AN ABSTRACT OF THE THESIS OF
Shukla Roy for the degree of Doctor of Philosophy in Toxicology presented on
September 10, 1998. Title: Regulation of Hepatic Pyruvate Carboxylase in 2,3,7,8Tetrachlorodibenzo-p-dioxin Treated C57BL/6J Mice and their Pair-Fed Controls.
Redacted for Privacy
Abstract Approved:
aniel P. Selivonchick
2,3,7,8-Tetrachlorodibenzo-p-dioxin (TCDD) has an inhibitory effect on the
expression and activity of pyruvate carboxylase (PC), a key enzyme in gluconeogenesis.
However, pair-fed controls of TCDD treated C57BL/6J Ahlilb mice exhibit increased
concentrations of hepatic PC protein relative to ad libitum controls and the TCDD treated
experimental group. Data presented in this thesis illustrate that the induction of hepatic
PC protein concentration in the pair-fed controls is the result of dietary calorie restriction.
Consensus sites for several transcription factors such as NF-1, HNF-4, Sp 1,
OCT-1, CCAAT box and sixteen E-boxes were previously found in the upstream
regulatory region of the mouse PC gene. Presence of consensus sites for transcription
factors does not guarantee protein binding to these elements. Therefore, protein-DNA
interaction studies were conducted with parts of the PC promoter region using hepatic
crude nuclear extracts from C57BL/6J mice. Electromobility shift assays (EMSAs) of a
fragment of the PC gene encompassing the Inr element (-238 by to +65 bp) shows a
single protein-DNA complex. Inr elements play an essential role in the formation of the
transcription apparatus in TATA-less promoters.
Competitive EMSAs confirm that
nuclear proteins bind in a sequence specific manner. DNase I footprinting analysis of this
region shows a protected area from -13 by to +57 by relative to transcription start site. In
addition to the Inr element, a CCAAT box is also present (+36 by to +41 bp) within the
protected area. CCAAT box binding proteins such as CTF/NF-1 are known to interact
with the transcription appararus and initiate transcription from these genes.
EMSA of the multiple E-box region (-1262 by to -639 bp) showed that increasing
the nuclear protein concentration in the binding reaction causes greater shift(s) in the
protein-DNA complex. This suggests that multiple proteins are binding to the E-box
region and that occupancy of the E-boxes increases with increasing nuclear protein
concentration. Competitive EMSAs of the E-box region with specific and non-specific
cold competitor probes confirmed that the protein-DNA complex formation was due to
specific protein binding. An ARNT antibody (BEARNT) failed to supershift the E-box
protein-DNA complex indicating that the nuclear protein(s) binding to the PC multiple Ebox is not ARNT. E-box binding patterns by nuclear proteins from the mice injected with
75 jig TCDD/kg dose were identical to those of the untreated controls, described above.
However, nuclear proteins from the pair-fed controls bound with a reduced affinity to the
E-box region. The reason for this reduced binding is still not clear. However, calorie
restriction has been shown to alter the binding affinity of several transcription factors to
promoter regions.
Regulation of Hepatic Pyruvate Carboxylase in 2,3,7,8-Tetrachlorodibenzo-p-dioxin
Treated C57BL/6J Mice and their Pair-Fed Controls
by
Shukla Roy
A THESIS
submitted to
Oregon State University
in partial fulfillment of
the requirements for the
degree of
Doctor of Philosophy
Presented September 10, 1998
Commencement June, 1999
Doctor of Philosophy thesis of Shukla Roy presented on September 10, 1998
APPROVED:
Redacted for Privacy
Major Professor, repre/entitig
Toxicology
Redacted for Privacy
Chair of Toicolov P
Redacted for Privacy
Dean of Graduate School
I understand that my thesis will become part of the permanent collection of Oregon State
University libraries. My signature below authorizes release of my thesis to any reader
upon request.
Redacted for Privacy
Shukla Roy, Author
Acknowledgements
I would like to thank several special people for making this thesis possible. First and
foremost, I would like to express my utmost gratitude to my parents, Dr. Dwijendra Nath
Roy and Mrs. Nandita Roy and brother, Sabyasachee Roy, for their love and support. I
thank Dr. Daniel Selivonchick for his constant encouragement and much needed sense of
humor during difficult times. I would especially like to thank Dr. Henry Schaup for
allowing me to work in his laboratory and for providing me with valuable advice in my
research projects. Thanks to Dr. Indira Rajagopal for taking the time to have long
discussions on my work, Dr. Cliff Pereira of the Statistics department for data analysis,
Dr. Nancy Kerkvleit's laboratory for providing the ARNT antibody and Linda Stephan
for her help during animal experiments. I would also like to express my appreciation to
my committee members: Dr. David Williams, Dr. Ian Tinsley and Dr. Valerian Dolja.
Thank to my collegues Dr. Barney Sparrow and Dr. Byung Woo Ryu for their friendship
and assistance. Thanks to the department of Food Sciences and Technology and the
Toxicology program for the financial support. Last but not least, I would like to thank my
friends Kinga Farkas and Yvonne Will for their moral support.
Table of Contents
Page
Chapter 1
Introduction
Chapter 2
Literature Review
6
2.1 History of 2,3,7,8-Tetrachlorodibenzo-p-dioxin
6
2.2 2,3,7,8-Tetrachlorodibenzo-p-dioxin in the Environment
7
2.3 Toxicity of 2,3,7,8-Tetrachlorodibenzo-p-dioxin
9
1
2.4 The Aryl Hydrocarbon Receptor Pathway for Dioxin Toxicity
15
2.5 Non-Aryl Hydrocarbon Receptor Pathway for Dioxin Toxicity
20
2.6 Alteration in Intermediary Metabolism by Dioxin
21
2.7 Pyruvate Carboxylase: A Key Enzyme in Gluconeogenesis
22
2.8 References
27
Chapter 3 Dietary Calorie Restriction Induces Hepatic Pyruvate Carboxylase
in Pair-Fed Controls for the C57BL/6J Mice Exposed to
2,3,7,8-Tetrachlorodibenzo-p-dioxin
40
3.1 Abstract
41
3.2 Introduction
42
3.3 Materials and Methods
44
3.4 Results
49
3.5 Discussion
62
3.6 References
65
Table of Contents (Continued)
Page
Chapter 4 Identification of Transcriptional Initiation Complex Binding Site
within the Hepatic Pyruvate Carboxylase Promoter Region from
C57BL/6J Mice
Chapter 5
69
4.1 Abstract
70
4.2 Introduction
71
4.3 Materials and Methods
76
4.4 Results
80
4.5 Discussion
87
4.6 References
94
Comparison of DNA Binding Patterns of Hepatic Crude Nuclear
Extracts from 2,3,7,8-Tetrachlorodibenzo-p-dioxin Treated and
Untreated C57BL/6J Mice to the Multiple E-box Region within the
Pyruvate Carboxylase Promoter
99
5.1 Abstract
100
5.2 Introduction
102
5.3 Materials and Methods
105
5.4 Results
109
5.5 Discussion
122
5.6 References
130
Chapter 6 Conclusions
136
Bibliography
143
List of Figures
Figure
3.1
Western blot analysis of hepatic pyruvate carboxylase from C57BL/6J
Ahbib male mice from corn oil dose response experiment
Page
50
3.2
Repeated measures analysis (average of days 7+8 average of days 2+3)
of the food intake/body weight ratios of C57BLJ6J Ahbib mice injected with
various doses of TCDD
52
3.3
Repeated measures analysis (average of days 7+8 average of days 2+3)
of the food intake/body weight ratios of C57BL/6J Ahdld mice injected
with various doses of TCDD
54
Western blot analysis of hepatic pyruvate carboxylase from C57BL/6J
Ahblb male mice subjected to diet restriction
57
Western blot analysis of hepatic pyruvate carboxylase from Ah"
congenic male mice subjected to diet restriction
59
DNA sequence of hepatic pyruvate carboxylase upstream regulatory
