Genetic reprogramming of tumor cells by zinc finger
transcription factors
Pilar Blancafort*†, Emily I. Chen*‡, Beatriz Gonzalez*, Sharon Bergquist*, Andries Zijlstra§, Daniel Guthy¶,
Arndt Brachat¶, Ruud H. Brakenhoff储, James P. Quigley§, Dirk Erdmann¶, and Carlos F. Barbas III*,**
*Department of Molecular Biology and The Skaggs Institute for Chemical Biology, and Departments of ‡Molecular and Experimental Medicine and
§Cell Biology, The Scripps Research Institute, La Jolla, CA 92037; ¶Oncology Research, Novartis Institutes for Biomedical Research, Novartis Pharma AG,
CH-4002 Basel, Switzerland; and 储Section of Tumor Biology, Department of Otolaryngology兾Head–Neck Surgery, VU University Medical Center,
1081HV, Amsterdam, The Netherlands
Edited by Peter K. Vogt, The Scripps Research Institute, La Jolla, CA, and approved June 3, 2005 (received for review February 10, 2005)
Cancer arises by the accumulation of genetic alterations in DNA
leading to aberrant gene transcription. Expression-profiling studies have correlated genomewide expression signatures with malignancy. However, functional analysis elucidating the contribution and synergy of genes in specific cancer cell phenotypes
remains a formidable obstacle. Herein, we describe an alternative
genetic approach for identification of genes involved in tumor
progression by using a library of zinc finger artificial transcription
factors (ATFs) and functional screening of tumor cells as a source
of genetic plasticity and clonal selection. We isolated a six-zinc
finger transcriptional activator (TF 20-VP, TF 20 containing the VP64
activator domain) that acts to reprogram a drug-sensitive, poorly
invasive, and nonmetastatic cell line into a cell line with a drugresistant, highly invasive, and metastatic phenotype. Differential
expression profiles of cells expressing TF 20-VP followed by functional studies, both in vitro and in animal models, revealed that
invasion and metastasis requires coregulation of multiple target
genes. Significantly, the E48 antigen, associated with poor metastasis-free survival in head and neck cancer, was identified as one
specific target of TF 20-VP. We have shown phenotypic modulation
of tumor cell behavior by E48 expression, including enhanced cell
migration in vitro and tumor cell dissemination in vivo. This study
demonstrates the use of ATFs to identify the group of genes that
cooperate during tumor progression. By coregulating multiple
targets, ATFs can be used as master genetic switches to reprogram
and modulate complex neoplastic phenotypes.
drug resistance 兩 metastasis 兩 invasion 兩 transcriptional regulation 兩
RNA inteference
D
uring different stages of a neoplastic disease, phenotypic
diversity and clonal selection of tumor cells generate cell
populations possessing traits that increase the potential for malignancy, such as increased mobility and invasiveness. Gene expression
profiling of tumors has revealed that increased malignancy is
associated with changes in gene expression affecting multiple loci
(1–3). Because of their unique ability to orchestrate and coregulate
multiple target genes, transcription factors (TFs) play a crucial role
in generating phenotypic plasticity associated with cancer progression. TFs that play a role in lineage-specific differentiation, such as
STATs [signal of transduction and activator of transcription (4)],
and those that affect morphogenesis and embryonic development,
such as Twist, Snail, and SIP1, have recently been shown to be
involved in invasiveness during tumor progression (5, 6).
As a consequence of their inherent potential for altering genetic
cascades, artificial TFs (ATFs) may be used to modulate cancer cell
phenotypes. TFs possess several distinctive features. First, by interacting specifically with endogenous regulatory sequences, TFs
can mediate the simultaneous regulation of multiple genes necessary for the control of complex phenotypes. Second, TFs have the
ability either to up-regulate expression of target genes [when the
DNA-binding domain (DBD) is linked to an activator of transcription, i.e., VP16, VP64, or p65] or to down-regulate target gene
11716 –11721 兩 PNAS 兩 August 16, 2005 兩 vol. 102 兩 no. 33
expression (when the same DBD is linked to a repressor domain
such as the KRAB domain) (7). ATFs with zinc finger (ZF) DBDs
are particularly useful because a well characterized lexicon of ZFs
has been optimized for specific recognition of virtually any triplet
of DNA (8, 9). Furthermore, we have recombined the existing ZF
DBDs to generate multimodular libraries made of three- and six-ZF
building blocks (10–12). When delivered into a tumor cell population, TF libraries provide phenotypic diversity on the order of
millions of ATFs capable of ‘‘scanning’’ the tumor cell genome for
functional, accessible regulatory sequences, each with the potential
to affect transcription of multiple genes involved in tumor progression. A combination of differential DNA profiling and target site
search, based on the predicted specificity of ZF units, allows
selected ATFs to be used as genetic probes for the identification of
genes and genetic interactions involved in malignancy.
In this article we describe the selection and characterization of a
six-ZF ATF (TF 20-VP, TF 20 containing the VP64 activator
domain) selected from a six-ZF combinatorial activator library
capable of inducing drug resistance, cytoskeleton remodeling,
matrix-dependent cell migration, and tumor cell invasion in vitro.
Furthermore, TF 20-VP enhanced the number of tumor metastases
in animal models. An analysis of the expression profiles of TF
20-VP-transduced cells revealed gene expression signatures involved in cancer progression. Our data support the use of ATFs as
genetic switches to coregulate genes, discover new gene expression
markers of cancer progression, and modulate complex phenotypes
associated with malignancy.
Materials and Methods
ZF Selection. TF 20-VP was selected from a six-ZF retroviral
activator library (pMX-6ZFlibrary-IRES-GFP) by treating 108
HeLa cells with 200 ␮M Taxol (Sigma) for 72 h. Surviving cells were
morphologically examined for the presence of epithelialmesenchymal transition-like phenotypes. Retroviral DNA was recovered from genomic DNA and then recloned in the retroviral
vector as described (10).
Migration Assays. The cell migration assay was performed by using
transwell plates (8-␮m pore size) (Costar). The undersurface of the
membrane was coated at 4°C overnight with 0.25 ␮g兾ml of Laminin
(Sigma L-2020) diluted in PBS and then blocked with 2% BSA. The
upper compartment was seeded with 2.5 ⫻ 105 transduced HeLa
cells per well in 100 ␮l of DMEM. FBS (2%) in DMEM was added
This paper was submitted directly (Track II) to the PNAS office.
Abbreviations: TF, transcription factor; TF 20-SKD, TF 20 containing the SKD repressor
domain; TF 20-VP, TF 20 containing the VP64 activator domain; ATF, artificial TF; ZF, zinc
finger; DBD, DNA-binding domain; STAT, signal transduction and activator of transcription;
NOD, nonobese diabetic; SCID, severe combined immunodeficient; AGT, angiotensinogen;
IL-13R␣1, IL-13 receptor ␣1.
†Present
address: Department of Pharmacology, University of North Carolina, Chapel Hill,
NC 27599-7365.
