TISSUE-SPECIFIC STEM CELLS
The Simultaneous Treatment of MMP-2 Stimulants in Retinal
Transplantation Enhances Grafted Cell Migration into the
Host Retina
TAKUYA SUZUKI,a MICHIKO MANDAI,b MASAYUKI AKIMOTO,b NAGAHISA YOSHIMURA,a MASAYO TAKAHASHIb
a
Department of Ophthalmology and Visual Sciences, Graduate School of Medicine, Kyoto University, Kyoto, Japan;
Department of Experimental Therapeutics, Translational Research Center, Kyoto University Hospital, Kyoto, Japan
b
Key Words. MMP-2 • Concanavalin A • 17 ␤-Estradiol • Retinal transplantation
ABSTRACT
The success of functional retinal cell transplantation has
been limited by the low efficiency of the transplanted cell
integration into the host retina. Given that the extracellular matrix (ECM) is thought to inhibit entry and axonal
outgrowth of grafted neural cells into the host retina,
modulation of the ECMs in the host environment may
overcome this limitation. Here, we demonstrate that matrix metalloprotease-2 (MMP-2) expression is associated
with the high migratory potential of adult rat hippocampus-derived neural stem cells compared with retinal progenitor cells. In addition, MMP-2, as well as its reported
inducers concanavalin A and 17␤-estradiol, can trigger
the migration of retinal progenitor cells into explanted
retinas. Inhibitors of MMP-2 suppressed these effects.
Intense cell migration is not required for photoreceptor
transplantation; however, the environment that allows
the transplanted cells to integrate is most important.
Migration of the transplanted cells is a good index of the
acceptance of grafted cell of the host tissue. Strategies
modulating the environment by MMP-2 stimulation may
provide an advance in the development of retinal transplantation. STEM CELLS 2006;24:2406 –2411
INTRODUCTION
nents of the ECM, is a potential candidate for this purpose [10,
11]. MMP expression is associated with tumor invasion and
metastatic potential [10 –12]. MMPs also contribute to oligodendrocyte neurite outgrowth in the CNS or axonal growth in
peripheral nerves by inhibition of factors, such as chondroitin
sulfate proteoglycan, and modulation of the ECM. In previous
studies, we observed the migration and incorporation of adult rat
hippocampus-derived neural stem cells (AHSCs) (clone PZ5)
into the developing retina and into the damaged retinas of adult
rats [13–16]. Although incorporated AHSCs mimic retinal cells
morphologically, they do not express retinal cell markers after
settlement [17–19]. In contrast, retinal progenitor cells express
retinal markers after transplantation, but the efficiency of
grafted cell incorporation into the host retina is too low for
practical use in transplantation [20, 21].
In this study, we showed for the first time that MMP-2 might
be responsible for the invasive nature of the grafted progenitor
cells and that the manipulation of host environment with
MMP-2 or its stimulator facilitate the migration of retinal progenitor cells into explanted retinas. Although the photoreceptors
exist in the outermost layer of the retina, the transplanted pho-
Neural cell transplantation is a promising therapeutic option to
replace dysfunctional cells in degenerative diseases of the central nervous system (CNS), including retina. Retinal transplantation, however, has achieved only limited success as yet [1–9].
Successful retinal transplantation requires incorporation of the
graft cells, proper synapse formation between host and grafted
neural cells, and long-term survival of the functional grafted
cells.
The primary obstacle in retinal transplantation has been poor
incorporation of the grafted cells into the retina, the initial step
in transplantation. Kinouchi et al. recently demonstrated that
elimination of the intermediate filaments of reactive Müller cells
or astrocytes within the retina permitted neuronal integration in
retinal transplantation of glial fibrillary acidic protein
(GFAP)⫺/⫺vimentin⫺/⫺ mice [9]. This result suggested that
removal of the extracellular matrix (ECM) barrier produced by
reactive glial cells in the damaged host retina is important in
encouraging the acceleration of graft cell migration.
