wrote the paper: Cameron Jack.
TABLE OF CONTENTS
Page
Chapter 1: Introduction.......................................................................................................1
1.1 Honey Bee Decline...................................................................................................1
1.2 Characterization of Nosema......................................................................................2
1.2.1 Background on Microsporidia..........................................................................2
1.2.2 Nosema Life Cycle in Honey bees...................................................................2
1.2.3 Comparison of Nosema apis and Nosema ceranae..........................................3
1.2.4 Effects of Nosema ceranae Infection...............................................................4
1.2.4.1 Caste Specific Pathology..........................................................................4
1.2.4.2 Colony Level Pathology...........................................................................6
1.2.5 Nosema Identification......................................................................................7
1.2.6 Nosema Monitoring..........................................................................................7
1.3 Honey Bee Nutrition.................................................................................................8
1.4 Impetus for Thesis Research.....................................................................................9
1.5 Conclusions...............................................................................................................9
1.6 References...............................................................................................................11
Chapter 2: Understanding the Colony Level Prevalence and Intensity of Honey Bee Gut
Pathogen Nosema ceranae..........................................................................................19
2.1 Abstract...................................................................................................................19
2.2 Introduction.............................................................................................................19
2.3 Materials and Methods............................................................................................22
2.3.1 Experiment 1..................................................................................................22
2.3.2 Experiment 2..................................................................................................23
2.3.2.1 Confirmation of Nosema ceranae by DNA Extraction, PCR, and Gel
Electrophoresis........................................................................................25
2.3.2.2 Hypopharyngeal Gland Protein Quantification......................................27
2.3.2.3 Gut pH Analysis......................................................................................28
2.3.3 Data Analysis.................................................................................................29
TABLE OF CONTENTS (Continued)
Page
2.3.3.1 Experiment 1...........................................................................................29
2.3.3.2 Experiment 2...........................................................................................29
2.4 Results.....................................................................................................................30
2.4.1 Experiment 1..................................................................................................30
2.4.1.1 Nosema ceranae Prevalence and Intensity.............................................30
2.4.2 Experiment 2..................................................................................................31
2.4.2.1 Nosema ceranae Prevalence and Intensity.............................................31
2.4.2.2 Hypopharyngeal Gland Protein Content.................................................32
2.4.2.3 Gut pH Analysis......................................................................................32
2.5 Discussion...............................................................................................................33
2.6 Conclusions.............................................................................................................37
2.7 Acknowledgements.................................................................................................38
2.8 References...............................................................................................................39
Chapter 3: Pollen Nutrition Dynamics in Nosema ceranae Infection and Survival in
Honey Bees....................................................................................................................52
3.1 Abstract...................................................................................................................52
3.2 Introduction.............................................................................................................52
3.3 Materials and Methods............................................................................................56
3.3.1 Nosema ceranae Prevalence, Intensity and Survival Analyses......................56
3.3.2 Hypopharyngeal Gland Protein Analysis.......................................................56
3.3.3 Total Midgut Proteolytic Enzyme Activity Analysis.....................................58
3.3.4 Data Analysis.................................................................................................59
3.4 Results.....................................................................................................................60
3.4.1 Consumption of Pollen Diet, Sucrose Solution and Water............................60
3.4.2 Nosema Prevalence and Intensity...................................................................60
3.4.3 Survival Analysis...........................................................................................61
3.4.4 Hypopharyngeal Gland Protein Content........................................................61
TABLE OF CONTENTS (Continued)
Page
3.4.5 Total Midgut Protease Activity......................................................................61
3.5 Discussion...............................................................................................................61
3.6 Conclusions.............................................................................................................64
3.7 Acknowledgements.................................................................................................65
3.8 References...............................................................................................................66
Chapter 4: Summary..........................................................................................................77
4.1 References...............................................................................................................80
Bibliography......................................................................................................................82
Appendices.........................................................................................................................95
Appendix A: Chapter 2 Supporting Information...........................................................96
Appendix B: Chapter 3 Supporting Information...........................................................97
LIST OF FIGURES
Figure
Page
2.1 Establishment of quadruple-cohort colonies. (a) Newly emerged bees from sister
queens were painted on the thorax to indicate a particular age cohort (b) and were then
released into their designated Nosema-free foster colony for aging. (c) Three weeks after
the first cohort was placed in the foster colony, 1,000 painted bees from each cohort were
vacuumed (d) and placed inside a sealed nucleus colony..................................................47
2.2 Mean ± SE Nosema ceranae infection levels of marked bees and background bees at
each age group/sampling date. Marked bees were recently emerged bees at the first
sample date, nurse-aged bees at the second sampling date and foraging-aged bees at the
third sampling date. Mean infection prevalence between marked and background bees on
corresponding collection days were not significantly different (P > 0.05). Mean
prevalence of infection was significantly higher in marked bees sampled on date 3 than
on dates 1 and 2 (P = 0.0043)............................................................................................48
2.3 Median ± SE Nosema ceranae infection intensity of marked bees and background
bees at each age group/sampling date. Marked bees were recently emerged bees at the
first sample date, nurse-aged bees at the second sampling date and foraging-aged bees at
the third sampling date. There were significant differences among the age cohorts
indicated by different letters (P < 0.0001).........................................................................49
2.4 Proportion of bees infected with Nosema ceranae spores within different age cohorts
of all 8 quadruple-cohort colonies combined. Different letters indicate significant
differences between the age cohorts (P < 0.0001).............................................................49
2.5 Median ± SE Nosema ceranae infection intensities within different age cohorts of all
4 quadruple-cohort colonies in 2013 combined. Different letters indicate significant
differences between age cohorts (P < 0.0008)...................................................................50
2.6 Median ± SE Nosema ceranae infection intensities within different age cohorts of all
4 quadruple-cohort colonies in 2014 combined. Different letters indicate significant
differences between age cohorts (P < 0.0213)...................................................................50
2.7 Hypopharyngeal gland protein concentrations of bees within different age cohorts of
the 4 quadruple-cohort colonies in 2013 combined. Different letters indicate significant
differences among the age cohorts (P < 0.0153)...............................................................51
LIST OF FIGURES (Continued)
Figure
Page
2.8 Mean gut pH of Nosema ceranae infected and non-infected honey bees. Triangle
symbols indicate Nosema absent samples; square symbols indicate Nosema present
samples. There was a significant difference in mean gut pH of Nosema ceranae-infected
and non-infected bees (P = 0.0453)...................................................................................51
3.1 Mean number of Nosema ceranae spores per bee (+ SE) fed different pollen
concentrations. Means with different letters indicate significant differences among the
treatments (P < 0.0001)......................................................................................................73
3.2 Survival of bees fed different concentrations of pollen...............................................74
3.3 Mean hypopharyngeal gland protein quantities of bees (+ SE) fed different pollen
concentrations. Different letters indicate significant differences among the treatments
(P < 0.0001).......................................................................................................................75
3.4 Mean midgut proteolytic enzyme activities of bees (+ SE) fed different pollen
concentrations. Different letters indicate significant differences among the treatments
(P < 0.0001).......................................................................................................................76
LIST OF TABLES
Table
Page
2.1 Summary of the age cohorts at time of quadruple-cohort colony establishment and
analysis after two weeks....................................................................................................45
2.2 Summary of Nosema ceranae infection levels and percent of individual bees infected
with Nosema ceranae in each of the five colonies. RE= recently emerged bees, BG=
background bees collected from the inner hive cover, outer frames, hive entrance and
brood area at the same time as each group (RE, Nurse-aged bees, Foraging-aged bees),
NSI = mean number of spores across infected bees, NSS = mean number of spores across
sampled bees (composite sample)......................................................................................45
2.3 Summary of the number of bees analyzed in each of the eight quadruple-cohort
colonies..............................................................................................................................46
3.1 Average consumption of diet, syrup and water per sampling event of treatment bees.
For each row, values followed by different letters are significantly different at P ≤ 0.05
(Least Significant Difference Test)…................................................................................72
1
Chapter 1:
Introduction
1.1 Honey Bee Colony Declines
Honey bees (Apis mellifera L.) are arguably the most important pollinator in agricultural
systems (Klein et al., 2007). Morse and Calderone (2000) estimated the economic value
of honey bee pollination to be $15 billion per year in the United States. However, recent
honey bee declines in North America, Europe, and several other countries have been
reported to be above the normal expected losses (vanEngelsdorp et al., 2009; van der Zee
et al., 2012; Spleen et al., 2013), drawing attention to the vulnerability of worldwide
agriculture to pollinator loss (Gallai et al., 2009).
Honey bee colonies often die during the winter for a number of reasons. Overwintering
losses are generally attributed to starvation, pests, and pathogens. However, during the
winter of 2006/2007 beekeepers in the United States reported a startling amount of losses
of managed colonies (vanEngelsdorp et al., 2007). The losses were mysterious in that the
colonies looked healthy during prior inspections and seemed to disappear for unknown
reasons, a phenomenon labeled as Colony Collapse Disorder, or CCD (vanEngelsdorp et
al., 2009). To date, no single factor has been identified as the cause, though these declines
are often attributed to a combination of pests, pathogens, viruses, chemicals, and a lack of
proper nutrition. One of the main suspects thought to be involved in bee decline is the
fungal pathogen Nosema ceranae.
U.S. beekeepers and researchers describe a pattern of high prevalence of pathogens such
as viruses and Microsporidia with dead and dying colonies (Cox-Foster et al., 2007;
Cornman et al., 2012). While Nosema ceranae was identified in all operations with CCD
symptoms, these studies did not suggest a link between Nosema ceranae and CCD. In
contrast to findings from the U.S., Nosema ceranae infections have been linked to colony
losses in Spain (Higes et al., 2008). However, most published data on colony loss linked
to Nosema ceranae are correlations and require continued investigation (Fries, 2010).
2
1.2 Characterization of Nosema
1.2.1 Background on Microsporidia
Nosema is classified under the phylum Microsporidia, a group of single-celled parasites
known to infect various animal hosts (Wiess & Becnel, 2014). Some well-known
Microsporidia species have been documented infecting salmon (Becker & Speare, 2007),
silk worms (Ma et al., 2013), and even humans (Didier et al., 2005). Microsporidia
cannot grow or divide outside their host cell. The exact mechanisms they use to acquire
resources from their host is an area of continued research (Keeling, 2009).
At the infective stage, a Microsporidian is a thick-walled spore capable of surviving
outside host cells (Weiss & Becnel, 2014). The spore contains a long coiled filament
which is used for infecting the host. Upon germination, the filament ejects quickly,
turning inside out to form a tube (Delbac & Polonais, 2008). The filament is ejected at
such a speed that it acts as a projectile, penetrating the host cell membrane and injecting
its own cytoplasm into the host cell (Keeling, 2009). The microsporidium proliferates
intracellularly, acquiring ATP from the host mitochondria through various mechanisms
(Tsaousis et al., 2008). Upon proliferation, the spores rupture the host cell membrane and
release more spores into the host.
1.2.2 Nosema Life Cycle in Honey bees
The midgut of the honey bee is the ideal environment for Nosema infection as the midgut,
unlike the foregut and hindgut, is not lined with cuticle. The cuticle within the foregut
and hindgut is thought to prevent the filament from penetrating the cell membrane upon
spore germination, thereby preventing the spread of infection in those areas. Nosema
growth and reproduction in honey bees is constrained to the midgut epithelial cells, a
phenomenon not observed in Nosema infections in other insects (Huang et al., 2013). The
conditions which trigger Nosema spore germination within the midgut of the honey bee
are not well understood.
3
Once Nosema spores have germinated and injected their binucleate sporoplasm into the
epithelial cells of the honey bee midgut, proliferation of Nosema proceeds through binary
fission (Fries, 1993; Fries et al., 1996). Approximately 48 hours post infection, newly
formed spores rupture the epithelial cell membrane and either empty into the gut lumen
or germinate spontaneously within the cell cytoplasm infecting adjacent epithelial cells
(de Graaf et al., 1994; Higes et al., 2007). Mature spores will either exit the honey bee via
defecation, enabling them to infect other honey bees, or remain in the midgut to infect
other cells.
1.2.3 Comparison of Nosema apis and Nosema ceranae
There are two species of Nosema known to infect honey bees, Nosema apis (Zander,
1909) and Nosema ceranae (Fries et al., 1996). For over 100 years, the effects of Nosema
apis on European honey bees have been studied, gathering a massive amount of
information regarding this particular host-parasite relationship (Fries, 1993). In contrast,
Nosema ceranae infections in European honey bees have only been studied for a decade.
Nosema ceranae in European honey bees was first recorded in Spain in 2005 (Higes et
al., 2006). Shortly thereafter, the parasite was recorded infecting honey bees in the U.S.
(Chen et al., 2007) and was widely spread throughout the world (Klee et al., 2007).
Presently, few Nosema apis infections are found, as Nosema ceranae has become the
dominant microsporidia infection in European honey bee colonies (Fries, 2010).
Nosema apis infections are often characterized by dysentery in honey bees, causing them
to defecate inside the hive (Bailey, 1955). It is therefore thought that a fecal-oral route of
transmission is the main mode of Nosema apis infection transmission between bees in a
colony. Fecal streaks caused by dysentery near the hive entrance are an outward
indication to beekeepers of Nosema apis infection. However, dysentery does not appear
to be a symptom of Nosema ceranae infection, making it nearly impossible to visually
identify its presence in a colony (Fries et al., 2006; Higes et al., 2008). It has been
reported that Nosema ceranae infection is transmitted between bees as they share food
with one another during the two-way exchange process known as trophallaxis (Smith,
4
2012). Since bees are not defecating inside the hive, an oral-oral route of transmission is
accepted as the main mode of Nosema ceranae infection transmission.
Experimentally, Nosema ceranae has induced significantly higher rates of individual
mortality in honey bees than Nosema apis (Higes et al., 2007; Paxton et al., 2007), though
this has not been confirmed in other cases (Forsgren & Fries, 2010). Data on Nosema
ceranae virulence at the colony level seem to be contradictory (Dainat et al., 2012; Higes
et al., 2013). These discrepancies may be due to variants of Nosema ceranae (Williams et
al., 2008), but comparisons of the strains have failed to show significant differences
(Dussaubat et al., 2012). These inconsistencies may also be due to climatic factors (Weiss
& Becnel, 2014). Given that regional variations may be important, data from long-term
monitoring of Nosema prevalence are needed worldwide.
1.2.4 Effects of Nosema ceranae infection
1.2.4.1 Caste Specific Pathology
A honey bee colony is made up of members physically modified for specific tasks and
functions as a superorganism. Like most eusocial insects, honey bees are divided into
castes, each caste performing specific functions in the colony. Since the anatomy and
physiology of bees belonging to these castes differ in nature, it is therefore necessary to
understand the effect that Nosema ceranae infection has on each caste individually before
we can comprehend how infection affects the entire colony.
The honey bee queen is a specialized female whose main functions are to lay eggs and
produce pheromones that maintain colony cohesion (Caron & Conner, 2013). She
produces a substance called Queen Mandibular Pheromone (QMP), which stimulates
queen attendance and regulates worker behavioral maturation (Slessor et al., 2005).
Alaux et al. (2011) found that the chemical composition of QMP had changed in Nosema
ceranae infected queens. Therefore QMP modification by Nosema ceranae might explain
reports of Nosema-induced queen supersedure, a process by which worker bees kill and
replace a poorly performing queen (Caron & Conner, 2013). Alaux et al. (2011) also
5
reported that Nosema ceranae infected queens’ exhibit twice the normal levels of
vitellogenin (Vg), a yolk precursor protein that influences their egg-laying ability. The
authors suggest that increased Vg synthesis may lead to a long-term depletion of fat body
content, negatively affecting the queen’s nutritional status.
The sperm from drones represents half of the reproductive organs within a colony, yet
drones are often overlooked when studying the effects of Nosema ceranae on colony
productivity. Traver and Fell (2011) found that both drone pupa and adults are
susceptible to natural infections of Nosema ceranae. A study by Reschnig et al. (2014)
found that Nosema ceranae infection has a greater negative effect on drone survival and
body mass than worker honey bees, even at lower spore intensities. Though the biological
impacts of these findings are not well understood, it can be speculated that Nosema
ceranae infection in drones could potentially cause a reduction in fertilization potential
and reproductive success.
The sociality of honey bee colonies is maintained by an age based division of labor in
worker bees. Tasks such as feeding and tending to the queen and larvae are usually
performed by workers during their first two weeks of life. Typically after two weeks,
workers begin tasks such as guarding and foraging for nectar and pollen outside of the
nest. These behaviors are physiologically based (Huang et al., 1994; Amdam & Omholt,
2003; Nelson et al., 2007) and are therefore sensitive to the effects of parasites and
pathogens that alter worker physiology (Holt et al., 2013). Nosema ceranae infection in
worker honey bees has been shown to alter the expression of important hormones
influencing behavior (Vidau et al., 2011; Goblirsch et al., 2013). For example, workers
infected with Nosema ceranae have shortened lifespans and begin dangerous foraging
tasks earlier in life (Higes et al., 2008; Tofilski, 2009; Goblirsch et al., 2013). Precocious
foraging may also be due to the high energetic cost of Nosema ceranae parasitization
(Mayak & Naug, 2009).
As previously mentioned, Nosema ceranae spores greatly weaken midgut epithelial cells
(the main site of nutrient absorption) during replication (Higes et al., 2007). As a result,
6
infected honey bees commonly demonstrate pronounced hunger (Mayak & Naug, 2009)
and are less likely to share food with nestmates via trophallaxis (Naug & Gibbs, 2009).
Furthermore, the presence of Nosema ceranae alters the expression of portions of the
midgut proteome responsible for energy production, protein regulation and antioxidant
defense (Vidau et al., 2014). This disrupts the metabolism of proteins in the midgut and
causes further energetic stress. The disruption of protein metabolism is also manifested in
the atrophy of hypopharyngeal glands (Alaux et al., 2010a), which are necessary for
synthesis of major components of royal jelly and larval brood food (Patel et al., 1960). As
these glands are critical for the rearing of brood, the effect of reduced hypopharyngeal
glands have implications for the health of the colony.
1.2.4.2 Colony Level Pathology
The honey bee colony can be considered as a complex living system that functions as a
whole, thus it is necessary to identify the differences between the pathologies of
individual bees and the colony (Higes et al., 2010). Nosema ceranae infection has a clear
effect at the colony level due to mortality of infected bees and reduced colony vigor
(Higes et al., 2008 & 2009). The decrease in colony population is likely due to the fact
that the heavily infected honey bees do not return to the hive, suggested as a disease
response by honey bees to reduce the pathogen load within the colony (Kralj and Fuchs,
2010). Depopulation of colonies becomes evident when the queen cannot compensate for
the loss of infected bees (Higes et al., 2008).
Nosema ceranae infected colonies have also been observed to exhibit higher winter
mortality rate than non-infected colonies (Higes et al., 2008). This may be due to the
premature death of individual bees during the winter, which reduces colony population
and affects the ability of the remaining bees to regulate temperatures. Poor
thermoregulation may lead to the death of the queen and/or the colony due to the
colony’s failure to keep warm during winter. Additionally, infected colonies are also
reported to have decreased honey production (Higes et al., 2010), possibly leading to
malnourished or starving bees during the winter season. Hungry bees are less likely to
7
share the food they have obtained (Naug & Gibbs, 2009) and as they rely significantly on
each other for food sharing, hence Nosema ceranae can have devastating effects on
colony cohesion.
1.2.5 Nosema Identification
The diagnosis of Nosema infection is traditionally performed using light microscopy
techniques and the infection level is estimated using a hemocytometer to count spores
(Cantwell, 1970). This method allows for an accurate assessment of the presence/absence
of spores as well as the amount of spores per bee. Nosema ceranae spores are slightly
smaller than Nosema apis (4.7 x 2.7 µm) and has fewer filament coils compared to
Nosema apis (Fries et al., 1996). However, the two species are nearly impossible to
identify without the use of molecular assays, particularly because mixed infections occur
frequently (Chen et al., 2009). Several PCR molecular assays have been described for the
detection and identification of Nosema apis and Nosema ceranae, though shortcomings
have been observed in Nosema ceranae specificity (Erler et al., 2012).
1.2.6 Nosema Monitoring
To diagnose colonies for Nosema ceranae infection, most protocols suggest sampling
forager bees from the hive entrance (Higes et al., 2010; Fries et al., 2013) due to the high
infection prevalence of foraging aged bees (Meana et al., 2010; Smart & Sheppard, 2012;
Botías et al., 2013). However, several studies involving Nosema sampling have
demonstrated that bees obtained from the brood area also exhibit significant Nosema
infection (Traver & Fell, 2012; unpublished data Sagili et al.). Thus, there are still many
unknowns regarding the distribution of Nosema ceranae infection within the colony. To
help beekeepers assess the realistic need of colony treatment, further research of colony
level infection dynamics are necessary to develop a more robust Nosema ceranae
sampling protocol.
8
1.3 Honey Bee Nutrition
Like other animals, bees require adequate nutrition to thrive (Haydak, 1970). Honey bees
can forage for nectar and pollen within a 3-mile radius of the hive (Beekman & Ratnieks,
2000); therefore, land use and management practices directly affect honey bee nutrition
(Donkersley et al., 2014). Land management practices have an enormous impact on how
honey bees obtain food and what is available (Decourtye et al., 2010; Keller et al., 2005).
While honey bees rarely face a total absence of food in their environment, they are often
confronted with a lack of diversity of food resource abundance (Di Pasquale et al., 2013).
As current farming practices are largely dependent upon monoculture cropping, a rapid
decline in pollen diversity in agricultural areas has narrowed the range of floral resources
available to bees, which has been shown to have negative effects on colony survival
(Kremen et al., 2002; Naug, 2009).
Honey bees get the vast majority of their required protein, lipids, vitamins and minerals
from pollen (Brodschneider & Crailsheim, 2010). Pollens can greatly differ between
floral species regarding their nutritional contents, (Herbert & Shimanuki, 1978; Roulston
& Cane, 2000), suggesting that some are of better quality for bees than others. While
some pollen types provide adequate nutrition alone (e.g., Rape, Brassica napus L.,
Schmidt et al., 1995), in general, polyfloral pollen is healthier for honey bees (Huang,
2012). Reduced pollen diversity available to honey bees may negatively impact brood
production, gland development, reduce individual bee weight and shorten a honey bee’s
life span (Schmidt, 1984; Schmidt et al., 1987, 1995).
A direct result of nutritional deficiency is a decrease in the resistance threshold of bees to
other stresses. Indeed, pollen intake is known for having a major influence on the
immunity (Alaux et al., 2010b) and tolerance to pathogens like bacteria (Rinderer et al.,
1974), viruses (Degrandi-Hoffman et al., 2010) and microsporidia (Rinderer & Elliot,
1977) and reducing the sensitivity to pesticides Wahl & Ulm, 1983). Even though few
studies have explored the role of protein/pollen nutrition in Nosema ceranae infected
bees (Eischen & Graham, 2008; Di Pasquale et al., 2013), there is still a great degree of
9
uncertainty regarding role of pollen nutrition on the physiology and survival of infected
bees.
1.4 Impetus for Thesis Research
Fumagillin is an antibiotic widely used for over 60 years to control nosema disease in
honey bees (Katznelson & Jamieson, 1952; Bailey, 1953). It has long been used for
Nosema apis control but has also been found to be effective for Nosema ceranae
suppression (Williams et al., 2008; Higes et al., 2011). In an effort to prevent colony
losses, many beekeepers have felt compelled to treat their colonies prophylactically with
fumagillin. Prophylactic treatment has significantly increased hive management costs and
can potentially reduce the effectiveness of fumagillin control of Nosema ceranae (Huang
et al., 2013). In order to properly employ preventative measures to keep colonies from
succumbing to Nosema ceranae infection as well as preventing the overuse of fumagillin,
a more reliable Nosema sampling protocol is needed to provide beekeepers with a
realistic view of colony infection levels.
Further, several beekeepers in Oregon and few other states have claimed that
supplemental feeding of protein to their colonies has increased colony survival and
helped reduce their reliance on fumagillin for Nosema treatment. There was great interest
and support to test this hypothesis since prior studies have shown that resistance to
pathogens can heavily depend upon nutrition (Alaux et al., 2010b). Though few other
studies have explored the role of protein/pollen nutrition in Nosema ceranae infection
and survival of infected bees (Porrini et al., 2011; Zheng et al., 2014), there is still
uncertainty regarding the physiological effects of bee nutrition on Nosema infection.
1.5 Conclusions
Before a more effective Nosema sampling protocol can be developed, colony-level
infection dynamics need to be better understood. Chapter II contains two experiments
which endeavor to describe Nosema ceranae infection at the colony level. The first
experiment specifically addresses questions of colony-level infection dynamics, as well
10
as different approaches to diagnostic sampling. The second experiment is a unique study
that examines the prevalence and intensity of Nosema ceranae in whole colonies (nucleus
colonies) by individually analyzing bees of known age. This study provides an in-depth
look into colony infection dynamics that has not been understood well despite significant
research regarding Nosema ceranae. Additionally, I explored how varying levels of
Nosema ceranae infection intensities influenced the hypopharyngeal gland protein
content of infected bees. Finally, an attempt to identify whether pH has a role in Nosema
ceranae spore germination within the honey bee midgut is also presented in this chapter.