region (1643 bp) and untranslated exon 1 from C57BL/6J mouse
74
Electromobility Shift Assay of proximal promoter region (-238 by
to +65 bp) of the pyruvate carboxylase gene from C57BL/6J mice
81
Competitive Electromobility Shift Assay of the hepatic pyruvate
carboxylase proximal promoter region (-238 by to +65 bp) from
C57BL/6J mice
83
DNase I footprinting analysis of the hepatic pyruvate carboxylase
proximal promoter region (-238 by to +65 bp) from C57BL/6J mice
85
Electromobility Shift Assay of hepatic pyruvate carboxylase multiple
E-box region (-1232 by to -639 bp) from C57BLJ6J mice
110
Protein-DNA complex mobility on a 1.2% agarose gel as a function of
crude nuclear extract concentration
112
Competitive Electromobility Shift Assay of the hepatic pyruvate
carboxylase multiple E-box region from C57BL/6J mice
114
3.4
3.5
4.1
4.2
4.3
4.4
5.1
5.2
5.3
List of Figures (Continued)
Figure
5.4
5.5
Page
Comparison of DNA-binding activities of crude nuclear extracts from
75 //g TCDD/kg treated C57BL/6J mice and their pair-fed controls to
the multiple E-box region
117
Electromobility Shift Assay of the hepatic pyruvate carboxylase
multiple E-box region in the presence of Anti-ARNT antibody
(BEARNT)
119
List of Tables
Page
Table
3.1
3.2
Daily food ration of C57BL/6J Alibib and Ah" mice in diet restriction
studies
46
Concentration and Activity of pyruvate carboxylase (PC) in livers of
control and diet restricted C57BL/6J Alibib and Ahdid mice
61
Regulation of Hepatic Pyruvate Carboxylase in 2,3,7,8-Tetrachlorodibenzo-p-dioxin
Treated C57BL/6J Mice and their Pair-Fed Controls
Chapter 1
Introduction
2,3,7,8-Tetrachlorodibenzo-p-dioxin (TCDD) is the most toxic member of the
halogenated aromatic hydrocarbon class of compounds. Toxicity of TCDD to animals
ranges from immunosuppression, carcinogenesis, teratogenesis, wasting syndrome and
death (Whitlock, 1993).
The wasting syndrome aspect of dioxin toxicity has been
attributed to inhibition of glucose synthesis. Lower blood glucose concentrations due to
TCDD toxicity has been linked to the down regulation of several key gluconeogenic
enzymes: phosphoenolpyruvate carboxykinase (PEPCK), acetyl CoA carboxylase (ACC)
and pyruvate carboxylase (PC) (Weber et al., 1992).
Down regulation of PC by TCDD has been well characterized in rats and mice.
Short term (8 days) exposure of C57BL/6J mice to TCDD reduces hepatic PC activity,
protein and mRNA concentrations in a dose and time dependant manner (Ilian et al.,
1996; Ryu et al., 1995; Sparrow et al., 1994). C57BL /6J mice with high affinity Ah
receptors (Ahb/b) experience a significant drop in PC activity even at a low dose of 1 tg
TCDD/kg (Sparrow et al., 1994). In C57BL/6J mice with low affinity Ah receptors
(Ah"), a significant reduction in activity does not occur below a 75 aug TCDD/kg dose
(Ryu et al., 1995).
An interesting observation made in our laboratory during the TCDD dose
response experiments was that PC protein levels were elevated in the pair-fed controls of
TCDD treated mice relative to ad libitum controls and the TCDD injected mice. This
induction occurred in the pair-fed controls of Ah" strain of mice injected with a 50 jig
TCDD/kg dose (Sparrow et al., 1994). However, no induction of PC protein was not
observed in pair-fed controls of Ah" strain of mice injected with a 50 ,ug TCDD/kg dose
(Ryu et al., 1995).
2
Starvation is a well known inducer of PC and TCDD treated mice experience
cachexia (reduced food intake). Since pair-fed controls are allowed only the amount of
food consumed by their TCDD treated counterparts, we hypothesized that calorie
restriction was causing induction of PC in the pair-fed controls. Examination of food
intake data of TCDD treated Ahh/b mice showed that during the course of the experiment
(8 days), food intake increased for animals given 1 or 10 jig TCDD/kg doses. Ah" mice
given doses
20 /./g TCDD/kg reduced their food consumption during this period. On
the other hand,
Ahdid
mice experienced hypophagia only at a high dose of 100 ,ug
TCDD/kg. The above data indicated that pair-fed controls of the 50 tig TCDD/kg Ah"
injected mice received a ration of food that was less than the amount consumed by ad lib
controls. The food ration of the Ahdld strain of mice was not affected at this dose. To test
our hypothesis, we conducted calorie restriction experiments where C57BL/6J mice of
both strains (Ah bib and Ahd/d) were given a ration of food consumed by Ah" mice
injected with a 50 pg TCDD/kg dose. PC levels were induced in both strains of mice
under calorie restriction compared to ad libitum controls. These experiments prove that a
pair-feeding regimen is responsible for PC induction in pair-fed controls of Ah" mice
given a 50 aug TCDD/kg dose.
To elucidate the molecular mechanisms by which TCDD down regulates PC at the
transcriptional level, the upstream regulatory region (1.4 kb) of the hepatic PC gene from
C57BL/6J mice liver had been previously cloned and sequenced in our laboratory.
Sequence analysis of the regulatory region revealed that there were consensus sites for
several transcription factors: NF-1, HNF-4, Sp 1, OCT-1, CCAAT box and sixteen Eboxes (Ryu, 1996; Sparrow, 1997). Ten of the E-boxes are juxtaposed to TFII I elements
and occur every 39 nucleotides in the -757 by to -1185 by region of the mouse regulatory
region (Sparrow, 1997).
Consensus sequence for an initiator (Inr) element was also found in the +3 by to
+10 by region relative to the transcription start site. Inr elements are present in the
promoters of housekeeping genes and play an essential role in the formation of the
transcription apparatus in TATA-less promoters. A TATA box is not present in the PC
gene promoter.
3
Presence of consensus sites in the regulatory regions of genes does not guarantee
binding of transcription factors to these elements. In order to further characterize the PC
regulatory region, protein-DNA interaction studies were conducted with hepatic crude
nuclear extracts from C57BL/6J mice.
Electromobility shift assays (EMSAs) of a
fragment of the PC gene encompassing the Inr element (-238 by to +65 bp) show a single
protein-DNA complex. Competitive EMSAs confirm that nuclear proteins bind in a
sequence specific manner. DNase I footprinting analysis of the Inr containing fragment
(-238 by to +65 bp) shows a protected area from -13 by to +57 by region. A CCAAT box
is present in the +36 by to +41 by region of the PC gene. CCAAT box binding proteins
such as CTF/NF-1 are known to interact with the transcription appararus and initiate
transcription from genes.
The 1.4 kb PC regulatory region lacks dioxin response elements (DREs), which
indicates that although PC downregulation by TCDD is Ah receptor dependant, it is most
likely not DRE dependant. In the Ah receptor signal transduction pathway, dioxin causes
Ah receptor to heterodimerize with the ARNT and bind to DREs present in the promoter
regions of genes altered by TCDD. ARNT also recognizes E-boxes and binds to it as a
homodimer or heterodimer. This presented the possibility that ARNT might interact
with the E-boxes of the PC regulatory region and influence downregulation of PC by
TCDD. Previously conducted transient cotransfection assays of hepa 1 c 1 c7 cells with the
PC promoter region and an ARNT encoding plasmid (pBM5/NEO/M1-1) showed that
ARNT suppressed TCDD induced PC promoter activity. These results suggested that
ARNT might be involved in modulation of PC by TCDD (Sparrow, 1997).