A member of the matrix metalloproteinases (MMPs), a
family of zinc-dependent proteases that can degrade compo-
Correspondence: Michiko Mandai, M.D., Ph.D., Department of Experimental Therapeutics, Translational Research Center, Kyoto
University Hospital, Kyoto 606-8507, Japan. Telephone: ⫹81-75-751-4717; Fax: ⫹81-75-751-4731; e-mail: manf@kuhp.kyotou.ac.jp Received November 23, 2005; accepted for publication June 27, 2006. ©AlphaMed Press 1066-5099/2006/$20.00/0 doi:
10.1634/stemcells.2005-0587
Downloaded from
www.StemCells.com
at Iowa State University on December 17, 2006
STEM CELLS 2006;24:2406
–2411
www.StemCells.com
Suzuki, Mandai, Akimoto et al.
toreceptor cells should be incorporated with host retina and
extend their processes into it. To evaluate this ability of integration, we adapted the migration ratio of the transplanted cells
as an index.
MATERIALS
AND
METHODS
Animals
All experimental procedures in this study adhered to the Guidelines for Animal Experimentation of Kyoto University (Kyoto,
Japan). Animals were maintained in a constant environment on
a 14/10-hour light-dark cycle. Animals were provided with
water and food ad libitum.
Reverse Transcription-Polymerase Chain Reaction
Total RNA was isolated from both embryonic day 19 (E19)
retina of Fisher rats and cultured AHSCs using the guanidine
isothiocyanate-based TRIzol reagent (Invitrogen, Carlsbad, CA,
http://www.invitrogen.com). First-strand cDNA was synthesized using a First-Strand cDNA Synthesis Kit (GE Healthcare,
Little Chalfont, Buckinghamshire, UK, http://www.gehealthcare.
com) in accordance with the manufacturer’s protocol. The polymerase chain reaction (PCR) was performed with Advantage 2 Taq
polymerase (Clontech, Mountain View, CA, http://www.clontech.
com) and the following primers:
MMP-2: TGCACCATCGCCCATCATCAAGTT (sense),
AAGGCCCGAGCAAAAGCATCATCC (antisense);
MMP-7: TTGGGGGACTGCAGACATCATAAT (sense),
GCTCAGGAAGGGCGTTTGCTCAT (antisense);
MMP-9: GCCCACAGCTCCTCCCACTATG (sense),
TTGCGCCCAGAGAAGAAGAAAATC (antisense);
RX: GCTACTCGCCCCTGCTATCC (sense),
AGGGCGGTGGCGGCGTGTA (antisense); and
PAX6: CCGGGAAAGACTAGCAGCCAAAAT (sense),
TGTGCGGAGGGGTGTAGGTATCAT (antisense).
In the PCRs, an initial denaturation at 94°C (1 minute) was
followed by amplification with 28 cycles of denaturation at
94°C (30 seconds), annealing at 58°C (30 seconds), and extension at 68°C (30 seconds).
Coculture of Retinal Progenitor Cells with
Retinal Explant
Retinal explant cultures were performed as described [22, 23].
Briefly, eyes of adult Fisher rats were enucleated (Shimizu
Laboratory Supplies, Kyoto, Japan, http://web.kyoto-inet.or.jp/
people/simizu/index.htm ); each neural retina was removed from
the remaining tissue and placed on a Millicell-CM chamber
filter (30-mm diameter, 0.4-␮m culture plate insert; Millipore,
Billerica, MA, http://www.millipore.com) with the ganglion cell
layer facing up. The Millicell-CM chamber filter was then
moved to a six-well culture plate (Millipore), each well of which
contained 1 ml culture medium (50% minimum essential medium with HEPES [Invitrogen], 25% Hanks’ balanced salt solution [Invitrogen], 25% heat-inactivated horse serum, 200 ␮M
L-glutamine, and 5.75 mg/ml glucose) with the following additives when indicated: active MMP-2 (ex vivo MMP-2 group;
Chemicon, Temecula, CA, http://www.chemicon.com), 20
␮g/ml concanavalin A (Con A) (ex vivo Con A group), 20
␮g/ml Con A and MMP-2 inhibitor (ex vivo Con A/ MMP-2
inhibitor group), 10⫺10 M 17␤-estradiol (E2) (ex vivo E2
2407
group), 10⫺10 M E2 and MMP-2 inhibitor (ex vivo E2/MMP-2
inhibitor group), 20 ␮g/ml Con A and 10⫺10 M E2 (ex vivo Con
A/E2 group), 20 ␮g/ml Con A, 10⫺10 M E2, MMP-2 inhibitor
(ex vivo Con A/E2/MMP-2 inhibitor group), 20 ␮g/ml MMP-2
inhibitor (ex vivo MMP-2 inhibitor group), or no additional
substances (control group). For ex vivo transplantation, retinal
cells from P0-P2 green fluorescent protein (GFP) transgenic
mice (the kind gift of M. Okabe, Osaka University, Osaka,
Japan) were dissociated using the Papain Dissociation System
(Worthington Biochemical Corporation, Lakewood, NJ, http://
www.worthington-biochem.com). Two microliters of cell suspension (1.0 ⫻ 105 cells per microliter) were placed between the
host retina and the chamber filter (subretinal space). Explants
were cultured at 34°C in 5% CO2, with a change of media every
other day; samples were harvested and processed for histology
approximately 1 week later.