**To whom correspondence should be addressed. E-mail: carlos@scripps.edu.
© 2005 by The National Academy of Sciences of the USA
www.pnas.org兾cgi兾doi兾10.1073兾pnas.0501162102
in the lower chamber. Cells were allowed to migrate 22 h, and
migrated cells were stained with 0.25% Crystal violet (Sigma) in
20% methanol (wt兾vol). Each experiment used triplicate wells and,
within each well, counting was done in four randomly selected
microscopic high-power fields (⫻100).
In Vitro Invasion Assays. HeLa cells transduced with different
retroviral vectors expressing TF 20-VP or TF 20-SKD (TF 20
containing the SKD repressor domain) or retrovirus containing
no ZF (control) were starved overnight, and then 1.25 ⫻ 105 cells
of each cell line were loaded in Matrigel invasion chambers (24
wells, BD Biocoat Matrigel invasion chamber, BD Biosciences)
according to the manufacturer’s instructions. Cells were allowed
to invade for 24 h, and then invasive cells were fixed and counted
with an inverted microscope (Leica, McBain Instruments, Chatsworth, CA). The experiment was done two to three times with
each sample in triplicate. For cDNA expression analysis 500 ng
of each transient expression vector was transfected in six-well
plates by using Lipofectamin PLUS according to the manufacturer’s instructions (Invitrogen). cDNA-expressing vectors were
pRC-CMV-E48 and pcDNA-IL-13R␣1-HA (a kind gift of K.
Kohno, University of Occupational and Environmental Health,
Kita-Kyushu, Japan). The angiotensinogen (AGT) expression
vector was obtained from Invitrogen (clone ID 4213559). Transfected cells overexpressing the corresponding cDNA were assessed by real-time PCR quantification.
Quantification of Tumorgenicity and Metastasis. A total of 106 HeLa
cells transduced with retroviral constructs expressing TF 20-VP
(seven mice), TF 20-SKD (seven mice), and no ZF domains
(control, seven mice) were implanted s.c. into 3- to 4-week-old
nonobese diabetic (NOD) severe combined immunodeficient
(SCID) mice females (The Scripps Research Institute rodent
breeding colony). The weight of each animal and the primary tumor
volume were monitored each week. Animals were killed at day 35
postinjection. Lungs harvested from the animals were fixed in
Bouin’s solution, and the number of macroscopic metastases was
Blancafort et al.
assessed by counting nodules at the surface of the lung under a
dissecting microscope. For consistency, the upper right lobe of each
lung was used for quantification. In all cases this lobe represented
metastases to the whole lung. Lung metastasis generated from TF
20-VP cell injection was significantly higher than the control cell
injection (P ⬍ 0.05), but no significant difference in lung metastasis
was found between TF 20-SKD cell injection and the control cell
injection.
Microarray Processing and Data Analysis. RNA samples (see Supporting Text, which is published as supporting information on the
PNAS web site, for a detailed protocol) were processed for hybridization on Affymetrix HG-U133A microarrays following standard
procedures as recommended by the manufacturer. Microarray data
were retrieved as MAS5 flat files and imported into GENESPRING 6.1
(Silicon Genetics, Redwood City, CA) or EXCEL (Microsoft).
Real-Time PCR. Changes in the expression of target genes were
examined with real-time PCR. The full-length cDNA sequences for
genes of interest were obtained from the National Library of
Medicine (www.ncbi.nlm.nih.gov兾UniGene). A detailed description of real-time PCR and other procedures are provided in
Supporting Text.
Results and Discussion
TF 20 –VP Induces Phenotypic Transformations in HeLa Cells. We have
developed a functional selection strategy to identify and modulate
genes involved in tumor progression (Fig. 1A). The ATF is used as
a tool to induce a desired phenotype by perturbing endogenous
transcription and to further understand the genes that are required
for neoplastic disease progression. We hypothesized that a delivery
of a TF activator library into a drug-sensitive, poorly invasive, and
nonmetastatic cell line would result in the generation of a phenotypically diverse cancer cell population (or cancer cell library). A
complex six-ZF activator library (comprising 8.42 ⫻ 107 different
ATF proteins with unique DNA binding specificities) could regulate multiple genes involved in tumor progression. Indeed, natural
PNAS 兩 August 16, 2005 兩 vol. 102 兩 no. 33 兩 11717
CELL BIOLOGY
Fig. 1. TF 20 is able to induce complex phenotypes
in HeLa cells. (A) Illustration of TF-mediated reprogramming of cancer cells. TF 20-VP induces morphological transformations and cytoskeleton remodeling in HeLa cells. (B) Aspect of a colony of control cells
expressing no ZFs. (Magnification: ⫻100.) TF 20-SKDtransduced cells formed the same WT compact colonies (data not shown). (C and F) Control cells (C) and
TF 20-VP-transduced cells (F) were stained for F-actin
(Texas red-phalloidin, red) and nucleus (DAPI, blue).
(Magnification: ⫻600.) (D and E) Morphological
transformations of HeLa cells transduced with a retrovirus expressing TF 20-VP, showing cells migrating
out of the colony. (Magnification: ⫻100.) (G) TF 20-VP
enhances the migration of HeLa cells on a laminin
migration assay.
TFs have recently been described that are able to induce epithelialmesenchymal transitions involving dramatic remodeling of the
cytoskeleton, loss of epithelial cell adhesion, and acquisition of
migratory phenotypes (5). One of these natural TFs, Twist, has also
been associated with resistance to taxol (13). Likewise, we hypothesized that some ATF library members would be able to regulate
several genes and induce complex malignant phenotypes, including
resistance to anticancer drugs and changes in cell morphology,
migration, and invasion. Cells in the population displaying complex
morphological transformations can be selected with phenotypic
screens. The ATF responsible for the phenotypic switch can then be
isolated and characterized. Expression profiles of ATF-expressing
cells are compared with profiles of the original cell line to determine
target genes required for the phenotype. One unique feature of this
system is that the phenotype of cancer cells is transformed without
changing their genetic background. Instead, ATFs mediate complex
changes in gene expression profiles that can facilitate reprogramming a tumor cell phenotype.
We have chosen HeLa cells as a model system to study genes
affecting neoplastic disease progression because this cell line is
sensitive to taxol, a commonly used anticancer drug for several
carcinomas, and because this cell line constitutes a prototypical
model of a noninvasive, poorly metastatic cell type. HeLa cells
were transduced with a six-ZF retroviral activator library [pMX6ZF-library-VP64-IRES-GFP (11)]. Transduced cells were
screened for taxol resistance, and drug-resistant clones were
morphologically examined for the appearance of more complex
morphological transformations, resembling epithelial-mesenchymal transition (5, 6).
Although several ATF clones were isolated that promoted drug
resistance, a unique feature of one of the selected ATFs, TF 20-VP,
was its ability to induce particularly aggressive phenotypic transformations. When TF 20-VP was expressed in HeLa cells by using
either retroviral vectors or transient expression vectors, they acquired elongated, fibroblast-like morphologies (compare Fig. 1 B
with D and E) as manifested by the orientation of the actin stress
fibers (Fig. 1 C and F). HeLa cells expressing TF 20-VP also
displayed enhanced migration in laminin-coated transwell assays,
compared with control cells expressing no ZF or cells containing
the same ZF linked to a repressor domain (TF 20-SKD) (Fig. 1G).