Electromobility shift assays (EMSA) of the multiple E-box region with hepatic
crude nuclear extracts from C57BL/6J mice have been employed to characterize the
multiple E-box region (-1232 by to 637 bp). Increasing the nuclear protein concentration
in the binding reaction causes greater shift(s) in the protein-DNA complex. A plot of
nuclear protein concentration (jig) in the binding reaction versus mobility of the protein-
DNA complex relative to free probe (Rf) produced a saturation curve. The hyperbolic
nature of the curve suggests that multiple proteins are binding to the E-box region and
that occupancy of the E-boxes increases with increasing nuclear protein concentration.
4
Competitive EMSAs of the E-box region with specific and non-specific cold competitor
probes confirmed that the protein-DNA complex was due to specific protein binding. An
ARNT antibody (BEARNT) was used to investigate if the nuclear protein binding to the
E-box region was ARNT. However, BERANT failed to supershift the protein DNA
complex. These results indicate that the nuclear protein(s) binding to the PC multiple E-
box is not ARNT.
EMSAs of the multiple E-box region with hepatic crude nuclear
extracts from mice treated with a 75 µg TCDD/kg dose and their pair fed controls, were
also conducted. The DNA binding patterns of nuclear proteins from the TCDD injected
mice were identical to those of untreated controls, described above. These results
indicated that the E-box region was not involved in dioxin mediated downregulation of
the mouse PC gene. However, nuclear proteins from the pair-fed controls bound with a
reduced affinity to the E-box region. The reason for this reduced binding is still not clear.
However, calorie restriction has been shown to alter the binding affinity of several
transcription factors.
5
References
Ilian, M. A., Sparrow, B. R., Ryu, B.W., Selivonchick, D. P. and Schaup, H.W. 1996.
Expression of hepatic pyruvate carboxylase mRNA in C57BL/6J Ah" and
congenic Ahdid mice exposed to 2,3,7,8-Tetrachlorodibenzo-p-dioxin. Journal of
Biochemical Toxicology. 11:51-56.
Ryu, B. W., Roy, S., Sparrow, B. R., Selivonchick, D. P. and Schaup, H. W. 1995. Ah
receptor involvement in mediation of pyruvate carboxylase levels and activity in
mice given 2,3,7,8-tetrachlorodibenzo-p-dioxin. Journal of
Biochemical
Toxicology. 10: 103-109.
Ryu, B. 1996. Characterization of pyruvate carboxylase responses to 2,3,7,8tetrachlorodibenzo-p-dioxin exposure in C57BL/6J Ahdid mice. Thesis
Dissertation, Oregon State University, Corvalllis, OR.
Sparrow, B. R., Thompson, C. S., Ryu, B. W., Selivonchick, D. P., and Schaup, H. W.
1994.
2,3,7,8-Tetrachlorodibenzo-p-dioxin induced alterations of pyruvate
carboxylase levels and lactate isozyme shifts in C57BL/6J male mice. Journal of
Biochemical Toxicology. 9: 329-335.
Sparrow, B. R. 1997. Characterization of 2,3,7,8-tetrachlorodibenzo-p-dioxin (TCDD)
induced modification of hepatic pyruvate carboxylase gene expression in
C57BL/6J male mice. Thesis Dissertation. Oregon State University, Corvallis,
OR.
Weber, L. W. D., Lebofsky, M., Stahl, B. U., Kettrup, A., and Rozman, K. 1992.
Comparative toxicity of four chlorinated dobenzo-p-dioxins (CDDs) and their
mixtures. Archives of Toxicology. 66: 478-483.
Whitlock, J. P. 1993.
Mechanistic aspects of dioxin action. Chemical Research in
Toxicology. 6: 754-762.
6
Chapter 2
Literature Review
2.1
History of 2,3,7,8-Tetrachlorodibenzo-p-dioxin
2,3,7,8-Tetrachlorodibenzo-p-dioxin is the prototype for a class of halogenated
aromatic hydrocarbons (HAHs), namely polychlorinated dibenzo-p-dioxins (PCDDs).
The HAHs consist of PCDDs, polychlorinated dibenzofurans (PCDFs), polychlorinated
biphenyls (PCBs), napthalenes, terphenyls, azo and azoxybenzenes, quaterphenyls and
their brominated and chloro/bromo analogues.
HAHs are aromatic compounds with a
planar structure (Firestone, 1984). They are lipophilic and quite resistant to degradation
by acids, bases, oxidation, reduction and hydrolysis. These physicochemical properties
are responsible for the environmental stability of HAHs.
The lipophilic nature and
environmental stability of HAHs have resulted in the bioaccumulation of these
compounds in the trophic food chain such that parts per trillion (ppt) levels can be found,
in agricultural, biological and environmental samples (Landrigan, 1980).
Large-scale manufacture of HAHs began as a result chlorine chemistry.
Chloroaromatic production in the U.S. increased in 1940 from 22 million kg to 360
million kgs in 1960 (Rossberg, 1986). Chlorinated phenols have been widely used as
bactericides,
slimicides,
wood preservatives
and
fungicides
(Rappe,
1980).
Polychlorinated napthalenes (PCNs) are used as protective coating material (Brinkman
and De Kok, 1980). Halogenated diphenyl ethers are used in flame retardants, electric
insulators, plasticizers, lubricants and hydraulic fluids. PCBs have been used as dielectric
fluids, investment casting waxes, heat transfer agents and plasticizers in paints, coatings
and carbonless copy paper (Firestone, 1984). However, the many benefits derived from
these products such as crop protection, light weight materials and water disinfection were
soon overshadowed by the realization that many of these compounds are extremely
harmful to humans and the ecosystem. Subsequently, the production of these chemicals
have been abated (Zook and Rappe, 1994).
Chlorinated dibenzo-p-dioxins, dibenzo furans and azo(xy) benzenes are ususally
found as contaminants in commercial products.
PCDDs and PCDFs are routinely
7
identified as impurities or byproducts in chlorinated phenols. The levels of PCDDs and
PCDFs in commercial products are highly variable and depend on several factors such as
alkaline conditions, temperature, ultraviolet irradiation and other radical initiators (Safe
and Hutzinger, 1990). Several other sources of PCDDs and PCDFs include the pulp and
paper industry, metallurgical processes and proceedures used for the reactivation of
granular carbon and burning of solid waste from municipal incinerators (Webster and
Commoner, 1994).
Interest in human exposure to PCDDs and PCDFs began when the extreme
toxicity of 2,3,7,8-tetrachlorodibenzo-p-dioxin also known as TCDD or dioxin to certain
laboratory animals was discovered. In 1970, K. D. Courtney of NIH, reported that the
TCDD contaminant in Agent Orange caused malformations and stillbirths in mice
(Courtney et al., 1970). TCDD was detected in trace levels (30 ppm) in 2,4,5trichlorophenoxy acetic acids and its derivatives which were used as herbicides and in
brush border control programs throughout the U.S. and other countries. The U.S. Air
Force had applied 42 million liters of this herbicide known as Agent Orange to jungle
areas to clear vegetation and reduce ambushes and disrupt enemy tactics during the
Vietnam war (Young, 1988).
TCDD has received a lot of attention as it is a potent carcinogen in all laboratory
animals tested. TCDD has a vapor pressure of 1.7 x 10.6 mm Hg at 25°C, a melting point
of 305°C and a water solubility of 0.2 lig/L. It is stable thermally up to about 700°C, has
a high degree of chemical stability and is poorly biodegragdable. TCDD is a poor
substrate for detoxification systems, such as the microsomal cytochrome P450 enzymes.
Resistance to metabolism of TCDD leads to its persistance in the body. The half-life of
TCDD in humans is in the order of 10 years (Manahan, 1994).