Tissue Processing
To prepare retinal sections, animals were sacrificed with an
overdose of pentobarbital sodium 4 weeks after surgery. Animals were perfused transcardially first with phosphate-buffered
saline (PBS), followed by 4% paraformaldehyde (PFA) (Merck,
Darmstadt, Germany, http://www.merck.com) in 0.1 M phosphate buffer. The posterior segments of the enucleated eyes
were immersed in fresh 4% PFA at 4°C for 16 hours, then in
25% sucrose-PBS for cryoprotection. After being embedded in
an optimal cutting temperature compound (Bayer Corp., Emeryville, CA, http://www.bayer.com), consecutive 12–16-␮m
frozen sections were generated on a cryostat.
Immunohistochemistry
After washing in PBS, sections were preincubated in blocking
solution (PBS containing 20% skim milk and 0.3% Triton
X-100) for 30 minutes, then incubated overnight at 4°C with one
of the following antibodies diluted as specified in 5% skim milk
and 0.3% Triton X-100 in PBS (staining buffer): mouse or rabbit
anti-GFP antibody (1:500; Molecular Probes Inc., Eugene, OR,
http://probes.invitrogen.com). Subsequent immunofluorescence
staining used goat anti-mouse immunoglobulin G (IgG) (H⫹L)
(AlexaFluor 488; Molecular Probes Inc.) or goat anti-rabbit IgG
(H⫹L) (AlexaFluor 594; Molecular Probes Inc.), as appropriate,
each diluted 1:500 in the staining buffer. GFP was visualized
either directly or indirectly by staining using mouse or rabbit
anti-GFP (1:500; Molecular Probes Inc.).
Tissue Analysis
Sections containing cocultured cells were examined with a
laser-scanning confocal microscope (Leica Microsystems
GmbH, Wetzlar, Germany, http://www.leica-microsystems.
com). Cells were counted within an average of every 10th
section, sampled across the entire host retina. Each experiment
was performed in three retinal explants (n ⫽ 3). The number of
GFP⫹ cells migrating into the host retina was compared with the
total number of GFP⫹ cells in each section to give the percentage of cells migrating into the host retina. The numbers of
counted cells are presented as means ⫾ SD. All of the group
data were subjected to the Student’s t test. p values less than .05
were considered to be statistically significant.
www.StemCells.com Downloaded from www.StemCells.com at Iowa State University on December 17, 2006
MMP-2 Stimulants in Retinal Transplantation
2408
Figure 1. The secretion of MMP-2 from AHSCs is important in the
migratory plasticity of retinal and/or retinal progenitor cells transplanted
into a host retina. (A): Reverse transcription-polymerase chain reaction
(RT-PCR) analysis of retinal cells and AHSCs. Total RNA was extracted from both E19 retinas of C57Bl/6 mice and cultured AHSCs
cells, then analyzed by RT-PCR. (B, C): Sections of retinal explants
untreated (B) or treated with an MMP-2 inhibitor (C). One week after
cell transplantation, the explants were examined by immunohistochemistry using an anti-␤-gal (green). Note the extensive migration of AHSCs (green) into the retina (B) in comparison with that seen in (C). Scale
bars ⫽ 20 ␮m. Abbreviations: AHSC, adult rat hippocampus-derived
neural stem cell; E19, embryonic day 19; GCL, ganglion cell layer; INL,
inner nuclear layer; MMP-2, matrix metalloprotease-2; ONL, outer
nuclear layer; SUB, subretina.
