OPEN 0 ACCESS Freely available online
A C om prehensive Molecular P h y logen y of
Dalytyphloplanida (Platyhelminthes: Rhabdocoela)
Reveals Multiple Escapes from th e Marine Environment
and Origins o f Symbiotic Relationships
Niels Van Steenkiste1*“, Bart Tessens1, Wim W illem s1, Thierry Backeljau2'3, Ulf Jondelius4, Tom Artois1
1 Centre for Environmental Sciences, Hassek University, D iepenbeek, Belgium, 2 D epartm ent of Biology, University of Antwerp, Antwerp, Belgium, 3 D epartm ent of
Invertebrates and Joint Experimental Molecular Unit, Royal Belgian Institute of Natural Sciences, Brussels, Belgium, 4 D epartm ent of Invertebrate Zoology, Swedish
Museum of Natural History, Stockholm, Sweden
Abstract
In this study we elaborate the phylogeny o f Dalytyphloplanida based on com plete 18S rDNA (156 sequences) and partial
28S rDNA (125 sequences), using a M axim um Likelihood and a Bayesian Inference approach, In order to Investigate the
origin o f a llm nlc o r llm noterrestrlal and o f a sym biotic lifestyle In this large gro u p o f rhabdltophoran flatworm s. The results
o f ou r phylogenetic analyses and ancestral state reconstructions Indicate th a t dalytyphloplanlds have the ir origin In the
marine environm ent and tha t there was one highly successful Invasion o f the freshw ater environm ent, leading to a large
radiation o f llm nlc and llm noterrestrlal dalytyphloplanlds. This m onophyletlc freshwater clade, Llm notyphloplanlda,
comprises the taxa Dalyelliidae, Tem nocephalida, and m ost Typhloplanidae. Tem nocephalida can be considered
ectosym blotlc Dalyelliidae as they are em bedded w ith in this group. Secondary returns to brackish w ater and marine
environm ents occurred relatively frequently In several dalyellld and typh lop lan ld taxa. Our phylogenles also show that, apart
from the Llm notyphloplanlda, there have been only few Independent Invasions o f the llm nlc environm ent, and apparently
these were not follow ed by spectacular spéciation events. The distinct phylogenetic positions o f the sym biotic taxa also
suggest m ultiple origins o f commensal and parasitic life strategies w ith in D alytyphloplanida. The previously established
higher-level dalytyphloplanld clades are confirm ed In our topologies, but m any o f the traditional families are not
m onophyletlc. Alternative hypothesis testing constraining the m onophyly o f these families In the topologies and using the
approxim ately unbiased test, also statistically rejects the ir m onophyly.
C itation : Van Steenkiste N, Tessens B, Willems W, Backeljau T, Jondelius U, e t al. (2013) A Com prehensive Molecular Phylogeny of Dalytyphloplanida
(Platyhelminthes: Rhabdocoela) Reveals Multiple Escapes from th e Marine Environment and Origins o f Symbiotic Relationships. PLoS ONE 8(3): e59917.
doi:10.1371/journal.pone.0059917
Editor: Diego Fontaneto, Consiglio Nazionale delle Ricerche (CNR), Italy
Received D ecember 16, 2012; A ccepted February 20, 2013; Published March 25, 2013
C opyrigh t: © 2013 Van Steenkiste e t al. This is an open-access article distributed under th e terms of th e Creative Commons Attribution License, which permits
unrestricted use, distribution, and reproduction in any medium, provided th e original author and source are credited.
F unding: NVS and BT have been b en efitin g from a grant (aspirant) of th e Flemish Research Foundation (FWO Vlaanderen). WW is supported by a Special
Research Foundation (BOF) grant o f Hasselt University. This paper is also a contribution to the Flemish Research Foundation (FWO) project G.08.208. The funders
had no role in study design, data collection and analysis, decision to publish, or preparation of th e manuscript.
C om peting Interests: The authors have declared th a t no com peting interests exist.
* E-mail: niels_van_steenkiste@hotmail.com
a Current address: D epartm ent o f Fisheries and Oceans, Pacific Biological Station, Nanaimo, British Columbia, Canada.
Rhabdocoela into two large clades: Kalyptorhynchia (±530
species) and Dalytyphloplanida (±1000 species). Dalytyphloplanids are found worldwide in marine, brackish water, limnic and
limnoterrestrial environments. It comprises the Typhloplanoida,
Dalyellioida and Tem nocephalida. Table 1 summarizes the
traditional classification o f the families and subfamilies in the
Dalytyphloplanida. Yet, Willems et al. [1] showed that both the
“Typhloplanoida” and “Dalyellioida” are polyphyletic and their
representatives are scattered all over the dalytyphloplanid tree
(Fig. 1). Consequently, the clades and names established by
Willems et al. [1] will be followed here. As such, Dalytyphlopla­
nida is divided into Neodalyellida and Neotyphloplanida, the
former roughly consisting o f all marine “Dalyellioida” , while the
latter being further divided into the well-supported Thalassotyphloplanida and a poorly-supported, trichotomous freshwater clade
comprising Typhloplanidae, Dalyelliidae and Tem nocephalida [1]
(Fig. 1). T he monophyly of this freshwater clade was already
Introduction
W ith about 1530 described species, R habdocoela is one of the
most species-rich taxa of non-neoderm atan flatworms. Classical
taxonomy, mainly based on the presence of a proboscis and the
pharynx morphology, recognises four large groups within
Rhabdocoela: Kalyptorhynchia (with a frontal proboscis and a
pharynx rosulatus, i.e. a mostly globular pharynx with a muscular
septum and a more or less vertical axis), Typhloplanoida (with
pharynx rosulatus, without proboscis), Dalyellioida (with pharynx
doliiformis, i.e. a barrel-shaped, anteriorly-situated pharynx with a
muscular septum and a horizontal axis) and Tem nocephalida (with
a pharynx doliiformis and ectosymbiotic on freshwater inverte­
brates and chelonians). Willems et al. [1] were the first to
thoroughly and intentionally explore rhabdocoel phylogenetic
relationships using 18S rD NA sequences. In contrast to the
traditional morphology-based phylogenies, this study divided
PLOS ONE I www.plosone.org
1
March 2013 | Volume 8 | Issue 3 | e59917
Phylogeny of Dalytyphloplanida
parasitism in dalytyphloplanids. Moreover, it would be interesting
to further explore the relationships of the symbiotic rhabdocoels.
Against this background, the present work aims at extending
and deepening the work of Willems et al. [1] in order to: (a)
establish a sound molecular phylogeny of the Dalytyphloplanida
using m ore taxa and gene fragments, (b) explore the transition
from the m arine to the freshwater environment in the D alytyph­
loplanida, and (c) corroborate the phylogenetic positions of
symbiotic taxa and their implications for the evolution of
commensalism and parasitism in free-living flatworms.
suggested by Jondelius and Thollesson [2], though needed further
support because it was based on methodologically ill-founded
conclusions [3]. Later on, Willems et al. [1] re-addressed the
monophyly of this clade, but could not definitively resolve the issue
because of too limited taxon sampling. Hence, the existence of the
freshwater clade in the Neotyphloplanida needs to be explored
further using more representatives than Willems et al. [1] did.
Addressing the monophyly of the neotyphloplanid freshwater
clade is interesting because it would show w hether or not the
Dalytyphloplanida follow a pattern of repeated independent
invasions of freshwater habitats by m arine ancestors, as observed
in other m ajor clades of Platyhelminthes (e.g. Catenulida,
Macrostom ida, Prorhynchida, Continenticola, Kalyptorhynchia;
see [4]).
H undreds of species of non-neoderm atan flatworms in 35
families live in symbiosis with other organisms, ranging from
commensalism to obligate parasitism. W ith ± 250 species, the
m ajority of these symbionts are dalytyphloplanids: T em nocepha­
lida, Umagillidae, Pterastericolidae and Graffillidae. A few species
of rhabdocoel symbionts were included in the analysis of Willems
et al. [1], showing that they are not closely related to each other.
This raised questions on the origins of commensalism and
M aterials and Methods
1. Collection an d selection of taxa
From 2007 to 2011, 157 dalytyphloplanid taxa were collected
worldwide for DNA sequence analysis of 18S and 28S rDNA.
They represent 10 of the 13 traditional families, 17 of the 24
traditional subfamilies and 57 of the 168 genera of free-living taxa.
In addition, sequences of 11 symbiotic taxa were also included (4
Tem nocephalidae, 2 Graffillidae, 2 Pterastericolidae and 3
Umagillidae). This taxon sampling involved 81 m arine and 76
freshwater taxa, yet m any m arine and some limnic species are also
found in brackish water, while five “limnic” species are actually
Astrotorhynchus bifidus
Prom esostom a sp.
Trigonostomum penicillatum
M aehrenthalia agilis
Styloplanella strongylostom oides
TH7 l a s s o t y p h l o p l a n i d a
Litucivis serpens
Proxenetes (5)
P tychopera (2)
Trigonostomum denhartogi
Gaziella sp.
Castrada lanceola
d
Castrada luteola
Castrada sp.
Castrada viridis
NEOTYPHLOPLANIDA
M esocastrada sp.
Olisthanella truncula
Phaenocora unipunctata
Bothromesostoma personatum
TYI 'HLOPLANIDAE
M esostom a lingua
Bothromesostoma sp.
M esostom a lingua
M esostom a thamagai
Strongylostoma elongatum
d
Castrella truncata
M icrodalyellia rossi
Temnocephala (2)
DALYELLIIDAE
TEMNOCEPHALIDA
Einarella argillophyla
Trisaccopharynx westbladi
Anoplodium stichopi
Provortex (2)
d
NEODALYELLIDA
Graffilla buccinicola
P terastericola australis
Figure 1. D alytyp hlo planid p hylogeny redraw n a fte r W illem s et al. [1]. D a ly ty p h lo p la n id a c o n sis ts o f N e o ty p h lo p la n id a a n d N eodalyellida.
N u m b e rs o f s p e c ie s p e r te rm in a l ta x o n a re g iv e n in p a r e n th e s e s if > 1 .
d o i:1 0 .1 3 7 1 /jo u rn a l.p o n e .0 0 5 9 9 1 7 .g 0 0 1
PLOS ONE I www.plosone.org
2
March 2013 | Volume 8 | Issue 3 | e59917
Phylogeny o f Dalytyphloplanida
Table 1. Traditional classification o f the taxa com prising Dalytyphloplanida.
T y p h l o p l a n o id a
B ressla u, 1 9 3 3
Prom esostom idae Den H artog , 1 964
D a l y e l l io id a B r e s s l a u , 1 9 3 3
D alye lliid a e G raff, 1908
Adenorhynchinae Ax and Heller, 1970
P rovorticidae B eklem ischew, 1927
Brinkmanniellinae Luther, 1948
Neokirgellinae Oswald e t al., 2010
Promesostominae Luther, 1948
Provorticinae Luther, 1962
Gaziella De Clerck and Schockaert, 1995
Haplovejdovskyinae Luther, 1962
Paraproboscifer De Clerck, 1994
Eldenia reducta Ax, 2008
Vauclusia Willems e t a I., 2004
Hypoblepharinidae Böhmig, 1914
T rig o n o sto m id a e G raff, 1905
Luridae S terrer and Rieger, 1990
Mariplanellinae Ax and Heller, 1970
G ra ffillid a e G raff, 1908
Param esostom inae Luther, 1948
Bresslauillinae Bresslau, 1933
Trigonostominae Luther, 1948
Pseudograffillinae Meixner, 1938
T y p h lo p la n id a e G raff, 1905
Graffillinae Graff, 1905
Ascophorinae Findenegg, 1924
P terasterico lid ae M eix n e r, 1 926
Cephalopharynginae Hochberg, 2004
U m a g illid a e W a h l, 1910
M esophaenocorinae Noreña e t al., 2006
Bicladinae Stunkard and Corliss, 1950
M esostominae Bresslau, 1933
Collastominae Wahl, 1910
Olisthanellinae Bresslau, 1933
Umagillinae Wahl, 1910
O pistominae Luther, 1963
Phaenocorinae Wahl, 1910
T e m n o c e p h a l id a
B r essla u a n d
R e is in g e r ,
1 9 3 3
Protoplanellinae Reisinger, 1924
Rhynchom esostominae Bresslau, 1933
Tem noc e p h a lid a e M on ticelli, 1899
Typhloplaninae Bresslau, 1933
D iceratocephalidae Joffe et al., 1998
B yrsoph lebid ae G raff, 1905
D id y m o rch id a e Bresslau and Reisinger, 1933
K yto rh yn ch idae Rieger, 1 974
A ctin o d ac ty le llid a e B enham , 1901
S o len o p h ary n g id a e G raff, 1882
S cutariellidae A n n a n d ale, 1912
Anthopharynginae Ehlers, 1972
Lenopharynginae Ehlers, 1972
Solenopharynginae Ehlers, 1972
C arc h a ro d o p h a ryn g id a e Bresslau, 1933
C ilio p h ary n g iellid ae A x, 1952
doi:10.1371 /journal.pone.0059917.t001
from previous studies [1,7-9] were taken from GenBank and are
also listed in Table SI with their GenBank accession numbers.
