Current Research Journal of Biological Sciences 4(1): 27-32, 2012
ISSN: 2041-0778
© Maxwell Scientific Organization, 2012
Submitted: September 21, 2011
Accepted: October 24, 2011
Published: January 20, 2012
Expression Analysis of CAMP-Responsive Element Modulator
Mrna in Different Tissues of Goat
Nasim Javdan and Jasem Estakhr
Science and Research Branch, Islamic Azad University, Fars, Iran
Abstract: CAMP-Responsive Element Modulator (CREM) is a key factor in the regulation of the expression
of number of post-meiotic genes during spermatogenesis. CREM binds to transcription factor and regulates
gene expression in spermatids. In the present study tissue-specific expressions of CREM and different
development stage expressions of CREM in testes of goat were quantified using qRT-PCR. The highest level
was detected in testes (p<0.05). The expression of CREM mRNA reached the highest level in 20-wk-old testes
(p<0.05). Furthermore, immunohistochemistry localized CREM mainly expressed in round spermatids, but not
in spermatogonium and spermatocyte. These results indicated that CREM was a regulation proteins and it may
play an important role in spermatid maturation.
Key words: CAMP-responsive element modulator, gene expression, goat, QRT-PCR
(bZIP) DNA-binding domains were encoded by H and
Ia/Ib. The DNA-binding domain itself containing leucine
zipper region has been shown essential for DNA-protein
interaction, and leucine zipper region was important in
binding to the CREM (Behr and Weinbauer, 2001). So
far, SCREM was notable for its pivotal roles in
spermatogenesis. As a master-switch, CREM could
regulate the differentiation and apoptosis of male germ
cell by alternative splicing of exons and alternative start
sites of translation (Lalli and Sassone-Corsi, 1994;
Habener et al., 1995). During puberty, activator isoforms
of CREM (CREMJ) accumulated in pachytene
spermatocytes and spermatids, while the CREMJ protein
can only be detected in haploid spermatids (Delmas et al.,
1993). CREM deficient mouse was sterile due to postmeiotic arrest at the first step of spermiogenesis (Blendy
et al., 1996; Nantel et al., 1996; Weinbauer et al., 1998;
Peri and Serio, 2000). CREM gene has been cloned
frommany species. The distribution of CREM in different
tissues has also 81 been studied in dog (Uyttersprot and
Miot, 1997), and non-human primates (Behr and
Weinbauer, 2000). However, little is known about CREM
cDNA sequence information in goat and expression
pattern in different tissues or different development stage
of testis. In this study, we cloned the nucleotide sequence
of CREMJa cDNA and characterized its deduced amino
acid sequence in goat testes. We also examined the
relative expression of CREM mRNA in various tissues
and in different developmental stages of the testis. The
cellular locations of CREM in adult goat testes were also
studied using immunohistochemistry.
INTRODUCTION
CAMP-responsive element modulator (CREM)
belongs to the CAMP-Responsive Element Binding
protein (CREB) family, multiple isoforms of CREM, that
act either as repressors or activators (Foulkes and
Sassone-Corsi, 1992). CREB family play important roles
in regulating transcription in response to various stresses,
metabolic and developmental signals (Sassone-Corsi,
1995; Hummler et al., 1994). CREM transcription factors
have been known to function 59 in many physiological
systems, including cardiac function (Müller et al., 2003;
Isoda et al., 2003), circadian rhythms (Foulkes et al.,
1997), pituitary function (Struthers et al., 1991), memory
and long-term potentiation (Silva et al., 1998), locomotion
(Maldonado et al., 1999), and spermatogenesis (SassoneCorsi, 1998; Sassone-Corsi, 2000; Oh et al., 2007).