RESULTS
The Function of MMP-2 Expression by AHSCs in
Cell Migration
Of all of the MMPs examined by preliminary reverse transcription-PCR analysis, only MMP-2 was upregulated in AHSCs in
comparison with the levels observed in embryonic retinal cells
(E19) (Fig. 1). Neither MMP-7 nor MMP-9 mRNA was expressed in both cell types (data not shown).
To investigate the role of MMP-2 in the migratory capacity
of AHSCs during retinal transplantation, we examined whether
exogenous MMP-2 inhibitors affected the migration of AHSCs
into the host retina using retinal organ culture. Seven days after
ex vivo transplantation, AHSCs migrated well into the entirety
of the host retina. In contrast, addition of an MMP-2 inhibitor
abrogated AHSCs migration into the host retina nearly completely. This result indicates that MMP-2 functions in the migration of AHSCs (Fig. 1).
Effects of MMP-2 on Retinal Progenitor Cell
Migration in Retinal Explants
Next, we used dissociated retinal cells derived from newborn
GFP⫹ mice as donor cells to investigate whether exogenous
MMP-2 stimulates cell migration into the host retina in ex vivo
transplantation. In the ex vivo MMP-2 group, 18.43% ⫾ 1.60%
Figure 2. The effect of exogenous MMP-2 on the migratory plasticity
of retinal and/or retinal progenitor cells. (A, B): Sections of retinal
explants in the absence (A) or presence (B) of active MMP-2. One week
after cell transplantation, explants were subjected to immunohistochemistry labeled with anti-green fluorescent protein antibody (green). The
transplanted cells in the MMP-2 group (B) exhibited improved migration in comparison with the control group (A). Scale bars ⫽ 20 ␮m. (C):
The number of transplanted cells in each group which migrated to the
host retina were quantified 1 week after transplantation. In comparison
with the control group, the MMP-2 group exhibited a significant increase in the ratio of transplanted cells that migrated into the host retina.
ⴱⴱ p ⬍ .01 versus control. Error bars indicate mean ⫾ SD. Abbreviations: GCL, ganglion cell layer; INL, inner nuclear layer; MMP-2,
matrix metalloprotease-2; ONL, outer nuclear layer; SUB, subretina.
of the total GFP⫹ cells migrated into host retina (Fig. 2), a
significantly greater proportion than observed in the ex vivo
control group (2.46% ⫾ 0.54%, p ⬍ .01) (Fig. 2). We then
examined the effect of Con A, E2, and the combination of both
stimuli on cell migratory potential. These substances enhance
MMP-2 activity by protein activation and transcriptional upregulation, respectively. The application of Con A, E2, or both
increased the percentages of migrating cells (15.68% ⫾ 2.86%,
12.88% ⫾ 2.29%, and 17.72% ⫾ 2.43%, respectively; Figs. 2
and 3). These increases were statistically significant (p ⬍ .05, ex
vivo Con A group vs. ex vivo control group; p ⬍ .01, ex vivo
E2 group vs. ex vivo control group). Although there was no
additive effect on the percentage of the migrated cells when the
Con A and E2 treatments were given together, the cells increasingly migrated into the inner retina after combined treatment
(Fig. 3D; Table 1).
To investigate whether these effects were mediated by
MMP-2, we added an MMP-2 inhibitor into these ex vivo
transplantation conditions (Fig. 4; Table 1). When an MMP-2
inhibitor was added, the ratio of migrated cells in each condition
decreased (7.54% ⫾ 0.55%, 5.82% ⫾ 1.06%, and 11.71% ⫾
1.66% for the ex vivo Con A/MMP-2 inhibitor, ex vivo E2/
MMP-2 inhibitor, and ex vivo Con A/E2/MMP-2 inhibitor
groups, respectively).
Downloaded from www.StemCells.com at Iowa State University on December 17, 2006
Suzuki, Mandai, Akimoto et al.
2409
Figure 3. The effect of MMP-2 inducers on the migratory plasticity of
green fluorescent protein⫹ retinal and/or retinal progenitor cells. (A, B):
Sections of retinal explants in the absence (A) or presence of Con A (B),
E2 (C), or the combination (D) treatment. One week after cell transplantation, explants were subjected to immunohistochemistry. Scale
bars ⫽ 20 ␮m. (E): The transplanted cells in each group which migrated
into the host retina were quantified at 1 week after transplantation.