Some specimens could not be identified to genus or species level
because either there was not enough material available or they
were new to science and not yet formally described. Nevertheless
we include these taxa in our analyses in order to recover as much
phylogenetic information as possible. T he results o f Willems et al.
[1] showed that Kalyptorhynchia is the sister group of the
Dalytyphloplanida. Therefore Acrorhynchides robustus (Polycystidi­
dae) and Placorhynchus octaculeatus (Placorhynchidae), the only two
kalyptorhynch species for which both IBS rD NA and 28S rDNA
sequences are available, were chosen as outgroup.
limnoterrestrial. All necessary permits were obtained for the
described field studies. Permission for sampling in protected areas
was granted by the governing authorities (Dofiana Biological
Station, D oñana National Park, Spain; Ezemvelo K Z N Wildlife,
iSimangaliso, South Africa; M useum and Art Gallery of the
N orthern Territory, N T , Australia). No specific permits were
required for the described field studies in other locations, which
were not privately owned or protected. T he field studies did not
involve the collection o f endangered or protected species.
M arine and some brackish water animals were collected from
sediment and algae using the M gCL décantation method, while
the oxygen depletion m ethod was deployed to obtain limnic and
brackish water specimens from aquatic vegetation, m ud and
organic material [5]. Lim noterrestrial animals were extracted from
mosses and forest soils with the Baerm ann pan m ethod [6],
Specimens were identified by studying live animals, whole mounts
and stained serial sections. Additional specimens were fixed in
95% ethanol and stored at —20"C until DNA extraction.
Specimen collection and sequence data and GenBank accession
numbers are provided in Table S I. Dalytyphloplanid sequences
PLOS ONE I www.plosone.org
2. DNA extraction a n d am plification
Genomic DNA was extracted from entire specimens using the
QIAamp® DNA M icro Kit with Q IA am p MinElute® columns
(QIAGEN) and following the m anufacturer’s protocol. Extracts
were stored in duplicate (40 and 20 pi) for each specimen.
For most specimens complete IBS rD NA (± 1780-1800 bp) and
partial 28S rD NA (± 1600-1700 bp) gene fragments were
amplified using the primers and P C R protocols listed in Tables 2
3
March 2013 | Volume 8 | Issue 3 | e59917
Phylogeny o f Dalytyphloplanida
and SI. M ost rD NA fragments were easily amplified using the
standard prim er pairs T im A /T im B for the 18S rD NA gene [9]
and L SU 5/LSU D 6.3 for the partial 28S rD NA gene [10] and
their respective standardised P C R protocols. Nevertheless, for a
relatively large num ber of taxa P C R conditions had to be
optimised. This could involve nothing more than increasing the
num ber of PC R cycles to developing new primers (with often a
reduction of the num ber of amplifiable bp as a consequence). In
particular, specimens of Promesostoma, Kaitalugia, some Trigonosto­
midae, Solenopharyngidae and m any marine Dalyellioida could
only be amplified with taxon-specific prim er pairs (Tables 2 and
SI). Amplicons yielded ± 1700 bp for P ro m l8 S F b /P ro m l8 S R b ,
± 1640 bp for N eodall 8S F /N eo d all 8SR, ± 1300 bp for Neodal28SFa/N eodal28SR b and ± 1600 bp for SolenoF l/S olenoR .
M ost P C R reactions were carried out using the 0.2 ml
PuR eT aq Ready-To-G o P C R beads (GE Flealthcare). For each
reaction 2.5 pi of each prim er (5 pM), 3 pi o f DNA and 17 pi of
purified water were assembled in the R T G -P C R tubes to make up
a volume of 25 pi. Some reactions were perform ed in 0.2 ml tubes
using the FlotStar 7fl</®Plus DNA polymerase (QIAGEN) kit. Each
of these reactions contained 2.5 pi dN TPs (2 mM), 2.5 pi P C R
buffer (10 x) with 15 m M M gC l2, 2.5 pi of each prim er (5 pM),
0.25 pi Taq DNA polymerase, 3 pi o f DNA and 11.75 pi purified
water. All P C R reactions were carried out in an E ppendorf
Mastercycler gradient or a Techne TC-5000 thermocycler. P C R
products (5 pi) were verified on a 1.4% agarose gel and stained
with ethidium brom ide or G elR ed™ . Some products were
purified with the QIAquick® P C R Purification K it (QIAGEN)
following the m anufacturer’s instructions, but for most P C R
products, purification was perform ed by M acrogen (Korea). In the
rare cases when multiple bands occurred while checking the P C R
product, the bands corresponding with the target fragment were
excised and purified using the QIAquick® Gel Extraction Kit
(QIAGEN) according to the m anufacturer’s protocol. Sequencing
was done by M acrogen (Korea) using B igD ye™ term inator
cycling conditions. Reaction products were purified with ethanol
precipitation and run with a 3730XL Automatic DNA Sequencer
3730XL.
bootstrap replicates under the G T R +C A T model [18-19]. This
model of evolution is a more workable approxim ation for G T R +T
and recom m ended by the program instead of G T R + T+L The
latter was the most appropriate model of evolution for the
concatenated and 28S dataset as selected in jM odeltest 0.1.1 [17]
by both the Akaike (AIC) and Bayesian (BIC) information criteria.
Although the InL value was better for the G T R +T +I model, AIC
and BIC for the 18S alignment were slighdy more in favour of the
TIM 2+T+I model. Gaps were treated as missing data. Bootstrap
replicates were used to construct majority rule consensus trees and
bootstrap support values (BS) were plotted on best-scoring trees in
SumTrees v2.0.2 of the D endroPy package [20].
Bayesian inferences (Bí) were done in MrBayes v3.1.2 [21]
under the G T R +T +I model (nst = 6; rates = invgamma), using
default prior settings, Metropolis coupled M arkov chain M onte
Carlo sampling with one cold and three heated chains (default;
tem p = 0.2) in two independent simultaneous runs for 10 million
generations. Gaps were treated as missing data. Convergence was
determ ined based on the logL values and the average standard
deviation of split frequencies. Trees were sampled every 100th
generation after a burnin of 2,500,000 generations (burnin = 25,000). Majority rule consensus trees were constructed
from the rem aining 75,000 trees. All Bayesian analyses were
perform ed on the Bioportal at Oslo University [22].
Figtree vl.3.1 [23] was used for tree drawing and displaying
bootstrap support values (BS) and posterior probabilities (PP).
Identical sequences removed pre-analysis were manually reinsert­
ed into the final phylogenetic trees. W e consider BS and PP
significant above a 0.70 and 0.95 threshold respectively, as was
proposed by Alfaro et al. [24].
5. H ypothesis testing
To test alternative hypotheses on the monophyly of some
dalytyphloplanid families, the M L searches in RAxM L as
described above (100 independent runs under the G TR +C A T
model) were repeated with different constrained topologies. These
constrained topologies were subsequendy tested against the
unconstrained M L topologies with the approximately unbiased
(AU) test [25]. Site-wise log-likelihoods were calculated in TreePuzzle v5.2 [26] and processed in Consel vO.li [27] to calculate pvalues for the AU test.
3. A lignm ent a n d d a ta s e t
Before alignment, consensus sequences were assembled from
contigs in Staden v l.6 .0 [11] and subjected to a BLAST search
[12] on the NCBI website (http://w w w .ncbi.nlm .nih.gov) to check
for possible contaminations. Subsequendy, sequences were aligned
with the structural Q TN S-i algorithm in M AFFT [13-14],
M anual editing of the alignments was avoided by selecting and
filtering ambiguous positions with the alignment masking program
Aliscore using the settings described by M isof and M isof [15]. The
5' and 3' alignment ends o f the 18S and 28S rD NA datasets were
trim m ed and subsequently both alignments were concatenated in
Geneious Pro 5.3.4 (Biomatters Ltd). Processed (aligned and
masked) sequences th at were identical, were removed from the
alignments before phylogenetic analysis (Table S2). Final align­
ments were tested for substitution saturation with D AMBE v5.2.57
according to X ia’s m ethod for more than 32 O T U s [16].
Proportions of invariant sites were obtained in jM odeltest vO.1.1
[17] when testing the best fitting substitution model for our
dataset. Saturation tests were perform ed on all sites with gaps
treated as unknown data (Table S3).
6. Ancestral sta te reconstructions
To explore habitat shifts between m arine/brackish water
environments and limnic environments, we followed the proce­
dure of Pagei et al. [28]. Using Acrorhynchides robustus as enforced
outgroup MrBayes v3.1.2. was rerun on the concatenated dataset
with settings and indications o f convergence as in the phylogenetic
analysis proper. MrBayes param eter files (.p) were then analysed
using T racer v l.5 [29] to obtain the LnL integrated autocorre­
lation time (IACT = 202) and effective sampling size (ESS = 371)
[30]. After burnin (25,000), the posterior o f 75,000 trees (.t) was
consequendy “thinned” with Burntrees vO.1.9 [31] by subsam­
pling every 202nd tree to approxim ate the ESS. A majority rule
consensus tree was constructed from the resulting 372 trees in
SumTrees v2.0.2 and com pared to the original consensus tree to
ensure that topology, branch lengths and posterior probabilities
rem ained stable. Acrorhynchides robustus was pruned from all trees in
the thinned tree file with Simmap vl.O [32] because branch
lengths between ingroup and outgroup have been shown to affect
ancestral state reconstructions [33-34],
Ancestral states were reconstructed for 11 well-supported nodes
(PP>0.95) in the 18S+28S phylogeny in BayesTraits vl.O [28].
T he binary traits, “ exclusively or predom inandy m arine/brackish
4. P hylogenetic analyses
M axim um likelihood (ML) analyses were conducted separately
for the three final datasets in RAxM L v7.2.8 perform ing 100
independent runs of thorough searches and 1000 non-param etric
PLOS ONE I www.plosone.org
4
March 2013 | Volume 8 | Issue 3 | e59917
Phylogeny o f Dalytyphloplanida
Table 2. Primers and usage.