Nutrition has a profound effect on host-parasite relationships, yet little is known on how
honey bee nutrition affects Nosema ceranae prevalence and intensity. Chapter III
contains a study which describes the effect of nutrition on Nosema ceranae infected bees.
For this component of my thesis, I examined effects of different concentrations of pollen
on the prevalence and intensity of Nosema ceranae as well as the longevity and
nutritional physiology of bees inoculated with Nosema ceranae. This study provides new
and timely information concerning the role of nutrition on pathogen resistance and
longevity in honey bees, which will greatly benefit beekeepers in their efforts to mitigate
problems caused by Nosema ceranae.
Researchers and beekeepers throughout the world have been calling for a more effective
and standardized method for Nosema sampling. This thesis provides invaluable
information for designing a comprehensive assessment of colony level infection status. It
also offers supporting evidence to recent claims that proper nutrition aids survival in
Nosema ceranae infected honey bees, and provides further information on the
physiological effects of nutrition in infected bees. This research not only provides greater
insights pertaining to Nosema ceranae infection, but will offer much to the growing effort
to mitigate the harmful effects of Nosema ceranae infection on honey bee colonies.
11
1.6 References
Alaux, C., Brunet, J.L., Dussaubat, C., Mondet, F., Tchamitchan, S., Cousin, M., Brillard,
J., Baldy, A., Belzunces, L.P., Le Conte, Y., 2010a. Interactions between Nosema
microspores and a neonicotinoid weaken honeybees (Apis mellifera). Env.
Microbiol. 12 (3): 774–782.
Alaux, C., Ducloz, F., Crauser, D., Le Conte, Y., 2010b. Diet effects on honeybee
immunocompetence. Biol. Lett. 6: 562-565. doi:10.1098/rsbl.2009.0986.
Alaux, C., Folschweiller, M., McDonnell, C., Beslay, D., Cousin, M., Dussaubat, C.,
Brunet, J.L., Le Conte, Y., 2011. Pathological effects of the microsporidium
Nosema ceranae on honey bee queen physiology (Apis mellifera). J. Invertebr.
Pathol. 106: 380–385.
Amdam, G.V., Omholt, S.W., 2003. The hive bee to forager transition in honeybee
colonies: the double repressor hypothesis. J. Theor. Biol. 223: 451–464. doi:
10.1016/s0022-5193(03)00121-8.
Bailey, L. 1953. Effect of fumagillin upon Nosema apis (Zander). Nat. 171: 212–213.
Bailey, L. 1955. The epidemiology and control of Nosema disease of the honey-bee. Ann.
Appl. Biol. 43: 379-389.
Becker, J.A., D. J. Speare. 2007. Transmission of the microsporidian gill parasite Loma
salmonae. Anim. Health Res. Rev. 8 (1): 59-68.
Beekman, M., Ratnieks, F.L.W., 2000. Long-range foraging by the honey-bee, Apis
mellifera L. Funct. Ecol. 14: 490–496. doi: 10.1046/j.1365-2435.2000.00443.x.
Botías, C., Martín-Hernández, R., Barrios, L., Meana A., Higes, M., 2013. Nosema spp.
infection and its negative effects on honey bees (Apis mellifera iberiensis) at the
colony level. Vet. Res. 44: 25.
Cantwell, G.E., 1970. Standard methods for counting Nosema spores. Am. Bee J. 110:
222-223.
Caron, D.M., Connor, L.J., 2013. Honey bee biology and beekeeping. Kalamazoo, MI:
Wicwas Press, LLC.
Chen, Y., Evans, J.D., Smith, I.B., Pettis, J.S., 2007. Nosema ceranae is a long-present
and wide-spread microsporidian infection of the European honey bee (Apis
mellifera) in the United States. J. Invert. Pathol. 97: 186–188.
Chen, Y., Evans, J.D., Zhou, L., Boncristiani, H., Kimura, K., Xiao, T-G., Litkowski,
A.M., Pettis, J.S., 2009. Asymmetrical coexistence of Nosema ceranae and Nosema
12
apis in honeybees. J. Invertebr. Pathol. 101: 204-209.
doi:10.1016/j.jip.2009.05.012.
Cornman, R.S., Tarpy, D.R., Chen, Y., Jeffreys, L., Lopez, D., Pettis, J.S.,
vanEngelsdorp, D., Evans, J.D., 2012. Pathogen Webs in Collapsing Honey Bee
Colonies. PLoS ONE 7 (8): e43562. doi:10.1371/journal.pone.0043562.
Cox-Foster, D.L., Conlan, S., Holmes, E.C., Palacios, G., Evans, J.D., Moran, N.A.,
Quan, P.L., Briese, T., Hornig, M., Geiser, D.M., Martinson, V., vanEnglesdorp, D.,
Kalkstein, A.L., Drysdale, A., Hui, J., Zhai, J., Cui, L., Hutchison, S.K., Simons,
J.F., Egholm, M., Pettis, J.S., Lipkin, I., 2007. A metagenomic survey of microbes
in honey bee Colony Collapse Disorder. Sci. 318: 283–287.
Dainat, B., vanEngelsdorp, D., Neumann, P., 2012. Colony Collapse Disorder in Europe.
Environ. Microbiol. Rep. 4: 123-125.
de Graaf, D.C., Raes, H., Jacobs, F.J., 1994. Spore dimorphism in Nosema apis
(Microsporida, Nosematidae) development cycle. J. Invertebr. Pathol. 63: 92-94.
Decourtye, A., Mader, E., Desneux, N., 2010. Landscape enhancement of floral resources
for honey bees in agro-ecosystems. Apidologie 41: 264-277.
doi:10.1051/apido/2010024.
Degrandi-Hoffman, G., Chen, Y., Huang, E., Huang, M.H., 2010. The effect of diet on
protein concentration, hypopharyngeal gland development and virus load in worker
honey bees (Apis mellifera L.). J. Insect. Physiol. 56: 1184-1191.
doi:10.1016/j.jinsphys.2010.03.017.
Delbac, F., Polonais, V., 2008. The microsporidian polar tube and its role in invasion.
Subcell Biochem. 47: 208-220.
Di Pasquale, G., Salignon, M., Le Conte, Y., Belzunces, L.P., Decourtye, A.,
Kretzschmar, A., Suchail, S., Brunet, J-L., Alaux, C., 2013. Influence of pollen
nutrition on honey bee health: do pollen quality and diversity matter? PLoS ONE
8(8): e72016. doi:10.1371/journal.pone.0072016.
Didier, E.S., Maddry, J.A., Brindley, P.J., Stovall, M.E., Didier, P.J. 2005. Therapeutic
strategies for human microsporidia infections. Expert Rev. Anti. Infect. Ther. 3:
419–434.
Donkersley, P., Rhodes, G., Pickup, R.W., Jones, K.C., Wilson, K., 2014. Honeybee
nutrition is linked to landscape composition. Ecol. Evol. 4(21): 4195- 4206.
Dussaubat, C., Sagastume, S., Gómez-Moracho, T., Botías, C., García-Palencia, P.,
Martín-Hernández, R., Le Conte, Y., Higes, M., 2013. Comparative study of
13
Nosema ceranae (Microsporidia) isolates from two different geographic origins.
Vet. Microbiol. 162: 670–678. doi: 10.1016/j.vetmic.2012.09.012.
Eischen, F.A., Graham, R.H., 2008. Feeding overwintering honey bee colonies infected
with Nosema ceranae. Am. Bee J. 148: 555.
Erler, S., Lommatzsch, S., Lattorff, H.M.G., 2012. Comparative analysis of detection
limits and specificity of molecular diagnostic markers for three pathogens
(Microsporidia, Nosema spp.) in the key pollinators Apis mellifera and Bombus
terrestris. Parasitol. Res. 110: 1403–1410. doi: 10.1007/s00436-011-2640-9.
Forsgren, E., Fries, I., 2010. Comparative virulence of Nosema ceranae and Nosema apis
in individual European honey bees. Vet. Parasitol. 170 (3-4): 212-217.
Fries, I. 1993. Nosema apis - a parasite in the honey bee colony. Bee World 74 (1): 5-19.
Fries, I., Feng, F., da Silva, A., Slemenda, S.B., Pieniazek N.J., 1996. Nosema ceranae
sp. (Microspora, Nosematidae), morphological and molecular characterization of a
Microsporidian parasite of the Asian honey bee Apis cerana (Hymenoptera,
Apidae). Eur. J. Protistol. 32: 356–365.
Fries, I., Martin, R., Meana, A., Garcia-Palencia, P., Higes, M., 2006. Natural infections
of Nosema ceranae in European honey bees. J. Apic. Res. 45 (3): 230-233.
Fries, I., 2010. Nosema ceranae in European honey bees (Apis mellifera). J. Invertebr.
Pathol. 103: S73–S79.
Fries, I., Chauzat, M.P., Chen, Y.P., Doublet, V., Genersch, E., Gisder, S., Higes, M.,
McMahon, D.P., Martin-Hernandez, R., Natsopoulou, M., Paxton, R.J., Tanner, G.,
Webster, T.C., Williams, G.R. 2013. Standard methods for Nosema research. J.
Apic. Res. 51(5): http://dx.doi.org/10.3896/IBRA.1.52.1.14.
Gallai, N., Salles, J., Settele, J., Vaissière, B. E., 2009. Economic valuation of the
vulnerability of world agriculture confronted with pollinator decline. Ecol. Econ.
68: 810-821.
Goblirsch, M., Huang, Z-Y., Spivak, M. 2013. Physiological and Behavioral Changes in
Honey Bees (Apis mellifera) Induced by Nosema ceranae Infection. PLoS ONE 8
(3): e58165. doi:10.1371/journal.pone.0058165.
Haydak, M.H. 1970. Honey bee nutrition. Annu. Rev. Entomol. 15: 143-156.
doi:10.1146/annurev.en.15.010170.001043.
Herbert, E.W. Jr., Shimanuki, H., 1978. Chemical composition and nutritive value of beecollected and bee-stored pollen. Apidologie 9: 33-40. doi:10.1051/apido:19780103.
14
Higes, M., Martín, R., Meana, A., 2006. Nosema ceranae, a new microsporidian parasite
in honey bees in Europe. J. Invert. Pathol. 92: 93–95.
Higes, M., Garcia-Palencia, P., Martin-Hernandez, R., Meana, A., 2007. Experimental
infection of Apis mellifera honeybees with Nosema ceranae (Microsporidia). J.
Invertebr. Pathol. 94: 211–217.
Higes, M. Martín-Hernandez, R., Botias, C., Bailon, E.G., Gonzales-Porto, A., Barrios,
L., del Nozal, M.J., Palencia, P.G., Meana, A., 2008. How natural infection by
Nosema ceranae causes honeybee colony collapse. Environ. Microbiol. 10: 2659–
2669.
Higes, M., Martín-Hernández, R., Garrido-Bailón, E., González-Porto, A.V., GarcíaPalencia, P., Meana, A., Del Nozal, M.J., Mayo, R., Bernal, J.L., 2009. Honeybee
colony collapse due to Nosema ceranae in professional apiaries, Environ.
Microbiol. Rep. 1: 110–113. doi: 10.1111/j.1758-2229.2009.00014.x.
Higes, M., Martin-Hernandez, R., Meana, A., 2010. Nosema ceranae in Europe: an
emergent type C nosemosis*. Apidologie 41: 375–392.
Higes, M., Nozal, M.J., Alvaro, A., Barrios, L., Meana, A., Martin-Hernandez, R.,
Bernal, J.L., Bernal, J., 2011. The stability and effectiveness of fumagillin in
controlling Nosema ceranae (Microsporidia) infection in honey bees (Apis
mellifera) under laboratory and field conditions. Apidologie 42: 364–377. doi:
10.1007/s13592-011-0003-2.
Higes, M., Meana, A., Bartolome, C., Botias, C., Martin-Hernandez, R., 2013. Nosema
ceranae (Microsporidia), a controversial 21st century honey bee pathogen. Environ.
Microbiol. Rep. 5:17-29.
Holt, H.L., Aronstein, K.A., Grozinger, C.M., 2013. Chronic parasitization by Nosema
microsporidia causes global expression changes in core nutritional, metabolic and
behavioral pathways in honey bee workers (Apis mellifera). BMC Genomics 14:
799. doi: 10.1186/1471-2164-14-799.
Huang, W-F., Solter, L.F., Yau, P.M., Imai, B.S. 2013. Nosema ceranae Escapes
Fumagillin Control in Honey Bees. PLoS Pathog. 9 (3): e1003185.
doi:10.1371/journal.ppat.1003185.
Huang, Z. 2012. Pollen nutrition affects honey bee stress resistance. Terr. Arthropod Rev.
5: 175–189.
Huang, Z-Y., Robinson, G.E., Borst, D.W., 1994. Physiological correlates of division of
labor among similarly aged honey bees. J. Comp. Physiol. A. 174: 731–739. doi:
10.1007/bf00192722.
15
Katznelson, H., Jamieson, C. A., 1952. Control of Nosema Disease of Honeybees with
Fumagillin. Sci. 115 (2977): 70-71.
Keeling, P., 2009. Five Questions about Microsporidia. PLoS Pathog. 5 (9): e1000489.
Keller, I., Fluri, P., Imdorf, A., 2005. Pollen nutrition and colony development in honey
bees, Part II. Bee World 86: 27-34.
Klee, J., Besana, A.M., Genersch, E., Gisder, S., Nanetti, A., Tam, D.Q., Chinh, T.X.,
Puerta, F., Ruz, J.M., Kryger, P., Message, D., Hatjina, F., Korpela, S., Fries, I.,
Paxton, R.J., 2007. Widespread dispersal of the microsporidian Nosema ceranae, an
emergent pathogen of the western honey bee, Apis mellifera. J. Inverteb. Pathol. 96:
1–10.
Klein, A.M., Vaissière, B.E., Cane, J.H., Steffan-Dewenter, I., Cunnigham, S.A.,
Kremen, C., Tscharntke, T., 2007. Importance of pollinators in changing landscapes
for world crops. Proc. R. Soc. 274: 303–313.
Kralj, J., Fuchs, S., 2010. Nosema sp. influences flight behavior of infected honey bee
(Apis mellifera) foragers. Apidologie 41: 21–28.
Kremen, C., Williams, N.M., Thorp, R.W., 2002. Crop pollination from native bees at
risk from agricultural intensification. PNAS 99(26): 16812-16816.
doi:10.1073/pnas.262413599.
Ma, Z., Li, C., Pan, G., Li, Z., Han, B., Xu, J., Lan, X., Chen, J., Yang, D., Chen, Q.,
Sang, Q., Ji, X., Li, T., Long, M., Zhou, Z., 2013. Genome-wide transcriptional
response of silkworm (Bombyx mori) to infection by the microsporidian Nosema
bombycis. PLoS ONE. 8 (12): e84137.
Mayack, C., Naug, D., 2009. Energetic stress in the honeybee Apis mellifera from
Nosema ceranae infection. J. Invertebr. Pathol. 100: 185–188.
Meana, A., Martin-Hernandez, R., Higes, M., 2010. The reliability of spore counts to
diagnose Nosema ceranae infections in honey bees. J. Apic. Res. Bee World, 49
(2): 212–214.
Morse, R.A., Calderone, N.W., 2000. The value of honey bees as pollinators of U.S.
crops in 2000. Bee Cult. 128: 2-15.
Naug, D., Gibbs, A., 2009. Behavioral changes mediated by hunger in honeybees
infected with Nosema ceranae. Apidologie 40 (6): 595-599.
Nelson, C.M., Ihle, K.E., Fondrk, M.K., Page, R.E. Jr., Amdam, G.V., 2007. The gene
vitellogenin has multiple effects on social organization. PLoS Biol. 5: e62. doi:
10.1371/journal.pbio.0050062.
16
Patel, N.G., Haydak, M.H., Gochnauer, T.A., 1960. Electrophoretic components of the
proteins in honeybee larval food. Nat. 186: 633–634.
Paxton, R.J., Klee, J., Korpela, S., Fries, I., 2007. Nosema ceranae has infected Apis
mellifera in Europe since at least 1998 and may be more virulent than Nosema apis.
Apidologie 38: 558–565.
Porrini, M.P., Sarlo, E.G., Medici, S.K., Garrido, P.M., Porrini, D.P., Damiani, N.,
Eguaras, M.J., 2011. Nosema ceranae development in Apis mellifera: influence of
diet and infective inoculum. J. Apic. Res. 50: 35–41. doi:10.3896/IBRA.1.50.1.04.
Retschnig, G., Williams, G.R., Mehmann, M.M., Yañez, O., de Miranda, J.R., Neumann,
P., 2014. Sex-Specific Differences in Pathogen Susceptibility in Honey Bees (Apis
mellifera). PLoS ONE 9 (1): e85261. doi:10.1371/journal.pone.0085261.
Rinderer, T.E., Elliot, K.D., 1977. Worker honey bee response to infection with Nosema
apis: influence of diet. J. Econ. Entomol. 70: 431-433.
Rinderer, T.E., Rothenbuhler, W.C., Gochnauer, T.A., 1974. The influence of pollen on
the susceptibility of honey-bee larvae to Bacillus larvae. J. Invertebr. Pathol. 23:
347-350. doi:10.1016/0022-2011(74)90100-1.
Roulston, T.H., Cane, J.H., 2000. Pollen nutritional content and digestibility for animals.
Plant Syst Evol 222: 187-209. doi:10.1007/BF00984102.
Schmidt, J.O., 1984. Feeding preference of Apis mellifera L. (Hymenoptera: Apidae):
individual versus mixed pollen species. J. Kans. Entomol. Soc. 57: 323-327.
Schmidt, J.O., Thoenes, S.C., Levin, M.D., 1987. Survival of honey bees, Apis mellifera
(Hymenoptera: Apidae), fed various pollen sources. J. Econ. Entomol. 80: 176-183.
Schmidt, L.S., Schmidt, J.O., Rao, H., Wang, W., Xu, L., 1995. Feeding preference of
young worker honey bees (Hymenoptera: Apidae) fed rape, sesame, and sunflower
pollen. J. Econ. Entomol. 88: 1591–1595.
Slessor, K.N., Winston, M.L., Le Conte, Y., 2005. Pheromone communication in the
honeybee (Apis mellifera L.). J. Chem. Ecol. 31 (11): 2731-45.
Smart, M., Sheppard, W., 2012. Nosema ceranae in age cohorts of the western honey bee
(Apis mellifera). J. Invert. Pathol. 109: 148–151.
Smith, M.L., 2012. The Honey Bee Parasite Nosema ceranae: Transmissible via Food
Exchange? PLoS ONE 7 (8): e43319. doi:10.1371/journal.pone.0043319.
Spleen, A.M., Lengerich, E.J., Rennich, K., Caron, D., Rose, R., Pettis, J.S., Henson, M.,
Wilkes, J.T., Wilson, M., Stitzinger, J., Lee, K., Andree, M., Snyder, R.,
17
vanEngelsdorp, D., 2013. A national survey of managed honey bee 2011-12 winter
colony losses in the United States: results from the Bee Informed Partnership. J
Apicult. Res. 52 (2): 44-53.
Tofilski, A., 2009. Shorter-lived workers start foraging earlier. Insectes Soc. 56: 359–
366.
Traver, B.E., Fell, R.D., 2011. Nosema ceranae in drone honey bees (Apis mellifera). J.
Invertebr. Pathol. 107 (3): 234-236.
Traver, B.E., Williams, M.R., Fell, R.D., 2012. Comparison of within hive sampling and
seasonal activity of Nosema ceranae in honey bee colonies. J. Invertebr. Pathol.
109: 187-193.
Tsaousis, A.D., Kunji, E.R.S., Goldberg, A.V., Lucocq, J.M., Hirt, R.P., Embley, T.M.,
2008. A novel route for ATP acquisition by the remnant mitochondria of
Encephalitozoon cuniculi. Nat. 453: 553–556.
Vidau, C., Diogon, M., Aufauvre, J., Fontbonne, R., Viguès, B., Brunet, J.L., Texier, C.,
Biron, D.G., Blot, N., El Alaoui, H., Belzunces, L.P., Delbac, F., 2011. Exposure to
sublethal doses of fipronil and thiacloprid highly increases mortality of honeybees
previously infected by Nosema ceranae. PLoS ONE. 6 (6):e21550.
doi:10.1371/journal.pone.0021550.
Vidau, C., Panek, J., Texier, C., Biron, D.G., Belzunces, L.P., Le Gall, M., Broussard, C.,
Delbac, F., El Alaoui, H., 2014. Differential proteomic analysis of midguts from
Nosema ceranae-infected honeybees reveals manipulation of key host functions. J.
Invertebr. Pathol. 121: 89–96. doi:10.1016/j.jip.2014.07.002.
van der Zee, R., Pisa, L., Andonov, S., Brodschneider, R., Charrière, J-D., Chlebo, R.,
Coffey, M.F., Crailsheim, K., Dahle, B., Gajda, A., Gray, A., Drazic, M.M., Higes,
M., Kauko, L., Kence, A., Kence, M., Kezic, N., Kiprijanovska, H., Kralj, J.,
Kristiansen, P., Martin- Hernandez, R., Mutinelli, F., Nguyen, B.K., Otten, C.,
Özkırım, A., Pernal, S.F., Peterson, M., Ramsay, G., Santrac, V., Soroker, V.,
Topolska, G., Uzunov, A., Vejsnæs, F., Wei, S., Wilkins, S., 2012. Managed honey
bee colony losses in Canada, China, Europe, Israel and Turkey, for the winters of
2008-9 and 2009-10. J. Apicult. Res. 51 (1): 100-114.
vanEngelsdorp, D., Underwood, R., Caron, D., Hayes, J., 2007. An estimate of managed
colony losses in the winter of 2006-2007; a report commissioned by the apiary
inspectors of America. Am. Bee. J. 147: 599-603.
vanEngelsdorp, D., Evans, J.D., Saegerman, C., Mullin, C., Haubruge, E., Nguyen, B.K.,
Frazier, M., Frazier, J., Cox-Foster, D., Chen, Y., Underwood, R., Tarpy, D.R.,
Pettis, J.S., 2009. Colony collapse disorder: a descriptive study. PLoS ONE 4
(8):e6481.
18
Wahl, O., Ulm, K., 1983. Influence of pollen feeding and physiological condition on
pesticide sensitivity of the honey bee Apis mellifera carnica. Oecologia 59: 106128. doi:10.1007/BF00388082.
Wiess, L.M., Becnel, J.J., 2014. Microsporidia: Pathogens of Opportunity. Hoboken, NJ:
Wiley-Blackwell.
Williams, G.R., Sampson, M.A., Shutler, D., Rogers, R.E., 2008. Does fumagillin control
the recently detected invasive parasite Nosema ceranae in western honey bees (Apis
mellifera)? J. Invertebr. Pathol. 99: 342–344.
Zander, E. 1909. Tierische parasiten als krankenheitserreger bei der biene. Münch
Bienenztg 31: 196-204.
Zheng, HQ., Lin, ZG., Huang, SK., Sohr, A., Chen, YP., 2014. Spore loads may not be
used alone as a direct indicator of the severity of Nosema ceranae infection in
honey bees Apis mellifera (Hymenoptera:Apidae). J. Econ. Entomol. 107 (6): 20372044.
19
Chapter 2:
Understanding the Colony Level Prevalence and Intensity of the Honey Bee Gut
Pathogen Nosema ceranae
2.1 Abstract
Recently, honey bee colonies have been reported to be infected with a relatively new
species of gut pathogen called Nosema ceranae. Little is known about colony level
prevalence and intensity of Nosema ceranae. Two experiments were conducted in order
to determine the importance for improved colony sampling methods for Nosema infection
and to understand the dynamics of Nosema ceranae infection at the colony level. The
first experiment compared the infection results from bees of known ages to the tradition
method of colony diagnosis of Nosema infection. The second experiment analyzed each
individual bee from eight quadruple-cohort colonies inoculated with Nosema ceranae to
determine the prevalence and intensity of infection within age cohorts as well as
determine the effects of Nosema ceranae on hypopharyngeal gland protein and midgut
pH level. In both experiments, foraging-aged bees had the highest prevalence of Nosema
infection. The second experiment showed that nurse-aged bees may have spore intensities
greater than those of forager-aged bees. Hypopharyngeal gland protein was not
influenced by Nosema ceranae infection severity, however a higher gut pH was observed
in Nosema ceranae infected bees. I determined that the prevalence and intensity of
Nosema ceranae infection is significantly influenced by honey bee age. Such results
emphasize the hazard of using composite sampling to determine the extent of Nosema
infections within a colony. Measuring the presence of Nosema ceranae in individual bees
of mixed, but known ages will provide a more complete and more accurate assessment of
infection level.