2.2 2,3,7,8-Tetrachlorodibenzo-p-dioxin in the Environment
Annual environmental emission of TCDD in the U.S. is between 25 and 120 kgs
as estimated by Travis and co-workers (Travis et al., 1989). TCDD is present in all
components of the environment i.e., land, air and water bodies. It is distributed from
point sources as combustion related emissions or as effluent liquid waste released into the
8
aquatic systems. Atmospheric transport of TCDD and related compounds across long
distances became evident after their detection in remote locales free of inputs from
industrial release (Zook and Rappe, 1994). A typical air parcel may contain a total of 1 to
10 pg PCDD per cubic meter (Tysklind et al., 1993). The soil PCDD homologue profile
corresponds to about 60 pg per gram (Zook and Rappe, 1994). The sediment homologue
profile corresponds to a total of about 2 ng PCDD per gram of sediment (Hites, 1991).
The primary means of TCDD degradation in the environment is photolysis and
reactions with hydroxyl radicals naturally present in the troposphere (Atkinson, 1991).
Breakdown of chloroaromatic compounds by microorganisms is generally slow. Lower
chlorinated PCDDs appear to be the most readily biodegradable (Parsons and Storms,
1989).
Absorption of PCDDs onto sediment particulates significantly prolongs
degradation routes (Parsons, 1992).
There have been several cases of high level human exposure to TCDD as a result
of industrial accidents. A mass poisoning, called Yusho occured in Japan in 1968.
Yusho was caused by ingestion of rice oil that was contaminated with PCBs, PCDFs,
PCQs and other chlorinated compounds (Masuda, 1994). A very similar mass poisoning,
called Yu-Cheng, occured in central Taiwan in 1979 (Hsu et al., 1985). The most notable
case of TCDD contamination in the U.S. resulted from the spraying of waste oil mixed
with TCDD on roads and horse arenas in Missouri in the early 1970s. The oil was used
to keep dust down in these areas (Sweeney et a/.,1992). Individuals exposed to mixtures
of chlorinated hydrocarbons during these industrial accidents experienced several acute as
well as chronic health problems. These included lesions of skin and mucous membranes
(chloracne), retarded growth in children, low birth weights, memory loss and cancer such
as soft tissue sarcoma (Masuda, 1994; Hsu et al., 1994).
The most notorious incidence of wildlife exposure to TCDD has been the
colonial, fish eating water birds of the Great Lakes. These exposures have resulted in a
number of adverse effects on their reproductive potential, such as deformities and
lethality of embryos, egg shell thinning and immunosuppression (Giesy et al., 1994).
9
2.3 Toxicity of 2,3,7,8-Tetrachlorodibenzo-p-dioxin
There are 75 possible chlorine substituted dibenzo-p-dioxins and 135 possible
chlorine substituted dibenzofuran congeners (Zook and Rappe, 1994). The presence of
chlorines in three or four of the lateral ring positions renders the compounds extremely
toxic (Goldstein, 1980). Laboratory animals and wild life species exposed to dioxin and
related compounds exhibit a wide array of toxic responses which include carcinogenicity,
teratogenicity, reproductive abnormalities, behavioral and neuroendocrine problems,
immunotoxicity and hepatotoxicity (De Vito and Birnbaum, 1994). Toxicity of TCDD is
manifest as clinical symptoms and biochemical alterations.
2.3.1 Clinical Signs Associated with 2,3,7,8-Tetrachlorodibenzo-p-dioxin Toxicity
The toxicity of dioxin varies with dose, route of exposure, length of exposure, sex,
age and species of animal. The acute oral LD50 of TCDD varies over a 5000-fold range in
different species: guinea pig (1 pg/kg), male rat (22 pg/kg), female rat (45 pg/kg),
monkey (<70 ,ug/kg), rabbit (115 ,ug/kg), mouse (114 pg/kg), dog (>300 pg/kg), bull frog
(>500 µg/kg), hamster (5000 pg/kg) (Poland and Knutson, 1982). Animals given a lethal
dose of TCDD experience weight loss or reduced weight gain and a depletion of adipose
tissue. Intoxicated animals also experience cachexia i.e., reduced food intake. This is
known as the wasting syndrome. A lethal dose of TCDD may cause a loss in body
weight as great as 50% (McConnell, 1980). Lethality of TCDD is not altogether due to
the wasting syndrome as TCDD-treated rats fed parenterally, gain weight at the same rate
as control rats fed parenterally and retain their adipose tissue. However, unlike the
control animals, the TCDD treated rats die within 2 weeks of treatment (Gasiewicz et al.,
1980).
The most frequently observed lesion produced by TCDD in humans is chloracne
(Taylor, 1974; Crow, 1970).
Chloracne is hyperplasia and hyperkeratosis of the
interfollicular epidermis, hyperkeratosis of the hair follicles and squamous metaplasia of
the sebaceous glands (Kimbrough, 1974). Rhesus monkeys given TCDD orally, lose hair
from the face and chest. Finger and toe nails become sloughed, the miebomian glands of
10
the eyelids thicken and become tortuous and keratinized while the ceruminous glands of
the ear canal fill with keratinaceous debris (McConnell et al., 1978).
TCDD causes a loss of lymphoid tissue (lymphoid involution) in the thymus,
spleen and lymph nodes. The thymus can be reduced to 20% of normal size, with a loss
of cortical lymphocytes (McConnell et al., 1978; Vos et al., 1974).
Necrosis of
lymphocytes does occur (McConnell et al., 1980; Allen, 1977; McNulty et al., 1981).
Thymic involution produced by TCDD is accompanied by immunosuppression in young
animals. The fact that TCDD does not have an effect on primary lymphocytes and
thymic cell lines in vitro suggests that TCDD may not act directly on T-cells, but may
produce loss of thymocytes via indirect mechanisms (Faith and Moore, 1977; Luster et
al., 1980). Animals exposed to lethal doses of TCDD ususally do not die from infections
(De Vito and Birnbaum, 1994).
In mice, humoral and cell-mediated immunity are suppressed by dioxins (De Vito
and Birmbaum, 1994). Susceptibility to a variety of infectous agents including endotoxins
is increased in mice as a result of this immunosuppression (Vos et al., 1978). A single
low dose of TCDD (10 ng/kg) significantly increases the mortality rate in adult mice
exposed to influenza virus (De Vito and Birnbaum, 1994). In rats, TCDD enhances the
immune response to sheep red blood cells (SRBC) in the plaque forming-cell (PFC)
assay. In the PFC assay, animals are injected with SRBC. Antibody production against
SRBC requires an interactions between macrophages, T cells and B cells (De Vito and
Birnbaum, 1994). TCDD also suppresses the immune response to sheep red blood cells
(SRBC) in the plaque forming cell (PFC) assay in mice (Vecchi et al., 1980).
Even at doses well below the lethal dose, TCDD produces hepatomegaly in all
species (McConnell, 1980; Kociba et al., 1978). The enlarged liver is due to hyperplasia
and hypertrophy of parenchymal cells and notably due to a proliferation of smooth
endoplasmic reticulum (Fowler et al., 1973; Hinton et al., 1978). An increase in smooth
endoplasmic
reticulum
is
accompanied
by
an
enhancement
in
microsomal
monooxygenase activity. There is a species difference in hepatic damage caused by
TCDD. Livers of rats treated with TCDD exhibit a distortion of the hepatic lobules,
necrosis of parenchymal cells, development of large multinucleated cells, lipid
11
accumulation, pigment disposition and infiltration of inflammatory cells and fibrous
proliferation in necrotic areas (Kociba et al., 1979; Gupta et al., 1973; Hintin et al., 1978;
Jones and Butler, 1973). In the liver of rabbits exposed to TCDD there is widespread
necrosis of liver. In the mouse, there are focal centrilobular lesions and in the guinea pig
the histopathologic changes are minimal.