CREM includes at least 14 exons and functional domains
were encoded by specific excons ( Walker and Habener,
1996; Daniel et al., 2000; Behr and Weinbauer, 2001;
Gellersen et al., 2002). Exon A was not translated. Exon
B has been known to be alternatively spliced by exons 21
and 22. The exons 21 and 22 contain an ATG codon and
two putative CRE sequences in their promoter region
(Daniel et al., 2000; Gellersen et al., 2002). Exons C and
G encode glutamine-rich domains that are essential for
transactivation. Exons E and F encode Kinase-Inducible
Domain (KID) being rich in serine residues which can be
phosphorylated and activated by several kinases (de Groot
et al., 1993; de Groot et al., 1994). However, activation of
CREM was phosphorylation-independent but activated by
ACT in testes (Fimia et al., 1999). Basic leucin zipper
Corresponding Author: Jasem Estakhr, Science and Research Branch, Islamic Azad University, Fars, Iran, Tel.: +989179283966
27
Curr. Res. J. Biol. Sci., 4(1): 27-32, 2012
Table 1: Sequences of primers used in this research
Primers
Sequence (5’- 3’)
Primers forRT-PCR
SP1F
TCCGGCCAGACCGTCCATGT
SP1R
GCCTCAGCTCCCGTTTGCGT
SP2F
TCCCAGTGGGGCTCGTCGTC
SP2R
GCTGCTGGGGACTGTGCAGG
Primers for 5’-and 3’-RACE
5’-GSP
GGGCTGGACTTTCATCCATTTC
CACAG
3’-GSP
TCCCTGGCTCCTGCCTCCCAA
ACTG
10X UPM
CTAATACGACTCACTATAGGG
CAAGC\
AGTGGTATCAACGCAGAGT
5’ CDS
(T)25V N
(N = A, C, G, or T; V = A, G, or C)
3’CDS
AAGCAGTGGTATCAACGCAGA
GTAC
(T)30V
(N = A, C, G, or T; V = A, G, or C)
SMART Oligo
AAGCAGTGGTATCAACGCAGA
GTA
CGCGGG
Primers for qRT-PCR
GAPDH
F
TCCACGGCACAGTCAAGG
R
TCAGCACCAGCATCACCC
CREM
F
TGCTGCCACTGG CGACATGC
R
TGCTGGGGACTGTGCAGGCT
expression levels in different samples with GAPDH as an
internal standard. All PCR reactions were performed
using Mx3000P real-time PCR system (Stratagene, USA)
and SYBR® Permix Ex TaqTM 143 kit (Takara, Japan)
following the manufacturers’ instructions. One microgram
total RNA from different samples was reverse transcribed
into cDNA with a PrimeScriptTM 145 RT reagent kit. All
the primer sequences of Q-PCR are shown in Table 1. QPCR was performed at 95ºC for 10 s; 40 cycles of 95ºC
for 10 s, 62ºC for 20 s, and a following cycle of 62ºC for
147 30 s and 95 ºC for 15 s and reaction specificity was
determined when dissociation curves were only specific
peak. PCR efficiencies were detected using relative
standard curve derived from diluted cDNA reaction
mixture (10-fold serial dilution with six levels: 106×,
105×, 150×, 104×, 103×, 102×, 101151×, respectively for
GAPDH and CREM). PCR efficiencies were between 90
and 110%, and R2 152 values for all standard curves were
between 0.998 and 0.999. The relative levels of mRNA of
the CREM were expressed as a percentage of the mean
contents of CREM RT-PCR products to that of GAPDH.
Data of real-time PCR analysis was statistically analyzed
using SPSS software by One-Way ANOVA and t-test to
compare the difference in mean values (p<0.05).
MATERIALS AND METHODS
Immunohistochemistry assay: Immunolocalization was
performed to determine CREM localization in testes using
commercial immunostaining kit (Boster, China). The
testes were fixed and embedded in paraffin wax using
standard techniques. Paraffin sections were
deparaffinized, rehydrated, and then treated with 3% H2
O 2 at 37ºC for 10 min. The deparaffinized sections were
then blocked with 2% Bovine Serum Albumin (BSA) for
30 min at 37ºC, washed in Phosphate Buffer Saline (PBS,
0.01 M pH 7.2) for 20 min, and incubated with Polyclonal
goat anti-CREM primary antibody (Abcam, USA)
overnight at 4 ºC. Having been washed with PBS, slides
were treated with secondary antibody (Boster, china) and
streptavidin-biotin-complex (SABC) under the instruction
of manufacturer. Each section was visualized with 3, 3’diaminobenzidine (DAB). For immunofluorescence
analysis, sections were treated with thegreen-fluorescein
isothiocyanate (FITC) or red fluorescence (169 Cy3) after
incubated with primary antibody. Negative controls were
performed by using no primary antibody or replacing with
normal goat serum. The sections were viewed under Leica
DMIRB microscope (Leica, Germany).