Interestingly, TF 20-mediated effect on cell migration depended on
the nature of the extracellular matrix protein used in the assay, as
we observed no effect with collagen I, collagen IV, or fibronectin
(data not shown). Both TF 20-VP and TF 20-SKD were expressed
in HeLa cells at similar levels, as determined by semiquantitative
RNA expression analysis and flow cytometry (Fig. 5, which is
published as supporting information on the PNAS web site).
TF 20 –VP Induces Cell Invasion in Vitro and Enhances the Number of
Distal Metastases in NOD SCID Mice. The enhanced migratory兾
epithelial-mesenchymal transition type phenotype of cells expressing TF 20-VP suggested altered invasive behavior. To test TF 20-VP
invasiveness in vitro, we performed Matrigel invasion assays. HeLa
cells transduced with a control retrovirus without ZFs and cells
transduced with TF20-SKD were poorly invasive in this assay.
However, TF 20-VP was able to enhance cell invasion in vitro
20-fold relative to cells transduced with a control retrovirus (Fig.
2A). Invading cells conserved the morphological signatures of TF
20-VP-expressing cells seen in Fig. 1 D and E.
Because invasive phenotypes are thought to be critical to a cell’s
ability to metastasize we investigated whether or not TF 20-VP was
able to promote metastasis in a mouse model. Approximately 106
HeLa cells transduced with a control virus, TF 20-VP, or TF
20-SKD were implanted s.c. into NOD SCID mice (n ⫽ 7).
Semiquantitative RT-PCR analysis using TF-specific primers and
GFP analysis by flow cytometry showed that tumors transduced
with either TF 20-VP or TF 20-SKD expressed TFs with similar
expression levels and that strong TF expression persisted through
11718 兩 www.pnas.org兾cgi兾doi兾10.1073兾pnas.0501162102
Fig. 2. TF 20-VP enhances cell invasion and metastasis. (A) Invasion assays
with control and TF-transduced cells were performed in vitro by using Matrigel chambers. (B) TF 20-VP increased the number of lung micrometastases in
a NOD SCID mouse model of spontaneous metastasis. Groups represent HeLa
cells expressing TF 20 VP64 activator domain (TF 20-VP), the same protein but
linked to a repressor domain (TF 20-SKD), and cells expressing no ZF domains
(control). P values between TF 20-VP and control and between TF 20-VP and
TF 20-SKD were ⬍0.05; P values between TF 20-SKD and control were ⬎0.4.
(Magnifications: ⫻200.)
the time course of the experiment (Fig. 5A). At day 35 postinjection
mice were killed and the number of lung micrometastases was
determined (Fig. 2B). Mice implanted with TF 20-VP-transduced
cells developed more lung metastases than mice implanted with
control cells (transduced with retrovirus without ZFs) or cells
transduced with TF 20-SKD, suggesting that TF 20-VP modulated
the expression of genes enhancing the ability of tumor cells to
produce metastasis in the lungs. TF 20–VP-transduced cells had a
lower proliferation index in vitro than control cells or TF 20–SKDtransduced cells. In addition, TF 20-VP did not promote primary
tumor growth compared with control tumors, whereas TF 20–SKD
inhibited tumor growth in vivo (Fig. 6, which is published as
supporting information on the PNAS web site). This finding is
consistent with recent reports showing that metastatic potential is
not always correlated to the number of cells in the primary tumor
or tumor size (1).
TF 20 –VP Regulates Specific Gene Expression Signatures. We next
evaluated the altered transcriptional profile mediated by TF 20-VP
by determining which genes are differentially regulated by this
ATF. We prepared duplicate independent transductions of HeLa
cells with TF 20-VP, TF 20-SKD, and control retrovirus. Untransduced cells were also evaluated. RNA expression profiles were
analyzed by using a HG-U133A array from Affymetrix with
⬇18,500 genes. Eight genes, listed in Table 1, which is published as
supporting information on the PNAS web site, appeared to be
differentially expressed in TF 20-VP-transduced cells compared
with control and TF 20-SKD groups. Quantitative real-time expression analysis was used to verify that five of these eight genes
were differentially regulated in TF 20-VP-expressing cells only
(Table 2, which is published as supporting information on the PNAS
web site). Three of these genes were highly regulated by TF 20-VP:
E48 antigen (E48), AGT, and IL-13 receptor ␣1 (IL-13R␣1).
E48 is a glycosylphosphatidylinositol-anchored molecule that
plays a role in cell–cell adhesion. E48 (LY-6D) belongs to the gene
family of Ly-6 antigens (14, 15). E48 is highly expressed in squamous
cell carcinomas of the head and neck and constitutes a marker of
disseminated tumor cells, particularly in lymph nodes and bone
marrow (16, 17). These tumors are characterized by local invasion
resulting in poor prognosis. AGT is a precursor of AgtII, a cellsignaling molecule associated with a variety of disorders, such as
cardiovascular remodeling and cancer (18–20). IL-13R␣1 is a
Blancafort et al.
receptor for IL-13 and IL-4 and has been shown to mediate
signaling processes that result in activation of the Jak1–STAT
pathway. Interestingly, strong expression of this target has been
detected in 16 cell lines for squamous cell carcinomas of the head
and neck (21–23).
A mAb that detects human E48 antigen was used to confirm a
500- to 1,000-fold induction of E48 antigen in HeLa cells transfected with TF 20-VP. In contrast, untransduced HeLa cells and
cells transduced with TF 20-SKD did not express significant E48
antigen. Immunofluorescence of TF 20-VP-transduced HeLa cells
confirmed the E48 up-regulation, particularly in cell–cell junctions
(Fig. 3C). We detected 8- to 10-fold up-regulation of IL-13R␣1 both
by DNA arrays and real-time PCR. In addition to these three
strongly up-regulated markers, we observed a 3.1-fold up–
regulation of the gene ABCC5, a multidrug resistance ABC transporter and a 4.7-fold up–regulation of a cDNA of unknown function
(cDNA: FLJ22642 fis, clone HS106970). To study the specificity of
gene regulation mediated by TF 20-VP, we analyzed expression
levels of these five genes in cells expressing four other unrelated
TFs. As shown in Fig. 7, which is published as supporting information on the PNAS web site, these five genes were specifically
up-regulated in only TF 20-VP-expressing cells.
Invasiveness and Tumor Cell Dissemination Requires Regulation of
Multiple Targets. Our functional analysis focused on the three genes
most strongly and specifically up–regulated by TF 20–VP: E48,
AGT, and IL-13R␣1. However, additional experiments are warranted to evaluate the specific contribution of ABCC5 and the gene
of unknown function. To extend our expression analysis to the in
vivo model, we first determined whether or not E48, AGT, and
IL-13R␣1 were differentially regulated in the primary tumors from
NOD SCID mice implanted with HeLa cells expressing TF 20-VP.