TCDD produces a hyperplastic and hypertrophic lesion of gastric mucosa in the
cow and monkey (McConnell et al., 1980; Allen and Norback, 1973). The lesion consists
of a greatly thickened hyperplastic gastric mucosa with extension of the gastric glands
into the submucosa and formation of submucosal cysts (Becker et al., 1979).
Cleft palate and hydronephrosis occur in mice at low doses of dioxins that do
not produce any maternal toxicity (DeVito and Birnbaum, 1994). Most laboratory
mammals exposed to TCDD at the gestational stage exhibit the patterns of toxicity
similar to adult animals treated with dioxin. These include thymic hypoplasia,
subcutanoous edema, decreased prenatal growth, and prenatal mortality (Couture et al.,
1990). At large doses, TCDD exposure can result in prenatal mortality which are detected
only by staining for resorption sites on dissection of the uterus. Prenatal toxicity and
prenatal mortality can in some cases be accompanied by maternal toxicity. The most
sensitive indicators of overt maternal toxicity are decrease in body weight gain or edema
compared, with vehicle-dosed control animals (Theobald and Peterson, 1994). TCDD
exposure leads to toxicities that are quite species specific. Mice develop cleft palates
(Birnbaum, 1991), rabbits develop extra ribs (Giavini et al., 1982) and rats develop
intestinal hemorrhage (Sparschu et al., 1971).
Offsprings of women exposed to mixtures of PCDDs, PCDFs and PCBs
developed hyperpigmentation of the skin, mucous membranes, fingernails and toe nails.
This syndrome was called ectodermal dysplasia (Yamashita and Hayashi, 1985).
Neurobehavioral abnormalities were observed in children that were victims of the
Yusho or Yu-cheng incidents (Hsu et al., 1974). These effects were also reported in
animals receiving dioxins alone indicating that it was dioxin in the mixtures that had
caused the developmental abnormalities in children (DeVito and Birnbaum, 1994).
12
Mice, rats and primates treated with TCDD have reduced fertility, litter size and
uterine weights (Kociba et al., 1979; Barsitti et al., 1979; Umbreit et al., 1987). Prenatal
exposure to low doses of TCDD delays vaginal openings and induces cleft pallus clitoris
in female rats. In severe cases of clefting, an abnormal development of the urethra was
also occurred. Male reproductive capabilities are reduced by TCDD in sexually mature
rats. This is probably due to reduction in testis and accessory sex organ weight, abnormal
testicular morphology, and decreased spermatogenesis (Kociba et al., 1976; Chahoud et
al., 1989).
Seventeen long-term carcinogenesis studies conducted between 1977 and 1988
have demonstrated that TCDD is a transspecies, transstrain, transsex, multisite, complete
carcinogen.
Carcinogenicity of TCDD is epigenetic in nature. A complete carcinogen
causes cancer in laboratory animals that have not been exposed to any known chemical
carcinogen (Huff et al., 1994). In rats, TCDD induced neoplasms in liver, lung, oral/nasal
cavities, thyroid and adrenal glands (Kociba et al., 1978). In mice, TCDD caused
neoplasms in the liver, subcutaneous tissue, thyroid gland, lung and lymphopoietic system
(Toth et al., 1979; Della Porta et al., 1987). In hamsters, TCDD produced squamous cell
carcinomas of the facial skin (Rao et al., 1988). Cancers in organs and tissues remote
from the site of TCDD exposure occurs in animals at doses well below the maximum
tolerated dose. TCDD is the most potent of the identified chemical carcinogens. A
noncarcinogenic exposure level could not be demonstrated, with 0.001 ,uWkg per day as
the lowest dose tested (Huff et al., 1994). Although it is well established that TCDD is a
complete carcinogen,
many two-stage liver or skin models have demonstrated that
TCDD also has considerable tumor promotion activity. Epidemiological data from
occupationally exposed workers show convincing evidence that exposure of humans to
TCDD results in cancers of the liver, lung, thyroid gland, respiratory tract, connective and
soft tissue sarcoma and hematopoietic system (Huff et al., 1994).
2.3.2 Biochemical Alterations due to 2,3,7,8-Tetrachlorodibenzo-p-dioxin Toxicity
Clinical manifestations of TCDD toxicity are a result of alteration in homeostatic
processes. Interaction between growth factors, steroid hormones and the enzymes
13
involved in the synthesis and degradation of these factors, regulates homeostasis. Toxicity
of dioxins can be explained partly by fluctuations in hormones and their receptors, and by
induction of enzymes involved in metabolism as a consequence of exposure to dioxins
(DeVito and Birnbaum, 1994).
Cell proliferation and differentiation are tightly controlled.
Abnormal
development and cancer are the result of inappropriate proliferation and differentiation.
Growth factors regulate some of these cellular processes. Growth factors interact with
specific membrane bound receptors, which act as signal transducers, and control cellular
proliferation, differentiation, and apoptosis. There are both stimulatory growth factors
such as epidermal growth factor (EGF) and transforming growth factor a (TGF-a) as well
as inhibitory growth factors. Dioxins can alter the levels of both types of growth factors
and their receptors (DeVito and Birnbaum, 1994). Depending on organ or tissue, age, sex
and species studied, dioxins can increase or decrease these factors. For example, TCDD
induces a proliferative response in rat liver (Lucier et al., 1991), hairless mouse skin
(Stohs et al., 1990), and the developing uteric epithelia in mice (Abbott et al., 1987).
EGF receptor concentrations are decreased in rat liver, unchanged in hairless mouse skin,
and increased in the developing uteric and palate epithelium. (DeVito and Birnbaum,
1994).
Like growth factors, hormones are also involved in homeostatic control at the
cellular, tissue, organ and organism levels. Steroid hormones participate in the regulation
of growth and development, sexual differentiation, reproduction and cellular metabolism.
Other hormones such as insulin regulate carbohydrate and fat metabolism. Dioxins alter
many of these hormones and their receptors (DeVito and Birnbaum, 1994). Decreases in
estrogen (Romkes and Safe, 1988; DeVito et al., 1992), glucocorticoid (Lin et al., 1991),
and insulin receptor (Madhukar et al., 1989) concentrations have been observed following
dioxin treatment. Dioxins also alter the concentration of several hormones and vitamins
such as estrogen, progesterone (Bonsotti et al., 1979), testosterone (Moore et al., 1985),
vitamin A (Thunberg, 1984), and thyroid hormone (Bastomsky et al., 1977) in several
tissues and in species.
Dioxins decrease testosterone and increase FSH and LH
concentrations in workers exposed during the manufacturing of 2,4,5-trichlorophenol
14
(De Vito and Birnbaum, 1994). In addition, workers exposed to dioxins such as Vietnam
veterans (Wolfe et al., 1992) and Operation Ranch Hand personnel, had increased
incidences of diabetes (Sweeny et al., 1992). In rats, high doses of dioxins decrease
hepatic insulin receptors which may result in alterations in glucose metabolims
(Madhukar et al., 1984). In guinea pigs, glucose uptake is decreased in adipose tissue,
pancreas and brain (Enan et al., 1992).
TCDD also induces numerous drug metaboilzing enzymes.
Enzymes that
metabolize drugs, carcinogens and environmental pollutants are divided into classes:
Phase 1 and phase 2. Phase 1 enzymes function by inserting an atom of atmospheric
oxygen into the substrate. Cytochrome P450s, tyrosine and phenylalanine hydroxylases,
dioxygenases, monoamine oxidases, and flavin-containing monooxygenases are examples
of phase 1 enzymes. Phase 2 enzymes act on oxygenated substrates, including products
of Phase 1 metabolism, usually by conjugation, or transfer mechanisms. Phase 2 enzymes
include UDP-glucuronosyltransferases, glutathione transferases, sulfotransferases, NAD-
and NADP-dependant alcohol and aldehyde and steroid dehydrogenases, quinone
reductases, NADPH diaphrose, azo reductases, aldoketoreductases, acetyltransferases,
methyltransferases, transaminases and a large variety of esterases and hydrolases (Nebert
et al., 1993 ).