Prim ers & Regim e
D irection
Prim er sequence (5 - 3 )
Usage
Reference
TimA
Forward
AMCTGGTTGATCCTGCCAG
PCR/Sequencing
[82]
TimB
Reverse
AGGTGAACCTGCAGATGGATCA
PCR/Sequencing
[82]
S30
Forward
GCTTGTCTCAAAGATTAAGCC
Nested PCR
[82]
5FK
Reverse
TTCTTGGCAAATGCTTTCGC
Nested PCR/Sequencing
[82]
4FB
Forward
CCAGCAGCCGCGGTAATTCCAG
Nested PCR
[82]
1806R
Reverse
CCTTGTTACGACTTTTACTTCCTC
Nested PCR
[82]
PCR regime Tim A/Tim B
DK18S: 95°C a t 5 min 10 s, 30x(94°C a t 30 s, 55°C a t 30 s, 72°C a t 1 min 30 s), 72°C a t 5 min
18S/SSU Prim ers
DK18S35cycli: 95°C a t 5 min 10 s, 35x(94°C a t 30 s, 55°C a t 30 s, 72°C a t 1 min 30 s), 72°C a t 5 min
Prom18SFb
Forward
ACGGTGAGACCGCGAATGGC
PCR/Sequencing
This study
Prom18SRb
Reverse
AACAAGGTTTCCGTAGGTGAACCTGC
PCR/Sequencing
This study
PCR regime Prom18SFb/Prom18SRb
DK18S65: 95°C a t 5 min 10 s, 30x(94°C a t 30 s, 65°C at 30 s, 72°C a t 1 min 30 s), 72°C a t 5 min
Neodal18SF
Forward
TGGTTGATCCTGCCAGTAATGATATGC
PCR/Sequencing
This study
Neodal18SR
Reverse
CGCCCGTCGCTACTACCGATT
PCR/Sequencing
This study
PCR regime Neodal18SF/Neodal18SR
DK18S65: 95°C a t 5 min 10 s, 30x(94°C a t 30 s, 65°C at 30 s, 72°C a t 1 min 30 s), 72°C a t 5 min
600F
Forward
GGTGCCAGCAGCCGCGGT
Sequencing
[1]
600R
Reverse
ACCGCGGCTGCTGGCACC
Sequencing
[1]
11 OOF
Forward
CAGAGGTTCGAAGACGATC
Sequencing
[82]
1100R
Reverse
GATCGTCTTCGAACCTCTG
Sequencing
[82]
18S7F
Forward
GCAATAACAGGTCTGTGATGC
Sequencing
[82]
18S7FK
Reverse
GCATCACAGACCTGTTATTGC
Sequencing
[82]
5F
Forward
GCGAAAGCATTTGCCAAGAA
Sequencing
[82]
7F
Forward
GCAATAACAGGTCTGTGATGC
Sequencing
[82]
7FK
Reverse
GCATCACAGACCTGTTATTGC
Sequencing
[82]
LSU5
Forward
TAGGTCGACCCGCTGAAYTTA
PCR/Sequencing
[10]
LSUD6.3
Reverse
GACTGAAGTGGAGAAGGGTTCC
PCR/Sequencing
[10]
PCR regime LSU5/LSU6.3
DK28S: 95°C a t 5 min 10 s, 30x(94°C a t 1 min, 50°C at 1 min, 72°C a t 1 min 30 s), 72°C a t 5 min
LSUD6.3B
Reverse
PCR regime LSU5/LSU6.3B
DK28S: 95°C a t 5 min 10 s, 30x(94°C a t 1 min, 50°C at 1 min, 72°C a t 1 min 30 s), 72°C a t 5 min
Neodal28SFa
Forward
ACGGCGAGTGAACAGGGAAAAGC
PCR/Sequencing
This study
Neodal28SRb
Reverse
AGACAGCAGGACGGTGGCCA
PCR/Sequencing
This study
PCR regime Neodal28SFa/Neodal28SRb
DK28S65: 95°C a t 5 min 10 s, 30x(94°C a t 1 min, 65°C a t 1 min, 72°C a t 1 min 30 s), 72°C a t 5 min
SolenoFI
Forward
CGGCGAGTGAACAGGAATTAGCCC
PCR/Sequencing
This study
SolenoR
Reverse
AGGCCGATGTGGAGAAGGGT
PCR/Sequencing
This study
PCR regime SolenoFI/SolenoR
DK28S68: 95°C a t 5 min 10 s, 30x(94°C a t 1 min, 68°C a t 1 min, 72°C a t 1 min 30 s), 72°C a t 5 min
L300F
Forward
CAAGTACCGTGAGGGAAAGTTG
Sequencing
[10]
L300R
Reverse
CAACTTTCCCTCACGGTACTTG
Sequencing
[10]
L1200F
Forward
CCCGAAAGATGGTGAACTATGC
Sequencing
[10]
L1200R
Reverse
GCATAGTTCACCATCTTTCGG
Sequencing
[10]
L1600F
Forward
GCAGGACGGTGGCCATGGAAG
Sequencing
[10]
L1600R
Reverse
CTTCCATGGCCACCGTCCTGC
Sequencing
[10]
28S/LSU Primers
DK28S35cycli: 95°C a t 5 min 10 s, 35x(94°C a t 1 min, 50°C a t 1 min, 72°C at 1 min 30 s), 72°C a t 5 min
GAGAAGGGTTCCATGTGAACAGC
PCR/Sequencing
This study
doi:10.1371 /journal, pone.0059917.t002
water (M /B)” and “exclusively or predom inantly lim nic/lim noterrestrial (L /L T )” were treated as habitat states. Each o f the
analysed nodes represents the most recent comm on ancestor
(MRCA) o f a certain num ber of descendants from both m arin e/
brackish water and freshwater habitats. M R C A -M C M C analyses
PLOS ONE I www.plosone.org
were run for each node (AddMRCA) using a multistate model with
two states. A reversible-jump hyperprior approach with an
exponential prior seeded from a uniform distribution between 0
and 30 (rjhp 0 30) was applied to reduce uncertainty and
arbitrariness of prior choice [28], Trial runs allowed to estimate a
5
March 2013 | Volume 8 | Issue 3 | e59917
Phylogeny o f Dalytyphloplanida
value for the rate deviation param eter (rd 8) and to obtain an
acceptance rate between 20—40%. M C M C chains were run for
50.1 million iterations (it 50,100,000) and sampled every 1000
iterations (sa 1000) after a burnin o f 100,000 iterations (bi
100,000). Nodes were subsequendy fossilised (fossil) to test whether
one of the two habitat states is significandy more supported. For
some analyses with fossil priors, rate deviations param eters were
set to 15 (rd 15) to secure acceptance rates between 20-40% . Each
analysis was repeated three times because the harm onic means of
log-likelihoods can be unstable. Bayes factors were used as test
statistics and calculated from the average harm onic means for the
fossilised states [28].
Trigonostomum, Ptychopera, Ceratopera, Beklemischeviella, Proxenetes and
Promesostoma.
T he monophyly o f the freshwater clade, Limnotyphloplanida, is
generally very well supported for all datasets (BS 98-100; PP 1.00)
except for the 28S M L tree (BS 64). W ithin this freshwater clade,
all topologies and support values (BS 98-100; PP 1.00) confirm the
monophyly of three m ajor clades: (a) a clade comprising
Tem nocephalida and the marine Dalyelliidae Jensenia angulata
and Halammovortex sp., (b) a clade comprising all freshwater
Dalyelliidae, and (c) a clade comprising nearly all Typhloplanidae
and Carcharodopharynx sp. (Carcharodopharyngidae). M L and BI
trees o f the concatenated and 18S data point to a clade (BS 76-86;
PP 0.99-1) grouping the Temnoceph'Aidts+Jensenia+Halammovortex
clade and the other Dalyelliidae as the sister clade of the
Typh\op\&mâa.e+Carcharodophaiynx clade (Figs. 2 and SI). For 28S
(Fig. S2), this clade is weakly supported (BS 60; PP 0.88). W ithin
Dalyelliidae, all genera with two or more representatives in this
study (Microdalyellia, Dalyellia, Castrella and all species of Gieysztoria
except for Gieysztoria cf. billabongensis) are monophyletic with high
support values (BS 93-100; PP 0.99-1), bu t their more detailed
relationships rem ain partly unresolved. Only the position of
Gieysztoria cf. billabongensis, which forms a separate clade with an
unidentified species from India, jeopardises the monophyly of
Gieysztoria. Relations within the Typh\op\&mâa.e+Carcharodophaiynx
clade are conflicting and often unresolved. Conversely, the
positions of Acrochordonoposthia conica, Opistomum arsenii and Carchar­
odopharynx as hierarchically nested sister taxa relative to all other
freshwater Typhloplanidae are well-supported in most topologies
(except for the position of 0. arsenii and Carcharodopharynx in the 28S
trees). T he rem aining taxa in the freshwater Typhloplanidae are
either unresolved, paraphyletic or receive various degrees of
support.
T he AU tests rejected the constrained trees forcing the
monophyly o f all “traditional” families th at appear para- and
polyphyletic in our trees (Table 3). Only the AU test of the 28S
tree constrained by monophyly of Byrsophlebidae was not
rejected, possibly because fewer taxa were used in this analysis.
T he results of the ancestral state reconstructions in the 18S+28S
phylogeny are summarised in Table 4 and Fig. 2. Bayes factors
clearly provide statistical support for the expected habitat state of
the most recent comm on ancestor of the analysed clades, i.e.
exclusively or predom inantly m arine/brackish water (M/B) for
Dalytyphloplanida (node 1), Neodalyellida (node 2), Neotyphlo­
planida (node 4), Thalassotyphloplanida s.l. and s.s. (nodes 5 and
6), the Byrsophlebidae+“m arine” Typhloplanidae clade (node 7)
and the “mixed” neodalyellid clade (node 3); exclusively or
predom inantly lim nic/lim noterrestrial (L/LT) for Limnotyphlo­
planida (node 8), Dalyelliidae s.l. (node 9) and Gieysztoria (node 11).
Only for the Temnoceph'Aida.+Jensenia+Halammovortex clade (node
10), the support for the best ancestral state model is average (BF
1.64).
Results
T he com bined dataset initially consisted of 2890 bp for 159
sequences (inch the outgroup); 18S and 28S datasets comprised
1614 bp for 156 sequences and 1276 bp for 125 sequences
respectively. After removing identical sequences (Table S2) from
the initial alignments, the numbers of sequences were 155, 145
and 121 for the combined, 18S and 28S alignments respectively.
T here were no indications of substitution saturation (Table S3).
M L topologies were generally congruent with the BI phylog­
énies, which are shown in Figs. 2, SI and S2. T he concatenated
data yielded better-resolved trees with overall higher support
values than the single gene trees (see Figs. 2, SI and S2).
Dalytyphloplanida consists of two well-supported sister clades:
Neodalyellida and Neotyphloplanida.
All trees provide strong support for three clades within
Neodalyellida: (a) the Æœflre//fl+Solenopharyngidae clade, (b) the
Provorticinae+Umagillidae clade and (c) a “mixed” clade includ­
ing Graffillidae, Pterastericolidae, different provorticid genera
(Canetellia, Baicalellia, Pogaina, Balgetia, Eldenia, Provorticidae sp.) and
some undescribed taxa. Some of the traditional families, i.e.
Solenopharyngidae, Pterastericolidae and Umagillidae, are monophyletic with high support, while Provorticidae and Graffillidae
are polyphyletic.
M ost M L and BI trees (Figs. 2 and S2) support the division of
Neotyphloplanida in two large clades: (a) a m arine clade,
Thalassotyphloplanida s.l. consisting o f K ytorhynchidae, Trigo­
nostomidae, Promesostomidae (except for Einarella argillophyla),
Byrsophlebidae and Gaziella sp. (Promesostomidae), and (b) a
freshwater clade, for which we propose the new nam e Limnotyphloplanida, which is defined as the last comm on ancestor of the
taxa Dalyelliidae, Tem nocephalida, most Typhloplanidae, and all
of the descendants of that comm on ancestor.