2.2 Introduction
Nosema ceranae is a microsporidian gut parasite that was recently found infecting
European honey bees (Apis mellifera) (Higes et al., 2006; Klee et al., 2007; Chen et al.,
20
2008). Nosema ceranae infection has been shown to increase colony loss (Higes et al.,
2008; Higes et al., 2009a) and there is evidence to suggest it as a contributing factor in
collapsing colonies (Cox-Foster et al., 2007; Bromenshank et al., 2010; vanEngelsdorp et
al., 2009). Once Nosema ceranae spores are ingested, they germinate inside the host
midgut, infecting the epithelial cells (Fries et al., 1996; Fries 2010). Intracellular
proliferation of Nosema ceranae will eventually burst the epithelial cell membrane, thus
destroying the cells (Higes et al., 2007). The combined effects of cell destruction and
energy parasitism in infected honey bees often manifest increased hunger levels (Mayak
& Naug, 2009) and decreased food sharing with nestmates via trophallaxis (Naug &
Gibbs, 2009).
Some studies indicate that the intensity of Nosema ceranae infection varies greatly
among bees of an infected colony—most bees apparently exhibiting no signs of infection,
while others show extremely high spore intensities (Smart & Sheppard, 2012; El-Shemy
& Pickard, 1989). Therefore, a few highly infected bees in a sample may greatly
misrepresent the level of infection, possibly providing a false perception of colony health.
Currently, there is no standardized method for Nosema ceranae sampling of colonies.
Many studies have used the number of spores from composite samples to determine
colony infection status (Burgher-MacLellan et al, 2010; Williams et al., 2010; Botías et
al., 2012a; Traver & Fell, 2012); though others have suggested that measuring the
proportion of infected individuals may be more accurate (Meana et al., 2010; Botías et
al., 2012b).
Forager bees are likely to have higher Nosema infection levels than do nurse bees (Higes
et al., 2008; Meana et al., 2010; Botías et al., 2012b; Martín-Hernández et al., 2012;
Smart & Sheppard, 2012; Botías et al., 2013); hence many studies have diagnosed
Nosema infections from samples comprised solely of foragers taken from the hive
entrance. However, several studies involving Nosema sampling have demonstrated that
bees obtained from the brood area also exhibit significant Nosema infection (Traver et al.,
2012; unpublished data Sagili et al.). Thus, there is still much to learn regarding the
distribution of Nosema ceranae infection within the colony.
21
Another area of concern regarding Nosema ceranae infections is the poor development of
the hypopharyngeal glands in infected honey bees. Hypopharyngeal gland secretions are
the major components of the protein-rich diet supplied to honey bee larvae by nurse
bees—royal jelly and brood food (Patel et al., 1960). Therefore, any negative impact on
the development of these glands could greatly affect colony health and size. It is known
that the presence of Nosema apis decreases hypopharyngeal gland protein content
(Malone & Gatehouse, 1998; Wang & Moeller, 1971) and alters the composition of
secretions (Liu, 1990). Though Nosema ceranae has not been detected in the
hypopharyngeal gland tissue (Huang and Solter, 2013), recent research has shown that its
parasitism of honey bees diminishes protein content in hypopharyngeal glands (personal
unpublished data). However, we currently do not know if and how different levels of
Nosema ceranae infection influence hypopharyngeal gland protein production.
Gut pH is a critical factor in insect health; it is essential for digestion as well as
maintaining gut microflora. But little is known about the relationship between gut pH and
Nosema infection, as only a few preliminary studies, published decades ago, describe
their interactions. Early literature from Bailey (1955) suggests that gut pH alone does not
trigger Nosema apis germination, however Jaronski (1979) concluded that Nosema
algerae spore germination was influenced by pH stimuli. Additionally, the effect of pH
on priming Nosema michaelis spores for germination is described by Weidner (1972).
Ishihara (1967) also described a higher rate of polar filament extrusion, an important step
in spore reproduction, in the microsporidium Glugea fumiferanae, at higher pH. Hence it
may then be possible for a specific gut pH level to provide an environment more
conducive to spore germination. A better understanding of how honey bee gut conditions
influence Nosema ceranae proliferation would greatly advance our efforts in mitigating
Nosema ceranae infections. To my knowledge, no prior work exists concerning the
effects of gut pH on Nosema ceranae.
The research presented here included two experiments intended to illustrate the dynamics
of a Nosema ceranae infection within the colony. The first of these experiments was
adapted from the methods of Smart and Sheppard (2012), who sampled bees of known
22
ages from colonies to describe colony infection status. In the second experiment, I
examined entire colonies that were infected with Nosema ceranae by mass inoculation
method. The main objective of both studies was to characterize the prevalence
(proportion of infected bees) and intensity (number of spores per bee) of Nosema ceranae
infection at the colony level. Further objectives of the second experiment included the
quantification of changes in hypopharyngeal gland protein at different intensities of
Nosema infection and the examination of a potential relationship between Nosema
ceranae infection and honey bee gut pH. I hypothesized that as honey bee age increased,
Nosema ceranae intensity and prevalence would also increase. Furthermore, I
hypothesized that as Nosema ceranae infection intensity increased, hypopharyngeal gland
protein content would decrease and that a relationship exists between Nosema infection
and honey bee gut pH.
2.3 Materials and Methods
2.3.1 Experiment 1
Five colonies naturally infected with Nosema ceranae were selected in July 2013 from a
single Oregon State University apiary (Corvallis, OR, USA). Prior to the experiment, I
identified the Nosema species in all five colonies as Nosema ceranae using DNA analysis
following the methods of Hamiduzzaman et al. (2010). Two or three capped combs with
emerging bees were collected from each of the five colonies and were incubated in the
lab under simulated hive conditions (33° C, 55% RH) for bee emergence. Incubating
brood combs were checked for emerging bees 16 hours later. Newly emerged bees were
color-coded by colony with a dot of TestorsTM enamel paint on the thorax. Once at least
500 newly emerged bees per colony had been painted, they were returned to their original
colonies. Fifty recently emerged bees per colony were also retained to establish a baseline
infection level of Nosema ceranae.
From each of these five experimental colonies, fifty marked (painted) bees were collected
during midday 8-11 days post-emergence and again at 22-25 days post-emergence. These
sampling periods represent the nursing and foraging phases, respectively, of a worker
23
bee, as honey bees exhibit temporal polyethism. While collecting these fifty marked bees,
an additional sample of fifty unmarked bees (background bees) was also collected from
each colony. This sample of background bees consisted of an equal mix of bees from the
brood area, colony cover (lid), colony entrance and outer combs in the colony. Smart and
Sheppard (2012) collected such background bee samples only from the inner colony
cover in their study. The infection intensity and prevalence of Nosema ceranae in these
random samples of mixed aged bees were compared to the infections of the marked bees
of known age.
The prevalence and intensity of Nosema infection in all collected bees were determined
following light microscopy techniques as described by Cantwell (1970). Briefly, each bee
abdomen was macerated by mortar and pestle in 1 ml of distilled water. A 10 µl drop of
that solution was placed on a hemocytometer (Cat # 3200, Hausser Scientific, PA, USA),
from which spores were counted at 400X magnification. All marked bees collected were
analyzed individually. Although background bees were collected as composite samples,
they too were analyzed individually. This permitted us to observe the prevalence and
intensity of infection in the bees comprising a composite sample, which is usually not
known because all bees are typically analyzed together. Furthermore, individually
analyzing bees from the composite samples allowed me to observe if any significant
differences exist between sampling bees of known ages and traditional composite
samples.
2.3.2 Experiment 2
In order to evaluate the characteristics of Nosema ceranae infections in whole colonies
across multiple age cohorts, I established nucleus colonies with bees of known ages and
then quantified the prevalence and intensity of Nosema infection in these bees. I collected
bee samples from the brood area of several colonies at Oregon State University’s apiaries
(Corvallis, OR, USA) in July 2013 and May 2014, and examined them for the presence of
Nosema using light microscopy as described above. Then, during each year, four colonies
determined to be Nosema-free were randomly selected to serve as foster colonies for the
24
bees used to establish experimental nucleus colonies. The nucleus colonies were
established according to standard methods used for triple-cohort colonies (Giray &
Robinson, 1994; Le Conte et al., 2001; Sagili et al., 2011); however, I created an
additional fourth cohort. Each quadruple-cohort colony was established with 1,000 bees
each of the following age groups: 1) one day old bees 2) one week old bees 3) two week
old bees 4) three week old bees. A total of eight nucleus colonies (eight replications)
were established for this study. For the purposes of brevity, cohorts will herein be
referred to by their age at time of colony establishment (as described above). Because
bees were sacrificed for analysis two weeks after inoculation (see below), each cohort
was two weeks older at time of analysis than at time of colony establishment (Table 2.1).
For establishing nucleus colonies, capped combs with emerging bees were obtained from
honey bee colonies headed by sister queens and were incubated in the lab under
simulated hive conditions (33° C, 55% RH) for bee emergence. Sister queen colonies
were used to control any variation in Nosema infection attributed to genetics of the bees.
Incubating brood combs were checked after 16 hours for emerging bees. Four weeks
prior to establishing my quadruple-cohort colonies, newly emerged bees were painted on
the thorax with Testors™ enamel paint to indicate a particular age cohort and were then
released into their designated Nosema-free foster colonies for aging. Each cohort of bees
was painted a unique color. At least 2,000 newly emerged bees per target cohort were
released into foster colonies at a time to ensure that 1,000 bees per cohort could be easily
found at time of final collection when establishing nucleus colonies.
Three weeks after the first cohort was placed in the foster colony, 1,000 painted bees
from each cohort were vacuumed with a BioQuip Insect Vac™ (Cat # 2820GA, BioQuip
Products Inc., CA, USA) and placed inside a nucleus colony with closed entrance
(Summarized in Fig. 2.1). Each quadruple-cohort colony contained three empty combs,
one honey comb and one comb containing uncapped brood. The following day, referred
to as day 1, entrance blockers on the nucleus colonies were removed and the bees were
allowed to forage freely. Also on day 1, any existing non-painted bees that were
accidentally vacuumed up with painted bees were removed, and a queen in a sealed
25
queen cage was placed inside the colony. On day 2, the sealant on the queen cage was
removed, so that bees could release the queen on their own. On day 3, the Nosema
ceranae spores were fed to bees in the nucleus colonies through mass inoculation
methods as described below.
Prior to inoculation, DNA analysis was performed using the methods of Hamiduzzaman
et al. (2010) to confirm that only Nosema ceranae spores were used in the inoculum. The
spore concentration of the inoculating solution was formulated following the methods of
Fries et al. (2013). Spores were purified through centrifugation and the Nosema ceranae
solution was prepared in 100 ml of sugar syrup at a concentration sufficient to inoculate
4,000 bees with 10,000 spores per bee. I provided the spore inoculant to experimental
colonies via inverted mason jars placed over a hole on the colony lid. After the spore
inoculant was consumed completely, bees were fed 300 ml of pure sugar syrup. Two
weeks after inoculation, colony entrances were blocked late in the evening and the
colonies were placed inside a -20 °C freezer for two days. The sacrificed bees were then
removed from frozen combs, separated into respective cohorts based on paint color, and
counted.
The prevalence and intensity of Nosema infection in each bee were determined by light
microscopy techniques of Cantwell (1970) described previously. Similarly the queens
from each of the eight nucleus colonies were tested for Nosema infection. The macerated
gut extracts were stored at -20 °C for pH analysis and Nosema species confirmation.
2.3.2.1 Confirmation of Nosema ceranae by DNA Extraction, PCR, and Gel
Electrophoresis
Gut samples used to determine the prevalence and intensity of Nosema infection were
saved at -20 °C if spores were detected. In order to confirm the species of Nosema spores
found in experimental bees, I randomly selected the Nosema-positive gut samples from
one of the four age cohorts from every colony, such that each age cohort was selected
once within each year’s set of colonies. From these randomly selected Nosema-positive
gut samples, I created DNA samples using phenol:chloroform extraction and alcohol
26
precipitation. Briefly, 2 ml of the bee gut-spore homogenate were well mixed with an
equal volume of phenol:chloroform:isoamyl alcohol (25:24:1), further macerated by
mortar and pestle, and centrifuged at 12,000 rpm for 3 minutes, at room temperature.
The resulting upper aqueous layer was then vigorously mixed with an equal volume of
phenol:chloroform:isoamyl alcohol solution and centrifuged again. The new upper
aqueous layer was gently mixed with an equal volume of room temperature 100%
isopropyl alcohol, incubated at room temperature for 15 minutes and centrifuged as
before. Finally, the resulting pellet was washed with 1 ml of ice cold 80% ethanol,
centrifuged again as before, air dried for 1 hour at room temperature, and resolubilized in
20 µl of chilled, autoclaved distilled water. The nucleic acid concentration of each DNA
sample was quantified on a Take3 micro-volume plate in a Biotek Synergy 2 plate reader
(BioTek Instruments, Inc., VT, USA) and then stored at -20 °C until time of PCR
reactions.
DNA samples were used in the co-amplification of the 16S rRNA gene of Nosema apis
and Nosema ceranae and the honey bee ribosomal protein S5 gene (RpS5) in the same
multiplex PCR reaction. Each 50 µl reaction contained 5 µl of 10X Ex Taq® Buffer (Cat
# RR001A, Takara Bio Inc., Shiga, Japan), 4 µl of 2.5 mM dNTPs (Cat # RR001A,
Takara Bio Inc.), 1 µl of 10 µM of each primer (MITOC and RpS5: BioNeer Corp., CA,
USA; NAPIS: IDT Inc., IA, USA), 0.25 µl of 5U/ µl Ex Taq® DNA Polymerase (Cat #
RR001A, Takara Bio Inc.), approximately 100 ng of template DNA and sterile distilled
water to bring to volume. All PCR reactions were performed in a GeneAmp® PCR
System 9700 thermocycler (Applied Biosystems, CA, USA), programmed as follows:
94 °C for 2.5 min, followed by 10 cycles of 94 °C for 15 sec, 62 °C for 30 sec, and 72 °C
for 45 sec; then 20 cycles of 94 °C for 15 sec, 62 °C for 30 sec, and 72 °C for 50 sec;
with a final extension step of 72 °C for 7 min (modified from Martin-Hernandez et al.,
2007 and Hamiduzzaman et al., 2010).
Primers amplifying a 218 bp product within the Nosema ceranae 16S rRNA gene were:
MITOC-F (5’ CGGCGACGATGTGATATGAAAATATTAA 3’) and MITOC-R (5’
CCCGGTCATTCTCAAACAAAAAACCG 3’) (Martin-Hernandez et al., 2007). Primers
27
amplifying a 788 bp product within the Nosema apis 16S rRNA gene were: NAPIS-F (5’
GCATGTCTTTGACGTACTATG 3’) and NAPIS-R (5’
CTCAGATCATATCCTCGCAG 3’). The NAPIS primers were designed based on
ClustalW (http://www.ebi.ac.uk/Tools/msa/clustalw2/) alignments of Nosema species
sequences published in the GenBank database (http://www.ncbi.nlm.nih.gov/GenBank/):
Nosema apis accession numbers DQ235446, U76706, U97150, U26534, X73894,
X74112; Nosema ceranae accession numbers DQ329034, U26533, DQ078785,
DQ286728. As a standard control, a 115 bp segment of the Apis mellifera house-keeping
gene RpS5 was amplified in all samples using the primers RpS5-F (5’
AATTATTTGGTCGCTGGAATTC 3’) and RpS5-R (5’
TAACGTCCAGCAGAATGTGGTA 3’) (Thompson et al., 2007). Reference DNA
samples for Nosema apis and Nosema ceranae were obtained from the Solter lab at
University of Illinois Urbana-Champaign. The PCR products were separated by
electrophoresis in a 2% agarose gel stained with 5% Midori Green (Cat # MG03, Nippon
Genetics, Düren, Germany) and run at 100 volts. For reference, a 100 bp DNA ladder
(Cat # G2101, Promega Corp., WI, USA) was included.
2.3.2.2 Hypopharyngeal gland protein quantification
The heads of all bees analyzed for Nosema (as described previously) were placed in
individual 0.5ml microcentrifuge tubes and stored at -20 °C until time of hypopharyngeal
gland protein quantification. Only bees from the four 2013 quadruple-cohort colonies
were used for hypopharyngeal gland protein analysis. Sixty heads from each age cohort
(from all four colonies combined) were separated into three groups of 20 based on
Nosema ceranae infection levels (Nosema free, low infection, high infection). Infection
levels were based on the availability of bees within a similar range of spore intensity as
follows: Nosema free bees with absolutely no spores detected; bees with low level of
infection (between 7.5 x 105 and 1.2 x 106 spores/bee); bees with high infection level
(between 3.685 x 107 and 5.76 x 107 spores/bee).
28
I collected the complete pair of hypopharyngeal glands from each of these stored heads.
The glands from each individual bee were stored separately in 1.5 ml microcentrifuge
tubes containing 5 µl PBS (Phosphate Buffered Saline, Sigma-Aldrich) and stored at 80 °C until time of analysis. During protein analysis I added 115µl of PBS to each pair of
glands (for a total PBS volume of 120 µl) and homogenized them with one 3-mm
tungsten carbide bead in a Qiagen® TissueLyser II (20 oscillations/sec., 2 x 45 sec.). The
samples were then centrifuged at room temperature for 2 minutes at 13,300 rpm to pellet
the debris.
I quantified the protein content of the resulting supernatant of each homogenized sample
with the Pierce™ Biotech BCA Assay Kit (Cat # 23225, Thermo-Scientific, IL, USA)
microplate procedure. These samples were homogenized in PBS; therefore, PBS was
used as the diluent for the Bovine Serum Albumin (BSA) standards and the blank. BSA
standard solutions were stored at -20 °C and used for several consecutive days. I loaded
25 µl of each sample, standard and blank into each of two duplicate wells on a 96-well
plate. Plating this volume allows the assay to have a protein detection range of 25-2000
µg/ml. After addition of the BCA working reagent (200 µl/well), the plate was shaken for
30 seconds on a microplate spectrophotometer (BioTek Synergy 2, Gen5 2.00 software).
The plate was then incubated uncovered for 30 minutes at 37 °C, followed by 12 minutes,
covered, at 4 °C. Absorbance at 562 nm was measured using the same spectrophotometer
as above and protein concentration in µg/ml was calculated from the resulting standard
curve. Due to a slight dilution error in the samples on one plate (150 µl of PBS were
added to each pair of glands), the resulting µg/ml outputs for samples of this plate were
adjusted to compensate for the greater dilution, thus allowing them to be analyzed and
reported on the same scale as all other samples.
2.3.2.3 Gut pH Analysis
For each of the eight experimental colonies, 50 random Nosema positive and 50 random
Nosema negative macerated gut samples from the 3 week, 2 week and 1 week old cohorts
were preserved for pH measurement. Samples from the one day old cohort were not
29
retained for pH analysis due to the low prevalence of Nosema infection. For a given
nucleus colony and cohort, the Nosema positive and Nosema negative gut samples were
each collected in a set of five vials (ten 1-ml macerated samples per vial), for a total of 30
vials per colony. Samples were stored at -20 °C until time of analysis, when they were
thawed and the pH in each vial was measured using a Waterproof pH EcoTester™ (Cat #
WD-35423-10, Oakton Instruments, IL, USA).
2.3.3 Statistical Analyses
2.3.3.1 Experiment 1
All statistical analyses were performed using the statistical software SAS 9.3. Nosema
ceranae prevalence and intensity data were analyzed using general linear models (PROC
GLM; SAS 9.3) for differences among the sampling periods. Intensity data were log
transformed to meet normality assumptions. Mean separations were performed using
least significant difference (LSD) test (P < 0.05). After statistical analysis, data were
back-transformed as needed for presentation herein.
2.3.3.2 Experiment 2
All statistical analyses were performed using the statistical software SAS 9.3. Nosema
ceranae prevalence and intensity data were analyzed using generalized linear models
(PROC GLIMMIX; SAS 9.3) for differences between age cohorts. Both prevalence and
intensity data were log transformed to meet normality assumptions. Mean separations
were performed using least significant difference (LSD) test (P < 0.05). Gut pH and
hypopharyngeal gland protein content data were analyzed using mixed linear models
(PROC MIXED; SAS 9.3). Mean separations were again performed using least
significant difference (LSD) test (P < 0.05). Hypopharyngeal gland protein content data
were log transformed to meet normality assumptions. After statistical analysis, data were
back-transformed as needed for presentation herein.
30
2.4 Results
2.4.1 Experiment 1
2.4.1.1 Nosema ceranae prevalence and intensity
The results of Nosema ceranae prevalence (proportion of infected bees) are summarized
in Fig. 2.2. The prevalence of Nosema ceranae infection was significantly different
between some age cohorts (F5, 24 = 4.92; P = 0.0043). Nosema ceranae infection was not
detected in any of the recently emerged bees (Table 2.2). Foraging-aged bees had a
significantly higher prevalence of Nosema ceranae infection than both nurse-aged bees
and recently emerged bees. Nurse-aged bees and recently emerged bees, however, did not
have significantly different levels of Nosema prevalence. The prevalence of Nosema
ceranae infection in background bees was not significantly different between sampling
dates; nor did it differ from that of corresponding marked bees on any of the sampling
dates. There was no significant correlation (r = 0.29, P > 0.05) between the percentage of
Nosema ceranae infected bees (prevalence) and infection level (intensity) in a composite
sample.
The results of Nosema ceranae intensity (number of spores per bee) are summarized in
Fig. 2.3. Median Nosema ceranae infection intensities were significantly different
between all age cohorts (F5, 221 = 243.64; P < 0.0001). Foraging-aged bees had
significantly higher Nosema ceranae spore intensities when compared to both nurse-aged
bees and recently emerged bees. Nurse-aged bees had significantly higher spore
intensities than recently emerged bees. The median infection intensities in background
bees were significantly different between sampling dates; the second and third sampling
dates had higher intensities than the first. Moreover, the background bees from the first
and second sampling dates had higher median intensities than the marked bees sampled
on those dates—recently emerged bees and nurse-aged bees, respectively. In background
bee samples, the mean number of spores across all sampled bees (NSS) was always much
lower than the one calculated across infected bees only (NSI) (Table 2.2).
31
2.4.2 Experiment 2
2.4.2.1 Nosema ceranae prevalence and intensity
DNA analysis revealed that only Nosema ceranae was present in all eight experimental
nucleus colonies (Appendix Figure A.1). The total number of bees analyzed is
summarized in Table 2.3 and the results of Nosema ceranae prevalence are summarized
in Fig. 2.4. Because the effect of age on Nosema ceranae prevalence did not depend on
the year (F3, 18 = 1.86; P = 0.1723), data from both years were combined for subsequent
analyses. The prevalence of Nosema ceranae infection was significantly different
between some age cohorts (F3, 18 = 75.64; P < 0.0001). Nosema ceranae infection
prevalence was significantly higher in 3 week old bees (38.78% infected) than in any
other age cohort. One day old bees (10.0% infected) had significantly lower prevalence
of Nosema ceranae infection when compared to any other age cohort. Infection
prevalence in 1 week old bees (25.38% infected) and 2 week old bees (29.11% infected)
was not significantly different. Further, Nosema ceranae infection was not detected in
any of the eight queens analyzed from the experimental nucleus colonies.
The results of Nosema ceranae intensity are summarized in Fig. 2.5 and 2.6. The effect of
age on Nosema ceranae intensity was dependent on the year (F3, 18 = 15.89; P < 0.0001);
therefore, data from each year were analyzed separately. Median Nosema ceranae
infection intensity was significantly different between some age cohorts in 2013 (F3, 9 =
14.72; P < 0.0008). One day old bees had a significantly lower median intensity of
Nosema ceranae infection when compared to any other age cohort. The median infection
intensities in 3 week, 2 week, and 1 week old bees were not significantly different (Fig.
2.5). Median Nosema ceranae infection intensities were also significantly different
between some age cohorts in 2014 (F3, 9 = 5.38; P = 0.0213). Both 1 day old and 1 week
old bees had significantly higher median spore intensities than those observed in 3 week
old bees. Only 1 week old bees, however, had a significantly higher level of spore
intensity than 2 week old bees (Fig. 2.6).