Animal and tissue collections: Male Taihang black goat
used in this study was maintained at Zabol Agricultural
Research Institute on November 2010. Six adult male
bucks were killed and the testes, heart, lung, kidneys,
liver, muscle, brain, spleen from each goat were collected,
and then brought to department of biology, Science and
Research Branch, Islamic Azad University, Fars, Iran, and
stored at -80ºC for the tissue-specific expression analysis
of CREM. To identify expression of CREM in different
developmental stages of the testes, bucks were castrated
at 1, 2, 4, 6, 8, 12 and 20 week-old. Half of the testis was
frozen in liquid nitrogen for total RNA extraction and the
other half was fixed in a 4% paraformaldehyde solution.
Five replicates for each age and three replicates for each
tissue were collected.
Total RNA isolation and clean up: Total RNA was
extracted from all collected tissues using Trizol Reagent
protocol as specified by the manufacturer (Invitrogen,
Carlsbad, 103 CA, USA). Total RNA integrity was
confirmed by running the RNA sample on a 1%
formaldehyde agarose gel with ethidium bromide and
quantity was determined spectrophotometrically
(NanoDrop ND-1000, NanoDrop Technologies Inc.,
USA). Total RNA was cleaned up from contaminating
DNA using RNeasy Mini Kit (Invitrogen, USA) and
purity of RNA samples was evaluated using an RNA Pico
Chip Kit (Agilent).
RESULTS AND DISCUSSION
Expression analysis of CREM mRNA in different
tissues: The results of CREM mRNA expression in adult
goat tissues were shown in Fig. 1. The highest level of
CREM mRNA was observed in testes (p<0.05), and the
lowest expression was detected in lung (p<0.05). CREM
Real-time PCR analysis: Quantitative PCR was
conducted to determine the relative CREM mRNA
28
Curr. Res. J. Biol. Sci., 4(1): 27-32, 2012
Relative expression of
CREM mRNA (%)
120
was 191 essential for brain development (Maldonado
et al.,1999; Díaz-Ruiz et al., 2008), cholesterol synthesis
in the liver (Acimovic et al., 2008), and cardiac function
(Müller et al., 2003; Isoda et al., 2003). The results
suggested that the various levels of CREM expression in
tissues may played different biological functions. The
similar results were reported by De Cesare et al. (2000)
who found CREM expressed in various tissues and with
high expression in testes (De Cesare et al., 2000). Also,
Northern-blot analysis showed that the transcripts of
CREM were dominant in the testes and very low in lung
in dog (Uyttersprot and Miot, 1997). However, Behr and
Weinbauer (2000) found CREM activator can only be
detected in testes, and other organs such as liver, heart,
kidneys, cortex, and cerebellum could not be detected in
the primate (Behr and Weinbauer, 2000). These different
results may be associated with the species or test methods.
The high relative expression of CREM in kidney was also
observed in the present study. However, the function of
CREM in kidney and other tissues was still unknown.
Prior studies revealed CAMP-responsive Element Binding
Protein (CREB), as the same family member with CREM,
played important roles in survival of renal epithelial cells
to oxidant stress (Arany et al., 2005). So we deduced
CREM and CREB may be together to play role in kidney
and other tissues. In order to understand the mechanism of
the specific tissue expression pattern of CREM, further
research based on these primary results is needed.
e
100
80
d
60
d
40
c
b
20
b
b
a
0
T
H
Lu
S
Organs
Li
K
B
M
(a)
120
Relative expression of
CREM mRNA (%)
100
80
60
40
20
0
1wk
2wj
4wk
6wk
Age
8wk 12wk
20wk
(b)
Fig. 1: Relative expression levels of CREM mRNA in different
tissues (a) and different ages of testes (b). Results are
means±S.E.M (n = 5) and normalized by GAPDH.
Values with different lowercase letter are significantly
different (p<0.05). Testes (T), Heart (H), Liver (Li),
Spleen (S), Lung (Lu), Kidney (K), Muscle (M), Brain
(B)
Expression analysis of CREM mRNA in testes of
different age: William and Habenes. (1999) found
CREB and CREM specific relation during germ cell
Fig. 2: Immunohistochemistry displaying the location of CREM in sexually maturevgoat testes. The a, a’, b and b’ were reacted
with anti-CREM antibody, for controls A and B reacted with normal serum. For immunofluorescence analysis, CREM
staining was visualized using FITC (green fluorescence) or Cy3 (red fluorescence). The antibody reacted prominently with
CST in 20-wk-old testes section ( a, a’ and b, b’). The control exhibited no positive signals (A). NS: no signal; SS: strong
signal; CST: Convoluted seminiferous tubules.