Significant differences between the control and treatment groups were
identified by Student’s t test. ⴱ p ⬍ .05, ⴱⴱ p ⬍ .01 versus control. Error
bars indicate mean ⫾ SD. Abbreviations: Con A, concanavalin A; E2,
17␤-estradiol; GCL, ganglion cell layer; INL, inner nuclear layer;
MMP-2, matrix metalloprotease-2; ONL, outer nuclear layer; SUB,
subretina.
DISCUSSION
To achieve the functional recovery of a damaged CNS by cell
transplantation, the donor transplant cells must migrate and
integrate into the neural circuit at the damaged site. Grafted stem
cells appear to have the ability to migrate toward damaged sites,
taking their cue from a chemoattractant produced at the site [24,
25]. Degradation of the ECM appears to be necessary for the
grafted cells to integrate into a host tissue packed with cells. We
observed that the migration ratio (percentage of transplanted
cells entering the retina) differs significantly among the various
types of neural stem/progenitor cells. Prestoz et al. also observed this phenomenon, reporting that differences in integrin
signaling contributed to the differential migratory abilities [26].
Thus, the migration of transplanted cells are significantly influenced by the ECM. The robust neuronal integration in retinal
transplantation seen in GFAP⫺/⫺vimentin⫺/⫺ mice also supports this viewpoint [9].
MMPs are proteolytic enzymes that degrade ECM molecules, including collagen, fibronectin, laminin, and a variety of
proteoglycans. These proteases have been widely implicated in
tumor invasion and metastasis [10 –12]. Recently, the role of
MMPs in the generation of the CNS and peripheral nervous
system has been increasingly recognized. MMP-2 and MMP-9
expression increases at sites of peripheral nerve injury or degeneration and enhances neural promoting activity, partially by
downregulating the chondroitin sulfate proteoglycan activity
that may inhibit neural outgrowth [12, 13]. In the CNS, MMP-9
contributes to process outgrowth by oligodendrocytes in the
initial phase of myelination that occurs during development or
during remyelination after pathologic damage [14, 15]. The
efficient migratory potential and axonal outgrowth of AHSCs
hinted to us that factors degrading the ECM may facilitate the
invasive nature of these cells. We found that the expression of
MMP-2 is higher in AHSCs than in embryonic retinal progenitor cells. The migratory potential of AHSCs could be abrogated
by treatment with an MMP2 inhibitor, indicating an important
role for MMP-2 in the migration of AHSCs during retinal
transplantation. In ex vivo transplantation, exogenous activation
of MMP-2 enhanced the migration of retinal protenitor cells into
the retinal explant, suggesting that the activation of MMP-2 in
situ may trigger migration and enhance the incorporation of
grafted cells into the host retina.
MMP-2 activity can be regulated at three levels: gene transcription, proenzyme activation by membrane-type metalloproteinases (MT-MMP), and inhibition by naturally occurring tissue inhibitors of metalloproteinases (TIMPs) [27]. Phorbol
esters, interleukin-1, tumor necrosis factor-␣, transforming
growth factor ␤-1, and E2 are all stimulants of MMP-2 gene
transcription. Sp1, Sp3, AP-2, and Smad4 are transcription
factors reported to upregulate MMP-2 mRNA levels [28 –32].
MMP-2 is initially expressed as an inactive proenzyme, which is
Table 1. A semiquantative analysis of the transplanted cell quantity in the different layers
GCL
IPL/INL
OPL/ONL
SUB
Control
MMP-2
MMP-2 inhibitor
Con A
E2
Con
A/E2
⫺
⫺
⫺⬃⫾
⫹⫹
⫺
⫺⬃⫾
⫾⬃⫹
⫹ ⬃ ⫹⫹
⫺
⫺
⫺⬃⫾
⫹⫹
⫺
⫺
⫾⬃⫹
⫹⬃
⫹⫹
⫺
⫺
⫾⬃⫹
⫹⬃
⫹⫹
⫺
⫺⬃⫾
⫾⬃⫹
⫹⬃
⫹⫹
Abbreviations: Con A, concanavalin A; E2, 17␤ -estradiol; GCL, ganglion cell layer; INL, inner nuclear layer; IPL, inner plexiform
layer; MMP-2, matrix metalloprotease-2; ONL, outer nuclear layer; OPL, outer plexiform layer; SUB, subretina; ⫾, one or two cells per
field; ⫹, several cells per field; ⫹⫹, more than 10 cells per field; ⫺, no cells per field.