32
2.4.2.2 Hypopharyngeal gland protein content
The results of hypopharyngeal gland protein content are summarized in Fig. 2.7. The
effect of age on hypopharyngeal gland protein content did not depend on Nosema
ceranae infection level (F6, 17 = 1.48; P = 0.2432); therefore, age and infection level data
were combined for subsequent analyses. There were significant differences in median
hypopharyngeal gland protein concentration between some age cohorts (F3, 9 = 6.05; P =
0.0153). The hypopharyngeal glands of 1 day old bees and 2 week old bees contained
significantly more protein (529.1 µg/ml in 1 day old bees, 493.6 µg/ml in 2 week old
bees) than those of 1 week old bees (332.5 µg/ml) and 3 week old bees (223.4 µg/ml). I
found no significant differences in median hypopharyngeal gland protein concentration
between the three levels of Nosema ceranae infection severity (Nosema free bees; low
level of infection (7.5 x 105–1.2 x 106 spores); high level of infection (3.685 x 107–5.76 x
107 spores; F2, 6 = 0.30; P = 0.7538).
2.4.2.3 Gut pH Analysis
The results of gut pH analysis are summarized in Fig. 2.8. Because the effect of Nosema
ceranae infection on mean gut pH did not depend on the year (F1, 6 = 0.29; P = 0.6126),
data from both years were combined for subsequent analyses. There was a significant
difference in mean gut pH of Nosema ceranae infected bees and non-infected bees (F1, 6 =
6.35; P = 0.0453). The pH of infected bees was, on average, 0.058 units higher than the
pH of non-infected bees. There were also significant differences in gut pH of
experimental bees between the years 2013 and 2014 (F1, 6 = 16.26; P = 0.0069). There
were no significant differences in gut pH between any of the different age cohorts (F2, 14 =
1.92; P = 0.1832).
2.5 Discussion
This study provides a comprehensive examination of Nosema ceranae infection dynamics
at the colony level, while also investigating potentially important physiological effects of
infection on hypopharyngeal gland protein concentration and midgut pH. These results
33
suggest that the prevalence and intensity of Nosema ceranae infection is significantly
influenced by honey bee age. Such findings emphasize the hazard of using composite
sampling to determine the extent of Nosema infections within a colony. The work
described herein is one of few studies to directly compare the efficacies of individual bee
samples and composite samples for colony level diagnosis of Nosema ceranae infection
(Burgher-MacLean et al., 2010; Smart & Sheppard, 2012) (Experiment 1). To my
knowledge, this is also the first study to analyze each individual bee from whole nucleus
colonies infected by Nosema ceranae in order to gain a complete perspective of colony
level infection dynamics (Experiment 2).
In both experiments, I found that foraging-aged bees had a higher prevalence of Nosema
ceranae infection than nurse-aged bees (Fig. 2.1 and Fig. 2.3). Previous research supports
these findings (Higes et al., 2008; Meana et al., 2010; Botías et al., 2012b; MartínHernández et al., 2012; Smart & Sheppard, 2012; Botías et al., 2013). Surprisingly,
however, no investigators describe the cause of this phenomenon. Schmid-Hempel (1994)
explains that diseases are more likely to be picked up by foragers, while young workers
are less likely to be at risk of infection. Yet in Experiment 2, higher Nosema ceranae
infection prevalence was observed in foragers even though all bees were inoculated with
spores simultaneously in the hive. Thus, the probability of being infected by Nosema
ceranae may increase with age, and potentially with increased activity outside of the nest.
But, my results suggest that greater prevalence in foragers is not simply due to their
greater likelihood of encountering the pathogen or parasite. Because Nosema ceranae
infection is likely contained solely within the midgut (Huang & Solter, 2013),
immunocompetence parameters which decrease with age, such as hemocyte count
(Amdam et al., 2005; Schmid et al., 2008) and antimicrobial peptides (Wilson-Rich et al.,
2008; Laughton et al., 2011), are not expected to be a causative factor in higher infection
prevalence in older bees. It is therefore critical that future studies identify the factors
influencing infection susceptibility in honey bees.
In Experiment 1, Nosema ceranae infection prevalence values from composite samples of
background bees were not significantly different than those of the marked-bee age
34
cohorts specific to each sampling date and appear to lie roughly between the prevalence
of nurse-aged and foraging-aged bees (Fig. 2.2). These results support the assertion made
by Traver et al. (2012) and Smart and Sheppard (2012) that sampling bees from a mixture
of ages offers a better representation of colony infection level. Although the results from
both Experiment 1 and 2 indicate a lower Nosema ceranae infection prevalence in nurseaged bees than in foraging-aged bees, the infection is still likely to be detected by
sampling nurse bees. Forager bees only represent a portion of the colony; but in this
experiment, the odds of infection in foraging-aged bees were extremely high. Therefore,
exclusively sampling forager bees (eg. El-Shemy & Pickard, 1989; Higes et al., 2008;
Meana et al., 2010) biases the sample to the most severely infected bees and may create
an inaccurate impression of colony infection level. On the other hand, sampling only
nurse bees may create a perceived infection level that is lower than what the colony as a
whole is experiencing. Other factors such as climate (Gisder et al., 2010), season (Traver
& Fell, 2011; Traver et al., 2012), exposure to chemicals (Alaux et al., 2010; Pettis et al.
2012; Pettis et al. 2013) and time of sampling (Meana et al., 2010) may also influence the
proportion of infected bees in a sample. Furthermore, Experiment 1 showed no
significant correlation between Nosema ceranae infection intensity and percentage of
infected bees in composite samples. This result further demonstrates the inaccuracy of
using spore counts from composite samples to diagnose Nosema ceranae infection in
colonies—one cannot accurately estimate infection prevalence based on infection
intensity in composite samples. With these findings in mind, I suggest that the prevalence
of infection in individual bees of mixed ages provides a more accurate indication of a
colony’s health status than either a composite sample analyzed collectively or a sample of
foragers alone.
It is presumed that the oral transfer of food is the main mode of Nosema ceranae
infection transmission between bees (Smith, 2012); in this manner, queens become
infected from sick attending bees (Higes et al., 2009b). However, none of the eight
queens in Experiment 2 tested positive for Nosema ceranae infection. This is likely due
to the low prevalence of infected bees in the 1 day old cohort—which were two weeks
35
old at time of sampling—as these would have been the nurse bees feeding the queen
(Seeley, 1982;Winston, 1987). In contrast to my results, Higes et al. (2009b) found the
queens of their cage experiment were heavily infected 21 days after exposure to Nosema
ceranae infected workers. Two factors may explain this difference: a shorter length of
study (my colonies were euthanized 14 days after inoculation); and a lower infection
prevalence in the attending workers in my study than in those of the Higes et al. (2009b)
work. Infection prevalence, however, was not measured by Higes et al. (2009b).
In Experiment 2, bees from the 1 day old and 1 week old cohorts of 2014 demonstrated
the highest Nosema ceranae intensities (Fig. 2.6). This may be due to differences in diet
among the age cohorts. Other studies have observed that bees with a greater quantity of
pollen in their diet have increased Nosema ceranae spore intensities (Porrini et al., 2011;
Zheng et al., 2014; personal unpublished data). Crailsheim et al. (1992) reported that
nurse bees at 4 and 9 days old had the highest amount of pollen in their gastrointestinal
tracts and foragers only contained minimal amounts of pollen. Thus, when I introduced
the parasite to my experimental colonies, the 1 day and 1 week old cohorts (3 days and 10
days old at time of inoculation, respectively) may have more recently consumed pollen
than had foragers; potentially further exacerbating Nosema ceranae spore intensities.
Bees in older cohorts likely would have greatly reduced their pollen consumption, as well
as taken cleansing flights—thereby reducing the amount of spores present in their gut at
time of sampling. Similar results, however, were not observed in Experiment 1 or
Experiment 2 in 2013 (Fig. 2.2 and Fig. 2.5). This may be due to the time of year during
which these colonies were sampled and established. While 2014 Experiment 2 colonies
were established in May, colonies in Experiment 1 and 2013 Experiment 2 colonies were
sampled or established in late July, when fewer plants are making pollen. The reduced
amount of pollen available to younger bees may have contributed to lower spore
intensities.
I observed that Nosema ceranae did not have a significant effect on hypopharyngeal
gland protein content. Previous cage studies investigating the effect of Nosema ceranae
on hypopharyngeal glands have resulted in various outcomes: one observing no effect on
36
gland size (Alaux et al., 2010) and another showing a significant reduction in protein
content (personal unpublished data). It is likely that conditions in the field affect
hypopharyngeal gland protein content differently than cage experiment conditions.
Further research will need to elucidate the effects of Nosema ceranae on the
hypopharyngeal glands of bees in the field. Nurse bees have well-developed and highly
active hypopharyngeal glands (Brouwers, 1982; Crailsheim & Stolberg, 1989) that
produce and secrete most of the proteins contained in royal jelly (Knecht & Kaatz, 1990;
Lass & Crailsheim, 1996). Indeed, the 1 day old cohort (2 weeks old at time of analysis)
had the highest mean concentration of hypopharyngeal gland protein (Fig. 2.7).
Surprisingly, the 2 week old cohort possessed hypopharyngeal glands with protein
concentrations comparable to those of the 1 day old cohort. These bees were 4 weeks old
at time of analysis and would have long since made the transition to foraging tasks,
thereby suggesting that factors other than brood food production influence the amount of
protein stored in the hypopharyngeal glands. In addition to major royal jelly proteins
(MRJP), important carbohydrate-metabolizing enzymes, such as a-amylase and glucose
oxidase, are synthesized in the hypopharyngeal glands and are required for the production
of honey from nectar (White et al., 1963; Ohashi et al., 1999; Santos et al., 2005).
Hypopharyngeal gland size and protein content, therefore, may be governed by multiple
physiological and behavioral circumstances not yet fully enumerated by research.
This study provides an important foundation for future Nosema ceranae explorations as
no other reports relative to Nosema ceranae infection and honey bee midgut pH levels are
known. I observed significant differences in the gut pH between Nosema ceranae
infected and non-infected bees (Fig. 2.8). These findings suggest that either Nosema
ceranae infection causes a change in gut pH or that a particular pH level in honey bee
midguts is more conducive to Nosema ceranae proliferation. Earlier Nosema ceranae
research states that the polar tube is everted from the Nosema spore in the honey bee
midgut under appropriate conditions (Higes et al., 2010; Gisder et al., 201l; Fries, 2010);
however these conditions have not yet been identified.
37
The differences in honey bee gut pH between the two years might be explained by the
different diets to which the experimental bees were exposed. For instance, honey is
known for its low pH (Kwakman et al., 2010); thus the addition of honey to a bee’s diet
may decrease pH within their midgut. Additionally, bee bread—pollen packed in the
comb and combined with regurgitated nectar, honey, and glandular secretions—has less
starch and a lower pH than freshly collected pollen (Brodschneider & Crailsheim, 2010).
Bees that consumed a greater proportion of bee bread than freshly packed pollen might
also exhibit a more acidic midgut environment. The experimental bees in 2013 aged in
their foster colonies during the month of July and may have been exposed to more honey
and/or consumed proportionally more bee bread than experimental bees in 2014, who
were aged in their foster colonies during the month of May. If indeed gut pH plays a role
in influencing Nosema ceranae spore proliferation, further research on how diet
influences Nosema ceranae would be invaluable.
2.6 Conclusions
This study provides a thorough analysis of Nosema ceranae infection levels in all ages of
bees within a colony. Indeed, this is the first study to analyze entire colonies in order to
describe the dynamics of Nosema ceranae infections, and the first study to identify a
relationship between honey bee midgut pH and Nosema ceranae spore germination. This
study has demonstrated the importance of considering age of sampled honey bees for a
more representative and accurate measurement of Nosema ceranae infection parameters.
Future studies will therefore need to incorporate numerous factors influencing Nosema
ceranae infection to develop a more robust and standardized method of Nosema
sampling. In order to better understand the damaging effects of Nosema ceranae infection
at the colony level, further research on factors influencing hypopharyngeal gland protein
content and spore germination are warranted. As the number of honey bee colonies
continues to decline, there is dire need to increase our understanding of Nosema ceranae
infection dynamics at both the individual and colony level in order to establish a more
accurate diagnosis of infection severity and reduce the risk of colony loss.
38
2.7 Acknowledgements
The authors would like to thank Dr. Tom Webster at Kentucky State University and the
Leellen Solter lab at University of Illinois Urbana-Champaign for providing Nosema apis
and N. ceranae DNA. This research was supported by funds from the National Honey
Board, OSU Agricultural Research Foundation, Oregon State Beekeepers Association
and Central Oregon Seeds Inc. to R. Sagili.
39
2.8 References
Alaux, C., Brunet, J-L., Dussaubat, C., Mondet, F., Tchamitchan, S., Cousin, M.,
Brillard, J., Baldy, A., Belzunces, L.P., Le Conte, Y., 2010. Interactions between
Nosema microspores and a neonicotinoid weaken honeybees (Apis mellifera).
Environ. Microbiol. 12(3): 774–782.
Amdam, G.V., Aase, A.L.T.O., Seehuus, S., Fondrk, M.K., Norberg, K., Hartfelder, K.,
2005. Social reversal of immunosenescence in honey bee workers. Exp. Gerontol.
40: 939–947.
Bailey, L. 1955. The infection of the ventriculous of the adult honey bee by Nosema apis
(Zander). Parasitol. 45(1-2): 86-94.
Botías, C., Martín-Hernández, R., Días, J., García-Palencia, P., Matabuena, M., Juarranz,
Á., Barrios, L., Meana, A., Nanetti, A., Higes, M., 2012b. The effect of induced
queen replacement on Nosema spp. infection in honey bee (Apis mellifera
iberiensis) colonies. Environ. Microbiol. 14: 845–859. doi: 10.1111/j.14622920.2011.02647.x.
Botías, C., Martín-Hernández, R., Garrido-Bailón, E., González-Porto, A., MartínezSalvador, A., De La Rúa, P., Meana, A., Higes, M., 2012a. The growing prevalence
of Nosema ceranae in honey bees in Spain, an emerging problem for the last
decade. Res. Vet. Sci. 93(1): 150-155. doi:10.1016/j.rvsc.2011.08.002.
Botías, C., Martín-Hernández, R., Barrios, L., Meana, A., Higes, M., 2013. Nosema spp.
infection and its negative effects on honey bees (Apis mellifera iberiensis) at the
colony level. Vet. Res. 44:25.
Brodschneider, R., Crailsheim, K., 2010. Nutrition and health in honey bees. Apidologie
41(3): 278-294.
Bromenshenk, J.J., Henderson, C.B., Wick, C.H., Stanford, M.F., Zulich, A.W., Jabbour,
R.E., Deshpande, S.V., McCubbin, P.E., Seccomb, R.A., Welch, P.M., Williams,
T., Firth, D.R., Skowronski, E., Lehmann, M.M., Bilimoria, S.L., Gress, J., Wanner,
K.W., Cramer Jr., R.A., 2010. Iridovirus and microsporidian linked to honey bee
colony decline. PLoS ONE 5(10): e13181.
Brouwers, E.V.M., 1982. Measurement of hypopharyngeal gland activity in the
honeybee. J. Apicul. Res. 21(4): 193-198.
Burgher-MacLellan, K.L., Williams, G.R., Shutler, D., MacKenzie, K., Rogers R.E.L.,
2010. Optimization of duplex real-time PCR with meltingcurve analysis for
detecting the microsporidian parasites Nosema apis and Nosema ceranae in Apis
mellifera. Can. Entomol. 142: 271–283.
40
Cantwell, GE. 1970. Standard methods for counting Nosema spores. Am. Bee J. 110:
222-223.
Chen, Y., Evans, J.D., Smith, B.I., Pettis, J.S., 2008. Nosema ceranae is a long present
and wide spread microsporidian of the European honey bee (Apis mellifera) in the
United States. J. Invertebr. Pathol. 97(2): 186–188.
Cox-Foster, D.L., Conlan, S., Holmes, E.C., Palacios, G., Evans, J.D., Moran, N.A.,
Quan, P.L., Briese, T., Hornig, M., Geiser, D.M., Martinson, V., vanEnglesdorp, D.,
Kalkstein, A.L., Drysdale, A., Hui, J., Zhai, J., Cui, L., Hutchison, S.K., Simons,
J.F., Egholm, M., Pettis, J.S., Lipkin. I., 2007. A metagenomic survey of microbes
in honey bee Colony Collapse Disorder. Sci. 318: 283–287.
Crailsheim, K., Schneider, L.H.W., Hrassnigg, N., Buhlmann, G., Brosch, U.,
Gmeinbauer, R., Schoffmann, B., 1992. Pollen consumption and utilization in
worker honeybees (Apis mellifera carnica): dependence on individual age and
function. J. Insect. Physiol. 38: 409–419.
Crailsheim, K., Stolberg, E., 1989. Influence of diet, age and colony condition upon
intestinal proteolytic activity and size of the hypopharyngeal glands in the honeybee
(Apis mellifera L.). J.Insect Physiol. 35(8): 595-602.
El-Shemy, A.A.M., Pickard, P.S., 1989. Seasonal variation in the infection of honeybee
colonies with Nosema apis Zander. J. Apicult. Res. 28: 93–100.
Fries, I., Feng, F., da Silva, A., Slemenda, S.B., Pieniazek, N.J., 1996. Nosema ceranae
sp. (Microspora, Nosematidae), morphological and molecular characterization of a
microsporidian parasite of the Asian honey bee Apis cerana (Hymenoptera, Apidae)
Eur. J. Protistol. 32: 356–365.
Fries, I., 2010. Nosema ceranae in European honey bees (Apis mellifera). J. Invertebr.
Pathol. 103: S73-S79.
Fries, I., Chauzat, M.P., Chen, Y.P., Doublet, V., Genersch, E., Gisder, S., Higes, M.,
McMahon, D.P., Martin-Hernandez, R., Natsopoulou, M., Paxton, R.J., Tanner, G.,
Webster, T.C., Williams, G.R., 2013. Standard methods for Nosema research. J.
Apic. Res. 51(5): http://dx.doi.org/10.3896/IBRA.1.52.1.14.
Giray, T., Robinson, G.E., 1994. Effects of intracolony variability in behavioral
development on plasticity of division of labor in honeybee colonies. Behav. Ecol.
Sociobiol. 35: 13–20.
Gisder, S., Hedtke, K., Möckel, N., Frielitz, M.C., Linde, A., Genersch, E., 2010. Fiveyear cohort study of Nosema spp. in Germany: does climate shape virulence and
assertiveness of Nosema ceranae? Appl. Environ. Microbiol. 76: 3032–3038.
41
Gisder, S., Möckel, N., Linde, A., Genersch, E., 2011. A cell culture model for Nosema
ceranae and Nosema apis allows new insights into the life cycle of these important
honey bee-pathogenic microsporidia. Environ. Microbiol. 13(2): 404–413.
Higes, M., Martín-Hernández, R., Garrido-Bailón, E., González-Porto, A. V., GarcíaPalencia, P., Meana, A., Del Nozal, M. J., Mayo, R., Bernal, J. L., 2009a. Honeybee
colony collapse due to Nosema ceranae in professional apiaries. Environ.
Microbiol. Rep. 1: 110–113. doi: 10.1111/j.1758-2229.2009.00014.x.
Higes, M., Martin, R., Meana, A., 2006. Nosema ceranae, a new microsporidian parasite
in honeybees in Europe. J. Invertebr. Pathol. 92: 93–95.
Higes, M., Garcia-Palencia, P., Martin-Hernandez, R., Meana, A., 2007. Experimental
infection of Apis mellifera honeybees with Nosema ceranae (Microsporidia). J.
Invertebr. Pathol. 94: 211–217.
Higes, M., Martín-Hernández, R., Botías, C., Garrido-Bailón, E., González-Porto, A.V.,
Barrios, L., del Nozal, M.J., Bernal, J.L., Jiménez, J.J., García-Palencia, P., Meana,
A., 2008. How natural infection by Nosema ceranae causes honey bee colony
collapse. Environ. Microbiol. 10: 2659-2669.
Higes, M., Martín-Hernández, R., García-Palencia, P., Marín, P., Meana, A., 2009b.
Horizontal transmission of Nosema ceranae (Microsporidia) from worker
honeybees to queens (Apis mellifera). Environ. Microbiol. Rep. 1: 495–498. doi:
10.1111/j.1758-2229.2009.00052.x.
Higes, M., Martin-Hernandez, R., Meana, A. 2010. Nosema ceranae in Europe: an
emergent type C nosemosis*. Apidologie 41: 375–392.
Huang, W-F., Solter, L.F., 2013. Comparative development and tissue tropism of Nosema
apis and Nosema ceranae. J. Invertebr. Pathol. 113: 35–41.
Ishihara, R., 1967. Stimuli causing extrusion of polar filaments of Glugea fumiferanae
spores. Can. J. Microbiol. 13: 1321-1332.
Jaronski, S.T., 1979. Role of the larval mosquito midgut in determining host
susceptibility to Nosema algerae (Microsporidia). Ph.D. Thesis, Cornell University.
Klee, J., Besana, A.M., Genersch, E., Gisder, S., Nanetti, A., Tam, D.Q., Chinh, T.X.,
Puerta, F., Ruz, J.M., Kryger, P., Message, D., Hatjina, F., Korpela, S., Fries, I.,
Paxton, R.J., 2007. Widespread dispersal of the microsporidian Nosema ceranae, an
emergent pathogen of the western honey bee, Apis mellifera. J. Inverteb. Pathol. 96:
1–10.
Knecht, D., Kaatz, H.H., 1990. Patterns of larval food production by hypopharyngeal
glands in adult worker honey bees. Apidologie 21: 457–468.
42
Kwakman, P.H.S., Te Velde, A.A., de Boer, L., Speijer, D., Vandenbroucke-Grauls,
C.M.J.E., Zaat, S.A.J., 2010. How honey kills bacteria. FASEB J. 24: 2576–2582.
doi: 10.1096/fj.09-150789.
Lass, A., Crailsheim, K., 1996. Influence of age and caging upon protein metabolism,
hypopharyngeal glands and trophallactic behavior in the honey bee (Apis mellifera
L). Insectes Soc. 43: 347–358.
Laughton, A.M., Boots, M., Siva-Jothy, M.T., 2011. The ontogeny of immunity in the
honey bee, Apis mellifera L. following an immune challenge. J. Insect Physiol. 57:
1023–1032. doi:10.1016/j.jinsphys.2011.04.020.
Le Conte, Y., Mohammedi, A., Robinson, G.E., 2001. Primer effects of a brood
pheromone on honeybee behavioral development. Proc. R. Soc. B 268: 163–168.
Liu, T.P., 1990. Ultrastructural analysis on the gland secretion in the extracellular ducts
of the hypopharyngeal glands of the honeybee infected by Nosema apis. Tissue and
Cell 22(4): 533–540.
Malone, L.A., Gatehouse, H.S., 1998. Effects of Nosema apis infection on honey bee
(Apis mellifera) digestive proteolytic enzyme activity. J. Invertebr. Pathol. 71: 169174. doi:10.1006/jipa.1997.4715.
Martín-Hernández, R., Meana, A., Prieto, L., Martínez Salvador, A., Garrido-Bailón, E.,
Higes, M., 2007. Outcome of colonization of Apis mellifera by Nosema ceranae.
Appl. Environ. Microbiol. 73: 6331–6338.
Martín-Hernández, R., Botías, C., Bailón, E.G., Martínez-Salvador, A., Prieto, L., Meana,
A., Higes, M., 2012. Microsporidia infecting Apis mellifera: coexistence or
competition. Is Nosema ceranae replacing Nosema apis? Environ. Microbiol. 14:
2127–2138.
Mayack, C., Naug, D., 2009. Energetic stress in the honeybee Apis mellifera from
Nosema ceranae infection. J. Invertebr. Pathol. 100: 185–188.
Meana, A., Martin-Hernandez, R., Higes, M., 2010. The reliability of spore counts to
diagnose Nosema ceranae infections in honey bees. J. Apic. Res. Bee World, 49(2):
212–214.
Naug, D., Gibbs, A., 2009. Behavioral changes mediated by hunger in honeybees
infected with Nosema ceranae. Apidologie 40(6): 595-599.
Ohashi, K., Natori, S., Kubo, T., 1999. Expression of amylase and glucose oxidase in the
hypopharyngeal glands with an age-dependent role change of the worker honeybee
(Apis mellifera L.). Eur. J. Biochem. 265(1): 127–133. doi: 10.1046/j.14321327.1999.00696.x.
43
Patel, N.G., Haydak, M.H., Gochnauer, T.A., 1960. Electrophoretic components of the
proteins in honeybee larval food. Nat. 186: 633–634.
Pettis, J.S., vanEngelsdorp, D., Johnson , J., Dively, G., 2012. Pesticide exposure in
honey bees results in increased levels of the gut pathogen Nosema.
Naturwissenschaften 99: 153–158. doi: 10.1007/s00114-011-0881-1.
Pettis, J.S., Lichtenberg, E.M., Andree, M., Stitzinger, J., Rose, R., vanEngelsdorp, D.,
2013. Crop pollination exposes honey bees to pesticides which alters their
susceptibility to the gut pathogen Nosema ceranae. PLoS ONE 8(7): e70182.