29
Curr. Res. J. Biol. Sci., 4(1): 27-32, 2012
Arany, I., J.K. Megyesi, J.E. Reusch and R.L. Safirstein,
2005. CREB mediates ERK-induced survival of
mouse renal tubular cells after oxidant stress. Kidney
Int., 68(4): 1573-1582.
Behr, R. and G.F. Weinbauer, 2001. CAMP response
element modulator (CREM): An essential factor for
spermatogenesis in primates? Int. J. Androl., 24:
126-135.
Behr, R. and G.F. Weinbauer, 2000. CREM activator and
repressor isoforms in human testis: Sequence
variations and inaccurate splicing during impaired
spermatogenesis. Mol. Hum. Reprod., 6: 967-972.
Blendy, J.A., K.H. Kaestner, G.F. Weinbauer,
E.Nieschlag and G. Schütz, 1996. Severe impairment
of spermatogenesis in mice lacking the CREM Gene.
Nature, 380: 162-165.
Blöcher, S., R. Behr, G.F. Weinbauer, M. Bergmann and
K. Steger, 2003. Different CREM isoform gene
expression between equine and human normal and
impaired spermatogenesis. Theriogenology, 356(60):
1357-1369.
Daniel, P.B., I. Rohrbach and J.F. Habener, 2000. Novel
cyclic adenosine 3’, 5’-monophosphate (CAMP)
response element modulator isoforms expressed by
low newly identified CAMP-responsive promoters
active in testis. Endocrinology, 141: 3923-3930.
De Cesare, D., G.M. Fimia and P. Sassone-Corsi, 2000.
CREM, a master switch of the transcriptional cascade
in male germ cells. J. Endocrinol. Invest., 23:
592-596.
De Groot, R.P., J. Den Hertog, J.R. Vandenheede, J.Goris
and P. Sassone-Corsi, 1993. Multiple and cooperative
phosphorylation events regulate the CREM activator
function. EMBO J., 12: 3903-3911.
De Groot, R.P., L.M. Ballou and P. Sassone-Corsi, 1994.
Positive regulation of the CAMP-responsive activator
CREM by the p70 S6 kinase: an alternative route to
mitogen-induced gene expression. Cell, 79: 81-91.
Delmas, V., F. Van Der Hoorn, B. Mellström, B. Jégou
and P. Sassone-Corsi, 1993. Induction of CREM
activator proteins in spermatids: downstream targets
and implications for haploid germ cell differentiation.
Mol. Endocrinol., 7: 1502-1514.
Díaz-Ruiz, C., R. Parlato, F. Aguado, J.M. Ureña,
F.Burgaya, A. Martínez, M. Carmona, G. Kreiner, S.
Bleckmann, J.A. Del Río, G. Schütz and E.Soriano,
2008. Regulation of neural migration by the
CREB/CREM transcription factors and altered Dab1
levels in CREB/CREM mutants. Mol. Cell.
Neurosci., 39: 519-528.
Fimia, G.M., D. De Cesare and P. Sassone-Corsi, 2000. A
family of LIM-only transcriptional coactivators:
tissue-specific expression and selective activation of
CREB and CREM. Mol. Cell Biol., 20: 8613-8622.
development in testes and spermatogenesis. We examined
the mRNA expression in 1, 2, 4, 6, 8, 12 and 20 weeks of
goat testes. The results showed that relative expression of
CREM showed no difference between 1, 2, 4, 6 and 8-213
wk-old testes (p>0.05), increased at 12 wk (p<0.05),
and reached the highest level in 20-wk-old testes
(p<0.05) (Fig. 1). Similar observations were observed
by Fimia et al. (2000) who found CREM protein was
mainly expressed after 3 weeks, and reached the highest
levels in adult mouse testes (Fimia et al., 2000). It was
suggested that CREM was an age-dependent protein in
testes. The cellular locations of CREM in adult goat testes
(20-wk-old) showed CREM was only detected in round
spermatids of the convoluted seminiferous tubules
(Fig. 2). Similar observations were also observed in
human (Blendy et al., 1996; Blöcher et al., 2003), and
mouse (Blendy et al., 1996; Nantel et al., 1996). The postmeiotic expression of known or novel genes such as RT7
(Delmas et al., 1993), CYP51, angiotensin converting
enzyme (Zhou et al., 1996), transition protein-1 (Kistler
et al., 1994), calspermin (Sun et al., 1995), and PHGPx
(Tramer et al., 2004) have been shown to be CREM
targets. The expression of PHGPx mRNA in goat testes
has been studied by Shi et al. (2010). PHGPx is essential
for spermatogenesis and male fertility (Shi et al., 2010).