T he 28S and 18S+28S (Figs. 2 and S2), but not the 18S trees
(Fig. SI) support Kytorhynchidae as sister taxon to all other
Thalassotyphloplanida s.s. T he position of Gaziella sp. is somewhat
doubtful, yet both the 18S and 18S+28S data (no 28S data
available) suggest it to be the sister taxon of the rem aining
Thalassotyphloplanida s.s. The latter clade consists of a polytomy
of several well-supported clades: (a) a clade with some Promesos­
tom idae (Litucivis, Coronhelmis) and all Trigonostom inae (Trigonos­
tomidae), (b) a clade with Promesostominae (Promesostomidae)
and Paramesostominae (Trigonostomidae), and (c) a clade with
Byrsophlebidae and some peculiar Typhloplanidae (Styloplanella
strongylostomoides, Thalassoplanella collaris, Kaitalugia sp.). T he position
of Brinkmanniella palmata and Kymocarens sp. (both Promesostomidae)
in these clades is uncertain. Anyway, the traditional families
Trigonostomidae, Promesostomidae and Byrsophlebidae are
clearly not monophyletic. Conversely, most trees and support
values support the monophyly of the thalassotyphloplanid genera
represented by two or more species in this study: Coronhelmis,
PLOS ONE I www.plosone.org
Discussion
W ith “ only” 41 dalytyphloplanid 18S rD NA sequences, Will­
ems et al. [1] established a phylogeny of Dalytyphloplanida that
was very different from the traditional classification of rhabdocoels
into “Typhloplanoida”, “Dalyellioida”, Tem nocephalida and
Kalyptorhynchia. These findings invoked im portant questions on
the origin o f the freshwater taxa and the phylogenetic position of
symbiotic dalytyphloplanids. O u r phylogenies and ancestral state
reconstructions suggest that Dalytyphloplanida, Neotyphloplanida
and Thalassotyphloplanida have (eury)haline origins and that
apart from some smaller colonisation events in both Neodalyellida
6
March 2013 | Volume 8 | Issue 3 | e59917
Phylogeny o f Dalytyphloplanida
• Bl p p = 1
▼ 0.95 < Bl p p < 1
A 0.9 0 < Bl p p < 0.95
K y to rh y n c h id a e
Kytorhynchidae sp. 4
- Kytorhynchus sp.
O ML b o o ts tr a p = 100
I s y m b io tic
f r e s h w a te r
□ 85 < ML b o o ts tr a p < 1 0 0
<> 70 < ML b o o ts tr a p < 85
T rig o n o s to m u m
Trigonostomumfranki
Ptychopera plebeia
Ptychopera sp.
Q.
T r ig o n o s to m in a e
—
—
—
fTA
Proxenetesflabellifer
Proxenetes trigonus
Proxenetesfasciger
Proxenetes simplex
Proxenetes karlingi
Proxenetes quadrispinosus
P ro x e n e te s
I P a r a m e s o s to m in a e
P r o m e s o s to m in a e
"“Byrsophlebs delamarei
B y r s o p h le b id a e + m a r in e T y p h lo p la n id a e
NEOTYPHLOPLANIDA
Maehrenthalia agilis
T e m n o c e p h a lid a
Castrella pinguis
— Microdalyellia fitsca
- Microdalyellia armigera (Spain)
• Microdalyellia armigera (Finland
Microdalyellia kupelwieseri
• Microdalyellia nanella
rMicrodalyelliafairchildi
Microdalyellia picta
M ic ro d a ly e llia
i— Dalyelliidae n. gen. n. sp.
*— Gieysztoria cf. billabongens
Gieysztoria knipovic
f r e s h w a te r D aly e lliid ae
Gieysztoria cuspidata (Belgium)
Gieysztoria complicata
a.
G ie y s z to ria
Q.
>»
— Gieysztoria beltrani
|j
Gieysztoria rubra
- Acrochordonoposthia conica
------------Opistomum arsenii
Carcharodopharynx sp.
— Castrada hofmanni
— Krumbachia sp.
fr e s h w a te r T y p h lo p la n id a e + C a rc h a ro d o p h a ry n x
Mesostoma thamagai
Bothromesostoma personatum
Strongylostoma devleescltouweri
- Strongylostoma radiatum
Protoplanella simplex
Adenopharynx mitrabursalis
S o le n o p h a r y n g id a e
NEODALYELLIDA
narella argillophyla
Pogo
Tgetia semicirculifera
Neodalyellida n. gen. n. sp. 2
Wahlia macrostylijera
tritia elegans
■^Amo¡jlodiumjticho£^
U m a g illid ae
O U TG RO U P
PLOS ONE I www.plosone.org
7
March 2013 | Volume 8 | Issue 3 | e59917
Phylogeny o f Dalytyphloplanida
Figure 2. M ajo rity -ru le consensus tre e from th e Bayesian analysis o f the concatenated 18S+28S rD NA dataset. D a ly ty p h lo p la n id a
c o n sis ts o f N e o ty p h lo p la n id a a n d N eo d aly ellid a. S y m b o ls a b o v e th e b ra n c h e s in d ic a te b o o ts tr a p v a lu e s fro m th e ML analysis. No s y m b o ls in d ic a te
s u p p o r t v a lu e s b e lo w th e th re s h o ld s in th e le g e n d . B ra n ch e s h a v e b e e n c o lla p se d w h e n b o th th e p o s te rio r p ro b a b ilitie s a n d b o o ts tr a p s u p p o r t
v a lu e s a re b e lo w th e th re s h o ld s in th e le g e n d . Scale b a rs re p r e s e n t n u m b e rs o f s u b s titu tio n s /s ite . N o d e n u m b e rs c o rre s p o n d w ith th e m o s t re c e n t
c o m m o n a n c e s to rs o f th e a n c e s tra l s ta te re c o n s tru c tio n s .
d o i:1 0 .1 3 7 1 /jo u rn a l.p o n e .0 0 5 9 9 1 7 .g 0 0 2
and Thalassotyphloplanida, one very successful invasion of the
freshwater environm ent by a comm on ancestor of Dalyelliidae,
Typhloplanidae and Tem nocephalida took place. T he analyses
presented here are the first to specifically deal with these issues
using DNA sequence data. In addition, they provide a wealth of
new phylogenetic insights and taxonom ic information.
1. Single e s c a p e from t h e marine en v iro n m en t?
1.1.
event.
Major
radiation
after
a
single
colonisation
Except for the 28S M L topology (BS 64), the monophyly
of Limnotyphloplanida, the clade roughly comprising Dalyelliidae,
most Typhloplanidae and Tem nocephalida, is well-established.
This freshwater clade was already suggested by Jondelius and
Thollesson [2] and Z am paro et al. [35] based on morphological
data. Willems et al. [1] also retrieved these three freshwater clades
within Neotyphloplanida, but could not corroborate limnotyphloplanid monophyly with 18S sequence data. T he present study,
however, strongly suggests a m ajor ecological shift and a
spectacular evolutionary radiation when the comm on ancestor of
Tem nocephalida, Dalyelliidae and Typhloplanidae invaded the
limnic environment. This is supported by the fact that more than
half of the currently known species occur in this environm ent and
the majority of them belong to one of the limnotyphloplanid
genera present in this study.
Dalyelliidae, Typhloplanidae and Tem nocephalidae include
some of the most species-rich rhabdocoel genera (e.g. Gieysztoria,
Castrada, Temnocephala) possibly suggesting evolutionary radiation
took place once freshwater environments were colonised. M any of
these freshwater genera have representatives on all continents and
some species seem to be widespread or even cosmopolitan (e.g.
Mesostoma lingua, Rhynchomesostoma rostratum, Gieysztoria cuspidata). No
less than 53 dalytyphloplanid species, mostly Protoplanellinae
(Typhloplanidae), are limnoterrestrial [36], This is remarkable,
since the limnoterrestrial taxa Acrochordonoposthia, Carcharodopharynx,
Bryoplana, Protoplanella, and Krumbachia form a polyphyletic assem­
blage suggesting multiple independent colonisations of limnoter­
restrial habitats.
1.2.
back?
From marine and brackish water to freshwater and
Surprisingly, our trees suggest several secondary returns
to brackish water and marine habitats within Limnotyphloplanida.
Species of Halammovortex and Jensenia are euryhaline. T hey appear
as possible sister taxa of the limnic temnocephalids, but since many
other dalyelliid genera that might be m ore closely-related to either
T em nocephalida (e.g. Varsoviella and Alexlutheria; see further section
2.1) or Halammovortex and Jensenia have not been included in the
analysis, the origins of symbiosis and a secondary return to
brackish and marine environments rem ain highly speculative in
this clade. In addition, four species o f Gieysztoria exclusively occur
in brackish w ater or marine environments (G. expeditoides, G.
maritima, G. reggae and G. subsalsa; see [37—39]). These species were
not available for this study, but their morphology suggests that
they undoubtedly belong to Gieysztoria. O ther dalyelliid species are
limnic, but occur facultatively in brackish w ater (e.g. M . armigera,
M . firsca, G. cuspidata, G. knipovici, G. triquetra; [39]). Similar
examples o f limnic species that may also inhabit brackish water
of up to 5%o, can be found within the limnic Typhloplanidae (e.g.
Castrada hofmanni, C. intermedia, C. lanceola, Mesostoma lingua,
Strongylostoma elongatum and Typhloplana viridata) [39,40], This
Table 3. p-values o f the AU tests In Consel v0.1l.
suggests that recolonisation of brackish habitats may be relatively
Trees
18S+28S
18S
28S
Constrained monophyly
Byrsophlebidae
0.002
4e~04
0.738
Optimal ML tree
Table 4. Ancestral state reconstruction using BayesTralts
v3.1.2.
0.998
1.000
0.262
Constrained monophyly Dalyelliidae2e-06
1e-04
2e-96
Optimal ML tree
1.000
1.000
1.000
Constrained monophyly
Promesostomidae
2e-10
5e-54
0.003
Optimal ML tree
1.000
1.000
0.997
Constrained monophyly
Provorticidae
6e-07
0.006
2e-28
N ode (mrca)
Best m odel
BF
S up port fo r best m odel
1
M/B
6,88
strong
2
M/B
12,67
very strong
3
M/B
12,70
very strong
4
M/B
7,17
strong
5
M/B
9,83
strong
6
M/B
12,63
very strong
Optimal ML tree
1.000
0.994
1.000
7
M/B
11,38
very strong
Constrained monophyly
Trigonostomidae
3e-05
6e-06
0.003
8
L/LT
2,16
positive
9
L/LT
2,37
positive
Optimal ML tree
1.000
1.000
0.997
10
M/B
1,64
average
Constrained monophyly
Typhloplanidae
3e-67
3e-06
1e-05
11
L/LT
28,71
very strong
Optimal ML tree
1.000
1.000
1.000
Constrained monophyly
Brinkmanniellinae
3e-132
2e-05
0.065
Optimal ML tree
1.000
1.000
0.935
doi:10.1371 /journal.pone.0059917.t003
PLOS ONE I www.plosone.org
Habitat states are categorised as marine/brackish w ater (M/B) or limnic/
limnoterrestrial (L/LT). Analysed nodes representing most recent common
ancestors (MRCA) are visualised in Fig. 2. Bayes Factors (BF) w ere calculated
with the harmonic means (HM) of the fossilised states: BF = 2*(HMbest model
—HMworse model)- Support for the best model is described as "average" (BF>0),
"positive" (BF>2), "strong" (BF>5) or "very strong" (BF>10).
doi:10.1371 /journal.pone.0059917.t004
March 2013 | Volume 8 | Issue 3 | e59917
Phylogeny o f Dalytyphloplanida
easy and may have occurred independendy in different clades.
1.3.
F re s h w a te r in v a sio n s b y th a la s s o ty p h lo p la n id s a n d
n e o d a ly e llid s. In addition to the single-origin freshwater
colonisation of the Limnotyphloplanida, independent shifts from
marine to limnic environments also occurred within Thalasso­
typhloplanida and Neodalyellida. Many, predom inantly marine
genera in these clades have obligate or facultative brackish water
representatives (Thalassotyphloplanida: Beklemischeviella, Brinkman­
tentatively confirmed by Ehlers [49], Jondelius and Thollesson [2]
and Z am paro et al. [35]. Ehlers and Sopott-Ehlers [50] also
supported this point o f view based on stylet morphology and the
ultrastructural synapomorphies a í Jensenia and the temnocephalids
(duo-gland adhesive system and lamellated rhabdites). Although
very different life strategies have been adopted by the free-living
Dalyelliidae and by the ectosymbiotic Tem nocephalida, the
position of Tem nocephalida within Dalyelliidae is plausible
niella, Byrsophlebs, Coronhelmis, Maehrenthalia, Promesostoma, Proxenetes,
considering the very similar internal morphology of both taxa.