Porrini, M.P., Sarlo, E.G., Medici, S.K., Garrido, P.M., Porrini, D.P., Damiani, N.,
Eguaras, M.J., 2011. Nosema ceranae development in Apis mellifera: influence of
diet and infective inoculum. J. Apic. Res. 50: 35–41. doi:10.3896/IBRA.1.50.1.04.
Sagili, R.R., Pankiw, T., Metz, B.N., 2011. Division of labor associated with brood
rearing in the honey bee: how does it translate to colony fitness? PLoS ONE 6(2):
e16785.
Santos, K.S., dos Santoa, L.D., Mendes, M.A., de Souza, B.M., Malaspina, O., Palma,
M.S., 2005. Profiling the proteome complement of the secretion from
hypopharyngeal gland of Africanized nurse-honeybees (Apis mellifera L.) Insect
Biochem. Mol. Biol. 35: 85-91.
Schmid, M.R., Brockmann, A., Pirk, C.W.W., Stanley, D.W., Tautz, J., 2008. Adult
honeybees (Apis mellifera L.) abandon hemocytic but not phenoloxidase-based
immunity. J. Insect Physiol. 54: 439–444.
Seeley, T.D., 1982. Adaptive significant of the age polyethism schedule in honeybee
colonies. Behav. Eco. Sociobiol. 11:287-293.
Smart, M., Sheppard, W., 2012. Nosema ceranae in age cohorts of the western honey bee
(Apis mellifera). J. Invert. Pathol. 109: 148–151.
Smith, M.L., 2012. The honey bee parasite Nosema ceranae: transmissible via food
exchange? PLoS ONE 7(8): e43319. doi:10.1371/journal.pone.0043319.
Thompson, G.J., Yockey, H., Lim, J., Oldroyd, B.P., 2007. Experimental manipulation of
ovary activation and gene expression in honey bee (Apis mellifera) queens and
workers: testing hypotheses of reproductive regulation. J. Exp. Zool. 307A: 600–
610.
Traver, B.E., Fell, R.D., 2011. Prevalence and infection intensity of Nosema in honey bee
(Apis mellifera L.) colonies in Virginia. J. Invertebr. Pathol., 107: 43–49.
44
Traver, B.E., Williams, M.R., Fell, R.D., 2012. Comparison of within hive sampling and
seasonal activity of Nosema ceranae in honey bee colonies. J. Invertebr. Pathol.
109: 187-193.
vanEngelsdorp, D., Evans, J.D., Saegerman, C., Mullin, C., Haubruge, E., Nguyen, B.K.,
Frazier, M., Frazier, J., Cox-Foster, D., Chen, Y., Underwood, R., Tarpy, D.R.,
Pettis, J.S., 2009. Colony collapse disorder: a descriptive study. PLoS ONE 4
(8):e6481.
Wang I., Moeller, F.E., 1971. Ultrastructural changes in the hypopharyngeal glands of
worker honey bees infected by Nosema apis. J. Invertebr. Pathol. 17: 308–320.
Weidner, E., 1972. Ultrastructural study of microsporidian invasion into cells. Z.
Parasitenk. 40: 227-242.
White, J.W. Jr., Subers, M.H., Schepartz, A.I., 1963. The identification of inhibine,
antibacterial factor in honey, as hydrogen peroxide, and its origin in a honey
glucose oxidase system. BBA 73: 57-70.
Williams, G.R., Shutler, D., Little, C.M., Burgher-MacLellan, K.L., Rogers, R.E.L.,
2010. The Microsporidian Nosema ceranae, the antibiotic Fumagillin-B, and
western honey bee (Apis mellifera) colony strength. Apidologie. 42: 15-22. doi:
10.1051/apido/2010030.
Wilson-Rich, N., Dres, S.T., Starks, P.T., 2008. The ontogeny of immunity: development
of innate immune strength in the honey bee (Apis mellifera). J. Insect Physiol. 54:
1392–1399.
Winston, M.L., 1987. The Biology of the Honey Bee. Cambridge, MA: Harvard
University Press.
Zheng, HQ., Lin, ZG., Huang, SK., Sohr, A., Chen, YP., 2014. Spore loads may not be
used alone as a direct indicator of the severity of Nosema ceranae infection in
honey bees Apis mellifera (Hymenoptera:Apidae). J. Econ. Entomol. 107(6): 20372044.
45
Table 2.1 Summary of the age cohorts at time of quadruple-cohort colony establishment
and analysis after two weeks.
Age at colony establishment
1 Day
1 Week
2 Weeks
3 Weeks
Age at time of analysis
2 Weeks
3 Weeks
4 Weeks
5 Weeks
Table 2.2 Summary of Nosema ceranae infection levels and percent of individual bees
infected with Nosema ceranae in each of the five colonies. RE= recently emerged bees,
BG= background bees collected from the inner hive cover, outer frames, hive entrance
and brood area at the same time as each group (RE, Nurse-aged bees, Foraging-aged
bees), NSI = mean number of spores across infected bees, NSS = mean number of spores
across sampled bees (composite sample).
Colony
n
n
%
NSI
NSS
6
#
Age Group
sampled infected infected
(x10 )
(x106)
1
RE
50
0
0
0
0
Nurse
26
2
7.7
0.93
0.07
Foragers
50
3
6
41.77
2.56
BG
150
7
4.7
19.19
0.9
2
RE
50
0
0
0
0
Nurse
50
9
18
0.35
0.06
Foragers
50
15
30
2.01
0.6
BG
150
5
3.3
5.54
0.18
3
RE
50
0
0
0
0
Nurse
50
3
6
6.53
0.39
Foragers
50
9
18
28.32
5.1
BG
150
12
8
14.25
1.14
4
RE
50
0
0
0
0
Nurse
50
5
10
0.11
0.01
Foragers
50
18
36
7.08
2.55
BG
150
24
16
9.27
1.48
5
RE
50
0
0
0
0
Nurse
50
11
22
1.33
0.29
Foragers
50
37
74
1.52
1.13
BG
150
61
40.7
2.89
1.18
46
Table 2.3 Summary of the number of bees analyzed in each of the eight quadruple-cohort
colonies.
Age of bees at colony establishment
Year
Hive
1 Day
1 Week
2 Weeks
3 Weeks
1
1
794
702
662
469
2
854
452
600
248
3
895
585
739
301
4
1005
644
514
436
2
5
1051
691
823
298
6
923
648
576
113
7
826
625
550
258
8
1044
512
480
130
Total:
7392
4859
4944
2253
47
Figure 2.1 Establishment of quadruple-cohort colonies. (a) Newly emerged bees from
sister queens were painted on the thorax to indicate a particular age cohort (b) and were
then released into their designated Nosema-free foster colony for aging. (c) Three weeks
after the first cohort was placed in the foster colony, 1,000 painted bees from each cohort
were vacuumed (d) and placed inside a sealed nucleus colony.
48
Figure 2.2 Mean ± SE Nosema ceranae infection levels of marked bees and background
bees at each age group/sampling date. Marked bees were recently emerged bees at the
first sample date, nurse-aged bees at the second sampling date and foraging-aged bees at
the third sampling date. Mean infection prevalence between marked and background bees
on corresponding collection days were not significantly different (P > 0.05). Mean
prevalence of infection was significantly higher in marked bees sampled on date 3 than
on dates 1 and 2, indicated by different letters (P = 0.0043).
49
Figure 2.3 Median ± SE Nosema ceranae infection intensity of marked bees and
background bees at each age group/sampling date. Marked bees were recently emerged
bees at the first sample date, nurse-aged bees at the second sampling date and foragingaged bees at the third sampling date. There were significant differences among the age
cohorts indicated by different letters (P < 0.0001).
Figure 2.4 Proportion of bees infected with Nosema ceranae spores within different age
cohorts of all 8 quadruple-cohort colonies combined. Different letters indicate significant
differences between the age cohorts (P < 0.0001). Age cohort labels indicate age at
colony establishment. Bees of all cohorts were two weeks older when analyzed.
50
Figure 2.5 Median ± SE Nosema ceranae infection intensities within different age
cohorts of all 4 quadruple-cohort colonies in 2013 combined. Different letters indicate
significant differences between age cohorts (P < 0.0008). Age cohort labels indicate age
at colony establishment. Bees of all cohorts were two weeks older when analyzed.
Figure 2.6 Median ± SE Nosema ceranae infection intensities within different age
cohorts of all 4 quadruple-cohort colonies in 2014 combined. Different letters indicate
significant differences between age cohorts (P < 0.0213). Age cohort labels indicate age
at colony establishment. Bees of all cohorts were two weeks older when analyzed.
51
Figure 2.7 Hypopharyngeal gland protein concentrations of bees within different age
cohorts of the 4 quadruple-cohort colonies in 2013 combined. Different letters indicate
significant differences among the age cohorts (P < 0.0153). Age cohort labels indicate
age at colony establishment. Bees of all cohorts were two weeks older when analyzed.
Figure 2.8 Mean gut pH of Nosema ceranae infected and non-infected honey bees.
Triangle symbols indicate Nosema absent samples; square symbols indicate Nosema
present samples. There was a significant difference in mean gut pH of Nosema ceranaeinfected and non-infected bees (P = 0.0453). Age cohort labels indicate age at colony
establishment. Bees of all cohorts were two weeks older when analyzed.
52
Chapter 3:
Pollen nutrition dynamics in Nosema ceranae infection and survival in honey bees
3.1 Abstract
Multiple stressors are currently threatening honey bee health, including pests and
pathogens. Among honey bee pathogens, Nosema ceranae is a relatively new pathogen
parasitizing the western honey bee (Apis mellifera). Optimal nutrition has been attributed
to pathogen resistance and longevity in honey bees. Here I hypothesize that optimal
pollen nutrition or bees receiving higher concentration of pollen will have lower Nosema
ceranae intensity, low prevalence and higher survival or longevity. To test this
hypothesis, I examined effects of different concentrations of pollen on a) the prevalence
and intensity of Nosema ceranae and b) longevity and nutritional physiology of bees
inoculated with Nosema ceranae. Significantly higher spore intensities were observed in
treatments that received higher pollen concentrations (1:0 and 1:1 pollen: cellulose) when
compared to treatments that received relatively lower pollen concentrations. There were
no significant differences in Nosema ceranae prevalence between different pollen diet
treatments. Interestingly, the bees in higher pollen concentration treatments also had
significantly higher survival despite higher intensities of Nosema ceranae. The
hypopharyngeal gland protein content was significantly different between treatments with
significantly higher hypopharyngeal gland protein content observed in the control
treatment followed by 1:0 pollen: cellulose treatment. Here I demonstrate that optimal
pollen nutrition increases Nosema ceranae intensity, but also enhances the survival or
longevity of honey bees. The information from this study could be potentially used by
beekeepers to formulate appropriate protein feeding regimens for their colonies to
mitigate Nosema ceranae problems.
3.2 Introduction
Honey bees are critical pollinators of many important agricultural crops and are currently
facing several challenges including pests and pathogens. Nosema ceranae is a
53
microsporidian gut parasite which was reported in European honey bee in 2006 (Higes et
al., 2006; Chen et al., 2008). Nosema ceranae infection has been shown to increase
colony loss (Higes et al., 2008; Higes et al., 2009) and decrease immune functions
(Antúnez et al., 2009). Ingested spores germinate inside the host midgut and reproduce
intracellularly. Nosema ceranae obtains its energy from the mitochondria of the bees’
midgut cells and can destroy midgut epithelial cells during replication (Higes et al.,
2007). Furthermore, the presence of Nosema ceranae alters expression of portions of the
midgut proteome responsible for energy production, protein regulation and antioxidant
defense (Vidau et al., 2014). This disrupts the metabolism of proteins in the midgut and
causes energetic stress. As a result, infected honey bees commonly demonstrate
pronounced hunger (Mayak & Naug, 2009) and are less likely to share food with
nestmates via trophallaxis (Naug & Gibbs, 2009). This can in turn have detrimental
effects on honey bee colony health.
Additionally, a growing body of literature supports the notion that hypopharyngeal gland
structure and function are influenced by Nosema ceranae infection. In honey bees,
hypopharyngeal glands secrete major components of royal jelly and larval brood food
(Patel et al., 1960) as well as synthesize enzymes involved in honey production.
Explorations into the effects of Nosema ceranae parasitism on honey bee hypopharyngeal
glands have demonstrated that infection induces gland atrophy (Alaux et al., 2010a) and a
deficiency in gland secretion (Liu, 1990). The parasite, however, has not been detected in
the hypopharyngeal glands (Huang and Solter, 2013); thus hypopharngeal gland
responses observed in the presence of Nosema ceranae are potentially indirect effects of
Nosema infection. The ability to ingest and digest pollen is crucial for the development
and activity of the hypopharyngeal glands (Haydak, 1970; Mohammedi et al., 1996).
Hence brood health may be indirectly affected when adult bees are infected with Nosema
ceranae.
In the wake of deteriorating honey bee colony health and unsustainable colony declines
(vanEngelsdorp et al., 2012), bee nutrition has attained greater importance and garnered
greater focus. Like other animals, bees require adequate nutrition to thrive (Haydak,
54
1970). Because honey bees obtain their food from the plants found within a 3-mile radius
of the hive (Beekman & Ratnieks, 2000), land use and management practices directly
affect honey bee nutrition (Donkersley et al., 2014). Land management practices have an
enormous impact on how honey bees obtain food and what is available (Decourtye et al.,
2010; Keller et al., 2005). Current farming practices largely dependent on monoculture
cropping have resulted in rapid decline in pollen diversity in agricultural areas (Kremen
et al., 2002). The narrow range of floral resources available to bees has been shown to
have a negative effect on colony survival (Naug, 2009).
Honey bees get the vast majority of their required protein, lipids and vitamins from
pollen (Brodschneider & Crailsheim, 2010). However the pollen nutrition obtained by the
honey bee is plant-dependent (Huang, 2012; Crailsheim, 1990). While some pollen types
provide adequate nutrition alone (e.g., Rape, Brassica napus L., Schmidt et al., 1995), in
general, polyfloral pollen is healthier for honey bees (Huang, 2012). Diminished pollen
diversity within the forage available to honey bees leads to a nutritional deficit that
negatively impacts colony survival (Naug, 2009) by hindering brood production,
inhibiting gland development, facilitating the presence of diseases, reducing individual
bee weight, decreasing immunocompetence and shortening individual life span (Alaux et
al., 2010b; Avni et al., 2014; Schmidt, 1984; Schmidt et al., 1987, 1995). Pollen quantity,
quality and diversity have also been shown to affect the survival of honey bees
parasitized by Nosema ceranae (Eischen & Graham, 2008; Di Pasquale et al., 2013).
Because a bees’ resistance to pathogens can heavily depend upon nutrition (Alaux et al.,
2010b), it is important to understand the relationship between bee nutrition and pathogen
infection (intensity and prevalence). Pollen is the primary source of protein for honey
bees (Hrassnigg & Crailsheim, 1998; Brodschneider & Crailsheim, 2010). Pollen
nutrition is one of the most important factors affecting longevity of newly emerged bees
(Wang et al., 2014). Even though few studies have explored the role of protein/pollen
nutrition in Nosema infection and survival of infected bees, there is still a great degree of
uncertainty regarding role of pollen nutrition on infection and survival of bees.
55
Rinderer & Elliot (1977) reported that feeding protein to honey bees infected with
Nosema apis increased the spore development of the pathogen, but also improved the
longevity of infected bees. Porrini et al. (2011) found that the presence of pollen in honey
bee’s diet increased the intensity of Nosema ceranae spores. More recently, Zheng et al.
(2014) reported that increased pollen feeding increased Nosema ceranae spore loads in
bees, and longevity of bees decreased with or without pollen feeding. Mattila and Otis
(2006) reported contradictory findings to Rinderer and Elliot. In their experiment with
field colonies Mattila and Otis found that there was no increase in worker longevity in
experimental colonies that were inoculated with Nosema apis and received pollen
supplements. Both the studies (Mattila and Otis; Rinderer and Elliot) mentioned above
have focused on Nosema apis. Many significant differences between Nosema apis and
Nosema ceranae have been documented in the past few years in terms of infectivity,
epidemiology, biology, phylogeny, pathology, genetics and distribution (Chen et al.,
2013; Milbrath et al., 2015). In temperate climates Nosema cerane has been reported to
be the predominant species with occasional mixed infections of both Nosema ceranae
and Nosema apis (Paxton et al., 2007; Fries, 2010).
To my knowledge, currently there are no comprehensive studies that have explored the
effects of pollen nutrition on Nosema ceranae infection, prevalence, and corresponding
survival of bees along with simultaneous examination of critical physiological parameters
such as hypopharyngeal gland protein and midgut enzyme activity. Here I hypothesize
that optimal pollen nutrition or bees receiving higher concentration of pollen will have
lower Nosema ceranae intensity, low prevalence and higher survival or longevity. To test
these hypotheses I examined effects of different concentrations of pollen on a) the
prevalence and intensity of Nosema ceranae and b) longevity and physiological
parameters (hypopharyngeal gland protein and midgut proteolytic enzyme activity) of
bees inoculated with Nosema ceranae.
56
3.3 Materials and Methods
3.3.1 Nosema ceranae Prevalence, Intensity and Survival Analyses
In June 2014, capped combs with emerging bees were obtained from honey bee colonies
headed by sister queens at Oregon State University apiaries (Corvallis, OR, USA). Sister
queen colonies were used to control any variation in Nosema infection attributed to
genetics of the bees. These combs with emerging bees were placed in an incubator under
simulated hive conditions (33° C, 55% RH) for bee emergence. Twenty four hours later I
gently brushed newly emerged bees into a large container and mixed them thoroughly by
hand. After the bees were mixed, 250 individual bees were placed inside cylindrical wire
cages (6306 cm3) and returned to the incubator. The bees in cages were provided ad
libitum access to a vial containing water and a vial with 50% sucrose solution.
Consumption of both water and sucrose solution was measured and were replaced on
alternate days. Varying dilutions of pollen diet were also provided to the bees in
experimental cages.
To alter the nutritional content and obtain diets with different concentrations of pollen,
the pollen diets were diluted using a cellulose powder similar to methods described in
Waddington et al. (1998) and Willard et al. (2011). The consumable non-nutritious alphacellulose lowers the quality of the pollen diet and presumably leads to a higher digestive
demand relative to the nutrients obtained (Willard et al., 2011). By increasing the
cellulose proportion in the pollen diet I decreased the average biomass specific nutritional
quality of the diet. Treatments consisted of ground wild flower pollen (The Pollen Man,
OR, USA) and α-cellulose powder (Sigma Aldrich product C8002, MO, USA) in the
following pollen: cellulose ratios: a) 1:0 b) 1:1 c) 1:2 d) 1:3 and e) 0:1. I also included a
control diet group that was provided pollen similar to 1:0 pollen: cellulose treatment, but
did not receive Nosema ceranae spores. To hold the diet blend (pollen and cellulose)
together, 35 ml of 33% sucrose solution was mixed into 300 g of each diet. The
pollen/sucrose mixture was then measured out to 25 g and packed into petri dishes (VWR
150x15 mm) and placed at the bottom of corresponding cages. In all, there were 6
57
treatments and 6 replicates (cages) of each treatment, for a total of 36 cages. Prior to the
experiment, wildflower pollen used in this study was sent for pesticide analysis to assess
presence of any pesticide residues.
Five days after ad libitum access to the diet treatments, bees in each cage were massinoculated with Nosema ceranae spores similar to Pettis et al. (2012). Prior to
inoculation, the Nosema species identification was performed following the PCR
methods described by Hamiduzzaman et al. (2010). The Nosema ceranae spore solution
was formulated following the methods of Fries et al. (2013). Spores were purified
through centrifugation and the concentrate was calculated to inoculate 250 bees with
10,000 spores per bee. The spore inoculant was formulated in 30 ml of 50% sucrose
solution and inverted on top of cages for ad libitum access for twenty four hours. After
twenty four hours of ad libitum feeding, the feeders were topped up with regular 50%
sucrose solution without spores.
Once a week I measured consumption of the diet (pollen or pollen plus cellulose) patties
and replaced them with fresh patties. Bee mortality was recorded every other day and
dead bees were removed at the time of diet replacement for convenience. Sixteen days
after spore inoculation, 30 bees were randomly removed from each cage for analysis. The
abdomens of 20 bees were used to estimate the Nosema prevalence and intensity as
determined by the light microscopy techniques described by Cantwell (1970). Each bee
abdomen was checked individually for Nosema ceranae infection. The heads of the same
20 bees were used for dissecting and estimating hypopharyngeal gland protein content.
The remaining 10 bees were used to analyze midgut proteolytic enzyme activity.
3.3.2 Hypopharyngeal Gland Protein Analysis
The hypopharyngeal gland protein content was measured using a standard BCA Assay
(Pierce™ Biotech BCA Assay Kit, Thermo-Scientific, IL, USA). Twenty bees from each
cage were used to dissect pairs of hypopharyngeal glands. The glands from each
individual bee were stored in 1.5 ml microcentrifuge tubes containing 5 µl PBS
(Phosphate Buffered Saline, Sigma-Aldrich) and stored at -80 °C until time of analysis.
58
Glands were homogenized with a plastic micropestle. Once glands were homogenized
thoroughly, 25 µl of PBS was added to each tube. Samples were then vortexed for a few
seconds and centrifuged at room temperature for 2 minutes at 13,300 rpm. The
supernatant from each tube was used for analysis.
I quantified the protein content of each sample following the microplate procedure of the
Pierce™ Biotech BCA Assay Kit Instructions (Thermo-Scientific). These samples were
homogenized in PBS; therefore, PBS was used as the diluent for the Bovine Serum
Albumin (BSA) standards and the blank. BSA standard solutions were stored at -20 °C
and used for several consecutive days. I loaded 10 µl of each sample, standard and blank
into two duplicate wells of a 96-well plate kept on ice. Plating this volume allows the
assay to have a protein detection range of 125-2000 µg/ml. After addition of the BCA
working reagent (200 µl/well), the plate was shaken for 30 seconds in a microplate
spectrophotometer (BioTek Synergy 2, Gen5 2.00 software, VT, USA). The uncovered
plate was then incubated at 37 °C for 30 minutes and, again at 4 °C for 12 minutes while
covered. The absorbance at 562 nm was measured and protein concentration in µg/ml
was calculated from the resulting standard curve.
3.3.3 Total Midgut Proteolytic Enzyme Activity Analysis
Bees that were removed from cages for analysis were kept at -20 °C until the time of
analysis. The abdomens of the bees were removed and placed in a separate 2-ml
microcentrifuge tube containing 90 µl of chilled 0.1 M Tris buffer (pH 7.9). The
abdomens were homogenized with a Qiagen® TissueLyser II at (30 oscillations/sec., 2 x
45 sec.), then centrifuged at room temperature for 6 minutes at 13,000 rpm. Three 1.5-ml
tubes containing 25 µl of the chilled Tris buffer were prepared for each sample. For a
given sample, 5 µl of the resulting supernatant was added to each of the three tubes – 1
tube to serve as sample blank, and 2 replicate measurements used to calculate the mean of
each sample. I added 60 μl of 2% Azocasein to all tubes and vortexed each gently.
Sample blanks were left at room temperature while the other tubes were incubated at
37 °C for 4 hours.
59
After incubation, all tubes were placed on ice to stop the reaction and 300 μl of chilled
10% trichloroacetic acid (TCA) was added to all tubes. Each tube was vortexed well and
then centrifuged at room temperature for 4 minutes at 13,300 rpm. I moved 350 μl of the
resulting supernatant into a separate plastic 1-cm cuvettes containing 200 μl of 50%
ethanol in an ice bath. Each cuvette was vortexed gently before reading each at 440 nm
using a Beckman DU 64 spectrophotometer. For each bee abdomen, there were three
cuvettes. The sample blank (incubated at room temperature) was used to zero the
machine before measuring the absorbance of the 2 replicate cuvettes. The total midgut
proteolytic enzyme activity was calculated from the mean of the readings of two sample
cuvettes for each sample and expressed in terms of OD440.
3.3.4 Data Analysis
All data analysis was carried out using SAS 9.3. Data were tested for normal distribution
and whenever there is non-normality, data transformations were performed. After
statistical analysis, means were back-transformed as needed for presentation herein. Data
pertaining to consumption of pollen, water, sucrose, syrup, Nosema intensity, Nosema
prevalence, hypopharyngeal gland protein quantity, total midgut proteolytic enzyme
activity were analyzed by generalized mixed linear model analysis for differences among
the treatments. Mean separations were performed using Fisher’s protected least
significant difference (LSD) test (P ≤0.05). For hypopharyngeal gland protein estimation,
data points which were outside of the limits of the BSA standards were removed and
considered as missing observations. Survival analysis was conducted using PROC
LIFETEST and Kaplan-Meier estimates were computed and survival curves were
generated for various treatments (Le, 1997). For this, survival probabilities were plotted
against number of days from the initiation to the end of experiment. Survival curves were
compared using log rank tests (Allison, 1998). Bees that survived until the end of the
experiment (Day 28) and those that were removed for midgut enzyme analysis,
hypopharyngeal gland protein content and Nosema intensity and prevalence were treated
as censored cases.