Cells were recovered from tumors 2 and 6 weeks postinjection. Cells
expressing GFP were sorted by flow cytometry, and gene expression was analyzed by real-time PCR. E48 and AGT were strongly
expressed in the tumors at 2 and 6 weeks (Table 2). However, we
Blancafort et al.
did not detect significant up-regulation of IL-13R␣1 in tumors at
either time point. One possibility is that IL-13R␣1 plays a role in the
initial steps of tumor progression and is silenced in tumors by 2
weeks postinjection. In contrast, E48 expression was increased by
three orders of magnitude in cells derived from TF 20-VPcontaining tumors at both 2 and 6 weeks compared with control or
TF 20-SKD tumors, as assessed by real-time RNA quantification
and flow cytometry (Table 2 and Fig. 3B).
TF 20 VP-mediated induction of E48 expression in vitro and its
increased expression in late stages of tumor development in vivo
suggested a role of E48 in tumor progression. Several glycosylphosphatidylinositol-anchored proteins have been shown to promote
cytoskeleton reorganization, changes in cell shape, cell attachment
and extracellular matrix-specific migration in neutrophil cells (24),
pre-B lymphocytes (25), and breast carcinomas (26). These effects
depend on a cross-talk between the glycosylphosphatidylinositolcontaining protein and specific integrins. In light of these observations, we first investigated the possibility that E48 expression
could influence cell migration. As indicated in Fig. 3D, ectopic
expression of E48 cDNA in HeLa cells induced extracellular
matrix-dependent cell migration. As in TF 20- VP-expressing cells,
E48 induced migration in laminin-coated transwells (Fig. 3D), but
not in collagen or fibronectin-coated wells, suggesting an involvement of specific integrin signaling. We also observed that, like TF
20-VP transduced cells, cells that overexpressed E48 had elongated
fibroblast-like cell morphologies (data not shown), suggesting that
E48 participates in the cytoskeleton-remodeling characteristic of
TF 20-VP-expressing cells.
To better understand the function of E48 and its potential
involvement in promoting tumor progression in vivo, we studied
experimental metastasis formation in chicken embryos. The
chicken embryo system has two important advantages for studying
the role of potential TF-targeted cDNAs: metastases can be
generated and analyzed much more quickly than in mouse models
(7 days in chickens versus 35 days in mouse) and methodology exists
to allow precise time course-dependent quantification of dissemiPNAS 兩 August 16, 2005 兩 vol. 102 兩 no. 33 兩 11719
CELL BIOLOGY
Fig. 3. TF 20-VP regulates the endogenous E48 gene, a
marker of disseminated tumor cells of squamous cell carcinomas of the head and neck. (A) HeLa cells were analyzed for E48
expression 72 h posttransduction. (B) HeLa cells recovered
from mouse primary tumors 35 days postinjection. Flow cytometry analyses were performed with a mAb that detects
human E48. E48 is up-regulated in HeLa cells transduced with
a TF 20-VP retrovirus (red); HeLa cells expressing TF 20-SKD
(light blue); control cells expressing no ZFs (green); untransduced cells (filled blue). (C) Immunofluorescence analysis of
E48 expression in HeLa cells expressing TF 20-VP, control cells
expressing no ZFs (control), and cells overexpressing an E48
cDNA (E48). Expression of E48 was induced in the cell– cell
junctions (arrow). (Magnifications: ⫻400.) (D) Ectopic expression of E48 induces cell migration in Laminin-coated transwells. HeLa cells were transduced with EGFP, TF 20-VP, and
E48 cDNA (E48). Untransduced (HeLa cells) were also evaluated. (E) HeLa cells transduced with TF 20-VP, TF 20-SKD, and
E48 retroviruses were injected i.v. in chicken embryos; disseminated tumor cells were detected in distal organs (lung and
lower chorioallantoic membrane, CAM) by real-time alu-PCR
as described (27). HeLa cells expressing both TF 20-VP and E48
cDNA enhance 10- to 20-fold and 5-fold, respectively, the
number of experimental metastasis in a chicken embryo
model of organ colonization.
Fig. 4. In vitro induction of cell invasion requires coexpression of multiple
targets. (A) HeLa cells were transiently transfected with individual cDNAs
encoding E48, AGT, IL-13R␣1, and TF 20-VP. Transfected cells were loaded into
Matrigel chambers, and invading cells were fixed and counted. Values represent averages of two wells, and experiments were done in triplicate. (B) E48
and AGT coexpression in HeLa cells suffices to recapitulate the cell morphology changes mediated by TF 20-VP. (Magnification: ⫻400.)
nated tumor cells by using real-time PCR to detect alu-human
sequences in chicken organs (27). In the experimental metastasis
system described in Fig. 3E, control HeLa cells and cells transduced
with TF 20-VP, TF 20-SKD, or a retroviral construct expressing
human E48 cDNA (E48) were injected i.v. into the allantoic vein,
and disseminated cells were detected by quantitative PCR. In this
model, TF 20-VP was able to enhance the process of organ
colonization in the lungs and the lower chorioallantoic membrane
by 10- and 20-fold, respectively, compared with control and TF
20-SKD cells. Furthermore, E48-expressing cells were able to
increase by 5-fold the colonization of HeLa cells in the lower
chorioallantoic membrane relative to the control. Thus, these data
confirmed the role of TF 20-VP in promoting organ colonization
and also suggested a role of E48 antigen in enhancing tumor cell
dissemination in specific organs. Nevertheless, E48 by itself was not
able to fully recapitulate the TF 20-VP effect in tumor cell
dissemination, suggesting that the fully metastatic phenotype conferred by TF 20-VP requires concerted and synergistic action of
several targets.
Subsequently, we analyzed the possibility that coexpression of TF
20-VP-targeted genes could cooperate in generating the invasive
phenotype of TF 20-VP-expressing cells. We introduced the cDNAs
coding for E48, AGT, or IL-13R␣1 into HeLa cells by using
transient expression vectors, and transfected cells were evaluated by
using in vitro invasion assays. Expression of these proteins was
efficiently up-regulated, as confirmed by real-time quantification.
As shown in Fig. 4A, transfection of individual targets had little
impact on cell invasion. However, the simultaneous expression of
AGT, E48, and IL-13R␣1 resulted in a cooperative effect that
enhanced the ability of HeLa cells to invade the matrix. Interestingly, cotransfection of E48 and AGT recapitulated the elongated
phenotype and the cytoskeleton-remodeling characteristic of TF
20-VP expression (Fig. 4B). Cotransfection of IL-13R␣1 did not
enhance cell shape and affected only the efficiency of invasion.
11720 兩 www.pnas.org兾cgi兾doi兾10.1073兾pnas.0501162102
Nevertheless, cells transiently transfected with TF 20-VP were
2.6-fold more efficient in promoting cell invasion than E48, AGT,
and IL-13R␣1 cDNAs combined. This result further confirms that
TF 20-VP regulates multiple gene targets that are cooperatively
necessary for cell invasion. The failure of cDNA transfection to fully
recapitulate the phenotype provided by TF 20-VP might also be
attributed to contributions provided by splice variants that are not
produced under cDNA delivery.
