Supplemental Figure Legends Supplemental Figure 1. Effects of maternal injection with vehicle (CTL), flutamide (FLU) or DHT propionate from GD 60 to 90 on oSDN development. A, treatment differences in thionin volume; B, treatment differences in oSDN length. Data (mean ± SEM) were analyzed by 2-way ANOVA followed by LSD test. Bars with different superscripts differ significantly (P < 0.05). Supplemental Figure 2. Effects of maternal injections with vehicle (CTL), flutamide (FLU) or DHT propionate from GD 60 to 84 on preoptic area (POA) GnRH and Kiss1 gene expression in GD 85 ovine fetuses. Data (means ± SEM) were analyzed by 2-way ANOVA. Supplemental Table 1. Ovine primer sequences used in qtRT-PCR Gene Sense Antisense LHβ TGTCATCCTGCCGCCCATGC GGAGCCGAACGGAGGCGAAG FSHβ TGCCCAGGATGAAGTCCGTCCAGT ACCAAGTCCCGGGTGTAGCAAT α-subunit CTCCAGCGAGGTCTAAGAAG CACTGTGGCCTTGGTAAATG KISS TTCCAGGACCGGCATCTTC GAGCCTGTGGTTCTAGGATTC GnRH TGCTCTGGTCAACACTGGTC GAGGAGAATGGGACTGGTGA GAPDH TCATCCATGACCACTTTG AGTAGAAGCAGGGATGATGT Length 74 175 84 133 154 145 Accession # NM001009380 NM001009798 NM001009464 JQ716394 U02517 NM001190390 Supplemental Table 2. Effects of maternal injection with flutamide (Flu) and DHT propionate (DHTP) from GD 60 to 90 on physical measures and serum testosterone concentrations of GD 135 ovine fetuses. Measure Treatment CTL CTL Flu Flu DHTP DHTP male female male female male female Testosterone† 225±55 147±16* 153±26 122±26* 191±35 109±14* (pg/ml) Brain wt (g) 52.9±1.0 49.0±0.7 51.4±1.1 50.3±1.0 52.8±1.2 51.3±1.6 A.Pit wt (mg) 46.8±9.3 37.2±7.6 43.3±4.8 33.2±5.4 40.0±7.6 35.0±3.6 Body wt (kg) 4.1±0.2 3.3±0.1 3.7±0.3 3.2±0.3 4.1±0.4 3.9±0.4 CRL (cm) 53.0±0.7 48.9±0.5 50.3±1.3 49.4±1.3 52.0±1.8 51.4±1.6 AGD/AUD 0.8±.01 0.1±.01* 0.9±.01 0.1±.01* 0.9±.01 0.1±.01* n 6-7 4-7 6-7 5-7 5-6 7 †, Serum testosterone was measured in umbilical artery blood. Data (means±SEM) were analyzed by two-way ANOVA. The mean concentration of serum testosterone was significantly greater in males than in females [F(1,34) = 4.6; P <0.05], but was not significantly affected by treatment [F(2.34) = 1.5; P = 0.2]. There were no significant sex or treatment effects on brain weight (wt), anterior pituitary (A.Pit.) wt, body wt or crown-rump length (CRL). The expected larger ratio of anogential distance to anoumbilical distance (AGD/AUD) found in males compared to females [F(1,35) = 10,963: P < 0.0001] was not affected by treatment [F(2,35) = 1.0; P = 0.4]. *, Indicates significant main effect of sex, P < 0.05. Supplemental Table 3. Effects of maternal injections with flutamide (Flu) or DHT propionate from GD 60 to 84 on physical measures in GD 85 ovine fetuses. Treatment CTL CTL female Flu Flu DHTP DHTP Measure male male female male female Body wt (g) 477±12 474±8 525±18 505±17 514±16 500±23 Brain wt (g) 13±0.5 12±0.2 13±0.3 13±0.5 13±0.4 13±0.5 CRL (cm) 26±0.4 26±.4 27±0.4 26±0.6 26±.3 26±.4 AUG/AUD 0.9±0.01 0.09±0.01* 0.9±0.003 0.1±0.02* 0.9±0.004 0.1±0.003* n 6-7 5 5-6 4-9 14 8 Data (means±SEM) were analyzed by two-way ANOVA. There were no significant sex or treatment effects on body weight (wt), brain wt or crown-rump length (CRL). The expected larger ratio of anogential distance to anoumbilical distance (AGD/AUD) found in males compared to females [F(1,43) = 10,228: P < 0.0001] was not affected by treatment [F(2,43) = 0.6; P = 0.5]. *, Indicates significant main effect of sex, P < 0.05. *, Indicates significant main effect of sex, P < 0.05; no treatment effects were observed.