Ptychopera, Thalassoplanella, Trigonostomum', Neodalyellida: Baicalellia,
As such, the tem nocephalid genus Didymorchis has even been linked
Balgetia, Bresslauilla, Canetellia, Pogaina, Provortex, Pseudograffilla,
to either Dalyelliidae or Tem nocephalida, b u t cladistical analyses
Vejdovskya; [39,40]), b u t only few have become limnic (see [41]
of morphological data and ultrastructural studies on the epidermis
for an overview). T he sole hollimnic thalassotyphloplanid is
confirms that it belongs to Tem nocephalida [51,52]. This
Styloplanella strongylostomoides, a species apparently confined to
tem nocephalid relationship is fully supported by our DNA data.
alpino-boreal bogs. Although only 18S data were available for
Several morphological synapomorphies have been defined for
this taxon, Bayesian analyses support it as a m em ber of the
Tem nocephalida, including a multisyncytial epidermis, a posterior
Byrsophlebidae+(marine) Typhloplanidae clade (PP 1.0). Findeadhesive organ, genito-intestinal com m unication and a split shaft
negg [42] already stressed its problem atic position within
o f sperm cells [51,53].
Typhloplaninae and even expressed doubts on its position within
2.2. P te ra s te ric o lid a e . Pterastericolidae are parasites of
Typhloplanidae. T he presence of a stylet and the species’ overall
starfish, which have been linked to different dalyellioid groups
morphology is similar to that o f other marine Typhloplanidae,
and even to N eoderm ata (see [2] and references therein, [54-56]).
suggesting a phylogenetic reassessment o f the other marine
T he latter hypothesis was, however, rejected by DNA sequence
representatives of this taxon is needed.
data [57] and different ultrastructural characters (spermiogenesis,
Obligate limnic neodalyellids are very rare. W e included an
sperm, protonephridia; see [58] and references therein). O ne
unidentified species of Provorticidae (Provorticidae sp.) from
pterastericolid species was included in the analyses of Willems et
Hawaiian freshwater ponds, with a morphology that was
al. [1], which showed it to be firmly em bedded within
somewhat reminiscent of the poorly-described Provortex sphagnorum.
Neodalyellida as the sister taxon of the endosymbiotic graffillid
Some m arine and euryhaline neodalyellid species have also been
Grcffilla buccinicola. O u r data confirm its position within Neoda­
found in limnic habitats. For Bresslauilla relicta many inland records
lyellida and also suggest that pterastericolids are closely related to
from freshwater habitats are known [39,43], while the euryhaline
some neokirgelline provorticids (Canetellia, Baicalellia) and some
Vejdovskya ignava and Coronhelmis multispinosus locally invade the
graffillids (Graffilla, Pseudograffilla).
limnic zones of the Elbe estuary [39,44,45]. Several hypotheses on
2.3. G ra ffillid a e . This family is a polyphyletic amalgam of
how these colonisations may have taken place, were tentatively
endosymbiotic and free-living species. Grcffilla buccinicola lives in
suggested by Kolasa [41], Euryhaline habitats such as estuaries,
the digestive glands of carnivorous gastropods. It predom inantly
old land-locked seawater basins and salt marches could have acted
feeds on its host’s partly-digested food and almost entirely depends
as stepping stones between m arine and limnic habitats. Possibly
on its host’s digestive enzymes [59]. Pseudograffilla arenicola and a yet
Bresslauilla relicta and the limnic provorticid from Hawaii, which
unidentified m arine dalyellioid species (.Dalyellioida “houdini” sp.),
are both closely related to m any neokirgelline taxa that are
both free-living, emerge as the sister taxa of G. buccinicola in our
euryhaline (Baicalellia brevituba, Balgetia semicirculifera, Canetellia
topologies. Pseudogrcffilla is known to be microphagous rather than
beauchampi) or exclusively known from salt marshes (Eldenia reducta),
predatory, while for Dalyellioida “ houdini” sp. stylets of other
fit into this hypothesis.
rhabdocoels were am ong its gut contents (Willems, unpublished
observations). T he fact th at Dalyellioida “houdini” sp. is related to
2. Symbiosis
G. buccinicola and P. arenicola opens interesting perspectives for
Symbiotic taxa are scattered throughout several clades in our
future research on the evolution of nutritional strategies in this
trees, confirming previous findings that symbiotic life strategies
group [60].
have evolved multiple times independendy in both marine and
2.4. U m a g illid a e . Umagillidae is the most species-rich taxon
freshwater dalytyphloplanids [1,2]. Ecological and evolutionary
of symbiotic non-neoderm atan flatworms [61,62]. Umagillids are
triggers for the origins of symbiotic relations and the transition
comm on endosymbionts o f echinoderms, with few species also
from facultative commensalism to obligate parasitism are far from
living inside sipunculids. They demonstrate a wide variety of
clear in non-neoderm atan flatworms in general and dalytyphlo­
feeding behaviours, ranging from endozoic predation of symbiotic
planids in particular (for an interesting hypothesis see [46]).
protozoans to full endoparasitic feeding on its host’s tissues. Little
2.1.
T e m n o c e p h a lid a . Tem nocephalida, ectosymbionts of
in-depth information (e.g. physiology, host specificity, nutritional
various freshwater invertebrates and chelonians, display nearly all
preferences) is available about life history strategies of umagillids.
interm ediate steps of transition from commensalism to parasitism.
M ost species, including species of Seritia and Wahlia are intestinal,
As corroborated by our phylogenies, tem nocephalids are in fact
while species of Anoplodium are confined to the coelomic regions of
ectosymbiotic dalyelliids.
its host. C annon [61] suggests that species a í Anoplodium must have
T he phylogenetic position of Tem nocephalida has always been
been derived from intestinal inhabiting forms. W ith only three
controversial. Various studies linking them to N eoderm ata have
umagillid taxa represented in this study, none o f these hypotheses
later been rejected (see [47] and references therein). A close
could be corroborated. Yet, the phylogenetic position of
relationship between Dalyelliidae and Tem nocephalida was
Umagillidae confirms that symbiotic relations in marine rhabdo­
suggested by K arling [48], who proposed the stylet morphology
coels originated multiple times independendy involving different
of Alexlutheria as an ancestral “tem plate” for the Tem nocephalida
nutritional strategies that eventually led to full endoparasitism in
in general and for Didymorchis in particular. Later, a sister group
some clades.
relation between free-living Dalyelliidae and Tem nocephalida was
PLOS ONE I www.plosone.org
9
March 2013 | Volume 8 | Issue 3 | e59917
Phylogeny o f Dalytyphloplanida
3. T axonom ic implications
O ur phylogenetic inferences have im portant implications for the
taxonom y of rhabdocoels in general and of Dalytyphloplanida in
particular. T he addition of new taxa and a second gene fragment
(28S rDNA) in this study com pared to th at of Willems et al. [1],
largely confirms the new clades by Willems et al. [1], i.e.
Neotyphloplanida, Neodalyellida and Thalassotyphloplanida. The
monophyly of taxa that have long been regarded as such based on
morphology (Dalyelliidae, Umagillidae, Pterastericolidae, T em no­
cephalida, K ytorhynchidae, Solenopharyngidae), is firmly sup­
ported by our DNA sequence data, while many of the uncertain
taxa (Graffillidae, Provorticidae, Promesostomidae, Trigonostom i­
dae, Typhloplanidae, Byrsophlebidae; see [2] for a morphological
overview) are clearly not monophyletic in our trees. The division
of Dalytyphloplanida in Neodalyellida and Neotyphloplanida is
well-supported.
3.1.
N e o d aly ellid a. T he Einarella+Trisaccopharynx, Anoplodium+Provortex and Graffilla+Pterastericola clades suggested by Will­
ems et al. [1], are confirmed and extended in the present analysis.
T he position of the promesostomid Einarella argillophyla as the sister
group of Solenopharyngidae is one of the several indications of the
polyphyly of Promesostomidae, of which other representatives are
scattered throughout Thalassotyphloplanida (see below). Soleno­
pharyngidae has been well diagnosed by Ehlers [63] and is likely
monophyletic. However, our analysis included species of only one
of the three recognised subfamilies (Solenopharynginae), except for
Solenopharyngidae sp., which could not be placed in any subfamily
because of a lack of data.
Provorticidae and Graffillidae are clearly not monophyletic,
since species belonging to these families are scattered over the two
other m ajor neodalyellid clades. As some authors pointed out, the
monophyly of Provorticidae is not supported by morphological
synapomorphies [64,65]. M oreover, the taxonomic mixing of
Provorticidae and Graffillidae is not surprising, since both taxa
were originally regarded as subfamilies o f a single family that was
first nam ed Graffillidae, and later on Provorticidae [66-68]. The
present taxonomic separation into Graffillidae and Provorticidae is
solely based on the position o f the gonopore [68,69], a character
considered of poor phylogenetic value by K arling [48,70]. Two
peculiar sister taxa of the “mixed” clade (see results), Neodalyellida
sp. 1 and Neodalyellida sp. 2 could not be placed in any of the
existing families. T heir overall morphology suggests that they
belong to one of the marine dalyellioid clades, b u t the presence of
an anterior male copulatory organ with a stylet is a unique feature
within dalytyphloplanids. O nly graffillids also have a male
copulatory organ in the anterior body half, though w ithout a
stylet. T he provorticid Eldenia reducta is closely related to the freeliving graffillid Bresslauilla relicta. However, Eldenia reducta has a
caudal stylet accom panied by an accessory stylet, a feature th at is
unique within Provorticidae. The other well-delined taxa within
the “mixed” clade, Baicalellia, Balgetia, Canetellia and Pogaina, are
phylogenetically closely related. Traditionally they are grouped
within Neokirgellinae, which is clearly not monophyletic because
of the position of the Pterastericolidae.
Provorticinae (Provortex, Vejdovskya) is well-separated from the
Neokirgellinae in our trees. This separation is also supported by
morphology based on the relative position o f prostate and seminal
vesicle [70,71]. T he close relation between Provortex and Vejdovskya,
the only difference being separate ovaries and vitellaria in Provortex
as opposed to ovovitellaria in Vejdovskya, was already suggested by
Luther [72] and M arcus [68] and is confirmed in our 18S and
combined trees (no 28S sequences of Provortex available), though in
a polytomy with the endosymbiotic Umagillidae in the concate­
nated analysis. O nly one umagillid species (Anoplodium stichopi) was
PLOS ONE I www.plosone.org
10
included in the study o f Willems et al. [1], where it appeared as the
sister taxon of Provortex. T he close relationship of umagillids with
Provorticinae was already discussed in K arling [48] and is now
firmly supported by our molecular phylogenies.
3.2. T h a la s s o ty p h lo p la n id a . T he 28S and combined data
suggest that K ytorhynchidae is the sister taxon of all other
thalassotyphloplanids. K ytorhynchidae have a glandular “false”
proboscis derived from a perm anent anterior term inal invagina­
tion of the body wall. T he differentiation o f the anterior tip into a
proboscis-like structure is a feature they share with some other
“typhloplanoids” (e.g. Trigonostomum, Astrotorhynchus, Microvahine,
Rhynchomesostoma, Adenorhynchus, Elaplorhynchella, Microcalyptorhynchus,
Prorhynchella, Pararhynchella; [73-75]). T he presence of a proper
muscular proboscis is typical of K alyptorhynchia. Based on
“proboscis” structure and other morphological data, Rieger [75]
placed Kytorhynchidae within the non-kalyptorhynch rhabdo­
coels. T he present phylogenetic study confirms th at kytorhynchids
are indeed not kalyptorhynchs, b u t dalytyphloplanids.