It is possible that other gene products up-regulated by TF 20-VP
but not detected in this study are necessary to fully recapitulate the
TF 20-VP phenotype. By binding to multiple targets, a TF can
orchestrate and regulate the expression of each target gene, and its
splice variants, at the proper level. Unlike heterologous cDNAs that
express a single splice variant, TFs use the genomic scaffold that
provides endogenous elements and spatiotemporal cues necessary
for target gene regulation. A biochemical analysis of the E48, AGT,
and IL-13R␣1 gene promoters has revealed functional TF 20
binding sites for the AGT and IL-13R␣1 proximal promoters,
suggesting direct regulation. The E48 reporter gene was not regulated by a TF 20 site found upstream of the proximal promoter and
could be regulated indirectly by another gene or a more distal site
(Fig. 8, which is published as supporting information on the PNAS
web site). Although our experiments analyzed the effect of a limited
number of targets on the process of cell invasion in vitro, in vivo
these genes may contribute to any one of many different steps of the
metastatic cascade such as mobility, invasion of surrounding tissues,
intravasation or extravasation and survival in the vasculature, or
colonization and survival in distal organs.
Overall, the above experiments provide evidence that TF 20-VP
regulates expression of E48, AGT, and IL-13R␣1. Real-time PCR
experiments on HeLa cells showed that overexpression of each
given target individually did not affect transcription of the other
markers (Table 2). This finding indicates that TF 20 affects transcription of these three genes autonomously.
Several reports have suggested an association of E48 antigen
expression with increased tumor progression (28–31). The E48
antigen is highly expressed in locally invasive squamous cell carcinomas of the head and neck and constitutes a marker of disseminated tumor cells both in lymph nodes and bone marrow (32).
Recently, the presence of micrometastatic cells in bone marrow of
patients with squamous cell carcinomas of the head and neck with
two or more lymph node metastases has been correlated with a
poor metastasis-free survival (33). It has been hypothesized that
E48 is a signal transduction protein that plays a role in cell–cell
communication, and recent reports suggest involvement in mediating selectin-dependent binding of premetastatic tumor cells to the
endothelium (28). Nevertheless, the signal transduction pathway
and the adhesion system activated by E48 was unknown. Our data
demonstrate a role of E48 in promoting matrix-dependent migration of tumor cells, suggesting integrin-dependent signaling. Additionally, we found that E48 is able to facilitate organ colonization
in in vivo models, thus confirming the role of this antigen in tumor
dissemination.
Expression of AGT, a precursor of the signaling molecule AgtII,
is regulated in a tissue-specific manner (34–37). In heart tissue,
AgtII activates Jak1, Jak2, and Tyk2, resulting in activation of
STATs (38). In addition, AgtII can influence important cellular
processes, such as cytoskeleton remodeling, migration, and survival (19).
Signaling mediated by IL-13R involves binding of cytokines IL-13
and IL-4 to the receptor and triggers activation of two pathways: the
Jak–STAT pathway and the phosphatidylinositol 3-kinase pathway
(39). One intriguing possibility is that some AgtII- and IL-13Rsignaling cascades are necessary for the TF 20-VP-mediated metastatic phenotype. In this regard, TF 20-VP-expressing cells offer an
experimental framework to study the effect of activators and
inhibitors of signaling pathways in the process of cell invasion and
metastasis. Our preliminary experiments indicate that TF-20-VPBlancafort et al.
Functional studies suggest that three of the up-regulated markers, E48, AGT, and IL-13R␣1, contributed synergistically in recapitulating some aspects of the TF 20-VP-induced phenotype. This
phenomenon is consistent with the fact that increased malignancy
of human tumors seems to require the action of several genes
operating in concert. Mechanistically a TF can achieve simultaneous regulation of several genes by binding multiple promoters.
This ability to regulate multiple defined genes is a distinctive feature
of TFs, compared with other strategies to modulate gene expression, such as ribozymes, antisense, and RNA interference. Whereas
the latter strategies typically target a specific RNA sequence from
a single gene, ATFs can bind similar or identical DNA sequences
located in several regulatory regions, facilitating targeting of multiple genes. Additionally, ATFs can induce either gain-of-function
phenotypes or knockdown phenotypes, whereas RNA-derived
strategies can achieve only knockdowns.
This work demonstrates that ATFs selected from combinatorial
libraries can be used to transcriptionally reprogram cancer cells to
modify complex phenotypes and identify genes involved in cancer
progression. ATF library screens could also be used to interfere
with the regulation of genetic or signaling cascades to modify or
revert certain aspects of a malignant phenotype. In recent experiments, we observed that TF 20-SKD is able to efficiently reduce cell
invasion in a highly metastatic melanoma cell line (Fig. 10 which is
published as supporting information on the PNAS web site).
Together with the xenograph model (Fig. 6), these experiments
demonstrate the use of ATFs to negatively effect cell invasion and
tumor growth. In summary, we have shown that ATFs can be used
as tools to dissect the function of genes in tumor progression. This
work also suggests potential applications of ATFs in cancer therapy.
1. Ramaswamy, S., Ross, K. N., Lander, E. S. & Golub, T. R. (2003) Nat. Genet. 33,
49–87.
2. Rhodes, D. R., Yu, J., Shanker, K., Deshpande, N., Varambally, R., Ghosh, D.,
Barrette. T., Pandey, A. & Chinnaiyan, A. M. (2004) Proc. Natl. Acad. Sci. USA 101,
9309–9314.
3. Segal, E., Friedman, N. & Regev, A. (2004) Nat. Genet. 36, 1090–1098.
4. Beneklli, M., Baer, M. R., Baumann, H. & Wetzier, M. (2003) Blood 101, 2940–2951.
5. Kang, Y. & Massague, J. E. (2004) Cell 118, 277–279.
6. Vermon, A. E & LaBonne, C. (2004) Cell 14, R719–R721.
7. Blancafort, P., Segal, D. J & Barbas, C. F., III (2004) Mol. Pharmacol. 66, 1361–1371.
8. Dreier, B., Segal, D. J. & Barbas, C. F., III (2002) J. Mol. Biol. 303, 489–502.
9. Segal, D. J., Beerli, R. R., Blancafort, P., Dreider, B., Effertz, K., Huber, A., Koksch,
B., Magnenat, L., Valente, D. & Barbas, C. F., III (2003) Biochemistry 42, 2137–2148.
10. Blancafort, P., Magnenat, L. & Barbas, C. F., III (2003) Nat. Biotechnol. 21, 269–274.
11. Lund, C. V., Blancafort, P. & Barbas, C. F., III (2004) J. Mol. Biol. 340, 599–613.
12. Magnenat, L., Blancafort, P. & Barbas, C. F., III (2004) J. Mol. Biol. 341, 635–649.
13. Wang, X., Ling, M. T., Guan, X.-Y., Tsao, S. W., Cheung, H. W., Lee, D. T. & Wong,
Y. C. (2004) Oncogene 23, 474–482.
14. Schrijvers, A. H., Gerretsen, M., Fritz, J. M., van Walsum, M., Quak, J. J., Snow, G. B.
& van Dongen, G. A. (1991) Exp. Cell Res. 196, 264–269.