60
3.4 Results
3.4.1 Consumption of Pollen Diet, Sucrose Solution and Water
The average consumption of pollen, syrup and water are presented in Table 1. The pollen
diet consumption in control and 1:0 pollen: cellulose treatments was significantly higher
when compared to all other treatments (1:1, 1:2, 1:3 and 0:1 pollen: cellulose treatments)
(F5, 120 = 3.81; P = 0.0031), but there was no significant difference in pollen diet
consumption between control (received pollen but not inoculated with Nosema) and 1:0
pollen: cellulose treatments. The mean amount of pollen diet consumed by bees in all
treatments was significantly higher in the first week of the experiment (9.25 g) when
compared to the second (6.0 g), third (5.8 g), or fourth weeks (5.33 g), which did not
differ significantly (F3, 120 = 39.53; P < 0.0001). There were significant differences in
sucrose syrup consumption between treatments (F5, 419 = 15.47; P < 0.0001) with
significantly higher sucrose syrup consumption observed in the control, 1:0 and1:1
pollen: cellulose treatments compared to the 1:2, 1:3 and 0:1 pollen: cellulose treatments.
Further, the water consumption was also significantly different between treatments (F5,
419
= 6.71; P < 0.0001) with significantly higher water consumption observed in the
control, 1:0 and 0:1 pollen: cellulose treatments. The treatments 1:2 and1:3 pollen:
cellulose had significantly lower water consumption when compared to all the other diets.
Trace amounts of eight pesticides were found in the wild flower pollen used in this study
(Appendix Table B.1).
3.4.2 Nosema prevalence and intensity
To meet normal distribution assumptions, Nosema intensity data were transformed by
logarithmic transformation and Nosema prevalence data were transformed by square root
transformation. The effects of treatments on Nosema ceranae intensity are summarized
in Fig. 1. Among the treatments that received Nosema spore inoculations, there were
significant differences in Nosema spore intensities (F5, 188 = 5.75; P < 0.0001).
Significantly higher spore intensities were observed in the 1:0 and 1:1 pollen: cellulose
treatments when compared to the remaining treatments. Treatments 1:3 and 0:1 pollen:
61
cellulose ratio showed lowest Nosema spore intensities. There were no significant
differences in Nosema ceranae prevalence between treatments (F5, 29 = 1.26; P = 0.3066).
3.4.3 Survival Analysis
Kaplan-Meier survival curves were used to plot the survival data (Fig. 2) and log rank
tests were used to compare the survival curves of the various treatments. Log rank tests
indicated that there were significant differences in survival among bees that were fed
with different ratios of pollen and cellulose (
= 1062.8; df=5 and P < 0.0001). The
highest survival was observed in control treatments followed by 1:0, 1:1, 1:2, 1:3 and 0:1
pollen: cellulose ratio diets. χ2
3.4.4 Hypopharyngeal Gland Protein Content
The effects of diet on the amount of protein from adult hypopharyngeal glands are
summarized in Fig. 3. The hypopharyngeal gland protein content was significantly
different between treatments (F5, 494 = 77.65; P <0.0001). Significantly higher
hypopharyngeal gland protein content was observed in the control treatment (976.64
µg/mL) followed by 1:0 pollen:cellulose treatment (778.17 µg/mL). All other remaining
treatments had significantly lower concentrations of hypopharyngeal gland protein in the
range of 197 to 303 µg/mL and were not significantly different from each other.
3.4.5 Total Midgut Protease Activity
The mean midgut proteolytic enzyme activity was significantly different between
treatments (F5, 354 = 103.07; P <0.0001) and the highest enzyme activity was observed in
the control and 1:0 pollen:cellulose treatments. The lowest midgut proteolytic enzyme
activity was observed in 0:1 and 1:3 pollen:cellulose treatments (Fig 4).
3.5 Discussion
This study provides clarity and additional insights on how pollen nutrition influences
Nosema ceranae intensity, prevalence and adult bee survival in honey bees. Interestingly
62
here I found that the bees in the treatments that received higher pollen concentration had
higher Nosema cerane intensities, but also higher survival. Similar findings were reported
with Nosema apis (Rinderer & Elliot, 1977), but to my knowledge this is the first
comprehensive study to examine spore intensities, prevalence and survival
simultaneously in Nosema ceranae along with critical physiological parameters
(hypopharyngeal gland protein content and midgut enzyme activity).
Different pollen diets used in this study appear to have no significant effects on
prevalence of Nosema ceranae. Once ingested, spores germinate in response to cues in
the gut lumen of the host (Weiss & Becnel, 2014). It appears that honey bee nutrition
does not influence the cues or factors responsible for Nosema ceranae spore germination
as spores were detected in all diet treatments regardless of the type of diet. However, my
results suggest that the successful reproduction of the pathogen is largely dependent upon
host nutrition.
I observed that increase in pollen concentration in the diets also increased the intensity of
Nosema infection similar to the observations made by Rinderer & Elliot (1977) and
Porrini et al. (2011). This observed phenomenon may be due to the fact that Nosema
ceranae is highly dependent on host nutritional status or nutritional environment for its
development. Most microsporidians including Nosema ceranae lack mitochondria and
hence are believed to hijack ATP directly from their host’s cytoplasm. It is likely that an
individual honey bee receiving a highly nutritious diet becomes an ideal host for greater
proliferation of the parasite by providing an ideal nutritional environment. Wiess and
Becnel (2014) suggest that microsporidia also likely appropriate other core nutrients from
their host which further lends support to the idea that Nosema ceranae might replicate
faster in a host providing ideal nutritional environment.
Even though Nosema ceranae spore intensities were higher in bees that received more
pollen in their diet, the bees in these treatments had greater survival which appears to be
counterintuitive. However, certain nutritional factors may be contributing to honey bee
survival despite increased infection intensities. For instance, Alaux et al. (2010b)
63
demonstrated that the presence of pollen in the diet increased fat body content, the site of
immunoprotein synthesis. The study results of Zheng et al. (2014) and Di Pasquale et al.
(2013) suggests that the expression of vitellogenin, an immunoprotein involved in honey
bee longevity (Amdam & Omholt, 2002), may contribute to the increased survival of
Nosema ceranae parasitized bees. Pollen grains have p-coumaric acid which may act as a
neutraceutical and regulate immune and detoxification process in honey bees (Mao et al.,
2013). I further speculate that optimal nutrition as a result of higher pollen concentration
availability might compensate for the energy and nutrients lost in bees with high Nosema
intensity, leading to greater survival. These results are in agreement with the conclusions
made by Eischen and Graham (2008), that nutrition influences survival during a Nosema
infection at the colony level.
Hypopharyngeal gland protein content in all the treatments that were inoculated with
Nosema ceranae was significantly lower compared to the control treatment that was not
inoculated with Nosema spores. These findings are similar to the results from studies with
Nosema apis (Malone & Gatehouse, 1998; Wang & Moeller, 1971) and reaffirm the
assertion that Nosema ceranae disrupts protein metabolism in bees which in turn affects
hypopharyngeal gland protein biosynthesis. The total midgut protease activity
significantly decreased with the reduction of pollen in the diet. However, I did not
observe any negative effects on midgut enzyme activity as a result of Nosema ceranae
infection. Malone and Gatehouse (1998) observed that proteolytic enzymes are at highest
levels during the first few days after adult emergence and then decline quickly. Since the
bees in my treatments were inoculated with Nosema ceranae spores five days after
emergence, it may therefore be possible that proteolytic enzymes were synthesized
abundantly in the 1:0 treatment bees similar to the bees in control treatments before the
spores damaged the epithelial cells, hence no significant differences were detected
between treatments.
Since newly emerged adult bees were used in this experiment, the rate of pollen
consumption was highest during the first week in all treatments, as that is the typical time
of pollen consumption for young bees (Crailshiem et al., 1992). The amount of assigned
64
diet consumed was also highest in bees fed 100% pollen, demonstrating the ability of the
bees to recognize the pollen quality. My results also show that bees in the control
treatments consumed similar volumes of sucrose syrup when compared to Nosema
infected treatments. However, previous studies have demonstrated that sucrose syrup
consumption was higher in Nosema infected bees when compared to controls (MartínHernández et al., 2011; Naug & Gibbs, 2009; Mayak & Naug, 2009). This difference
observed in my study may be attributed to low mortality in the control treatments,
causing the amount of syrup consumption to remain on par with Nosema infected
treatments. Water consumption was highest in the 100% pollen treatments, possibly
indicating the necessity of water for proper pollen digestion.
Traces or very small concentrations of few agrochemicals were detected in the pollen
sample that was sent for pesticides analysis and used in this study. I do not expect these
minute concentrations of chemicals detected in pollen to have any significant effects on
the study results. Such small concentrations are regularly found in bee collected pollen's
and it is impossible to obtain bee collected pollen with no traces of any chemicals given
the foraging behavior of honey bees. Moreover, the same pollen was used for all the
treatments in this study and hence any potential miniscule effects resulting from these
chemicals are distributed evenly among all the treatments.
3.6 Conclusions
Here I demonstrate that optimal pollen nutrition increases Nosema ceranae intensity, but
also enhances the survival or longevity of honey bees. Pollen nutrition doesn't appear to
influence the prevalence of Nosema ceranae. Information from this study could be
potentially used by beekeepers to formulate appropriate protein feeding regimens for
their colonies. The beekeepers could provide additional protein supplement to colonies
during periods of serious Nosema infection (intensity) to improve colony survival and
probably avoid feeding protein during other times when the infection levels are low so
that the intensities are not exacerbated.
65
Future studies need to focus on understanding the factors affecting Nosema ceranae spore
germination inside the midguts in order to mitigate infections. Since Nosema ceranae
intensities are more severe in honey bees fed a higher concentration of pollen in their
diet, it may also be important to understand the core nutrients acquired by the spores that
aid in their proliferation. Though challenging, a field study investigating pollen from
various sources as well as protein supplements would be important in determining if the
same effect of increased spore intensity is observed under natural conditions.
3.7 Acknowledgements
The authors would like to thank Stephanie Parreira for her assistance with editing,
comments and suggestions. This research was supported by funds from the National
Honey Board, OSU Agricultural Research Foundation, Oregon State Beekeepers
Association and Central Oregon Seeds Inc. to R. Sagili and a scholarship to C. Jack from
The Foundation for the Preservation of Honey Bees, Inc.
66
3.8 References
Alaux, C., Brunet, J.L., Dussaubat, C., Mondet, F., Tchamitchan, S., Cousin, M., Brillard,
J., Baldy, A., Belzunces, L.P., Le Conte, Y., 2010a. Interactions between Nosema
microspores and a neonicotinoid weaken honeybees (Apis mellifera). Env.
Microbiol. 12(3): 774–782.
Alaux, C., Ducloz, F., Crauser, D., Le Conte, Y., 2010b. Diet effects on honeybee
immunocompetence. Biol. Lett. 6: 562-565. doi:10.1098/rsbl.2009.0986.
Allison, P.D., 1998. Survival analysis using the SAS system. A Practical Guide. SAS
Institute Inc., Cary, NC.
Amdam, G.V., Omholt, S.W., 2002. The regulatory anatomy of honeybee lifespan. J.
Theor. Biol. 216: 209–228. doi:10.1006/jtbi.2002.2545
Antúnez, K., Martín-Hernández, R., Prieto, L., Meana, A., Zunino, P., Higes, M., 2009.
Immune suppression in the honey bee (Apis mellifera) following infection by
Nosema ceranae (Microsporidia). Env. Microbiol. 11: 2284–2290. doi:
10.1111/j.1462-2920.2009.01953.x.
Avni, D., Hendriksma, H.P., Dag, A., Uni, Z., Shafir, S., 2014. Nutritional aspects of
honey bee-collected pollen and constraints on colony development in the eastern
Mediterranean. J. Insect Physiol. 69: 65–73.
Beekman, M., Ratnieks, F.L.W., 2000. Long-range foraging by the honey-bee, Apis
mellifera L. Funct. Ecol. 14: 490–496. doi: 10.1046/j.1365-2435.2000.00443.x.
Brodschneider, R., Crailsheim, K., 2010. Nutrition and health in honey bees. Apidologie
41: 278-294. doi: 10.1051/apido/2010012.
Cantwell, G.E., 1970. Standard methods for counting Nosema spores. Am. Bee J. 110:
222-223.
Chen, Y., Evans, J.D., Smith, B.I., Pettis, J.S., 2008. Nosema ceranae is a long present
and wide spread microsporidian of the European honey bee (Apis mellifera) in the
United States. J. Invertebr. Pathol. 97(2): 186–188.
Chen, Y., Pettis, J.S., Zhao, Y.T., Liu, X., Tallon, L.J., Sadzewicz, L.D., Li, R., Zheng,
H., Huang, S., Zhang, X., Hamilton, M.C., Pernal, S.F., Melathopoulos, A.P., Yan,
X., Evans, J.D., 2013. Genome sequencing and comparative genomics of honey bee
67
microsporidia, Nosema apis reveal novel insights into host-parasite interactions.
BMC Genet. 14(451). doi: 10.1186/1471-2164-14-451.
Crailsheim, K., 1990. The protein balance of the honey bee worker. Apidologie 21: 417–
429.
Crailsheim, K., Schneider, L.H.W., Hrassnigg, N., Bühlmann, G., Brosch, U.,
Gmeinbauer, R., Schöffmann, B., 1992. Pollen consumption and utilization in
worker honeybees (Apis mellifera carnica): dependence on individual age and
function. J. Insect Physiol. 38: 409-419. doi: 10.1016/0022-1910(92)90117-V.
Decourtye, A., Mader, E., Desneux, N., 2010. Landscape enhancement of floral resources
for honey bees in agro-ecosystems. Apidologie 41: 264-277.
doi:10.1051/apido/2010024.
Di Pasquale, G., Salignon, M., Le Conte, Y., Belzunces, L.P., Decourtye, A.,
Kretzschmar, A., Suchail, S., Brunet, J-L., Alaux, C., 2013. Influence of pollen
nutrition on honey bee health: do pollen quality and diversity matter? PLoS ONE
8(8): e72016. doi:10.1371/journal.pone.0072016.
Donkersley, P., Rhodes, G., Pickup, R.W., Jones, K.C., Wilson, K., 2014. Honeybee
nutrition is linked to landscape composition. Ecol. Evol. 4(21): 4195- 4206.
Eischen, F.A., Graham, R.H., 2008. Feeding overwintering honey bee colonies infected
with Nosema ceranae. Am. Bee J. 148: 555.
Fries, I. 2010. Nosema ceranae in European honey bees (Apis mellifera). J. Invertebr.
Pathol. 103: S73-S79.
Fries, I., Chauzat, M.P., Chen, Y.P., Doublet, V., Genersch, E., Gisder, S., Higes, M.,
McMahon, D.P., Martin-Hernandez, R., Natsopoulou, M., Paxton, R.J., Tanner, G.,
Webster, T.C., Williams, G.R. 2013. Standard methods for Nosema research. J.
Apic. Res. 51(5): http://dx.doi.org/10.3896/IBRA.1.52.1.14.
Hamiduzzaman, M.M., Guzman-Novoa, E., Goodwin, P.H. 2010. A multiplex PCR assay
to diagnose and quantify Nosema infections in honey bees (Apis mellifera). J.
Invertebr. Pathol. 105: 151–155. doi:10.1016/j.jip.2010.06.001.
Haydak, M.H., 1970. Honey bee nutrition. Annu. Rev. Entomol. 15: 143-156.
doi:10.1146/annurev.en.15.010170.001043.
68
Higes, M., Garcia-Palencia, P., Martin-Hernandez, R., Meana, A., 2007. Experimental
infection of Apis mellifera honeybees with Nosema ceranae (Microsporidia). J.
Invertebr. Pathol. 94: 211–217.
Higes, M., Martín-Hernández, R., Botías, C., Garrido-Bailón, E., González-Porto, A.V.,
Barrios, L., del Nozal, M.J., Bernal, J.L., Jiménez, J.J., García-Palencia, P., Meana,
A., 2008. How natural infection by Nosema ceranae causes honey bee colony
collapse. Environ. Microbiol. 10: 2659-2669.
Higes, M., Martín-Hernández, R., Garrido-Bailón, E., González-Porto, A.V., GarcíaPalencia, P., Meana, A., del Nozal, M.J., Mayo, R., Bernal, J.L., 2009. Honeybee
colony collapse due to Nosema ceranae in professional apiaries. Env. Microbiol.
Rep. 1: 110–113. doi: 10.1111/j.1758-2229.2009.00014.x
Higes, M., Martín, R., Meana, A., 2006. Nosema ceranae, a new microsporidian parasite
in honeybees in Europe. J. Invertebr. Pathol. 92(2): 93-95.
doi:10.1016/j.jip.2006.02.005
Hrassnigg, N., Crailsheim, K., 1998. The influence of brood on the pollen consumption
of worker bees (Apis mellifera L.). J. Insect Physiol. 44(5-6): 393-404.
Huang, W.F., Solter, L.F., 2013. Comparative development and tissue tropism of Nosema
apis and Nosema ceranae. J. Invertebr. Pathol. 113(1): 35-41.
Huang, Z. 2012. Pollen nutrition affects honey bee stress resistance. Terr. Arthropod Rev.
5: 175–189.
Keller, I., Fluri, P., Imdorf, A., 2005. Pollen nutrition and colony development in honey
bees, Part II. Bee World 86: 27-34.
Kremen, C., Williams, N.M., Thorp, R.W., 2002. Crop pollination from native bees at
risk from agricultural intensification. PNAS 99(26): 16812-16816.
doi:10.1073/pnas.262413599
Le, C.T., 1997. Applied survival analysis. Wiley-Interscience Publication, New York.
Liu, T.P., 1990. Ultrastructural analysis on the gland secretion in the extracellular ducts
of the hypopharyngeal glands of the honeybee infected by Nosema apis. Tissue and
Cell 22(4): 533–540.
69
Malone, L.A., Gatehouse, H.S. 1998. Effects of Nosema apis infection on honey bee
(Apis mellifera) digestive proteolytic enzyme activity. J. Invertebr. Pathol. 71: 169174. doi:10.1006/jipa.1997.4715
Mao, W., Schuler, M.A., Berenbaum ,M.R., 2013. Honey constituents up-regulate
detoxification and immunity genes in the western honey bee Apis mellifera. PNAS
110: 8842–8846. doi: 10.1073/pnas.1303884110.
Martín-Hernández, R., Botías, C., Barrios, L., Martínez-Salvador, A., Meana, A.,
Mayack, C., Higes, M., 2011. Comparison of the energetic stress associated with
experimental Nosema ceranae and Nosema apis infection of honeybees (Apis
mellifera). Parasitol. Res. 3: 605–612.
Mattila, H.R., Otis, G.W., 2006. Effects of pollen availability and Nosema infection
during the spring on division of labor and survival of worker honey bees
(Hymenoptera: Apidae). Env. Entomol. 35: 708-717.
Mayack, C., Naug, D., 2009. Energetic stress in the honeybee Apis mellifera from
Nosema ceranae infection. J. Invertebr. Pathol. 100(3): 185-188.
Milbrath, M.O., Tran, T., Huang, W-F., Solter, L.F., Tarpy, D.R., Lawrence, F., Huang,
Z-Y., 2015. Comparative virulence and competition between Nosema apis and
Nosema ceranae in honey bees (Apis mellifera). J. Invertebr. Pathol. 125: 9-15.
Mohammedi, A., Crauser, D., Paris, A., Le Conte, Y., 1996. Effect of a brood pheromone
on honeybee hypopharyngeal glands. C. R. Acad. Sci. 319: 769–772.
Naug, D. 2009. Nutritional stress due to habitat loss may explain recent honeybee colony
collapses. Biol. Conserv. 142: 2369-2372. doi:10.1016/j.biocon.2009.04.007.
Naug, D., Gibbs, A., 2009. Behavioral changes mediated by hunger in honeybees
infected with Nosema ceranae. Apidologie 40(6): 595-599.
Patel, N.G., Haydak, M.H., Gochnauer, T.A., 1960. Electrophoretic components of the
proteins in honeybee larval food. Nat. 186: 633–634
Paxton, R.J., Klee, J., Korpela, S., Fries, I., 2007. Nosema ceranae has infected Apis
mellifera in Europe since at least 1998 and may be more virulent than Nosema apis.
Apidologie 38: 558–565.
70
Pettis, J.S., vanEngelsdorp, D., Johnson, J., Dively, G., 2012. Pesticide exposure in honey
bees results in increased levels of the gut pathogen Nosema. Naturwissenschaften
99: 153–158. doi: 10.1007/s00114-011-0881-1.
Porrini, M.P., Sarlo, E.G., Medici, S.K., Garrido, P.M., Porrini, D.P., Damiani, N., and
Eguaras, M.J., 2011. Nosema ceranae development in Apis mellifera: influence of
diet and infective inoculum. J. Apic. Res. 50: 35–41. doi:10.3896/IBRA.1.50.1.04.
Rinderer, T.E., Elliot, K.D., 1977. Worker honey bee response to infection with Nosema
apis: influence of diet. J. Econ. Entomol. 70: 431-433.
Schmidt, J.O., 1984. Feeding preference of Apis mellifera L. (Hymenoptera: Apidae):
individual versus mixed pollen species. J. Kans. Entomol. Soc. 57: 323-327.
Schmidt, J.O., Thoenes, S.C., Levin, M.D., 1987. Survival of honey bees, Apis mellifera
(Hymenoptera: Apidae), fed various pollen sources. J. Econ. Entomol. 80: 176-183.
Schmidt, L.S., Schmidt, J.O., Rao, H., Wang, W., Xu, L., 1995. Feeding preference of
young worker honey bees (Hymenoptera: Apidae) fed rape, sesame, and sunflower
pollen. J. Econ. Entomol. 88: 1591–1595.
vanEngelsdorp, D., Caron, D., Hayes, J., Underwood, R., Henson, M., Rennich, K.,
Spleen, A., Andree, M., Snyder, R., Lee, K., Roccasecca, K., Wilson, M., Wilkes,
J., Lengerich, E., Pettis, J., 2012. A national survey of managed honey bee 2010–11
winter colony losses in the USA: results from the Bee Informed Partnership. J.
Apic. Res. 51: 115–124. doi: 10.3896/ibra.1.51.1.14.
Vidau, C., Panek, J., Texier, C., Biron, D.G., Belzunces, L.P., Le Gall, M., Broussard, C.,
Delbac, F., Alaoui, H.El, 2014. Differential proteomic analysis of midguts from
Nosema ceranae-infected honeybees reveals manipulation of key host functions. J.
Invertebr. Pathol. 121: 89–96. doi:10.1016/j.jip.2014.07.002
Waddington, K.D., Nelson, M., Page, R.E. Jr., 1998. Effects of pollen quality and
genotype on the dance of foraging honey bees. Anim. Behav. 56: 35–39.
Wang I., Moeller, F.E., 1971. Ultrastructural changes in the hypopharyngeal glands of
worker honey bees infected by N. apis. J. Invertebr. Pathol. 17: 308–320.
Wang, H., Zhang, S., Yan, W., 2014. Nutrition affects longevity and gene expression in
honey bee workers. Apidologie 45: 618-625.
71
Wiess, L.M., Becnel, J.J., 2014. Microsporidia: Pathogens of Opportunity. Hoboken, NJ:
Wiley-Blackwell.
Willard, L.E., Hayes, A.M., Wallrichs, M.A., Rueppell, O., 2011. Food manipulation in
honeybees induces physiological responses at the individual and colony level.
Apidologie. 42(4): 508-518.
Zheng, HQ., Lin, ZG., Huang, SK., Sohr, A., Chen, YP., 2014. Spore loads may not be
used alone as a direct indicator of the severity of Nosema ceranae infection in
honey bees Apis mellifera (Hymenoptera: Apidae). J. Econ. Entomol. 107(6): 20372044.
72
Table 3.1 Average consumption of diet, syrup and water per sampling event of
treatment bees.
Type
Control
1:0
1:1
1:2
1:3
0:1
Diet (g / week)
7.79a
6.83ab
6.08b
5.88b
Syrup (ml / 2 days)
23.13a
22.77ab
23.64a
Water (ml / 2 days)
57.71a
55.32ab 51.49bc 49.28cd
6.38b
20.68bc 19.85cd
45.30d
6.63b
17.54d
53.46abc
For each row, values followed by different letters are significantly different at
P ≤ 0.05 (Least Significant Difference test).
73
Figure 3.1 Mean number of Nosema ceranae spores per bee (+ SE) fed different pollen
concentrations. Means with different letters indicate significant differences among the
treatments (P < 0.0001).
74
Figure 3.2 Survival of bees fed different concentrations of pollen.
75
Figure 3.3 Mean hypopharyngeal gland protein quantities of bees (+ SE) fed different
pollen concentrations. Different letters indicate significant differences among the
treatments (P < 0.0001).