www.StemCells.com Downloaded from www.StemCells.com at Iowa State University on December 17, 2006
MMP-2 Stimulants in Retinal Transplantation
2410
Figure 4. Altered migratory plasticity of green fluorescent protein⫹
retinal and/or retinal progenitor cells after treatment with an MMP-2
inhibitor in the presence of Con A, E2, or the combination. (A–D):
Sections of retinal explants after treatment with an MMP-2 inhibitor
alone (A), Con A and an MMP-2 inhibitor (B), E2 and an MMP-2
inhibitor (C), or Con A, E2, and an MMP-2 inhibitor (D). One week
after cell transplantation, explants were subjected to immunohistochemistry. Note the reduction in migratory plasticity of the transplanted cells
in the group with MMP-2 inhibitor in comparison with those without it.
Scale bars ⫽ 20 ␮m. (E–H): Quantification of the numbers of transplanted cells in each group which migrated into the host retina at 1 week
after transplantation. Statistical significance: ⴱ p ⬍ .05, Con A/MMP
inhibitor group versus Con A group (F) and E2/MMP inhibitor group
versus E2 group (G). Data are expressed as the means ⫾ SD. Abbreviations: Con A, concanavalin A; E2, 17␤-estradiol; GCL, ganglion cell
layer; INL, inner nuclear layer; MMP-2, matrix metalloprotease-2;
ONL, outer nuclear layer; SUB, subretina.
activated by MT-MMP cleavage of the propeptide, rendering the
enzyme fully active. TIMPs form a complex with both proMMP-2 and active MMP-2, which controls the rate of MMP-2
activation in a complicated manner [27].
REFERENCES
The plant lectin Con A, a carbohydrate-binding protein,
induces MT1-MMP expression, subsequently activating
MMP-2 [33]. Pretreatment of myoblasts with Con A increased
the intramuscular migration of transplanted myoblasts in an
MMP-2-dependent manner [34, 35]. Con A was also implicated
as a neuronal modulator, as the extracellular domains of many
receptors for neurotransmitters, growth factors, or other neuromodulators are glycosylated, leading to ligation by lectins such
as Con A [36, 37]. E2 regulates the expression of MMP-2 by
activating estrogen receptors in a dose-dependent fashion in
both in vivo and in vitro systems [31, 32]. In the CNS, E2
induces synaptogenesis in the hippocampus and dendritic spine
formation in hippocampal neurons in a brain-derived neurotrophic factor-dependent pathway [38, 39].
In this study, the migratory activity of transplanted cells was
enhanced by adding Con A, E2, or the combination to the culture
medium; these effects could be significantly suppressed by the
addition of an MMP-2 inhibitor. This result suggested that Con
A and E2 may facilitate grafted cell migration by activating
MMP-2 in situ. The fact that we did not observe any additive
effects on the percentage of migrating cells after treatment with
both stimuli indicates that both of these factors affect the same
pathway. Interestingly, combined treatment resulted in a significantly different distribution of the migrated cells within the
retinal explant, indicating the potential existence of an additive
effect of these two factors on a pathway independent from
MMP-2. Simultaneous treatment of retinal progenitor cells with
Con A and E2 also enhanced the migration of grafted cells into
the retinas of mice exhibiting retinal degeneration. This is the
first report conclusively demonstrating that stimulation of
MMP-2 activity can enhance the incorporation of grafted cells
during neuronal transplantation.
The recovery of retinal function depends primarily on the
efficiency of grafted cell integration into the host retina. Intense
cell migration is not required for photoreceptor transplantation;
however, the environment that allows the transplanted cells to
integrate is most important. Migration of the transplanted cells
is a good index of the acceptance of grafted cells of the host
tissue. Strategies modulating the environment by MMP-2 stimulation may provide an advance in the development of retinal
transplantation therapy.
ACKNOWLEDGMENTS
This work was supported by grants-in-aid from the Ministry of
Education, Culture, Sports, Science and Technology (MEXT)
Japan (the Leading Project).