T he internal relationships of Thalassotyphloplanida show that
many o f the traditional marine typhloplanoid genera (Trigonosto­
mum, Promesostoma, Proxenetes, Ceratopera) and subfamilies (Prome­
sostominae, Paramesostominae, Trigonostominae) are monophy­
letic, but that the two largest traditional families are not. Indeed,
both Trigonostom idae and Promesostomidae appear to be
polyphyletic. In the cladogram, Trigonostomidae is represented
by two clades: Trigonostom inae, sistergroup to a clade consisting
of the prom esostomid taxa Litucivis (Adenorhynchinae) and
Cilionema and Coronhelmis (Brinkmanniellinae), and Paramesosto­
minae, which forms a well-supported sistergroup relationship with
Promesostoma (Promesostominae, Promesostomidae). This Param esostomina e+Promesostoma clade is p art o f a larger unresolved clade
containing am ong others Brinkmanniella palmata (Brinkmanniellinae,
Promesostomidae), clearly showing the polyphyletic nature of the
taxon Promesostomidae, a m em ber of which is even found within
Neodalyellida (Einarella argillophyla, see above). A nother clade
within the polytomy is formed by species o f Byrsophlebidae, a
num ber of marine Typhloplanidae and one freshwater typhloplanid, Styloplanella strongylostomoides. Both Typhloplanidae and By­
rsophlebidae share the presence of one single ovary, but species of
Byrsophlebidae have separate male and female genital pores,
whereas species o f Typhloplanidae have a comm on genital pore.
Species of Typhloplanidae are nearly all limnic, but some,
including Thalassoplanella and Kaitalugia, occur in brackish water
and marine environments. Although Luther [76] classified
Thalassoplanella into Typhloplanidae, he firmly expressed his
reluctance to do so because o f certain morphological features
(e.g. the presence of a reduced second ovary). A similar situation
applies to Kaitalugia, which Willems et al. [77] considered to be
very closely related to Thalassoplanella. In addition, many authors
[75,78-81] state that the taxonomic position o f other marine
typhloplanid genera is doubtful (e.g. Haloplanella, Gullmariella,
Notomonoophorum, Thalassoplanina, Tauridella, Lioniella, Ruanis, Stygo­
planellina, Pratoplana, Magnetia, and Haplodidymos). W ith the presence
of a stylet in the male genital system (unusual for Typhloplanidae)
most of these brackish water and marine taxa appear similar to
Byrsophlebidae, except that Byrsophlebidae have separate male
and female genital pores.
This clearly shows that the higher-level phylogeny (i.e. above
genus) of the taxa in question is highly in need of revision, which
was already discussed by K arling et al. [73] and many of the
above-m entioned authors (e.g. [75]).
3.3. L rn m o ty p h lo p la n id a . The limnic dalyelliid genera
Castrella, Dalyellia, Microdalyellia, and Gieysztoria are confirmed as
clades. Only the Australian G. cf. billabongensis is positioned outside
March 2013 | Volume 8 | Issue 3 | e59917
Phylogeny o f Dalytyphloplanida
Gieysztoria. This species forms a separate clade with Dalyelliidae n.
gen. n. sp., a yet unidentified species from India. Irrespective of
whether or not this Indian taxon is the same as the Australian one,
it is clear that based on our molecular data, both taxa are not part
of the Gieysztoria clade. In general, intergeneric dalyelliid relations
are far from clear, illustrated by the conflicting or unresolved
position of several genera (e.g. Castrella, Dalyellia, Microdalyellia,
Pseudodalyellia, Gieysztoria) in the 18S and 28S trees.
T a b le S I L is t o f s p e c ie s , s a m p li n g lo c a tio n s a n d
a m p lif ic a tio n p r i m e r s a s u s e d in th i s s tu d y . Additional
sequences that were taken from GenBank are also listed with their
GenBank accession num ber and when known, their sampling
location. M: marine; F: freshwater; B: brackish water; L:
limnoterrestrial; S: symbiotic.
(DOC)
T a b le S2
ses.
(DOC)
Conclusions
O ur phylogenies clearly show that: (a) dalytyphloplanids have
their origins in the marine environment, (b) colonisation of a wide
range of limnic and limnoterrestrial habitats took place when the
comm on ancestor o f all species of Lim notyphloplanida (compris­
ing all Dalyelliidae, Tem nocephalida, and nearly all limnic
Typhloplanidae) escaped its marine environment; (c) this coloni­
sation was followed by a spectacular radiation, resulting in speciose
genera of Limnotyphloplanida, (d) some thalassotyphloplanids and
neodalyellids also invaded limnic environments, though very
sporadically and not followed by spéciation events as in Lim no­
typhloplanida; (e) secondary returns to brackish water and marine
environments occurred relatively frequently in several dalyelliid and
typhloplanid taxa; (f) some well-diagnosed rhabdocoel families or
subfamilies are monophyletic (freshwater Dalyelliidae, Umagillidae,
Pterastericolidae, Temnocephalida, Solenopharyngidae, Trigonos­
tominae, Paramesostominae, Promesostominae), while others are
clearly polyphyletic (Graffillidae, Provorticidae, Promesostomidae,
Trigonostomidae, Typhloplanidae, Byrsophlebidae); (g) K ytor­
hynchidae, an enigmatic “typhloplanoid” taxon, is most likely the
sister taxon to all other thalassotyphloplanids; (h) Carcharodopharynx
can be assigned to Typhloplanidae.
Although m any new dalytyphloplanid clades can be formally
recognised based on this molecular phylogeny, we provisionally
refrain from erecting a new formal (DNA-based) classification. We
believe that this should ideally be backed up by thorough
morphological studies in which clear (syn)apomorphies for each
newly-established clade are delineated.
I d e n t ic a l s e q u e n c e s re m o v e d f r o m th e a n a ly ­
T a b le S3 T e s t o f s u b s tit u ti o n s a t u r a t i o n w ith D A M B E
v 5 .2 .5 7 a c c o r d in g to X ia ’s m e t h o d f o r m o r e t h a n 32
O T U s . Analyses perform ed on all sites with gaps treated as
unknown data. Subsets o f 4, 8, 16 and 32 O T U s were random ly
sampled 60 times and the test was perform ed for each subset. Iss:
simple index of substitution saturation; Iss,cSym: critical Iss
assuming a symmetrical topology; Iss,cAsym: critical Iss assuming
an asymmetrical topology. If Iss is significantly smaller than Iss,c,
little substitution saturation is present. Although Iss(18S+28S) does
not significantly differ from Iss,cAsym(18S+28S), asymetrica! trees
are highly unlikely for our datasets.
(DOC)
Acknowledgments
W e would like to thank the following people, organisations and institutions
for their invaluable support an d contribution to this study by providing
specimens or hosting (some of) the authors during sampling campaigns:
M arco C urini-G alletti (Universitá di Sassari, Italy), P aul D avison
(University of N orth Alabam a, USA), M ark M artindale an d Elaine Seaver
(University o f H aw ai’i a t M anoa, USA), Ju re k K olasa (M cM aster
University, Canada), the D oriana Biological Station and Spanish N ational
R esearch Council, Philippe Jo u k (Royal Zoological Society o f Antwerp,
Belgium), N athalie Revis (Hassek University, Belgium), C hristopher
L aum er (H arvard University, USA), Chris Glasby (Museum and A rt
Gallery o f the N orthern Territory, Australia) and Ricky Taylor and S’Bu
M feka (Ezemvelo K Z N Wildlife, South Africa); R ajeev Rhaghavan (St.
A lbert’s College, K ochi, India) for facilitating the sam pling cam paign in
India; Sven Boström (Swedish M useum o f N atural History, Sweden) for
p u n ctu ally pro v id in g us w ith type m aterial for com p ariso n an d
identification purposes. Finally, we would like to thank the three reviewers
for their helpful and valuable comm ents to improve this manuscript.
Supporting Inform ation
F ig u re SI M a jo r ity - r u le c o n s e n s u s t r e e f r o m th e B a y e s­
ia n a n a ly s is o f th e 18S rD N A d a t a s e t . Legend identical to
Fig. 2.
(TIF)
Author Contributions
Conceived an d designed the experiments: NVS TA. Perform ed the
experiments: NVS BT W W UJ TA. Analyzed the data: N VS TA.
C ontributed reagents/m aterials/analysis tools: NVS BT W W U J TA.
W rote the paper: NVS TB TA.
F ig u re S2 M a jo r ity - r u le c o n s e n s u s t r e e f r o m th e B a y e s­
ia n a n a ly s is o f th e 28S rD N A d a t a s e t . Legend identical to
Fig. 2.
(TIF)
References
1. W illem s W R , W a llb e rg A , J o n d e liu s U , L itd e w o o d D T J , B ack eljau T , e t al.
(2006) F illin g a g a p in th e p h y lo g e n y o f fla tw o rm s: rela tio n s h ip s w ith in th e
R h a b d o c o e la {P laty h elm in th es), in fe rre d f ro m 18S rib o s o m a l D N A se q u en c e s.
6.
T o w n s h e n d J L (1963) A m o d ific a tio n a n d e v a lu a tio n o f th e a p p a ra tu s fo r th e
O o s te n b rin k d ire c t c o tto n w o o l filter e x tra c tio n m e th o d . N e m a to lo g ic a 9: 106—
Z o o l S er 35: 1 -1 7 .
2. J o n d e liu s U , T h o lle s s o n M (1993) P h y lo g e n y o f th e R h a b d o c o e la (P la ty h e lm in ­
7.
L itd e w o o d D T J? R o h d e K , C lo u g h K A (1999a) T h e in te rre la d o n s h ip s o f all
m a jo r g ro u p s o f P la ty h e lm in th e s : p h y lo g e n e tic e v id e n c e fro m m o rp h o lo g y a n d
m o lecu les. B i o lJ L in n S o c L o n d 66: 75—114.
3. W illem s W R (2005) T h e p h y lo g e n y o f th e ‘T y p h lo p la n o id a ’ (P la ty h e lm in th e s)
in fe rre d fro m 18S rib o s o m a l D N A se q u en c e s. P h .D . D is s e rta tio n , L im b u rg s
U n iv e rs ita ir C e n tru m , D ie p e n b e e k , 67 p . + 7 a p p e n d ic e s.
8.
L itd e w o o d D T J? R o h d e K , B ra y R A , H e r n io u E A (1999b) P h y lo g e n y o f th e
P la ty h e lm in th e s a n d th e e v o lu tio n o f p a ra sitism . B i o lJ L in n So c L o n d 68: 257—
287.
4.
9. N o r é n M , J o n d e liu s U (2002) T h e p h y lo g e n e tic p o s itio n o f t h e P ro le c ith o p h o ra
110.
thes): a w o rk in g h y p o th esis. C a n J Z o o l 71: 29 8 —308.
5.
S c h o c k a e rt E R , H o o g e M , Sluys R , S c h illin g S, T y le r S, e t al. (2008) G lo b a l
d iv ersity o f fre e -liv in g fla tw o rm s (P la ty h e lm in th e s, “ T u r b e lla ria ” ) in fre sh w a te r.
H y d ro b io lo g ia 595: 4 1 M 8 .
10.
S c h o c k a e rt E R (1996) T u r b e lla ria n s. In : H a ii G S , e d ito r. M e th o d s fo r th e
e x a m in a tio n o f o rg a n is m a l d iv ersity in soils a n d se d im e n ts. W a llin fo rd : C A B
I n te r n a d o n a l. p p . 2 2 1 -2 2 6 .
PLOS ONE I www.plosone.org
11.
11
( R h a b d ito p h o r a , ‘P la ty h e lm in th e s ’). Z o o l S er 31: 4 0 3 M 4 4 .