76
Figure 3.4 Mean midgut proteolytic enzyme activities of bees (+ SE) fed different pollen
concentrations. Different letters indicate significant differences among the treatments
(P < 0.0001).
77
Chapter 4:
Summary
As honey bees are the world’s most economically important pollinator (Klein et al.,
2007), it is absolutely necessary that we strive to improve honey bee health for
sustainable pollination. Currently, there are many issues plaguing honey bees and causing
population declines worldwide (Neumann & Carreck, 2010; van der Zee et al., 2012;
vanEngelsdorp et al., 2009). The microsporidian gut parasite Nosema ceranae is thought
to be one of the contributing factors in the colony losses, and is now attracting attention
on a global scale (Fries, 2010; Higes et al., 2013). However, there are still many
unknowns regarding Nosema ceranae and the factors that may cause or exacerbate
infections. In this study, I described the dynamics of a Nosema ceranae infection at the
colony level and demonstrated the limitations of current sampling protocols (Chapter 2).
Furthermore, I examined the influence of nutrition on Nosema ceranae infection and
other important health parameters in individual honey bees (Chapter 3).
Due to the devastating effect that Nosema ceranae infection can have on honey bee
colonies, many beekeepers prophylactically treat all of their colonies with antibiotics.
This extremely costly and potentially harmful course of action may be reduced if
beekeepers had an accurate perception of their colonies infection status. Findings from
Chapter 2 indicated that no correlation exists between Nosema ceranae infection intensity
and the percentage of infected bees in composite samples. This result further
demonstrates the limitations of using spore counts from composite samples to diagnose
Nosema ceranae infection in colonies. Additionally, many studies suggest that sampling
forager bees exclusively is the best way to diagnose a colony’s infection level (Higes et
al., 2008; Fries et al., 2013); yet, Chapter 2 clearly demonstrated that nurse bees may also
be infected to a considerable degree. Solely sampling the most heavily infected age
cohort will undoubtedly create a biased sample, thereby providing an inaccurate
diagnosis of colony infection status. Based on these findings, I speculate that the
percentage of infection in individual bees of mixed ages provides a more accurate
indication of colony health status.
78
In Chapter 2 one more objective was to explore if pH levels within the honey bee midgut
have an effect on Nosema ceranae spore proliferation. Since no previous work regarding
pH and Nosema ceranae exists, this study provided the first insights on this subject. I
observed significantly higher gut pH levels in Nosema ceranae infected bees than
uninfected honey bees. Future research should address whether Nosema ceranae causes
the change in gut pH or whether a particular pH level increases spore proliferation. Any
new information regarding the effects of Nosema ceranae on honey bee midgut pH levels
could lead to many more explanations of how it infects or affects bees, as well as the
development of new treatments.
Honey bees forage on a variety of pollen sources that vary greatly in their nutritional
properties (Crailsheim, 1990; Huang, 2012) and honey bee nutrition has been shown to
provide resistance against pests and pathogens (Rinderer et al., 1974; Degrandi-Hoffman
et al., 2010; Di Pasquale et al., 2013). The main objective in Chapter 3 was to determine
how varying levels of pollen quality influence Nosema ceranae infection dynamics in
individual honey bees. I observed that an increase in pollen in the diet increased Nosema
ceranae spore intensity, similar to other studies (Porrini et al. 2011; Zheng et al., 2014).
Nevertheless, bees that received more pollen in their diet had greater survival despite the
increased spore intensities. This research provides supporting evidence to the claim by
several researchers that spore intensities may not be useful in determining colony health
(Meana et al., 2010; Traver et al., 2012; Smart & Sheppard, 2012; Zheng et al., 2014).
The information from this study could be potentially used by beekeepers to formulate
appropriate protein feeding regimens for their colonies to mitigate Nosema ceranae
problems.
Another major objective of Chapter 3 related to Nosema ceranae infection and honey bee
nutrition was determining whether the parasite disrupted protein digestion in infected
bees. I observed that the total midgut protease activity significantly decreased with the
reduction of pollen in the diet, but I did not observe any negative effects on midgut
enzyme activity due to the presence of Nosema ceranae. Malone and Gatehouse (1998)
observed that proteolytic enzymes activity is highest during the first few days after adult
79
emergence, so I speculated that the age of the bees analyzed may have influenced the
amount of proteolytic enzymes in the midgut. Future research efforts should continue
towards elucidating the effects of Nosema ceranae on protein digestion, as protein
digestion has a major role in many physiological processes.
Hypopharyngeal glands are an important indicator of honey bee nutrition status and
overall colony health (DeGrandi-Hoffman et al., 2010); yet, there are still many
unknowns regarding the physiological effects of Nosema ceranae infection on
hypopharyngeal glands. In Chapter 2, I observed no significant differences in
hypopharyngeal gland protein content between Nosema ceranae infected and uninfected
bees, though there were differences between age cohorts. However, in Chapter 3 I did
observe a significant difference in protein content between the infected and uninfected
bees. This discrepancy could be caused by the settings of the experiments, one being a
field study and the other a cage study. There may be unidentified factors influencing
honey bee hypopharyngeal gland protein in the field in ways that are not yet understood.
Future research should seek to identify these factors influencing hypopharyngeal gland
protein during Nosema ceranae infections so that application of methods that protect the
normal functions of these essential glands can be employed.
Overall, this study has provided useful insights regarding Nosema ceranae infection
dynamics and role of pollen nutrition in Nosema infection that has the potential to aid in
the development of better Nosema sampling protocols and the prevention of colony losses
due to Nosema. This study also describes new methods in Nosema ceranae research that
will benefit future studies as well as set forth several new research foci that if pursued
will greatly increase our understanding of this parasite’s effect on honey bees. Though
more research is needed to determine the mechanism behind some of the physiological
differences between infected and uninfected bees, my results can be readily utilized by
beekeepers to promote colony health and survival during serious Nosema outbreaks.
80
References
Crailsheim, K., 1990. The protein balance of the honey bee worker. Apidologie 21: 417–
429.
DeGrandi-Hoffman, G., Chen, Y., Huang, E., Huang, M.H., 2010. The effect of diet on
protein concentration, hypopharyngeal gland development and virus load in worker
honey bees (Apis mellifera L.). J. Insect. Physiol. 56: 1184–1191.
Di Pasquale, G., Salignon, M., Le Conte, Y., Belzunces, L.P., Decourtye, A.,
Kretzschmar, A., Suchail, S., Brunet, J-L., Alaux, C., 2013. Influence of pollen
nutrition on honey bee health: do pollen quality and diversity matter? PLoS ONE
8(8): e72016. doi:10.1371/journal.pone.0072016.
Fries, I., 2010. Nosema ceranae in European honey bees (Apis mellifera). J. Invertebr.
Pathol. 103: S73–S79.
Fries, I., Chauzat, M.P., Chen, Y.P., Doublet, V., Genersch, E., Gisder, S., Higes, M.,
McMahon, D.P., Martin-Hernandez, R., Natsopoulou, M., Paxton, R.J., Tanner, G.,
Webster, T.C., Williams, G.R. 2013. Standard methods for Nosema research. J.
Apic. Res. 51(5): http://dx.doi.org/10.3896/IBRA.1.52.1.14.
Higes, M., Martín-Hernández, R., Botías, C., Garrido-Bailón, E., González-Porto, A.V.,
Barrios, L., del Nozal, M.J., Bernal, J.L., Jiménez, J.J., García-Palencia, P., Meana,
A., 2008. How natural infection by Nosema ceranae causes honey bee colony
collapse. Environ. Microbiol. 10: 2659-2669.
Higes, M., Meana, A., Bartolome, C., Botias, C., Martin-Hernandez, R., 2013. Nosema
ceranae (Microsporidia), a controversial 21st century honey bee pathogen. Environ.
Microbiol. Rep. 5:17-29.
Huang, Z. 2012. Pollen nutrition affects honey bee stress resistance. Terr. Arthropod Rev.
5: 175–189.
Klein, A.M., Vaissière, B.E., Cane, J.H., Steffan-Dewenter, I., Cunnigham, S.A.,
Kremen, C., Tscharntke, T., 2007. Importance of pollinators in changing landscapes
for world crops. Proc. R. Soc. 274: 303–313.
Malone, L.A., Gatehouse, H.S. 1998. Effects of Nosema apis infection on honey bee
(Apis mellifera) digestive proteolytic enzyme activity. J. Invertebr. Pathol. 71: 169174. doi:10.1006/jipa.1997.4715.
Meana, A., Martin-Hernandez, R., Higes, M., 2010. The reliability of spore counts to
diagnose Nosema ceranae infections in honey bees. J. Apic. Res. Bee World, 49
(2): 212–214.
81
Neumann, P., Carreck, N.L., 2010. Honey bee colony losses. J. Apicult. Res. 49: 1–6.
Porrini, M.P., Sarlo, E.G., Medici, S.K., Garrido, P.M., Porrini, D.P., Damiani, N., and
Eguaras, M.J., 2011. Nosema ceranae development in Apis mellifera: influence of
diet and infective inoculum. J. Apic. Res. 50: 35–41. doi:10.3896/IBRA.1.50.1.04.
Rinderer, T.E., Rothenbuhler, W.C., Gochnauer, T.A., 1974. The influence of pollen on
the susceptibility of honey-bee larvae to Bacillus larvae. J. Invertebr. Pathol. 23:
347-350. doi:10.1016/0022-2011(74)90100-1.
Smart M, W. Sheppard. 2012. Nosema ceranae in age cohorts of the western honey bee
(Apis mellifera). J. Invert. Pathol., 109, pp. 148–151.
Traver, B.E., Williams, M.R., Fell, R.D., 2012. Comparison of within hive sampling and
seasonal activity of Nosema ceranae in honey bee colonies. J. Invertebr. Pathol.
109: 187-193.
van der Zee, R., Pisa, L., Andonov, S., Brodschneider, R., Charrière, J-D., Chlebo, R.,
Coffey, M.F., Crailsheim, K., Dahle, B., Gajda, A., Gray, A., Drazic, M.M., Higes,
M., Kauko, L., Kence, A., Kence, M., Kezic, N., Kiprijanovska, H., Kralj, J.,
Kristiansen, P., Martin- Hernandez, R., Mutinelli, F., Nguyen, B.K., Otten, C.,
Özkırım, A., Pernal, S.F., Peterson, M., Ramsay, G., Santrac, V., Soroker, V.,
Topolska, G., Uzunov, A., Vejsnæs, F., Wei, S., Wilkins, S., 2012. Managed honey
bee colony losses in Canada, China, Europe, Israel and Turkey, for the winters of
2008-9 and 2009-10. J. Apicult. Res. 51 (1): 100-114.
vanEngelsdorp, D., Evans, J.D., Saegerman, C., Mullin, C., Haubruge, E., Nguyen, B.K.,
Frazier, M., Frazier, J., Cox-Foster, D., Chen, Y., Underwood, R., Tarpy, D.R.,
Pettis, J.S., 2009. Colony collapse disorder: a descriptive study. PLoS ONE 4
(8):e6481.
Zheng, HQ., Lin, ZG., Huang, SK., Sohr, A., Chen, YP., 2014. Spore loads may not be
used alone as a direct indicator of the severity of Nosema ceranae infection in
honey bees Apis mellifera (Hymenoptera: Apidae). J. Econ. Entomol. 107(6): 20372044.
82
Bibliography
Alaux, C., Brunet, J.L., Dussaubat, C., Mondet, F., Tchamitchan, S., Cousin, M., Brillard,
J., Baldy, A., Belzunces, L.P., Le Conte, Y., 2010. Interactions between Nosema
microspores and a neonicotinoid weaken honeybees (Apis mellifera). Env.
Microbiol. 12(3): 774–782.
Alaux, C., Ducloz, F., Crauser, D., Le Conte, Y., 2010. Diet effects on honeybee
immunocompetence. Biol. Lett. 6: 562-565. doi:10.1098/rsbl.2009.0986.
Alaux, C., Folschweiller, M., McDonnell, C., Beslay, D., Cousin, M., Dussaubat, C.,
Brunet, J.L., Le Conte, Y., 2011. Pathological effects of the microsporidium
Nosema ceranae on honey bee queen physiology (Apis mellifera). J. Invertebr.
Pathol. 106: 380–385.
Allison, P.D., 1998. Survival analysis using the SAS system. A Practical Guide. SAS
Institute Inc., Cary, NC.
Amdam, G.V., Aase, A.L.T.O., Seehuus, S., Fondrk, M.K., Norberg, K., Hartfelder, K.,
2005. Social reversal of immunosenescence in honey bee workers. Exp. Gerontol.
40: 939–947.
Amdam, G.V., Omholt, S.W., 2002. The regulatory anatomy of honeybee lifespan. J.
Theor. Biol. 216: 209–228. doi:10.1006/jtbi.2002.2545
Amdam, G.V., Omholt, S.W., 2003. The hive bee to forager transition in honeybee
colonies: the double repressor hypothesis. J. Theor. Biol. 223: 451–464. doi:
10.1016/s0022-5193(03)00121-8.
Antúnez, K., Martín-Hernández, R., Prieto, L., Meana, A., Zunino, P., Higes, M., 2009.
Immune suppression in the honey bee (Apis mellifera) following infection by
Nosema ceranae (Microsporidia). Env. Microbiol. 11: 2284–2290. doi:
10.1111/j.1462-2920.2009.01953.x.
Avni, D., Hendriksma, H.P., Dag, A., Uni, Z., Shafir, S., 2014. Nutritional aspects of
honey bee-collected pollen and constraints on colony development in the eastern
Mediterranean. J. Insect Physiol. 69: 65–73.
Bailey, L., 1953. Effect of fumagillin upon Nosema apis (Zander). Nat. 171: 212–213.
Bailey, L., 1955. The epidemiology and control of Nosema disease of the honey-bee.
Ann. Appl. Biol. 43: 379-389.
Bailey, L., 1955. The infection of the ventriculous of the adult honey bee by Nosema apis
(Zander). Parasitol. 45(1-2): 86-94.
83
Becker, J.A., Speare, D. J., 2007. Transmission of the microsporidian gill parasite Loma
salmonae. Anim. Health Res. Rev. 8(1): 59-68.
Beekman, M., Ratnieks, F.L.W., 2000. Long-range foraging by the honey-bee, Apis
mellifera L. Funct. Ecol. 14: 490–496. doi: 10.1046/j.1365-2435.2000.00443.x.
Botías, C., Martín-Hernández, R., Barrios, L., Meana, A., Higes, M., 2013. Nosema spp.
infection and its negative effects on honey bees (Apis mellifera iberiensis) at the
colony level. Vet. Res. 44:25.
Botías, C., Martín-Hernández, R., Días, J., García-Palencia, P., Matabuena, M., Juarranz,
Á., Barrios, L., Meana, A., Nanetti, A., Higes, M., 2012. The effect of induced
queen replacement on Nosema spp. infection in honey bee (Apis mellifera
iberiensis) colonies. Environ. Microbiol. 14: 845–859. doi: 10.1111/j.14622920.2011.02647.x.
Botías, C., Martín-Hernández, R., Garrido-Bailón, E., González-Porto, A., MartínezSalvador, A., De La Rúa, P., Meana, A., Higes, M., 2012. The growing prevalence
of Nosema ceranae in honey bees in Spain, an emerging problem for the last
decade. Res. Vet. Sci. 93(1): 150-155. doi:10.1016/j.rvsc.2011.08.002.
Brodschneider, R., Crailsheim, K., 2010. Nutrition and health in honey bees. Apidologie
41: 278-294. doi: 10.1051/apido/2010012.
Bromenshenk, J.J., Henderson, C.B., Wick, C.H., Stanford, M.F., Zulich, A.W., Jabbour,
R.E., Deshpande, S.V., McCubbin, P.E., Seccomb, R.A., Welch, P.M., Williams,
T., Firth, D.R., Skowronski, E., Lehmann, M.M., Bilimoria, S.L., Gress, J., Wanner,
K.W., Cramer Jr., R.A., 2010. Iridovirus and microsporidian linked to honey bee
colony decline. PLoS ONE 5(10): e13181.
Brouwers, E.V.M., 1982. Measurement of hypopharyngeal gland activity in the
honeybee. J. Apicul. Res. 21(4): 193-198.
Burgher-MacLellan, K.L., Williams, G.R., Shutler, D., MacKenzie, K., Rogers R.E.L.,
2010. Optimization of duplex real-time PCR with meltingcurve analysis for
detecting the microsporidian parasites Nosema apis and Nosema ceranae in Apis
mellifera. Can. Entomol. 142: 271–283.
Cantwell, G.E., 1970. Standard methods for counting Nosema spores. Am. Bee J. 110:
222-223.
Caron, D.M., Connor, L.J., 2013. Honey bee biology and beekeeping. Kalamazoo, MI:
Wicwas Press, LLC.
84
Chen, Y., Evans, J.D., Smith, B.I., Pettis, J.S., 2008. Nosema ceranae is a long present
and wide spread microsporidian of the European honey bee (Apis mellifera) in the
United States. J. Invertebr. Pathol. 97(2): 186–188.
Chen, Y., Evans, J.D., Zhou, L., Boncristiani, H., Kimura, K., Xiao, T-G., Litkowski,
A.M., Pettis, J.S., 2009. Asymmetrical coexistence of Nosema ceranae and Nosema
apis in honeybees. J. Invertebr. Pathol. 101: 204-209.
doi:10.1016/j.jip.2009.05.012.
Chen, Y., Pettis, J.S., Zhao, Y.T., Liu, X., Tallon, L.J., Sadzewicz, L.D., Li, R., Zheng,
H., Huang, S., Zhang, X., Hamilton, M.C., Pernal, S.F., Melathopoulos, A.P., Yan,
X., Evans, J.D., 2013. Genome sequencing and comparative genomics of honey bee
microsporidia, Nosema apis reveal novel insights into host-parasite interactions.
BMC Genet. 14(451). doi: 10.1186/1471-2164-14-451.
Cornman, R.S., Tarpy, D.R., Chen, Y., Jeffreys, L., Lopez, D., Pettis, J.S.,
vanEngelsdorp, D., Evans, J.D., 2012. Pathogen webs in collapsing honey bee
colonies. PLoS ONE 7(8): e43562. doi:10.1371/journal.pone.0043562.
Cox-Foster, D.L., Conlan, S., Holmes, E.C., Palacios, G., Evans, J.D., Moran, N.A.,
Quan, P.L., Briese, T., Hornig, M., Geiser, D.M., Martinson, V., vanEnglesdorp, D.,
Kalkstein, A.L., Drysdale, A., Hui, J., Zhai, J., Cui, L., Hutchison, S.K., Simons,
J.F., Egholm, M., Pettis, J.S., Lipkin, I., 2007. A metagenomic survey of microbes
in honey bee Colony Collapse Disorder. Sci. 318: 283–287.
Crailsheim, K., 1990. The protein balance of the honey bee worker. Apidologie 21: 417–
429.
Crailsheim, K., Schneider, L.H.W., Hrassnigg, N., Buhlmann, G., Brosch, U.,
Gmeinbauer, R., Schoffmann, B., 1992. Pollen consumption and utilization in
worker honeybees (Apis mellifera carnica): dependence on individual age and
function. J. Insect. Physiol. 38: 409–419.
Crailsheim, K., Stolberg, E., 1989. Influence of diet, age and colony condition upon
intestinal proteolytic activity and size of the hypopharyngeal glands in the honeybee
(Apis mellifera L.). J.Insect Physiol. 35(8): 595-602.
Dainat, B., vanEngelsdorp, D., Neumann, P., 2012. Colony Collapse Disorder in Europe.
Environ. Microbiol. Rep. 4: 123-125.
de Graaf, D.C., Raes, H., Jacobs, F.J., 1994. Spore dimorphism in Nosema apis
(Microsporida, Nosematidae) development cycle. J. Invertebr. Pathol. 63: 92-94.
Decourtye, A., Mader, E., Desneux, N., 2010. Landscape enhancement of floral resources
for honey bees in agro-ecosystems. Apidologie 41: 264-277.
doi:10.1051/apido/2010024.
85
DeGrandi-Hoffman, G., Chen, Y., Huang, E., Huang, M.H., 2010. The effect of diet on
protein concentration, hypopharyngeal gland development and virus load in worker
honey bees (Apis mellifera L.). J. Insect. Physiol. 56: 1184–1191.
Delbac, F., Polonais, V., 2008. The microsporidian polar tube and its role in invasion.
Subcell Biochem. 47: 208-220.
Di Pasquale, G., Salignon, M., Le Conte, Y., Belzunces, L.P., Decourtye, A.,
Kretzschmar, A., Suchail, S., Brunet, J-L., Alaux, C., 2013. Influence of pollen
nutrition on honey bee health: do pollen quality and diversity matter? PLoS ONE
8(8): e72016. doi:10.1371/journal.pone.0072016.
Didier, E.S., Maddry, J.A., Brindley, P.J., Stovall, M.E., Didier, P.J. 2005. Therapeutic
strategies for human microsporidia infections. Expert Rev. Anti. Infect. Ther. 3:
419–434.
Donkersley, P., Rhodes, G., Pickup, R.W., Jones, K.C., Wilson, K., 2014. Honeybee
nutrition is linked to landscape composition. Ecol. Evol. 4(21): 4195- 4206.
Dussaubat, C., Sagastume, S., Gómez-Moracho, T., Botías, C., García-Palencia, P.,
Martín-Hernández, R., Le Conte, Y., Higes, M., 2013. Comparative study of
Nosema ceranae (Microsporidia) isolates from two different geographic origins.
Vet. Microbiol. 162: 670–678. doi: 10.1016/j.vetmic.2012.09.012.
Eischen, F.A., Graham, R.H., 2008. Feeding overwintering honey bee colonies infected
with Nosema ceranae. Am. Bee J. 148: 555.
El-Shemy, A.A.M., Pickard, P.S., 1989. Seasonal variation in the infection of honeybee
colonies with Nosema apis Zander. J. Apicult. Res. 28: 93–100.
Erler, S., Lommatzsch, S., Lattorff, H.M.G., 2012. Comparative analysis of detection
limits and specificity of molecular diagnostic markers for three pathogens
(Microsporidia, Nosema spp.) in the key pollinators Apis mellifera and Bombus
terrestris. Parasitol. Res. 110: 1403–1410. doi: 10.1007/s00436-011-2640-9.
Forsgren, E., Fries, I., 2010. Comparative virulence of Nosema ceranae and Nosema apis
in individual European honey bees. Vet. Parasitol. 170(3-4): 212-217.
Fries, I., 1993. Nosema apis - a parasite in the honey bee colony. Bee World 74(1): 5-19.
Fries, I., 2010. Nosema ceranae in European honey bees (Apis mellifera). J. Invertebr.
Pathol. 103: S73–S79.
Fries, I., Chauzat, M.P., Chen, Y.P., Doublet, V., Genersch, E., Gisder, S., Higes, M.,
McMahon, D.P., Martin-Hernandez, R., Natsopoulou, M., Paxton, R.J., Tanner, G.,
86
Webster, T.C., Williams, G.R., 2013. Standard methods for Nosema research. J.
Apic. Res. 51(5): http://dx.doi.org/10.3896/IBRA.1.52.1.14.
Fries, I., Feng, F., da Silva, A., Slemenda, S.B., Pieniazek, N.J., 1996. Nosema ceranae
sp. (Microspora, Nosematidae), morphological and molecular characterization of a
microsporidian parasite of the Asian honey bee Apis cerana (Hymenoptera, Apidae)
Eur. J. Protistol. 32: 356–365.
Fries, I., Martin, R., Meana, A., Garcia-Palencia, P., Higes, M., 2006. Natural infections
of Nosema ceranae in European honey bees. J. Apic. Res. 45(3): 230-233.
Gallai, N., Salles, J., Settele, J., Vaissière, B. E., 2009. Economic valuation of the
vulnerability of world agriculture confronted with pollinator decline. Ecol. Econ.
68: 810-821.
Giray, T., Robinson, G.E., 1994. Effects of intracolony variability in behavioral
development on plasticity of division of labor in honeybee colonies. Behav. Ecol.
Sociobiol. 35: 13–20.
Gisder, S., Hedtke, K., Möckel, N., Frielitz, M.C., Linde, A., Genersch, E., 2010. Fiveyear cohort study of Nosema spp. in Germany: does climate shape virulence and
assertiveness of Nosema ceranae? Appl. Environ. Microbiol. 76: 3032–3038.
Gisder, S., Möckel, N., Linde, A., Genersch, E., 2011. A cell culture model for Nosema
ceranae and Nosema apis allows new insights into the life cycle of these important
honey bee-pathogenic microsporidia. Environ. Microbiol. 13(2): 404–413.
Goblirsch, M., Huang, Z-Y., Spivak, M. 2013. Physiological and behavioral changes in
honey bees (Apis mellifera) induced by Nosema ceranae infection. PLoS ONE 8(3):
e58165. doi:10.1371/journal.pone.0058165.