DISCLOSURES
The authors indicate no potential conflicts of interest.
3
1
Ehinger B, Bergstrom A, Seiler M et al. Ultrastructure of human retinal
cell transplants with long survival times in rats. Exp Eye Res 1991;53:
447– 460.
2
Gouras P, Du J, Kjeldbye H et al. Long-term photoreceptor transplants in
dystrophic and normal mouse retina. Invest Ophthalmol Vis Sci 1994;
35:3145–3153.
4
5
Zucker CL, Ehinger B, Seiler M et al. Ultrastructural circuitry in retinal
cell transplants to rat retina. J Neural Transpl Plast 1994;5:17–29.
Aramant RB, Seiler MJ. Fiber and synaptic connections between
embryonic retinal transplants and host retina. Exp Neurol 1995;133:
244 –255.
Litchfield TM, Whiteley SJ, Lund RD. Transplantation of retinal pigment epithelial, photoreceptor and other cells as treatment for retinal
degeneration. Exp Eye Res 1997;64:655– 666.
Downloaded from www.StemCells.com at Iowa State University on December 17, 2006
Suzuki, Mandai, Akimoto et al.
6
Seiler MJ, Aramant RB. Intact sheets of fetal retina transplanted to restore
damaged rat retinas. Invest Ophthalmol Vis Sci 1998;39:2121–2131.
7
Ghosh F, Bruun A, Ehinger B. Graft-host connections in long-term
full-thickness embryonic rabbit retinal transplants. Invest Ophthalmol
Vis Sci 1999;40:126 –132.
8
9
Ghosh F, Johansson K, Ehinger B. Long-term full-thickness embryonic
rabbit retinal transplants. Invest Ophthalmol Vis Sci 1999;40:133–142.
Kinouchi R, Takeda M, Yang L et al. Robust neural integration from
retinal transplants in mice deficient in GFAP and vimentin. Nat Neurosci
2003;6:863– 868.
2411
23 Akita J, Takahashi M, Hojo M et al. Neuronal differentiation of adult rat
hippocampus-derived neural stem cells transplanted into embryonic rat
explanted retinas with retinoic acid pretreatment. Brain Res 2002;954:
286 –293.
24 Zhang H, Vutskits L, Pepper MS et al. VEGF is a chemoattractant for
FGF-2-stimulated neural progenitors. J Cell Biol 2003;163:1375–1384.
25 Imitola J, Raddassi K, Park KI et al. Directed migration of neural stem
cells to sites of CNS injury by the stromal cell-derived factor 1alpha/
CXC chemokine receptor 4 pathway. Proc Natl Acad Sci U S A 2004;
101:18117–18122.
10 Bergers G, Coussens L. Extrinsic regulators of epithelial tumor progression: Metalloproteinases. Curr Opin Genet 2000;10:120 –127.
26 Prestoz L, Relvas JB, Hopkins K et al. Association between integrindependent migration capacity of neural stem cells in vitro and anatomical
repair following transplantation. Mol Cell Neurosci 2001;18:473– 484.
11 Kleiner DE, Stetler-Stevenson WG. Matrix metalloproteinases and metastasis. Cancer Chemother Pharmacol 1999;43:42–51.
27 Yong VW, Krekoski CA, Forsyth PA et al. Matrix metalloproteinases
and diseases of the CNS. Trends Neurosci 1998;21:75– 80.
12 Belien AT, Paganetti PA, Schwab ME. Membrane-type-1 matrix metalloprotease (MT1-MMP) enables invasive migration of glioma cells in
central nervous system white matter. J Cell Biol 1999;144:373–384.
28 Matsumoto K, Abiko S, Ariga H. Transcription regulatory complex
including YB-1 controls expression of mouse matrix metalloportinase-2
gene in NIH3T3 cells. Biol Pharm Bull 2005;28:1500 –1504.
13 Zuo J, Hernandez YJ, Muir D. Chondroitin sulfate proteoglycan with
neurite-inhibiting activity is up-regulated following peripheral nerve
injury. J Neurobiol 1998;34:41–54.
29 Lin HY, Yang Q, Wang HM et al. Involvement of SMAD4, but not of
SMAD2, in transforming growth factor-beta1-induced trophoblast expression of matrix metalloproteinase-2. Front Biosci 2006;11:637– 646.