Dioxin induces gene expression of many phase 1 and phase 2 enzymes. Some of
them are cytochrome P4501A1 (CYP1A1), cytochrome P4501A2 (CYP1A2), cytochrome
P4501B1 (CYP1B1), glutathione-S-transferase Ya subunit, aldehyde dehydrogenase,
quinone reductase and UDP-glucuronosyltransferase (Rowlands and Gustafsson, 1997).
The induction of CYP1A1 and CYP1A2 by dioxin has been studied extensively. UDPglucuronosyltransferase metabolizes thyroxine.
The increased hepatic metabolism of
thyroxine may lead to decreases in circulating thyroxine levels (Bastonsky et al., 1993).
In response to the lowered thyroxine levels, the pituatory gland increases thyroid
stimulating hormone (TSH) secretion. Increased TSH levels lead to hyperplasia and
hypertrophy of the thyroid gland. Prolonged stimulation may lead to thyroid tumors and
in fact TCDD increases thyroid tumors in both rats and mice (Lucier et al., 1993). Thus,
15
changes in enzymes involved in the metabolism of endogenous substances can result in
effects as severe as cancer (De Vito and Birnbaum, 1994).
2.4 The Aryl Hydrocarbon Receptor Pathway for Dioxin Toxicity
Many of the biological effects of dioxin including teratogenicity, carcinogenicity,
porphyria and hepatotoxicity are mediated through a cytosolic receptor known as the aryl
hydrocarbon (Ah) receptor (Nebert, 1989). Dioxin crosses the cell membrane through
passive diffusion and binds to the Ah receptor. The Ah receptor is a ligand-inducible
transcription factor that is important in regulating the response to polycyclic aromatic
hydrocarbons. It is a member of the helix-loop-helix-PAS regulatory protein superfamily
(Rowlands and Gustafsson, 1997). In the absence of TCDD, the AhR exists in the
cytosol as heterotetrameric complex in the cytoplasm along with an hsp90 dimer and a
43 kDa protein (Chen and Perdew, 1994). Hsp90 interacts with the AhR through the
bHLH and PAS domains. The AhR has a higher affinity for the ligand when it is
associated with hsp90. The absence of hsp90 allows the AhR to bind to DNA (McGuire
et al., 1994).
Upon binding TCDD,
the AhR dissociates from the hsp90 dimer,
translocates to the nucleus and heterodimerizes with another bHLH transcription factor
known as aryl hydrocarbon receptor nuclear translocator (ARNT) (Fukunaga et al., 1995).
The AhR-ARNT heterodimer binds to xenobiotic response elements (XREs) present in
the enhancer regions of genes such as CYP1A1 and CYP1A2 and alters transcription
(Meyer et al., 1998).
Ligands for the Ah receptor are hydrophobic aromatic compounds that are planar
or become coplanar in structure. Toxicity of these compounds is directly related to their
affinity for the Ah receptor. High affinity ligands for the Ah receptor include HAHs,
PAHs, aromatic amines, rutaecarpine alkaloids and indolocarbazoles and related
compounds (Hankinson, 1995). The equilibrium dissociation constants (1(4) of the
receptor for TCDD and related 2-iodo-7,8-dibromodibenzo-p-dioxin is in the picomolar
(10-12 M) range (Bradfield et al., 1988). The EC50 (effective concentration giving a fifty
percent response)
of high affinity PAHs, such
as 3-methylcholanthrene and
benzo(a)pyrene, for induction of CYP1A1 enzymatic activity is 1,000 to 10,000 greater
16
than EC50 for TCDD (Berghard et al., 1992; Riddick et al., 1994).
No endogenous
ligand for the AhR has yet been identified. High affinity HAH ligands bind within a
rectangular binding site of approximately 3x10 A in the AhR ligand binding domain. It is
postulated that in order to accomodate larger ligands the site must be increased to 7x10 A
(Landers and Bunce, 1991)
Using radiolabelled TCDD, Poland and coworkers first identified the Ah receptor
in C57BL/6J mice (Poland et al., 1976). The quest to find a receptor for dioxin and
related compounds began in the early 1970s
when it was shown that 3-
methylcholanthrine was capable of inducing AHH activity in the "responsive" C57BL/6
inbred mouse strain but not in the "nonresponsive" DBA/2 inbred mouse strain (Nebert
and Gelboin, 1969). Crossbreeding studies demonstrated that the responsive phenotype
segregated as a dominant trait and was governed by a single autosomal gene (Nebert et
al., 1972). The Ah receptor has been found in virtually all tissues including lung, liver,
kidney, placenta, tonsils, B lymphocytes, and ovarian and breast cancer cells (Rowlands
and Gustafsson, 1997). The Ah locus which encodes the Ah receptor is found on mouse
chromosome 12 and human 7p21 (Nebert et al., 1972; Ema et al., 1994).
Dose-response curves for induction of aryl hydrocarbon hydroxylase activity (a
biomarker of TCDD activity)
demonstrated that a number of inbred responsive
(C57BL/6J) strains of mice were approximately tenfold more sensitive to TCDD than the
nonresponsive (DBA/2) strains (ED50 1.2 vs 13.8 nmol/kg) (Pohjanvitra and Tuomisto,
1994). The defect in nonresponsive mice is due to an Ah receptor with lower affinity for
TCDD than the receptor for responsive mice (Okey et al., 1989). The murine Ah receptor
encoded by the high-affinity alleles Ahb-I, Ahb-2, Ahb-3 and the low affinity allele Ahd
have receptors of 805, 848, 883 and 848 amino acids, respectively, with 8 point mutation
differences within their first 805 amino acids.
Additional carboxy amino acids beyond
805 are the result of a readthrough mutation at the stop codon (Poland et al., 1994).
Differences in affinities for radiolabelled ligand for the receptor between these alleles can
be partly attributed to a specific amino acid substitution. For example, the Ahb-I and Ahb-2
receptors have an ala375 while Ahd has a va1375, which lies within the ligand binding
domains of these receptors (Ema et al., 1994).
17
The Ah receptor belongs to the HLH family of transcription factors. The HLH
proteins derive their name from a region of conserved amino acids that gives rise to a
common secondary structure consisting of two ampiphatic alpha helices separated by a
relatively unconserved loop (Kadesh, 1993). HLH motifs function in both protein
dimerization and DNA binding and are found in transcription factors that bind specific
DNA sequences as homodimers and heterodimers (Rowlands and Gustafsson, 1997).
Misregulated expression of many HLH proteins have been associated with developmental
abnormalities and tumorigenesis (Rowlands and Gustafsson, 1997). HLH proteins are
involved in myogenesis, neurogenesis, sex determination as well as hematopoiesis (Murre
et al., 1994). The bHLH-PAS family of proteins are a subfamily within the HLH proteins
and include Ah receptor, ARNT, SIM and PER as well as the recently cloned hypoxia-
inducible factor 1 alpha (HIF-1 a) (Rowlands and Gustafsson, 1997). These proteins
share not only the HLH domain, but also a region approximately 300 amino acids termed
the PAS (PER, ARNT, AhR, SIM) homology domain containing two copies of an
approximately 50-amino acid degenerate repeat, referred to as PAS A and PAS B repeats
(Nambu et al., 1991). The AhR and ARNT protein are approximately 20% identical to
each other in amino acid sequence (Hankinson, 1995).
The Ah receptor and ARNT have three major domains which are the bHLH
region, the PAS A and B region and the transactivation domain (Rowlands and
Gustafsson, 1997). The ligand-binding domain of AhR has been shown to be within a
192-amino acid region encompassing the PAS B repeat (Hankinson, 1995). CNBr
cleavage and amino acid sequence analysis of murine AhR define a ligand binding
domain (LBD) between amino acids 232 to 402 (Rowlands and Gustafsson, 1997).