15. Brakenhoff, R. H., Gerretsen, M., Knippels, E. M., van Dijk, M., van Essen, H.,
Weghuis, D. O., Sinke, R. J., Snow, G. B. & van Dongen, G. A. (1995) J. Cell Biol.
129, 1677–1689.
16. Brakenhoff, R. H., Stroomer, J. G., ten Brink, C., de Bree, R., Weima, S. M., Snow,
G. B. & van Dongen, G. A. (1999) Clin. Cancer Res. 5, 725–732.
17. Pantel, K. & Brakenhoff, R. H. (2004) Nat. Rev. Cancer 4, 448–456.
18. Mascareno, E., Dhar, M. & Siddiqui, M. A. Q. (1998) Proc. Natl. Acad. Sci. USA 95,
5590–5594.
19. Berry, G. C., Touyz, R., Dominiczak, R. C., Webb, R. C. & Johns, D. G. (2001) Am. J.
Physiol. 281, H2337–H2365.
20. Juillerat-Jeanneret, L., Celerier, J., Chapuis Bernasconi, C., Nguyen, G., Wostl, W.,
Maerki, H. P., Janzer, R. C., Corvol, P. & Gasc, J. M. (2004) Br. J. Cancer 90,
1059–1068.
21. Murata, T., Obiri, N. I., Debinski, W. & Puri, R. J. (1997) Biochem. Biophys. Res.
Commun. 238, 90–94.
22. Ise, T., Izumi, H., Nagatani, G., Takano, H., Wada, M., Kuwano, M. & Kohno, K.
(1999) Biochem. Biophys. Res. Commun. 265, 387–394.
23. Joshi, B. H., Kawakami, K., Leland, P. & Puri, R. K. (2002) Clin. Cancer Res. 8,
1948–1956.
24. Funaro, A., Ortolan, E., Ferranti, B., Gargiulo, L., Notaro, R., Luzzato, L. &
Malavasi, F. (2004) Blood 104, 4269–4278.
25. Kanse, S. M., Chavakis, T., Kuo, A., Bdeir, K., Cines, D. V. & Preissner, K. T. (2004)
Cell Biochem. Funct. 22, 257–264.
26. Burbach, B. J. Y. & Rapraeger, A. C. (2004) Exp. Cell Res. 300, 234–247.
27. Zijlstra, A., Mellor, R., Panzarella, G., Aimes, R. T., Hooper, J. D., Marchenko, N. D.
& Quigley, J. P. (2002) Cancer Res. 62, 7083–7092.
28. Eshel, R., Zanin, A., Sagi-Assif, O., Meshel, T., Smorodinsky, N. I., Dwir, O., Alon,
R., Brakenhoff, R., van Dongen, G. & Witz, I. P. (2000) J. Biol. Chem. 275,
12833–12840.
29. Figuerola, R., Nadal Serra, A., Farre Pueyo, X. & Palomar Garcia, V. (2000) Acta
Otorrinolaringol. Esp. 51, 288–292.
30. Eshel, R., Zanin, A., Kapon, D, Sagi-Assif, O., Brakenhoff, R., van Dongen, G. &
Witz, I. P. (2002) Int. J. Cancer 98, 803–810.
31. Partidge, M., Brakenhoff, R., Phillips, E., Ali K., Francis, R., Hooper, R., Lavery, K.,
Brown, A. & Langdon, J. (2003) Clin. Cancer Res. 9, 5287–5294.
32. Nieuwenhuis, E., Leemans, C. R., Kummer, J. A., Denkers, F., Snow, G. B. &
Brakenhoff, R. H. (2003) Clin. Cancer Res. 9, 755–761.
33. Colnot, D. R., Nieuwenhuis, E. J., Kuik, D. J., Leemans, C. R., Dijkstra, J., Snow, G.
B, van Dongen, G. A. & Brakenhoff, R. H. (2004) Clin. Cancer Res. 10, 7827–7833.
34. Nishii, T., Moriguchi, A., Morishita, R., Yamada, K., Nakamura, S., Tomita, N.,
Kaneda, Y., Fukamizu, A., Mikami, H., Higaki, J. & Ogihara, T. (1999) Circ. Res. 85,
257–263.
35. Mascareno, E., El-Shafei, M., Maulik, N., Sato, M., Guo, Y., Das, D. K. & Siddiqui,
M. A. (2001) Circulation 104, 325–329.
36. Lam, K. Y. & Leung, P. S. (2002) Eur. J. Endocrinol. 146, 567–572.
37. Mazak, I., Fiebeler, A., Muller, D. N., Park, J. K., Shagdarsuren, E., Lindschau, C.,
Dechend, R., Viedt, C., Pilz, B., Haller, H. & Luft, F. C. (2004) Circulation 109,
2792–2800.
38. Guo, Y., Mascareno, E. & Siddiqui, M. A. (2004) Mol. Endocrinol. 18, 1033–1041.
39. Umeshita-Suyama, R., Sugimoto, R., Akaiwa, M., Arima, K., Yu, B., Wada, M.,
Kuwano, M., Nakajima, K., Hamasaki, N. & Izuhara, K. (2000) Int. Immunol. 12,
1499–1509.
40. Opdam, F. J. M., Kamp, M., Bruijn, R. & Roos, E. (2004) Oncogene 23, 6647–6653.
Blancafort et al.
We thank Drs. A. Fukamizu and C. M. Perou for discussions, Dr. K.
Kohno for the IL-13R␣1 cDNA and Luc reporter constructs, and L.
Asawapornmongkol for technical support. This work was supported by
National Institutes of Health Grant R01CA086258.
PNAS 兩 August 16, 2005 兩 vol. 102 兩 no. 33 兩 11721
CELL BIOLOGY
mediated cell invasion in vitro is stimulated by AgtII and dramatically abolished by a Jak2-specific inhibitor (Fig. 9, which is published as supporting information on the PNAS web site). This
finding supports the possibility that Jak2 signaling is important for
the TF 20-VP-mediated invasive phenotype. Recently, activation of
the Jak2–STAT pathway has been shown to influence survival,
invasion, and metastasis in lymphomas (40). We expect that TFmediated dysregulation of critical signaling molecules will allow
investigators to transform the phenotype of tumor cells or ‘‘reprogram’’ tumor cells.