In this study, the same expression patterns were observed
between CREM and PHGPx. It could be suggested
CREM in adult goat testes may function to regulate the
post-meiotic expression of spermatogenesis related gene.
In summary, we obtained the full-length of goat CREMJa
cDNA for the first time and determined the expression
patterns of CREM mRNA in different tissues and
different ages of testes in goat. CREM was ubiquitously
detected in all tissues, suggesting CREM play important
biological roles in goat. The high expression level of
CREM mRNA and immunohistochemical localization of
CREM in goat testes suggested that CREM may play
important roles in male fertility. Further studies about
regulation mechanisms of CREM in goat testes 235 need
to be conducted.
ACKNOWLEDGMENT
We are grateful to Science and Research Branch,
Islamic Azad University, Fars, Iran for supporting this
study.
REFERENCES
Acimovic, J., M. Fink, D. Pompon, I. Bjorkhem,
J. Hirayama, P. Sassone-Corsi, M. Golicnik and D.
Rozman, 2008. CREM modulates the circadian
expression of CYP51, HMGCR and
cholesterogenesis in the liver. Biochem. Biophys.
Res. Commun., 376: 206-210.
30
Curr. Res. J. Biol. Sci., 4(1): 27-32, 2012
Fimia, G.M., D. De Cesare and P. Sassone-Corsi, 1999.
CBP-independent activation of CREM and CREB by
the LIM-only protein ACT. Nature, 398: 165-169.
Foulkes, N.S., J. Borjigin, S.H. Snyder and P. SassoneCorsi, 1997. Rhythmic 259 transcription: The
molecular basis of circadian melatonin synthesis.
Trend. Neurosci., 20: 487-492.
Foulkes, N.S. and P. Sassone-Corsi, 1992. More is better:
Activators and repressors from the same gene. Cell,
68(3): 411-414.
Habener, J.F., C.P. Miller and M. Vallejo, 1995. CAMPdependent 308 regulation of gene transcription by
CAMP response element-binding protein and CAMP
response element modulator. Vitam. Horm., 51: 1-57.
Hummler, E., T.J. Cole, J.A. Blendy, R. Ganss, A.Aguzzi,
W. Schmid, F. Beermann and G. Schutz, 1994.
Targeted mutation of the CREB gene: Compensation
within the CREB/ATF family of transcription factors.
Proc. Natl. Acad. Sci. USA, 91(12): 5647-5651.
Gellersen, B., R. Kempf, R. Sandhowe, G.F. Weinbauer
and R. Behr, 2002. Novel leader exons of the cyclic
adenosine 3’, 5’-monophosphate response element
modulator (CREM) gene transcribed from promoters
P3 and P4, are highly testis-specific in primates. Mol.
Hum. Reprod., 8: 965-976.
Isoda, T., N. Paolocci, K. Haghighi, C. Wang, Y. Wang,
D. Georgakopoulos, G. Servillo, M.A. Della Fazi,
E.G. Kranias, A.A. Depaoli-Roach, P. Sassone-Corsi
and D.A. Kass, 2003. Novel regulation of cardiac
force-frequency relation by CREM (CAMP response
element modulator. FASEB J., 17: 144-151.
Kistler, M.K., P. Sassone-Corsi and W.S. Kistler, 1994.
Identification of a functional cyclic adenosine 3’, 5’monophosphate response element in the 5’-flanking
region of the gene for transition protein 1 (TP1), a
basic chromosomal protein of mammalian
spermatids. Biol. Reprod., 51: 1322-1329.
Lalli, E. and P. Sassone-Corsi, 1994. Signal transduction
and gene regulation: The nuclear response to CAMP.
J. Biol. Chem., 269: 17359-17362.
Maldonado, R., C. Smadja, C. Mazucchelli and
P.Sassone-Corsi, 1999. Altered emotional and
locomotor responses in mice deficient in the
transcription factor CREM. Proc. Natl. Acad. Sci.,
96: 14094-14099.