Hamiduzzaman, M.M., Guzman-Novoa, E., Goodwin, P.H., 2010. A multiplex PCR
assay to diagnose and quantify Nosema infections in honey bees (Apis mellifera). J.
Invertebr. Pathol. 105: 151–155. doi:10.1016/j.jip.2010.06.001.
Haydak, M.H., 1970. Honey bee nutrition. Annu. Rev. Entomol. 15: 143-156.
doi:10.1146/annurev.en.15.010170.001043.
Herbert, E.W. Jr., Shimanuki, H., 1978. Chemical composition and nutritive value of beecollected and bee-stored pollen. Apidologie 9: 33-40. doi:10.1051/apido:19780103.
Higes, M., Martín-Hernandez, R., Botias, C., Bailon, E.G., Gonzales-Porto, A., Barrios,
L., del Nozal, M.J., Palencia, P.G., Meana, A., 2008. How natural infection by
Nosema ceranae causes honeybee colony collapse. Environ. Microbiol. 10: 2659–
2669.
87
Higes, M., Garcia-Palencia, P., Martin-Hernandez, R., Meana, A., 2007. Experimental
infection of Apis mellifera honeybees with Nosema ceranae (Microsporidia). J.
Invertebr. Pathol. 94: 211–217.
Higes, M., Martín, R., Meana, A., 2006. Nosema ceranae, a new microsporidian parasite
in honeybees in Europe. J. Invertebr. Pathol. 92(2): 93-95.
doi:10.1016/j.jip.2006.02.005.
Higes, M., Martín-Hernández, R., Botías, C., Garrido-Bailón, E., González-Porto, A.V.,
Barrios, L., del Nozal, M.J., Bernal, J.L., Jiménez, J.J., García-Palencia, P., Meana,
A., 2008. How natural infection by Nosema ceranae causes honey bee colony
collapse. Environ. Microbiol. 10: 2659-2669.
Higes, M., Martín-Hernández, R., García-Palencia, P., Marín, P., Meana, A., 2009.
Horizontal transmission of Nosema ceranae (Microsporidia) from worker
honeybees to queens (Apis mellifera). Environ. Microbiol. Rep. 1: 495–498. doi:
10.1111/j.1758-2229.2009.00052.x.
Higes, M., Martín-Hernández, R., Garrido-Bailón, E., González-Porto, A.V., GarcíaPalencia, P., Meana, A., del Nozal, M.J., Mayo, R., Bernal, J.L., 2009. Honeybee
colony collapse due to Nosema ceranae in professional apiaries. Env. Microbiol.
Rep. 1: 110–113. doi: 10.1111/j.1758-2229.2009.00014.x.
Higes, M., Martin-Hernandez, R., Meana, A., 2010. Nosema ceranae in Europe: an
emergent type C nosemosis*. Apidologie 41: 375–392.
Higes, M., Meana, A., Bartolome, C., Botias, C., Martin-Hernandez, R., 2013. Nosema
ceranae (Microsporidia), a controversial 21st century honey bee pathogen. Environ.
Microbiol. Rep. 5:17-29.
Higes, M., Nozal, M.J., Alvaro, A., Barrios, L., Meana, A., Martin-Hernandez, R.,
Bernal, J.L., Bernal, J., 2011. The stability and effectiveness of fumagillin in
controlling Nosema ceranae (Microsporidia) infection in honey bees (Apis
mellifera) under laboratory and field conditions. Apidologie 42: 364–377. doi:
10.1007/s13592-011-0003-2.
Holt, H.L., Aronstein, K.A., Grozinger, C.M., 2013. Chronic parasitization by Nosema
microsporidia causes global expression changes in core nutritional, metabolic and
behavioral pathways in honey bee workers (Apis mellifera). BMC Genomics 14:
799. doi: 10.1186/1471-2164-14-799.
Hrassnigg, N., Crailsheim, K., 1998. The influence of brood on the pollen consumption
of worker bees (Apis mellifera L.). J. Insect Physiol. 44(5-6): 393-404.
Huang, W.F., Solter, L.F., 2013. Comparative development and tissue tropism of Nosema
apis and Nosema ceranae. J. Invertebr. Pathol. 113(1): 35-41.
88
Huang, W-F., Solter, L.F., Yau, P.M., Imai, B.S. 2013. Nosema ceranae escapes
fumagillin control in honey bees. PLoS Pathog. 9(3): e1003185.
doi:10.1371/journal.ppat.1003185.
Huang, Z., 2012. Pollen nutrition affects honey bee stress resistance. Terr. Arthropod
Rev. 5: 175–189.
Huang, Z-Y., Robinson, G.E., Borst, D.W., 1994. Physiological correlates of division of
labor among similarly aged honey bees. J. Comp. Physiol. A. 174: 731–739. doi:
10.1007/bf00192722.
Ishihara, R., 1967. Stimuli causing extrusion of polar filaments of Glugea fumiferanae
spores. Can. J. Microbiol. 13: 1321-1332.
Jaronski, S.T., 1979. Role of the larval mosquito midgut in determining host
susceptibility to Nosema algerae (Microsporidia). Ph.D. Thesis, Cornell University.
Katznelson, H., Jamieson, C.A., 1952. Control of Nosema disease of honeybees with
fumagillin. Sci. 115(2977): 70-71.
Keeling, P., 2009. Five questions about microsporidia. PLoS Pathog. 5(9): e1000489.
Keller, I., Fluri, P., Imdorf, A., 2005. Pollen nutrition and colony development in honey
bees, Part II. Bee World 86: 27-34.
Klee, J., Besana, A.M., Genersch, E., Gisder, S., Nanetti, A., Tam, D.Q., Chinh, T.X.,
Puerta, F., Ruz, J.M., Kryger, P., Message, D., Hatjina, F., Korpela, S., Fries, I.,
Paxton, R.J., 2007. Widespread dispersal of the microsporidian Nosema ceranae, an
emergent pathogen of the western honey bee, Apis mellifera. J. Inverteb. Pathol. 96:
1–10.
Klein, A.M., Vaissière, B.E., Cane, J.H., Steffan-Dewenter, I., Cunnigham, S.A.,
Kremen, C., Tscharntke, T., 2007. Importance of pollinators in changing landscapes
for world crops. Proc. R. Soc. 274: 303–313.
Knecht, D., Kaatz, H.H., 1990. Patterns of larval food production by hypopharyngeal
glands in adult worker honey bees. Apidologie 21: 457–468.
Kralj, J., Fuchs, S., 2010. Nosema sp. influences flight behavior of infected honey bee
(Apis mellifera) foragers. Apidologie 41: 21–28.
Kremen, C., Williams, N.M., Thorp, R.W., 2002. Crop pollination from native bees at
risk from agricultural intensification. PNAS 99(26): 16812-16816.
doi:10.1073/pnas.262413599.
89
Kwakman, P.H.S., Te Velde, A.A., de Boer, L., Speijer, D., Vandenbroucke-Grauls,
C.M.J.E., Zaat, S.A.J., 2010. How honey kills bacteria. FASEB J. 24: 2576–2582.
doi: 10.1096/fj.09-150789.
Lass, A., Crailsheim, K., 1996. Influence of age and caging upon protein metabolism,
hypopharyngeal glands and trophallactic behavior in the honey bee (Apis mellifera
L). Insectes Soc. 43: 347–358.
Laughton, A.M., Boots, M., Siva-Jothy, M.T., 2011. The ontogeny of immunity in the
honey bee, Apis mellifera L. following an immune challenge. J. Insect Physiol. 57:
1023–1032. doi:10.1016/j.jinsphys.2011.04.020.
Le Conte, Y., Mohammedi, A., Robinson, G.E., 2001. Primer effects of a brood
pheromone on honeybee behavioral development. Proc. R. Soc. B 268: 163–168.
Le, C.T., 1997. Applied survival analysis. Wiley-Interscience Publication, New York.
Liu, T.P., 1990. Ultrastructural analysis on the gland secretion in the extracellular ducts
of the hypopharyngeal glands of the honeybee infected by Nosema apis. Tissue and
Cell 22(4): 533–540.
Ma, Z., Li, C., Pan, G., Li, Z., Han, B., Xu, J., Lan, X., Chen, J., Yang, D., Chen, Q.,
Sang, Q., Ji, X., Li, T., Long, M., Zhou, Z., 2013. Genome-wide transcriptional
response of silkworm (Bombyx mori) to infection by the microsporidian Nosema
bombycis. PLoS ONE. 8(12): e84137.
Malone, L.A., Gatehouse, H.S., 1998. Effects of Nosema apis infection on honey bee
(Apis mellifera) digestive proteolytic enzyme activity. J. Invertebr. Pathol. 71: 169174. doi:10.1006/jipa.1997.4715.
Mao, W., Schuler, M.A., Berenbaum ,M.R., 2013. Honey constituents up-regulate
detoxification and immunity genes in the western honey bee Apis mellifera. PNAS
110: 8842–8846. doi: 10.1073/pnas.1303884110.
Martín-Hernández, R., Botías, C., Bailón, E.G., Martínez-Salvador, A., Prieto, L., Meana,
A., Higes, M., 2012. Microsporidia infecting Apis mellifera: coexistence or
competition. Is Nosema ceranae replacing Nosema apis? Environ. Microbiol. 14:
2127–2138.
Martín-Hernández, R., Botías, C., Barrios, L., Martínez-Salvador, A., Meana, A.,
Mayack, C., Higes, M., 2011. Comparison of the energetic stress associated with
experimental Nosema ceranae and Nosema apis infection of honeybees (Apis
mellifera). Parasitol. Res. 3: 605–612.
90
Martín-Hernández, R., Meana, A., Prieto, L., Martínez Salvador, A., Garrido-Bailón, E.,
Higes, M., 2007. Outcome of colonization of Apis mellifera by Nosema ceranae.
Appl. Environ. Microbiol. 73: 6331–6338.
Mattila, H.R., Otis, G.W., 2006. Effects of pollen availability and Nosema infection
during the spring on division of labor and survival of worker honey bees
(Hymenoptera: Apidae). Env. Entomol. 35: 708-717.
Mayack, C., Naug, D., 2009. Energetic stress in the honeybee Apis mellifera from
Nosema ceranae infection. J. Invertebr. Pathol. 100: 185–188.
Meana, A., Martin-Hernandez, R., Higes, M., 2010. The reliability of spore counts to
diagnose Nosema ceranae infections in honey bees. J. Apic. Res. Bee World 49(2):
212–214.
Milbrath, M.O., Tran, T., Huang, W-F., Solter, L.F., Tarpy, D.R., Lawrence, F., Huang,
Z-Y., 2015. Comparative virulence and competition between Nosema apis and
Nosema ceranae in honey bees (Apis mellifera). J. Invertebr. Pathol. 125: 9-15.
Mohammedi, A., Crauser, D., Paris, A., Le Conte, Y., 1996. Effect of a brood pheromone
on honeybee hypopharyngeal glands. C. R. Acad. Sci. 319: 769–772.
Morse, R.A., Calderone, N.W., 2000. The value of honey bees as pollinators of U.S.
crops in 2000. Bee Cult. 128: 2-15.
Naug, D. 2009. Nutritional stress due to habitat loss may explain recent honeybee colony
collapses. Biol. Conserv. 142: 2369-2372. doi:10.1016/j.biocon.2009.04.007.
Naug, D., Gibbs, A., 2009. Behavioral changes mediated by hunger in honeybees
infected with Nosema ceranae. Apidologie 40(6): 595-599.
Nelson, C.M., Ihle, K.E., Fondrk, M.K., Page Jr., R.E., Amdam, G.V., 2007. The gene
vitellogenin has multiple effects on social organization. PLoS Biol. 5: e62. doi:
10.1371/journal.pbio.0050062.
Neumann, P., Carreck, N.L., 2010. Honey bee colony losses. J. Apicult. Res. 49: 1–6.
Ohashi, K., Natori, S., Kubo, T., 1999. Expression of amylase and glucose oxidase in the
hypopharyngeal glands with an age-dependent role change of the worker
honeybee (Apis mellifera L.). Eur. J. Biochem. 265(1): 127–133. doi:
10.1046/j.1432-1327.1999.00696.x.
Patel, N.G., Haydak, M.H., Gochnauer, T.A., 1960. Electrophoretic components of the
proteins in honeybee larval food. Nat. 186: 633–634.
91
Paxton, R.J., Klee, J., Korpela, S., Fries, I., 2007. Nosema ceranae has infected Apis
mellifera in Europe since at least 1998 and may be more virulent than Nosema apis.
Apidologie 38: 558–565.
Pettis, J.S., Lichtenberg, E.M., Andree, M., Stitzinger, J., Rose, R., vanEngelsdorp, D.,
2013. Crop pollination exposes honey bees to pesticides which alters their
susceptibility to the gut pathogen Nosema ceranae. PLoS ONE 8(7): e70182.
Pettis, J.S., vanEngelsdorp, D., Johnson, J., Dively, G., 2012. Pesticide exposure in honey
bees results in increased levels of the gut pathogen Nosema. Naturwissenschaften
99: 153–158. doi: 10.1007/s00114-011-0881-1.
Porrini, M.P., Sarlo, E.G., Medici, S.K., Garrido, P.M., Porrini, D.P., Damiani, N.,
Eguaras, M.J., 2011. Nosema ceranae development in Apis mellifera: influence of
diet and infective inoculum. J. Apic. Res. 50: 35–41. doi:10.3896/IBRA.1.50.1.04.
Retschnig, G., Williams, G.R., Mehmann, M.M., Yañez, O., de Miranda, J.R., Neumann,
P., 2014. Sex-specific differences in pathogen susceptibility in honey bees (Apis
mellifera). PLoS ONE 9(1): e85261. doi:10.1371/journal.pone.0085261.
Rinderer, T.E., Elliot, K.D., 1977. Worker honey bee response to infection with Nosema
apis: influence of diet. J. Econ. Entomol. 70: 431-433.
Rinderer, T.E., Rothenbuhler, W.C., Gochnauer, T.A., 1974. The influence of pollen on
the susceptibility of honey-bee larvae to Bacillus larvae. J. Invertebr. Pathol. 23:
347-350. doi:10.1016/0022-2011(74)90100-1.
Roulston, T.H., Cane, J.H., 2000. Pollen nutritional content and digestibility for animals.
Plant Syst Evol 222: 187-209. doi:10.1007/BF00984102.
Sagili, R.R., Pankiw, T., Metz, B.N., 2011. Division of labor associated with brood
rearing in the honey bee: how does it translate to colony fitness? PLoS ONE 6(2):
e16785.
Santos, K.S., dos Santoa, L.D., Mendes, M.A., de Souza, B.M., Malaspina, O., Palma,
M.S., 2005. Profiling the proteome complement of the secretion from
hypopharyngeal gland of Africanized nurse-honeybees (Apis mellifera L.) Insect
Biochem. Mol. Biol. 35: 85-91.
Schmid, M.R., Brockmann, A., Pirk, C.W.W., Stanley, D.W., Tautz, J., 2008. Adult
honeybees (Apis mellifera L.) abandon hemocytic but not phenoloxidase-based
immunity. J. Insect Physiol. 54: 439–444.
Schmidt, J.O., 1984. Feeding preference of Apis mellifera L. (Hymenoptera: Apidae):
individual versus mixed pollen species. J. Kans. Entomol. Soc. 57: 323-327.
92
Schmidt, J.O., Thoenes, S.C., Levin, M.D., 1987. Survival of honey bees, Apis mellifera
(Hymenoptera: Apidae), fed various pollen sources. J. Econ. Entomol. 80: 176-183.
Schmidt, L.S., Schmidt, J.O., Rao, H., Wang, W., Xu, L., 1995. Feeding preference of
young worker honey bees (Hymenoptera: Apidae) fed rape, sesame, and sunflower
pollen. J. Econ. Entomol. 88: 1591–1595.
Seeley, T.D., 1982. Adaptive significant of the age polyethism schedule in honeybee
colonies. Behav. Eco. Sociobiol. 11:287-293.
Slessor, K.N., Winston, M.L., Le Conte, Y., 2005. Pheromone communication in the
honeybee (Apis mellifera L.). J. Chem. Ecol. 31(11): 2731-45.
Smart, M., Sheppard, W., 2012. Nosema ceranae in age cohorts of the western honey bee
(Apis mellifera). J. Invert. Pathol. 109: 148–151.
Smith, M.L., 2012. The honey bee parasite Nosema ceranae: transmissible via food
exchange? PLoS ONE 7(8): e43319. doi:10.1371/journal.pone.0043319.
Spleen, A.M., Lengerich, E.J., Rennich, K., Caron, D., Rose, R., Pettis, J.S., Henson, M.,
Wilkes, J.T., Wilson, M., Stitzinger, J., Lee, K., Andree, M., Snyder, R.,
vanEngelsdorp, D., 2013. A national survey of managed honey bee 2011-12 winter
colony losses in the United States: results from the Bee Informed Partnership. J.
Apicult. Res. 52(2): 44-53.
Thompson, G.J., Yockey, H., Lim, J., Oldroyd, B.P., 2007. Experimental manipulation of
ovary activation and gene expression in honey bee (Apis mellifera) queens and
workers: testing hypotheses of reproductive regulation. J. Exp. Zool. 307A: 600–
610.
Tofilski, A., 2009. Shorter-lived workers start foraging earlier. Insectes Soc. 56: 359–
366.
Traver, B.E., Fell, R.D., 2011. Nosema ceranae in drone honey bees (Apis mellifera). J.
Invertebr. Pathol. 107(3): 234-236.
Traver, B.E., Fell, R.D., 2011. Prevalence and infection intensity of Nosema in honey bee
(Apis mellifera L.) colonies in Virginia. J. Invertebr. Pathol. 107: 43–49.
Traver, B.E., Williams, M.R., Fell, R.D., 2012. Comparison of within hive sampling and
seasonal activity of Nosema ceranae in honey bee colonies. J. Invertebr. Pathol.
109: 187-193.
Tsaousis, A.D., Kunji, E.R.S., Goldberg, A.V., Lucocq, J.M., Hirt, R.P., Embley, T.M.,
2008. A novel route for ATP acquisition by the remnant mitochondria of
Encephalitozoon cuniculi. Nat. 453: 553–556.
93
van der Zee, R., Pisa, L., Andonov, S., Brodschneider, R., Charrière, J-D., Chlebo, R.,
Coffey, M.F., Crailsheim, K., Dahle, B., Gajda, A., Gray, A., Drazic, M.M., Higes,
M., Kauko, L., Kence, A., Kence, M., Kezic, N., Kiprijanovska, H., Kralj, J.,
Kristiansen, P., Martin- Hernandez, R., Mutinelli, F., Nguyen, B.K., Otten, C.,
Özkırım, A., Pernal, S.F., Peterson, M., Ramsay, G., Santrac, V., Soroker, V.,
Topolska, G., Uzunov, A., Vejsnæs, F., Wei, S., Wilkins, S., 2012. Managed honey
bee colony losses in Canada, China, Europe, Israel and Turkey, for the winters of
2008-9 and 2009-10. J. Apicult. Res. 51(1): 100-114.
vanEngelsdorp, D., Caron, D., Hayes, J., Underwood, R., Henson, M., Rennich, K.,
Spleen, A., Andree, M., Snyder, R., Lee, K., Roccasecca, K., Wilson, M., Wilkes,
J., Lengerich, E., Pettis, J., 2012. A national survey of managed honey bee 2010–11
winter colony losses in the USA: results from the Bee Informed Partnership. J.
Apic. Res. 51: 115–124. doi: 10.3896/ibra.1.51.1.14
vanEngelsdorp, D., Evans, J.D., Saegerman, C., Mullin, C., Haubruge, E., Nguyen, B.K.,
Frazier, M., Frazier, J., Cox-Foster, D., Chen, Y., Underwood, R., Tarpy, D.R.,
Pettis, J.S., 2009. Colony collapse disorder: a descriptive study. PLoS ONE
4(8):e6481.
vanEngelsdorp, D., Underwood, R., Caron, D., Hayes, J., 2007. An estimate of managed
colony losses in the winter of 2006-2007; a report commissioned by the apiary
inspectors of America. Am. Bee. J. 147: 599-603.
Vidau, C., Diogon, M., Aufauvre, J., Fontbonne, R., Viguès, B., Brunet, J.L., Texier, C.,
Biron, D.G., Blot, N., El Alaoui, H., Belzunces, L.P., Delbac, F., 2011. Exposure to
sublethal doses of fipronil and thiacloprid highly increases mortality of honeybees
previously infected by Nosema ceranae. PLoS ONE. 6(6):e21550.
doi:10.1371/journal.pone.0021550.
Vidau, C., Panek, J., Texier, C., Biron, D.G., Belzunces, L.P., Le Gall, M., Broussard, C.,
Delbac, F., Alaoui, H.El, 2014. Differential proteomic analysis of midguts from
Nosema ceranae-infected honeybees reveals manipulation of key host functions. J.
Invertebr. Pathol. 121: 89–96. doi:10.1016/j.jip.2014.07.002.
Waddington, K.D., Nelson, M., Page Jr., R.E., 1998. Effects of pollen quality and
genotype on the dance of foraging honey bees. Anim. Behav. 56: 35–39.
Wahl, O., Ulm, K., 1983. Influence of pollen feeding and physiological condition on
pesticide sensitivity of the honey bee Apis mellifera carnica. Oecologia 59: 106128. doi:10.1007/BF00388082.
Wang I., Moeller, F.E., 1971. Ultrastructural changes in the hypopharyngeal glands of
worker honey bees infected by Nosema apis. J. Invertebr. Pathol. 17: 308–320.
94
Wang, H., Zhang, S., Yan, W., 2014. Nutrition affects longevity and gene expression in
honey bee workers. Apidologie 45: 618-625.
Weidner, E., 1972. Ultrastructural study of microsporidian invasion into cells. Z.
Parasitenk. 40: 227-242.
White Jr, J.W., Subers, M.H., Schepartz, A.I., 1963. The identification of inhibine,
antibacterial factor in honey, as hydrogen peroxide, and its origin in a honey
glucose oxidase system. BBA 73: 57-70.
Wiess, L.M., Becnel, J.J., 2014. Microsporidia: Pathogens of Opportunity. Hoboken, NJ:
Wiley-Blackwell.
Willard, L.E., Hayes, A.M., Wallrichs, M.A., Rueppell, O., 2011. Food manipulation in
honeybees induces physiological responses at the individual and colony level.
Apidologie. 42(4): 508-518.
Williams, G.R., Sampson, M.A., Shutler, D., Rogers, R.E., 2008. Does fumagillin control
the recently detected invasive parasite Nosema ceranae in western honey bees (Apis
mellifera)? J. Invertebr. Pathol. 99: 342–344.
Williams, G.R., Shutler, D., Little, C.M., Burgher-MacLellan, K.L., Rogers, R.E.L.,
2010. The microsporidian Nosema ceranae, the antibiotic Fumagillin-B, and
western honey bee (Apis mellifera) colony strength. Apidologie. 42: 15-22. doi:
10.1051/apido/2010030.
Wilson-Rich, N., Dres, S.T., Starks, P.T., 2008. The ontogeny of immunity: development
of innate immune strength in the honey bee (Apis mellifera). J. Insect Physiol. 54:
1392–1399.
Winston, M.L., 1987. The Biology of the Honey Bee. Cambridge, MA: Harvard
University Press.
Zander, E. 1909. Tierische parasiten als krankenheitserreger bei der biene. Münch
Bienenztg 31: 196-204.
Zheng, HQ., Lin, ZG., Huang, SK., Sohr, A., Chen, YP., 2014. Spore loads may not be
used alone as a direct indicator of the severity of Nosema ceranae infection in
honey bees Apis mellifera (Hymenoptera: Apidae). J. Econ. Entomol. 107(6): 20372044.
95
Appendix
96
Appendix A: Chapter 2 Supporting Information
Figure A.1 Gel showing multiplex PCR amplicons of lengths specific to the 16S rRNA
of Nosema ceranae and Nosema apis, as well as the honey bee house-keeping gene RpS5.
Lanes 1-8 show samples from infected honey bees from each of the eight quadruplecohort colonies. Only the Nosema ceranae species was present in the colonies. Lane 9 is
a sample infected only with Nosema ceranae, Lane 10 is a sample infected only with
Nosema apis. Lane 11 is a sample of non-infected honey bees. Lane M is a 100 bp DNA
ladder.
97
Appendix B: Chapter 3 Supporting Information
Table B.1 List of pesticide residues detected in wild flower pollen
used in diets.
Pesticide Residue
Result PPB
Carbendazim (MBC)
Trace
Chlorfenopyr
Trace
Chlorpyrifos
3.7
Cyhalothrin total
Fluvalinate
Trace
34
Hexachlorobenzene (HCB)
Trace
Quintozene (PCNB)
Trace
Trifluralin
2.6