In this study we have described an ATF, TF 20-VP, selected from
a combinatorial six-ZF TF library that is able to alter phenotypic
properties of HeLa cells. HeLa cells are taxol-sensitive, noninvasive, and nonmetastatic. However, upon delivery of TF 20-VP these
cells became drug-resistant, invasive, and metastatic. We demonstrated, using in vivo models, that the ability to enhance metastasis
and dissemination of tumor cells depended on linkage to an
activator domain. The fact that the same selected six-ZF DBD
domain linked to a repressor domain or cells not expressing any ZF
did not manifest the phenotype, allowed us to perform an analysis
of differentially expressed targets. We validated, by real-time PCR,
a group of five genes whose expression was altered only in TF
20-VP-expressing cells. Recently, an increasing number of genetic
profiling experiments have been reported with the ultimate goal of
identifying genetic markers involved in cancer progression and
metastasis (1–3). These studies often compared tumors from
different genetic backgrounds and the resulting heterogeneity of
the samples complicated the functional analysis of the targets. The
use of ATFs to artificially modify cancer cell phenotypes is appealing because the TF introduces a transcriptional perturbation of gene
expression but the genetic background of the cell line remains the
same. TFs selected from combinatorial libraries can be used to
identify generic biomarkers of tumor progression. Of the five
differentially expressed genes reported here, three were cell surface
proteins, illustrating the power of this approach in the identification
of cell surface antigens involved in tumor progression.
Supporting information
Supporting Figure Legends
Fig. 5. TF 20-VP and TF 20-SKD are expressed in both (A) transduced cells and
in (B) tumor cells recovered from NOD-SCID mice 35 days post-injection. RTPCR experiments (left panels) were performed using ZF-specific primers that
amplify the first three ZFs of TF 20. Control samples represent cells transduced
with retrovirus vectors in absence of ZF domains. GAPDH was used as a
normalizing control. Flow cytometry measurements (right panels) were performed
to detect GFP, a marker for protein expression.
Fig. 6. TF 20-VP do not confer growth advantages to HeLa cells as assessed (A)
in vitro by proliferation assays or (B) by monitoring the growth of the primary
tumor in NOD SCID mice implanted with TF-20 HeLa transduced cells.
Fig. 7. TF 20-VP up-regulates target genes specifically. Expression levels of
each of the indicated targets were compared in different TF-transduced cells.
Affymetrix DNA arrays were used in two independent experiments using
duplicate biological samples. Normalization was done with Affymetrix MAS5
algorithm. VP represents an activator domain and SKD a repressor domain. SSVP and SS-SKD indicate constructs expressing no ZFs.
Fig. 8. TF 20-VP-mediated cell invasion of TF 20-VP transduced cells is
stimulated by Angiotensin II (AgtII) and inhibited by the Jak2 specific inhibitor
AG490. Invasion was not inhibited by other kinase inhibitors, such as ERK2/1
inhibitor (U0126), a p38 inhibitor (SB 203580), or a Jak3 specific inhibitor (Jak3I).
Concentrations of these inhibitors are indicated in mM. TF 20-VP transduced
cells were starved overnight in serum free media and treated for 2.5 hr with
different concentrations of the indicated inhibitors. Cells were then evaluated in
Matrigel invasion assays as described in Materials and Methods. Data was
normalized to TF 20-VP transduced cells treated in absence of drugs. Data
represents average of two wells from each of two independent experiments.
Drugs were purchased from Calbiochem, San Diego, CA. These compounds
were not toxic at the indicated concentrations (mM) as assessed by survival
assays (XTT assays, Roche). * Indicates p<0.05.
Fig. 9. TF 20-SKD reduces the number of invasive melanoma C8161 cells in
matrigel invasion assays. Melanoma cells were transduced with an empty
retroviral vector (Control) or with a TF 20-SKD a retroviral vector. The percentage
of invasive cells was determined as described above.
Supporting Materials and Methods
Total RNA extraction and RNA quality assessment for Microarray profiling.
Cell lysate was homogenized by passing over a QIAshredder spin column
(Qiagen) and total RNA was isolated from the cell pellet using the RNeasy Mini
Kit (Qiagen) according to the manufacturer’s instructions. RNA quantity and
quality was analyzed with the RNA 6000 Nano Assay (Agilent Technologies)
according to the recommended protocol of the manufacturer. The computational
analyses were performed with the Agilent 2100 Bioanalyzer software (Agilent
Technologies).
Affymetrix MAS5 data were “normalized” to a constant value of 1 in
GeneSpring, effectively keeping the global normalization to a target intensity of
150 by the MAS5 algorithm. For clustering analyses, the experiment
interpretation was set to “log of ratio” and Pearson correlation was used as a
similarity measure for both dimensions (Gene tree and experiment tree). To
derive differentially expressed genes, a parametric test, not assuming equal
variances (Welch t-test), was used in the “log of ratio” mode. No multiple testing
correction was applied. Fold change filtering was either performed in GeneSpring
with the experiment interpretation set to “ratio” or in Excel. Genes were only
considered as differentially expressed when the majority of measurements
corresponded to “present” or “marginal” calls in at least one group of
experiments. Specific cut-off values for the various filtering steps are given in the
results section.
Real-Time PCR
Primers were designed to amplify the human target genes using a web-based
software (http://www.genome.wi.mit.edu/cgibin/primer/primer3_www.cgi) and
were purchased from MWG. 5 µg of RNA from each tested sample were
reverse-transcribed with Superscript II reverse transcriptase (Invitrogen Life
Technologies, Inc., CA). The resulting cDNA was diluted 20-fold prior to PCR
amplification. Reactions were performed using iQ SYBR Green Supermix (Biorad laboratories, Hercules, CA). Each PCR reaction was performed in a final
volume of 10 L under 10 L of mineral oil with the iCycler iQ real-time PCR
detection system (Bio-rad laboratories, Hercules, CA). A typical protocol
involved a 2 min of denaturation at 95oC, 40 cycles with annealing at 55oC for 15
sec, and extension at 72oC for 15 sec. An automated melting curve analysis was
used to verify that all primers yielded a single PCR product. A quantitative
measurement of total RNA was obtained by amplification of the human GAPDH
primers (forward: 5’GGGAAGGTGAAGGTCGGAGT3’ and reverse:
5’
TCCACTTTACCAGAGTTAAAAGCAG3’). Real time PCR was performed using
primers specific for IL13Ra1 forward: 5’CTCCACCAGTCATTTTTCAG3’ and
reverse: 5’ATTATCCTCTGCTCCTCCAG3’, EphB2 forward:
5’
TGCAGCTCCAGGTACATATC3’ and reverse:
AACAAACAAACCCCCTAAAC3’, PLSCR-1 forward:
5’
TCCATTAAACTGTCCACCTG3’ and reverse: 5’TGCAAAGTAAACCCTCTGTC3’,
AGT forward: 5’TGTACATACACCCCTTCCAC3’ and reverse:
5’
CTCAACTTGTCTTCGGTGTC3’, ABCC5 forward:
5’
GTCTCACACTGGCGTAGAAG3’ and reverse:
5’
GTTCAGCAAACATGCTAAGG3’, TNFRSF21 forward:
5’
GGGATTCCTTCACCAATTAC3’ and reverse: 5’CTTCACCACTACCCACAAAC3’,
FLJ22642 fis forward: 5’TTGGCTTGTGGAATTTACTG3’ and reverse:
5’
CTGCCTCTGTGAAAGAGTTG3’, E48 forward:
5’
AGATGAGGACAGCATTGCTGC3’ and reverse:
5’
GCAGACCACAGAATGCTTGC3’. The fluorescence emitted by the reporter dye
was recorded as a quantitative measure of the amount of PCR product in the
sample. The Ct is the fractional cycle number at which the fluorescence
generated by the reporter dye exceeds a fixed level above baseline. Signals
from amplification of target genes were normalized against the relative quantity of
GAPDH and expressed as Ct – (CtGAPDH – Ctgene). The changes in target gene
signal relative to the total amount of mRNA were expressed as Ct = Ctcontrol Ctgene. Relative fold differences in gene expression comparison were calculated
as 2Ct. Each gene expression analysis was normalized and calculated against
the indicated control samples in duplicate. Target gene expression was
presented as an average value of fold changes against the control.