Müller, F.U., G. Lewin, M. Matus, J. Neumann,
B.Riemann, J. Wistuba, G. Schütz and W. Schmitz,
2003. Impaired cardiac contraction and relaxation
and decreased expression of sarcoplasmic Ca2+253ATPase in mice lacking the CREM gene. FASEB J.,
17(1): 103-105.
Nantel, F., L. Monaco, N.S. Foulkes, D. Masquilier,
M. LeMeur, K. Henriksén, A. Dierich, M. Parvinen
and P. Sassone-Corsi, 1996. Spermiogenesis
deficiency and germ cell apoptosis in CREM mutant
mice. Nature, 380: 159-162.
Oh, M.S., W.M. Yang, M.S. Chang, W. Park, R. Kim do,
H.K. Lee, W.N. Kim and S.K. Park, 2007. Effects of
Rubus coreanus on sperm parameters and CAMPResponsive Element Modulator (CREM) expression
in rat testes. J. Ethnopharmacol, 114: 463-467.
Peri, A. and M. Serio, 2000. The CREM system in human
spermatogenesis. J. Endocrinol. Invest, 23: 578-583.
Sassone-Corsi, P., 1995. Transcription factors responsive
to cAMP. Annu Rev. Cell Dev. Biol., 11: 355-377.
Sassone-Corsi, P., 2000. CREM: A master-switch
regulating the balance between differentiation and
apoptosis in male germ cells. Mol. Reprod. Dev., 56:
228-229.
Sassone-Corsi, P., 1998. CREM: A master-switch
governing male germ cell differentiation and
apoptosis. Semin. Cell Dev. Biol., 9: 475-482.
Shi, L.G., W.J. Xun, W.B. Yue, C.X. Zhang, Y.S. Ren,
Q. Wang, X.Y. Wu, L. Shi, R.J. Yang and F.L.Lei,
2010. Cloning, characterization and expression
analysis of goat (Capra hircus) phospholipid
hydroperoxide glutathione peroxidase (PHGPx). Int.
J. Biol. Sci., 6(4): 316-326.
Silva, A.J., J.H. Kogan, P.W. Frankland and S. Kida,
1998. CREB and memory. Annu. Rev. Neurosci., 21:
127-148.
Struthers, R.S., W.W. Vale, C. Arias, P.E. Sawchenko
and M. Montminy, 1991. Somatotroph hypoplasia
and dwarfism in transgenic mice expressing a nonphosphorylatable CREB mutant. Nature, 350:
622-624.
Sun, Z., P. Sassone-Corsi and A.R. Means, 1995.
Calspermin gene transcription is regulated by two
cyclic AMP response elements contained in an
alternative promoter in the calmodulin kinase IV
gene. Mol. Cell Biol., 15: 561-571.
Tramer, F., L. Caponecchia, P. Sgrò, M. Martinelli,
G. Sandri, E. Panfili, A. Lenzi and L. Gandini, 2004.
Native specific activity of glutathione peroxidase
(GPx-1), phospholipid hydroperoxide glutathione
peroxidase (PHGPx) and Glutathione Reductase
(GR) does not differ between normo-and hypomotile
human sperm samples. Int. J. Androl., 27: 88-93.
Uyttersprot, N. and F. Miot, 1997. Dog CREM
transcription factors: cloning, tissue distribution and
identification of new isoforms. Biochem. Biophys.
Res. Commun., 237: 74-78.
31
Curr. Res. J. Biol. Sci., 4(1): 27-32, 2012
Walker, W.H. and J.F. Habener, 1996. Role of
transcription factors CREB and CREM in cAMPregulated transcription during spermatogenesis.
Trends Endocrinol. Metab, 7: 133-138.
Weinbauer, G.F., R. Behr, M. Bergmann and
E. Nieschlag, 1998. Testicular cAMP responsive
element modulator (CREM) protein is expressed in
round spermatids but is absent or reduced in men
with round spermatid maturation arrest. Mol. Hum
Reprod., 4: 9-15.
William, H.W. and J.F. Habenes, 1999. Role of
transcription factors CREB and CREM in CAMR
regulated transcription during Spermatogenesis.
Trend. Endocrinol. Met., 7(4): 133-138.
Zhou, Y., Z. Sun, AR. Means, P. Sassone-Corsi and
K.E. Bernstein, 1996. CAMP-response element
modulator tau is a positive regulator of testis
angiotensin converting enzyme transcription. Proc.
Natl. Acad. Sci., 93: 12262-12266.
32