14 Zuo J, Ferguson TA, Hernandez YJ et al. Neuronal matrix metalloproteinase-2 degrades and inactivates a neurite-inhibiting chondroitin sulfate
proteoglycan. J Neurosci 1998;18:5203–5211.
30 Hanemaaifer R, Koolwijk P, Le Clercq L et al. Regulation of matrix
metalloproteinase expression in human vein and microvascular endothelial cells. Effects of tumour necrosis factor alpha, interleukin 1 and
phobol ester. Biochem J 1993;296:803– 809.
15 Oh LY, Larsen PH, Krekoski CA et al. Matrix metalloproteinase-9/
gelatinase B is required for process outgrowth by oligodendrocytes.
J Neurosci 1999;19:8464 – 8475.
31 Guccione M, Silbiger S, Lei J et al. Estradiol upregulates mesangial cell
MMP-2 activity via the transcription factor AP-2. Am J Physiol Renal
Physiol 2002;282:164 –169.
16 Uhm JH, Dooley NP, Oh LYS et al. Oligodendrocytes utilize a matrix
metalloproteinase, MMP-9, to extend processes along an astrocyte extracellular matrix. Glia 1998;22:53– 63.
32 Marin-Castaño ME, Elliot SJ, Potier M et al. Regulation of estrogen
receptors and MMP-2 expression by estrogens in human retinal pigment
epithelium. Invest Ophthalmol Vis Sci 2003;44:50 –59.
17 Takahashi M, Palmer TD, Takahashi J et al. Widespread integration and
survival of adult-derived neural progenitor cells in the developing optic
retina. Mol Cell Neurosci 1998;12:340 –348.
33 Jiang A, Lehti K, Wang X et al. Regulation of membrane-type matrix
metalloproteinase 1 activity by dynamin-mediated endocytosis. Proc Natl
Acad Sci U S A 2001;98:13693–13698.
18 Young MJ, Ray J, Whiteley SJ et al. Neuronal differentiation and
morphological integration of hippocampal progenitor cells transplanted
to the retina of immature and mature dystrophic rats. Mol Cell Neurosci
2000;16:197–205.
34 Ito H, Hallauer PL, Hastings KE et al. Prior culture with concanavalin A
increases intramuscular migration of transplanted myoblast. Muscle
Nerve 1998;21:291–297.
19 Nishida A, Takahashi M, Tanihara H et al. Incorporation and differentiation of hippocampus-derived neural stem cells transplanted in injured
adult rat retina. Invest Ophthalmol Vis Sci 2000;41:4268 – 4274.
20 Akagi T, Haruta M, Akita J et al. different characteristics of rat retinal
progenitor cells from different culture periods. Neurosci Lett 2003;341:
213–216.
21 Klassen HJ, Ng TF, Kurimoto Y et al. Multipotent retinal progenitors
express developmental markers, differentiate into retinal neurons, and
preserve light-mediated behavior. Invest Ophthalmol Vis Sci 2004;45:
4167– 4173.
22 Hatakeyama J, Kageyama R. Retrovirus-mediated gene transfer to retinal
explants. Methods 2002;28:387–395.
35 Fahime EE, Torrente Y, Caron NJ et al. In vivo migration of transplanted
myoblasts requires matrix metalloproteinase activity. Exp Cell Res 2000;
258:279 –287.
36 Farmer LM, Hagmann J, Dagan D et al. Directional control of neurite
outgrowth from cultured hippocampal neurons is modulated by the lectin
concanavalin A J Neurobiol 1992;23:354 –363.
37 Lin SS, Levitan IB. Concanavalin A: A tool to investigate neuronal
plasticity. Trends Neurosci 1991;14:273–277.
38 Kretz O, Fester L, Wehernberg U et al. Hippocampal synapses depend on
hippocampal estrogen synthesis. J Neurosci 2004;24:5913–5921.
39 Murphy DD, Cole NB, Segal M. Brain-derived neurotrophic factor
mediates estradiol-induced dendritic spine formation in hippocampal
neurons. Proc Natl Acad Sci U S A 1998;95:11412–11417.
See www.StemCells.com for supplemental material available online.
www.StemCells.com Downloaded from www.StemCells.com at Iowa State University on December 17, 2006