5’
Analysis of GFP and E48 expression in primary tumors. For GFP
measurements in the primary tumors, tumor cells were recovered from primary
tumors at 2, 3, and 6 weeks post-injection (2 animals per group). The expression
of GFP in these recovered tumor cells was tracked by flow cytometry. Data was
analyzed using CELLQuest software (Becton Dickinson). For E48 staining of
primary tumors, cells were recovered from tumors 6-week post-injection, and
GFP positive cells were sorted using a FACSVantage (Becton Dickinson). The
sorted GFP positive cells were then used to detect the expression of E48 using
an anti-human E48 antibody (5 mg/mL) (28) and goat anti-mouse phycoerythrin
conjugated secondary antibody (Jackson ImmunoResearch, 1:100 dilution) and
analyzed by flow cytometry as described above.
Semi-quantitative PCR. Approximately 5 x 106 transduced cells were collected
72 hr post-transduction and RNA was extracted using the TRI reagent (Molecular
Research Center). Reverse transcription was done using the Superscript kit
(Invitrogen).
Primers
used
for
TF
20
detection
were
5’
3’
GCCCAGGCGGCCCTCGAGCCCGGGGAG
a n d
5’
GGCTGGCCAGGTGGCCGGCCTGGCTGAAAG3’ that specifically amplify the
first three ZFs of TF 20. Conditions for PCR amplification were: 5 min 94°C, 1
min 94°C, 30 sec 56°C, 1 min 30 sec 72°C for 25 cycles, and 10 min 72°C. For
ZF expression analysis in the primary tumors, tissue from primary tumors 35days post-injection was removed and RNA extracted (Qiagen). RT-PCR was
done as described above. Expression of glyceraldehyde-3-phosphate
dehydrogenase (GAPDH) was measured as described (10).
Immunofluorescence. For the immunofluorescent detection of E48, HeLa cells
transduced with retroviral constructs TF 20-VP, TF 20-SKD, control constructs in
without ZF domains, or a retroviral construct overexpressing E48 cDNA (E48)
were cultured on glass coverslips for 24 hr and subsequently fixed with 2%
formaldehyde. Samples were blocked with 3% BSA and 5% normal goat serum
to prevent non-specific staining. Stained samples were mounted onto glass
slides and analyzed by confocal microscopy (MRC1024 laser scanning confocal
microscope, Biorad). For actin staining 104 cells were cultured in glass coverslips
for 24 hr, fixed with 2% formaldehyde and stained with Texas red-phalloidin
(Molecular Probes) as described by the manufacturer’s instructions. 3-D images
were obtained using an Olympus IX-70 Delta Vision Deconvolution Microscope
and analyzed using softWoRx 2.5.
Figure 5.
Figure 6.
Figure 7
Figure 8
AGT Promoter fragments
A
B
Luc
-1222
–516
–344
uc
–312
*
–243
–344
–516
Duplex
Duplex
(-516 -> –429) (-429-> –344)
C
D
E
–76
5’ GGA GCA GCT GAA GGT CAC 3’ ANG -490 subs
Figure 9
Figure10
Table 1. List of differentially regulated genes in TF 20-VP infected samples versus control groups
Gene Bank
Accession Number
NM_001560
NM_0021105
NM_000029
NM_003695
NM_005688
AK026295
NM_017449
NM_014452
Description
Gene Symbol
Fold Activation
interleukin 13 receptor, alpha 1
phospholipid scramblase 1
angiotensinogen [serine (or cysteine)
proteinase inhibitor, clade A
(alpha–1antiproteinase, antitrypsin)
member 8]
lymphocyte antigen 6 complex, locus D
ATP–binding cassette, subfamily C
(CFTR/MRP), member 5
Homosapiens cDNA: FLJ22642 fis,
clone HS106970
Homo sapiens EphB2
tumor necrosis factor receptor
superfamily, member 21
IL13RA1
PLSCR1
AGT
11.34
2.59
98.51
E48
ABCC5
127.43
2.484
22.29
EphB2
TNFR21
13.23
2.68
Control groups include mock-infected cells and cells infected with retroviral constructs expressing no ZFs.
Affymetrix DNA arrays were performed in two independent experiments using duplicate biological samples.
RNA samples were processed for hybridization on Affymetrix HG-U133A microarrays
(interrogating approximately 18.500 transcripts).
Table 2. Gene target validation by realtime PCR
IL13R 1
A: HeLa cells, 72
E48
AGT
EphB2
FLJ22642
ABCC5
TNFSF21
PLSCR
hr postinfection
CONTROL
1
0.6
1.3
2.6
0.7
0.4
0.4
0.8
SS-VP64
2.4
0.6
1.1
1.5
1.6
0.9
0.8
0.7
SS-SKD
8.2
1.4
2.1
2.0
2.1
1.0
0.7
0.6
TF 20-VP
791.0
3360.2
8.5
1.7
4.7
3.1
0.5
0.6
TF 20-SKD
6.0
0.3
0.7
1.7
0.4
0.3
0.5
0.5
IL13R
1
B: Tumors, 2
E48
AGT
weeks postinfection
TF 20-VP
11.4
19.4
0.6
TF 20-SKD
0.8
0.9
1.9
IL13R 1
Tumors, 6
E48
AGT
weeks postinfection
TF 20-VP
4002.4
39.9
1.2
TF 20-SKD
3.9
0.8
0.9
IL13R 1
C: Transfected
E48
AGT
HeLa cells
E48 cDNA
4492.6
1.2
0.6
AGT cDNA
2.3
74.5
0.9
IL13R 1cDNA
0.9
1.4
38.6
Mixed cDNA
9863.2
478.5
47.3
A: Gene target validation by real-time PCR using HeLa cells, 72 hr post-infection. Control represents HeLa cells transduced with a retroviral
construct containing no ZFs (empty pMX-IRES-GFP); SS-VP64, a construct expressing an activator domain only; SS-SKD, a construct with a
repressor domain only. The target gene expression was expressed relative to non-infected cells.
B: Hela cells recovered from primary tumors, 2 weeks (top Table) and 6 weeks (bottom Table) post-transduction.
C: Monitoring the expression of E48, AGT, and IL13R 1 by quantitative PCR using HeLa cells transiently transfected with 500ng of each cDNA.
The mixed cDNAs sample was transfected with equal amount (250 ng) of each cDNA.
Each gene target was measured in triplicates from two independent experiments.