L itd e w o o d D T J) C u r in i-G a lle tti M , H e r n io u E A (2000) T h e in te rre la tio n sh ip s o f
P ro s e ria ta (P la ty h e lm in th e s: S e rata ) te s te d w ith m o le c u le s a n d m o rp h o lo g y . M o l
P h y lo g e n e t E v o l 16: 4 4 9 M 6 6 .
S ta d e n R (1996) T h e S ta d e n s e q u e n c e an aly sis p a c k ag e . M o l B io te c h n o l 5: 233—
241.
March 2013 | Volume 8 | Issue 3 | e59917
Phylogeny o f Dalytyphloplanida
12. A ltsc h u l S F, G is h W , M ille r W , M y e rs E W , L ip m a n D J (1990) B asic lo cal
a lig n m e n t s e a rc h tool. J M o l B iol 215: 4 0 3 -4 1 0 .
13. K a to h K , T o h H (2 0 0 8 a) Im p r o v e d a c c u ra c y o f m u ltip le n c R N A a lig n m e n t b y
in c o r p o r a tin g s tru c tu ra l in fo rm a tio n in to M A F F T -b a s e d fra m e w o rk . B M C
45.
B io in fo rm a tic s 9: 212.
K a to h K , T o h H (2008b) R e c e n t d e v e lo p m e n ts in th e M A F F T m u ltip le
s e q u e n c e a lig n m e n t p ro g ra m . B rie f B io in fo rm 9: 2 8 6 —298.
47.
M is o f B, M is o f K (2009) A M o n te C a rlo a p p ro a c h successfully id en tifies
ra n d o m n e s s in m u ltip le s e q u e n c e a lig n m en ts: a m o re o b jec tiv e m e a n s o f d a ta
e xclusion. Syst B iol 58: 2 1 -3 4 .
X ia X , L e m e y P (2009) A ssessing s u b s titu tio n s a tu r a tio n w ith D A M B E . In:
L e m e y P , S a l e m i M , V a n d a m m e A - M , e d it o r s . T h e p h y l o g e n e t i c
h a n d b o o k : a p ra c tic a l a p p ro a c h to D N A a n d p r o te in p h y lo g e n y , 2nd e d itio n .
C a m b rid g e U n iv e rs ity Press, p p . 6 1 5 —6 3 0 .
P o s a d a D (2008) jM o d e lte s t: p h y lo g e n e tic m o d e l a v e ra g in g . M o l B iol E v o l 25:
1 2 5 3 -1 2 5 6 .
S ta m a ta k is A (2006) P h y lo g e n e tic m o d els o f r a te h e te ro g e n e ity : A h ig h
p e rf o r m a n c e c o m p u tin g p e rsp e c tiv e . P ro c e e d in g s o f 2 0 th I E E E / A C M I n te r n a ­
tio n a l p a ra lle l a n d d is tr ib u te d p ro c e s s in g s y m p o s iu m , F lig h p e rf o r m a n c e
c o m p u ta tio n a l b io lo g y w o rk sh o p (P ro c e e d in g s o n C D . R h o d o s , G re e c e 2006.
S ta m a ta k is A (2006) R A x M L -V I-H P C : m a x im u m lik e lih o o d -b a se d p h y lo g e n e tic
an aly ses w ith th o u sa n d s o f ta x a a n d m ix e d m o d els. B io in fo rm a tic s 22: 2 6 8 8 —
2690.
S u k u m a r a n J , F lo ld e r M T (2010) D e n d ro P y : A P y th o n lib ra ry fo r p h y lo g e n e tic
c o m p u tin g . B io in fo rm a tic s 26: 1569—1571.
R o n q u is t F , H u e ls e n b e c k J P (2003) M R B A Y E S 3: B a y e sia n p h y lo g e n e d c
in fe re n c e u n d e r m ix e d m o d els. B io in fo rm a tic s 19: 1572—1574.
K u m a r S, S k jæ v e la n d Á , O r r B JS , E n g e r P , R ü d e n T , e t al. (2009) A IR : A
b a tc h - o rie n te d w e b p r o g ra m p a c k a g e fo r c o n s tru c tio n o f su p e rm a tric e s r e a d y fo r
48.
14.
15.
16.
17.
18.
19.
20.
21.
22.
46.
25.
26.
27.
28.
29.
30.
31.
32.
33.
34.
49.
E h le rs U (1985) D a s p h y lo g e n e tis c h e S y stem d e r P la th e lm in th e s . S tu ttg a rt:
G u sta v F is c h e r V e rla g . 31 7 p .
50.
E h le rs U , S o p o tt-E h le rs B (1993) T h e c a u d a l d u o -g la n d a d h e siv e system o f
Jensenia angulata (P la th e lm in th e s, D aly elliid ae): u ltr a s tr u c tu r e a n d p h y lo g e n e d c
s ig n ifican ce (W ith c o m m e n ts o n th e p h y lo g e n e tic p o s itio n o f th e T e m n o c e p h a ­
lid a a n d th e p o ly p h y ly o f th e C e rc o m e ria ). M ic ro fa u n a M a r 8: 6 5 —76.
52.
D a m b o re n e a M C , C a n n o n L R G (2001) T h e m o sa ic o f th e e p id e rm a l sy n c y d a in
Didymorchis sp. (D id y m o r c h id a e , T e m n o c e p h a lid a ) f ro m S o u th A m e ric a .
B elg J Z o o l 31: 1 6 7 -1 7 1 .
53.
W a ts o n N A (2001) In sig h ts fro m c o m p a r a d v e sp e rm a to lo g y in th e ‘tu rb e lla r ia n ’
R h a b d o c o e la . In : L itd e w o o d D T J , B ra y R A , ed ito rs. In te rre la d o n s h ip s o f th e
54.
P la ty h e lm in th e s . L o n d o n : T a y lo r a n d F ra n cis, p p . 21 7 —230.
C a n n o n L R G (1986) T h e P te ra s te ric o lid a e : P a ra s itic T u r b e lla ria n s fro m
S tarfish . In: C r e m in C , D o b s o n C , M o o re h o u s e D E , e d ito rs. P a ra s ite Lives.
St. L u cia: U n iv e rsity o f Q u e e n s la n d Press, p p . 15—32.
55. J o n d e liu s U (1 9 9 2 a) N e w Pterastericola sp ecies (P la ty h e lm in th e s, R h a b d o c o e la )
a n d a cla d istic an aly sis o f th e P te ra s te ric o lid a e . Z o o l S er 21: 9 3 —101.
56. J o n d e liu s U (1992b) S p e rm m o rp h o lo g y in th e P te ra s te ric o lid a e (P la ty h e lm in ­
57.
2011 A ug.
A lfaro M E , Z o lle r S, L u tz o n i F (2003) B ay es o r b o o tstra p ? A sim u la tio n s tu d y
c o m p a r in g th e p e rf o r m a n c e o f B a y e sia n M a rk o v c h a in M o n te C a rlo s a m p lin g
a n d b o o ts tr a p p in g in assessin g p h y lo g e n e tic c o n fid e n c e. M o l B iol E v o l 20: 2 55—
266.
S h im o d a ira H (2002) A n a p p ro x im a te ly u n b ia s e d test o f p h y lo g e n e tic tre e
se le c tio n . S yst B iol 51: 4 9 2 - 5 0 8 .
S c h m id t H A , S trim m e r K , V in g ro n M , v o n H a e s e le r A (2002) T R E E - P U Z Z L E :
m a x im u m lik e lih o o d p h y lo g e n e tic an aly sis u sin g q u a rte ts a n d p a ra lle l c o m p u t­
ing. B io in fo rm a tic s 18: 5 0 2 - 5 0 4 .
S h im o d a ira H , H a s e g a w a M (2001) C O N S E L : fo r assessin g th e c o n fid e n c e o f
p h y lo g e n e tic tre e selectio n . B io in fo rm a tic s 17: 1246—1247.
P a g e i M , M e a d e A , B a rk e r D (2004) B a y e sia n e s tim a tio n o f a n c e s tra l c h a ra c te r
th es, R h a b d o c o e la ): p h y lo g e n e d c im p lic a d o n s. Z o o l S e r 21: 2 2 3 —230.
R o h d e K , H e ffo rd C , Ellis J T , B a v e rsto c k P R , J o h n s o n A M , e t al. (1993)
C o n tr ib u tio n s to th e p h y lo g e n y o f P la ty h e lm in th e s b a s e d o n p a r d a l se q u e n c in g
o f 18S rib o s o m a l D N A . I n t J P a ra s ito l 23: 7 0 5 -7 2 4 .
58.
W a ts o n N A , R o h d e K , J o n d e liu s U (1993) U ltra s tr u c tu r e o f s p e rm a n d
s p e rm io g e n e s is o f Pterastericola astropectinis ( P la ty h e lm in th e s , R h a b d o c o e la ,
P te ra ste ric o lid a e ). P a ra s ito l R e s 79: 3 2 2 -3 2 8 .
59. J e n n in g s J B , P h illip s J I (1978) F e e d in g a n d d ig estio n in th re e e n to s y m b io d c
g raffillid r h a b d o c o e ls fro m b iv alv e a n d g a s tro p o d m o llu scs. B iol B ull 155: 5 4 2 —
562.
6 0 . J e n n in g s J B (1 997) N u t r it io n a l a n d r e s p ir a to r y p a th w a y s to p a ra s itis m
e x e m p lified in th e T u rb e lla ria . I n t J P a ra s ito l 27: 6 7 9 —6 9 1 .
61.
C a n n o n L R G (1982) E n d o s y m b io tic U m a g illid s (T u rb e lla ria ) fro m H o lo th u ria n s
o f th e G r e a t B a rrie r R e e f. Z o o l S er 11: 173—188.
62.
D o ig n o n G , A rto is T (2006) A n n o ta te d ch e ck list o f th e u m ag illid tu rb e lla ria n s
in fe stin g e c h in o id s (E c h in o d e rm a ta ). B e l g J Z o o l 136: 101—106.
63. E h le rs U (1972) S y stem a tisc h -p h y lo g e n etisc h e U n te rs u c h u n g e n a n d e r F a m ilie
S o le n o p h a ry n g id a e (T u rb e lla ria , N e o rh a b d o c o e la ). M ik ro fa u n a M e e re s b 1 1 : 3 —
78.
64. S o p o tt-E h le rs B, E h le rs U (1995) M o d ifie d sp e rm u ltra s tr u c tu r e a n d so m e d a ta
o n sp e rm io g e n e sis in Provortex tubiferus (P la th e lm in th e s, R h a b d o c o e la ): p h y lo g e ­
n e tic im p lic a tio n s fo r th e D a ly e llio id a . Z o o m o rp h o lo g y 115: 4 1 —49.
65. J o n d e liu s U (1997) A n e w fa m ily a n d t h r e e n e w sp e cie s o f fla tw o rm s
(P la ty h e lm in th e s) fro m th e D a rw in h a r b o u r a re a . In: H a n le y R H , C a sw e ll G ,
M e g iria n D , L a rs o n H K , ed ito rs. P ro c e e d in g s o f th e S ix th I n te r n a tio n a l M a rin e
B io lo g ical W o rk s h o p . T h e m a r in e flo ra a n d f a u n a o f D a rw in H a r b o u r , N o r th e r n
T e r rito r y , A u stra lia . D a rw in : M u s e u m a n d A r t G a lle rie s o f th e N o r th e r n
T e r rito r y a n d th e A u s tra lia n M a rin e S cien ces A sso c ia tio n 1997. p p . 187—197.
sta te s o n p h y lo g en ie s. Syst B iol 53: 6 7 3 —684.
R a m b a u t A , D r u m m o n d A J (2009) T r a c e r v l .5 . A v ailab le: h t t p : / / tre e .b io .e d .a c .
uk. A c c e ssed 2011 A ug.
B a rb e ito s M S , R o m a n o S L , L a sk e r H R (2010) R e p e a te d loss o f c o lo n ia lity a n d
sym biosis in sc le ra c tin ia n c o rals. P ro c N a d A c a d Sei U S A 107: 1 1 8 7 7 —11882.