Sulfhydryl groups are required for ligand binding. This LBD specifically bound both the
small ligands (TCDD, TCDF) as well as larger PAHs (ICZ,
(3-napthoflavone)
demonstrating that the AhR most likely possess only one LBD (Piskorska-Pliszczynska et
al., 1986; Gillner et al., 1993).
Ligand binding to the Ah receptor provides the signal for AhR-ARNT
heterodimerization, and ARNT is a coregulator of receptor activity only in the presence of
the ligand activated receptor. The bHLH motif of ARNT is required for XRE binding
18
and for heterodimerization with the Ah receptor (Rowlands and Gustafsson, 1997). The
PAS domain stabilizes the AhR-ARNT dimer. ARNT mutants lacking the PAS region
exhibit reduced abilities to dimerize with a full-length Ah receptor and bind XREs (Riess-
Porszasz, 1994). PAS-deleted AhR exhibit reduced XRE-binding activity, although able
to form constitutive ARNT heterodimers (Antonsson et al., 1995). A 132 amino acid
segment overlapping the ligand binding site is required for interaction of Ah receptor with
hsp90 (Rowlands and Gustafsson, 1997).
The Ah receptor and ARNT have transactivation domains at their C-terminus
(White law et al., 1994). This domain is involved in transcriptional activation of dioxin-
responsive genes.
Activation domains have been divided into distinct classes
corresponding to their amino acid composition: rich in glutamines (Q-rich); rich in acidic
amino acids (i.e., aspartate and glutamate); or with a high concentration of prolines,
serines and/or threonines (P/S/T) (Tjian and Maniatis, 1994). The transactivation domain
of ARNT is about 10 to 20% as potent as the Ah receptor activation domain (Rowlands
and Gustafsson, 1997). The Q-rich C-terminus of ARNT has an activation domain that
can be further divided into two loosely homologous subdomains containing critical
hydrophobic and acidic residues (Sogawa et al., 1995). The Ah receptor has acidic, Q
rich and P/S/T-rich subdomains within its transactivation domain. Each are capable of
activating transcription when expressed independently and can activate transcription
synergistically when expressed together as a single protein. The activity of the C-terminal
AhR activation domain varies depending on the promoter context and cell type,
suggesting that this activation domain makes contacts with cell-specific coactivators
(Whitelaw et al., 1994). The Ah receptor also contains a cis-acting repression domain
that lies in a region also involved in hsp90 binding and which confers conditional and
cell-type specific repression of Ah receptor transactivation (Ma et al., 1995).
A consensus sequence for the XRE (5'-TnGCGTG-3') is highly conserved in
many mammalian species (Hines et al., 1988). The 5'-CGTG-3' domain is essential for
receptor-enhancer interaction as shown by mutation analysis of the XRE.
This is
however not sufficient to maintain enhancer function (Lusska et al., 1993). Methylation-
protection and methylation-interference studies indicate that the liganded receptor
19
contacts both DNA strands at 4 guanine residues contained within the recognition motif,
implying that the ligand-activated receptor interacts with the major groove of the double
helix (Shen and Whitlock, 1989). Covalent crosslinking analysis and oligonucleotide
selection-amplification analysis have determined that the AhR and ARNT recognize the
5'-TnGC and GTG-3' (Swanson et al., 1995) XRE half-sites, respectively. Ligation
mediated polymerase chain reaction (LMPCR) was used to demonstrate that binding of
TCDD-activated AhR-ARNT complexes to XREs in vivo disrupts the local enhancer
structure of the chromatin and allows access of general transcription factors to the
promoter without disrupting the intervening chromatin.
These changes in chromatin
structure are graded and parallel to the graded induction of CYP1A1 transcription by
TCDD (Okino and White law, 1995). Protein-binding assays have been used to show that
direct contacts occur between the AhR activation domain and the basal transcription
factor complex required for transcription initiation from genes (Rowlands et al., 1996).
The binding of AhR to XRE is protein kinase C (PKC) dependant in TCDD
induced CYP1A1 expression in human and mouse derived cell lines (Carrier et al., 1992).
AhR-ARNT heterodimerization require phosphorylation (Pongratz et al., 1991). Only
phosphorylation of the ARNT protein is required for human and mouse AhR-ARNT
heterodimers to bind to DNA (Berghard et al., 1993). On the contrary, AhR binding to
XRE can be detected in guinea pig hepatic cytosol in the absence of any detectable PKC
activity (Schafer et al., 1993). AhR phosphorylation have been localized to two regions
on the C-terminal half of the mouse protein with one region within or adjacent to a DNA-
binding repressor domain that prevents constitutive XRE binding by AhR-ARNT
complexes. The other region is located at the guanine-rich carboxyl terminus (Dolwick et
al., 1993).
The Ah receptor regulates the expression of several genes that encode phase I and
phase II drug metabolizing enzymes as well as proteins involved in cell growth and
differentiation.
CYP1A 1 ,
CYP1A2,
glutatione-S-transferase
Ya,
aldehyde-3-
dehydrogenase and NAD(P)H:quinone oxidoreductase are drug metabolizing enzymes
that have functional XREs in enhancer regions of their genes and whose expression is
altered by dioxin (Rowlands and Gustafsson, 1997). Transforming growth factor-a
20
(TGF-a) expression is induced in keratinocyte cell lines by TCDD (Choi et al., 1991).
However, this induction is not dependant on XRE binding. TCDD considerably enhanced
the endotoxin-stimulated increase in the serum concentrations of tumor necrosis factor-a
in mice in an Ah receptor dependant fashion. DRE binding does not seem to be necessary
(Rowlands and Gustafsson, 1997).
2.5 Non-Aryl Hydrocarbon Receptor Pathway for Dioxin Toxicity
Alteration in gene expression by TCDD does not always occur via binding of the
transformed Ah receptor complex to XREs, resulting in an increase in the rate of
synthesis of the corresponding mRNA. Induction of TGF-a in human keratinocytes is
the result of stabilization of its mRNA rather than stimulation of mRNA synthesis
(Rowlands and Gustafsson, 1997).
Induction of the c-fos and Jun-B protooncogenes
appear to occur through an ARNT and Ah receptor independent mechanism (Puga et al.,
1992). TCDD causes a twofold increase in phosphorylation of proteins in extracellular
fraction of adipose tissue in vitro, and also increased protein kinase C activity in a
cytosolic extract of liver within minutes of exposure (Enan and Matsumura, 1994). This
time frame is too short to allow for AHRC mediated signal transduction. Other proteins
or mRNA that are modulated by dioxin but are not AHRC dependant are ornithine
decarboxylase (Nebert et al., 1980) , a 60-1(D microsomal esterase (Korza and Ozols,
1988), malic enzyme (Roth et al., 1988), transforming growth-01 protein and mRNA
(Abbott et al., 1992), aldehyde dehydrogenase ALD3m (Vasiliou et al., 1992), interleukin
10 mRNA, epidermal transglutaminase (Puhvel et al., 1984), protein kinase C activity
(Bombick et al., 1988), c-erb-A mRNA, phosphorylation of pp60src, and Ras-associated
GTP binding activity (Bombick et al., 1988).
Many changes in biochemical parameters occur as secondary or higher order
responses to TCDD exposure (Hankinson, 1995). In vivo, TCDD treatment leads to
autophosphorylation and internalization of hepatic EGF receptor (Lin et al., 1991). This
may result from induction of TGF-a which is a ligand for EGF receptor (Hankinson,
1995). TCDD is an antiestrogen and modulates a broad range of estrogen responses in
cell culture systems and in whole organisms. TCDD reduces the level of binding of
21
estradiol to the estrogen receptor, the amount of estrogen receptor protein, the level of
binding of estrogen receptor to estrogen response element, and transcriptional activation
of estrogen responsive genes in MCF-7 human breast cancer cells and Hepa-1 cells.