N y la n d e r J A A (2011) B u rn tre e s vO.1.9. P e rl s c rip t fo r m a n ip u la tin g M rB a y es
tre e s a n d p a r a m e te r files. A v ailab le: h t t p : / / w w w . a b c . s e / ~ n y l a n d e r / . A ccessed
2 0 1 2 M a r.
B o llback J P (2006) S IM M A P : S to c h astic c h a ra c te r m a p p in g o f d isc re te tra its o n
p h y lo g en ie s. B M C B io in fo rm a tic s 7: 88.
S c h u ltz T R , C h u rc h ill G A (1999) T h e ro le o f s u b je c tiv ity in re c o n s tru c tin g
a n c e s tra l c h a ra c te r states: a B a y e sia n a p p ro a c h to u n k n o w n ra te s, sta te s a n d
tra n s fo rm a tio n a sy m m e trie s. Syst B iol 48: 6 5 1 —66 4 .
S a lisb u ry BA , K im J (2001) A n c e s tra l sta te e s tim a tio n a n d ta x o n s a m p lin g
d e nsity. S yst B iol 50: 5 5 7 -5 6 4 .
Z a m p a r o D , B rook s D R , H o b e r g E P , M c L e n n a n D A (2001) P h y lo g e n e d c
analysis o f th e R h a b d o c o e la (P la ty h e lm in th e s) w ith e m p h a sis o n th e N e o d e r m a ta
a n d rela d v e s. Z o o l S er 30: 5 9 —77.
36. V a n S te en k iste N , D a v iso n P , A rto is T (2010) Bryoplana xerophila n . g. n . sp ., a
n e w lim n o te rre s tria l m ic r o tu r b e lla ria n (P la ty h e lm in th e s, T y p h lo p la n id a e , P r o ­
to p la n e llin a e ) f ro m ep ilith ic m osses, w ith n o te s o n its ecology. Z o o lo g Sei 27:
2 8 5 -2 9 1 .
37. L u th e r A (1955) D ie D a ly e lliid e n (T u rb e lla ria , N e o rh a b d o c o e la ). E in e M o n o ­
g ra p h ie . A c ta Z o o l F e n n 87: 1 -3 3 7 .
66.
M e ix n e r J (1926) B e itra g z u r M o rp h o lo g ie u n d z u m S y stem d e r T u rb e lla ria R h a b d o c o e la : II. Ü b e r Typhlorhynchus nanus L a id la w u n d d ie p a ra s itis c h e n
R h a b d o c ö le n n e b s t N a c h trä g e n zu d e n C a ly p to rh y n c h ia . Z M o rp h O k o l T ie re
5: 5 7 7 - 6 2 4 .
67.
M e ix n e r J (1938) T u r b e lla ria (S tru d e lw ü rm e r) T u r b e lla ria I. A llg em e in e r T eil.
In : G r im p e G , W a g le r E , ed ito rs. D ie T ie rw e lt d e r N o rd isk a - u n d O s ts e e 33 (4b).
L eipzig: A k a d e m is c h e V e rla g g e se llsch a ft, p p . 1—146.
68.
M a rc u s E (1954) T u r b e lla ria B ra sile iro s X I . P a p A vuls Z o o l S ec A g r S ao P a u lo
X I : 4 1 9 —489.
B e k le m isch e w V N (1927) Ü b e r d ie T u r b e lla rie n fa u n a d es A ralsees. Z u g le ic h e in
B e itra g z u r M o rp h o lo g ie u n d z u m S y stem d e r D a ly e lliid a . Z o o l j a h r b A b t Syst
G e o g r a p h B iol T ie re 54: 8 7 - 1 3 8 .
35.
69.
38.
T h e r r ia u lt T W , K o la s a J (1999) N e w sp ecies a n d re c o rd s o f m ic ro tu rb e lla ria n s
fro m c o a sta l ro ck p o o ls o f ja m a i c a , W e s t In d ies. A rc h iv f u r H y d ro b io l 144: 3 71—
381.
39. A x P (2008) P la th e lm in th e s a u s B ra c k g ew ä sse rn d e r N o r d h a lb k u g e l. M a in z :
A k a d e m ie d e r W isse n sch a fte n u n d d e r L ite r a tu r , A b h a n d lu n g e n d e r M a th e m a tis c h -N a tu rw is se n s c h a fd ic h e n K la sse , J h r g . 2 0 0 8 , N r. 1. 6 9 6 p.
40. K a r lin g T G (1974) T u r b e lla ria n f a u n a o f th e B a ld e p ro p e r: id en tific a d o n ,
eco lo g y a n d b io g e o g ra p h y . F a u n a F e n n 27: 1—101.
41. K o l a s a J (1977) R e m a rk s o n th e m a rin e - o r ig in a te d T u r b e lla ria in th e fre s h w a te r
fa u n a . A c ta Z o o l F e n n 154: 8 2 - 8 7 .
42. F in d e n e g g I (1930) U n te rs u c h u n g e n a n e in ig e n A r te n d e r F a m ilie T y p h lo p la ­
n id a e . Z o o l j a h r b A b t S yst G e o g ra p h B iol T ie re 59: 7 3 -1 3 0 .
43. A x P (1952) Bresslauilla relicta R e isin g e r, e in h o le u ry h a lin e s T u r b e lla r d es M e e ru n d S üßw assers. F a u n M itt N o r d d e u ts c h i I: 18.
44. A x P (1957) D ie E in w a n d e ru n g m a r in e r E le m e n te d e r M ik ro fa u n a in das
lim n is c h e M e so p s a m m a l d e r E lb e. V e r h a n d l D e u ts c h Z o o l G es 1956: 4 2 8 —135.
PLOS ONE I www.plosone.org
I o m in i C , F e r ra g u d M , J u s d n e J - L (1999) U ltra s tr u c tu r e o f g lan d s in a
s c u ta rie llid (P la ty h e lm in th e s) a n d p o ssib le p h y lo g e n e tic im p lic a d o n s . F olia
P a ra s ito l 46: 1 9 9 -2 0 3 .
K a r lin g T G (1956) Alexlutheria acrosiphoniae n . g e n ., n . sp ., e in b e m e rk e n sw e rte r
m a r in e r V e r tr e te r d e r F a m ilie D a ly e lliid a e (T u rb e lla ria ). A rk Z o o l 10: 3 3 1 —345.
51. J o ff e B I, C a n n o n L R G , S c h o c k a e rt E R (1998) O n th e p h y lo g e n y o ffa m ilie s a n d
g e n e ra w ith in th e T e m n o c e p h a lid a . H y d ro b io lo g ia 383: 2 6 3 —268.
p h y lo g e n o m ic analyses. B M C B io in fo rm a tic s 10: 357.
23. R a m b a u t A (2009) F ig tre e v l.3 .1 . A v ailab le: h t tp : // tr e e .b i o .e d .a c .u k . A ccessed
24.
R ix e n J - U (1961) K le in tu r b e lla r ie n a u s d e m L ito ra l d e r B in n e n g e w ä sse r
S ch lesw ig -H o lstein s. A rc h iv fu r H y d ro b io l 57: 464—53 9 .
R o h d e K (1997) T h e o rig in s o f p a ra s itis m in th e P la ty h e lm in th e s: a su m m a ry
in te r p re te d o n th e b a sis o f r e c e n t lite ra tu re . I n t J P a ra s ito l 27: 7 3 9 —746.
70.
71.
K a r lin g T G (1986) F re e-liv in g m a r in e R h a b d o c o e la (P la ty h e lm in th e s) fro m th e
N . A m e ric a n P acific c o ast. W ith re m a rk s o n species f ro m o th e r a re a s. Z o o l Ser
15: 2 0 1 -2 1 9 .
L u th e r A (1962) D ie T u r b e lla rie n O s tfe n n o s k a n d ie n s . III. N e o r h a b d o c o e la 1.
D a ly e llio id a , T y p h lo p la n o id a : B y rs o p h le b id a e u n d T rig o n o s to m id a e . F a u n a
F e n n 12: 1 -7 1 .
72.
L u th e r A (1948) U n te rs u c h u n g e n a n R h a b d o c o e le n T u r b e lla rie n — V II. Ü b e r
e in ig e m a r in e D a ly e llio id a — V III. B e iträ g e z u r K e n n tn is d e r T y p h lo p la n o id a .
A c ta Z o o l F e n n 55: 3 - 1 2 2 .
7 3 . K a r li n g T G , M a c k - F ir a V , D ö r je s J (1 9 7 2 ) F ir s t r e p o r t o n m a r in e
m ic ro tu rb e lla ria n s fro m H a w a ii. Z o o l S er 1: 2 5 1 —269.
74. E h le rs U , E h le rs B (1981) I n te rstitie lle F a u n a v o n G a la p a g o s — X X V I I .
B y rso p h le b id a e , P ro m e s o s to m id a e B rin k m a n n ie llin a e , K y to r h y n c h id a e (T u rb e l­
la ria , T y p h lo p la n o id a ). M ik ro fa u n a M e e re s b 83: 1—35.
12
March 2013 | Volume 8 | Issue 3 | e59917
Phylogeny o f Dalytyphloplanida
75.
R ie g e r M R (1974) A n e w g ro u p o f T u r b e lla ria —T y p h lo p la n o id a w ith a p ro b o sc is
a n d its re la tio n s h ip to K a ly p to rh y n c h ia . In : R is e r N W , M o rs e M P , e d ito rs.
B iology o f th e T u rb e lla ria . L ib b ie H H y m a n M e m o ria l V o lu m e . N e w Y o rk : M c ­
G ra w -H ill C o m p a n y , p p . 2 3 -6 2 .
76. L u th e r A (1946) U n te rs u c h u n g e n a n R h a b d o c o e le n T u r b e lla rie n — V . U b e r
ein ig e T y p h lo p la n id e n . A c ta Z o o l F e n n 46: 3—56.
77. W illem s W R , A rto is T J , V e r m in W , B a c k e lja u T , S c h o c k a e rt E R (2005)
T y p h lo p la n o id a {P laty h e lm in th e s, R h a b d o c o e la ) fro m N e w C a le d o n ia a n d
e a s te rn A u s tra lia , w ith th e d e s c rip tio n o f six n e w ta x a . N Z J Z o o l 32: 79—98.
78. A x P (i9 6 0 ) T u r b e lla rie n a u s s a lz d u rc h trä n k te n W ie s e n b ö d e n d e r d e u ts c h e n
M e ere sk ü ste n . Z W iss Z o o l 163: 2 1 0 -2 3 5 .
PLOS ONE I www.plosone.org
79.
E h le rs U , S o p o tt-E h le rs B (1989) In te rstitie lle F a u n a v o n G a la p ag o s. X X X V II I .
Haloplanella L u th e r u n d Pratoplana A x { T y p h lo p la n o id a , P la th e lm in th e s ).
M ic ro fa u n a M a r 5: 1 8 9 -2 0 6 .
8 0 . H o c h b e r g R , C a n n o n L R G {2002) T w o n e w f re s h w a te r rh a b d o c o e ls ,
Austrodalyellia g en . n o v . a n d Haplodidymos g en . no v . {P laty h elm inthes), fro m
Q u e e n s la n d , A u stra lia . Z o o ta x a 44: 1—15.
81. H o c h b e r g R , C a n n o n L R G {2003) Magnetia queenslandica, a n e w g e n u s a n d n e w
sp ecies o f ty p h lo p la n id fla tw o rm {P laty h elm in th es: R h a b d o c o e la ) f ro m M a g n e tic
82.
13
Isla n d . R affles B ull Z o o l 51: 1 -6 .
N o r é n M , J o n d e liu s U {1999) P h y lo g e n y o f th e P ro le c ith o p h o r a { P latyhelm in­
thes) in fe rre d f ro m 18S r D N A s e q u en c e s. C la d istic s 15: 103—112.
March 2013 | Volume 8 | Issue 3 | e59917