However, neither estrogen receptor mRNA levels nor the rate of estrogen receptor gene
transcription were affected (Wang et al., 1993). TCDD also increased the tyrosine
phosphorylation of certain liver proteins, including the cyclin-dependant kinases, p34cdc2
and p33cdk2 (Ma and Babish, 1993). TCDD decreased glucose transporting activity in
the plasma membrane of adipose tissue of guinea pig pancreas (Enan et al., 1992). All of
the above responses to dioxin have not yet been proven to directly involve Ah receptor
(Hankinson, 1995).
2.6 Alteration in Intermediary Metabolism by Dioxin
Rats treated with a lethal dose of TCDD and maintained on total parenteral
nutrition experienced hypoglycemia. TCDD has been shown to impair gluconeogenesis
from alanine by inhibiting several key enzymes of gluconeogenesis. Phosphoenolpyruvate
carboxykinase, pyruvate carboxylase, acetyl coenzyme A carboxylase, glucose-6phosphatase and fructose-1,6-bisphosphatase are downregulated by dioxin (Weber et al.,
1992).
However, dioxin does not change the activity of the key glycolytic enzyme,
pyruvate kinase (Weber et al., 1991). Hepatic glycogenolysis can be inhibited by TCDD.
Rats exposed to dioxin accumulate glycogen in their livers during the first six days post
exposure. TCDD also inhibits hepatic glycogen phosphorylase activities in rats. A dose-
dependant increase in hepatocellular glycogen content in TCDD exposed hamsters was
also observed. Impaired glycogenic capacity might be related to the finding that TCDDtreated rats survived longer receiving a high carbohydrate diet rather than a high fat diet.
Furthermore, elimination of [14q-glucose derived radioactivity was retarded in TCDDdosed rats, whereas the exhalation of 14CO2, following administration of [14C]palmitic
acid, was promoted (Pohjanvitra and Tuomisto, 1994).
TCDD exposure of rats increased concentrations of serum lipids. Acute exposure
to TCDD can result in relatively large changes in parameters related to lipid metabolism.
In rats, the clearance of chilomicra triglycerides was decreased by TCDD. This was
"-)2
coupled with marked shifts in chilomicra apoprotein composition i.e., decreases in
apoprotein A-1 and increase in apoprotein E.
TCDD increases plasma levels of
triglycerides, free fatty acids and cholesterol. TCDD also inhibits cellular respiration and
uncouples oxidative phosphorylation in beef heart mitochondria in vitro (Pohjanvitra and
Tuomisto, 1994).
2.7 Pyruvate Carboxylase: A Key Enzyme in Gluconeogenesis
The biosynthesis of glucose from noncarbohydrate presursors is known as
gluconeogenesis. Gluconeogenesis occurs primarily in the liver and to a smaller extent in
the kidney. Gluconeogenesis occupies a central role in metabolism by providing both
fuel (glucose) and precursor molecules essential for synthesis of amino acids and
carbohydrates via the citric acid cycle. Glucose is the primary energy source in the brain
and red blood cells. Under conditions of fasting or starvation, glycogen stored in the liver
provides the brain with glucose for only half a day.
Gluconeogenesis is responsible for
64% of total glucose production over the first 22 hours of the fast and account for almost
all the glucose production by 46 hours. Thus gluconeogenesis provides a substantial
fraction of the glucose produced in fasting humans, even after a few hours (Voet and
Voet, 1995).
Pyruvate carboxylase is a key enzyme in gluconeogenesis. It catalyzes the ATPdriven formation of oxaloacetate from pyruvate and HCO3-. Oxaloacetate is the starting
material for gluconeogenesis. Lactate, pyruvate, citric acid cycle intermediates and carbon
skeletons of most amino acids (exceptions are leucine and lysine) are noncarbohydrate
precursors that are converted to oxaloacetate before entering the gluconeogenic pathway.
Oxaloacetate is converted to phosphoenolpyruvate (PEP) by phosphoenolpyruvate
carboxykinase (PEPCK). The synthesis of glucose from PEP is then catalyzed by many of
the same enzymes required for glycolysis (Barritt, 1985).
PC resides in the mitochondrial matrix where it plays an anaplerotic role in
intermediary metabolism. It functions mainly as a gluconeogenic enzyme in the liver and
kidney. Oxaloacetate synthesis is an anaplerotic (filling up) reaction that increases citric
acid cycle activity. Citrate provides acetyl groups for the de novo biosynthesis of fatty
23
acids in adipose tissue and lactating mammary gland. Aspartate, glutamate, glutamine
and their derivatives and certain neurotransmitters such as acetylcholine and yaminobutyric acid are synthesized from oxaloacetate. Thus PC also plays a role in the
synthesis of certain amino acids (Barritt, 1985).
Formation of oxaloacetate from pyruvate or citric acid cycle intermediates occurs
only in the mitochondrion.
However, the enzymes that synthesize glucose from
phosphoenolpyruvate (PEP) are cytosolic. Oxaloacetate must first be converted either to
aspartate or malate, for which mitochondrial transport systems exist. Transport of
oxaloacetate by the malate dehydrogenase route results in the transport of reducing
equivalents from mitochondrion to the cytosol, since it utilizes mitochondrial NADH and
produces cytosolic NADH. Cytosolic NADH is required for gluconeogenesis so, under
most conditions, the route through malate is necessary. The aspartate aminotransferase
route does not involve NADH. If the gluconeogenic precursor is, however lactate, its
oxidation to pyruvate generates cytosolic NADH so that either transport route may then
be used (Voet and Voet, 1995).
2.7.1 Structure and Regulation of the Pyruvate Carboxylase Enzyme
Pyruvate carboxylase was discovered by Merton Utter in 1959. The PC enzyme
consists of four identical subunits (Mr 130,000) each with a biotin prosthetic group.
Biotin is covalently attached to the enzyme by an amide linkage between the carboxyl
group of its valerate side chain and the E-amino group of a lysine located 35 residues from
the carboxy terminus of the enzyme, to form a biocytin (alternatively, biotinyllysine)
residue. The biotin ring system is therefore at the end of a 14A-long flexible arm. Each
subunit consists of three functional domains: the biotin carboxylation domain, the
transcarboxylation domain and the biotinyl domain. Biotin functions as a CO2 carrier
between the two catalytic sites by forming a carboxyl substituent at its ureido group (Voet
and Voet, 1995).
The pyruvate carboxylase reaction occurs in two phases. In phase I, biotin is
carboxylated at its N1' atom by bicarbonate ion in a three-step reaction. The hydrolysis of
ATP to ADP + Pi functions to dehydrate bicarbonate via the intermediate formation of
24
carboxyphosphate. This yields free CO2 which has sufficient free energy to carboxylate
biotin. The resulting carboxyl group can be transferred to pyruvate without further free
energy input. In phase II, the activated carboxyl group is transferred from carboxybiotin
to pyruvate in a three-step reaction to form oxaloacetate. These two reaction phases
occur on different subsites of the same enzyme. The 14-A arm of biocytin serves to
transfer the biotin ring between the two sites (Voet and Voet, 1995).
PC is subject to both short term and long term regualtion. These two types of
mechanisms permit an increase in the rate of gluconeogenesis during starvation, diabetes,
neonatal development and in periods of enhanced cellular metabolism induced by thyroid
hormones (Barritt, 1985). Regulation of PC gene expression during the differentiation of
3T3-L1 mouse fibroblasts to adipocytes is exerted at a pretranslational level. PC mRNA
levels increases 9 to 10 fold with a concomitant 23 fold increase in the PC protein during
the conversion of 3T3-L1 fibroblasts into adipocytes (Zhang et al., 1995). However, little
is known about the mechanism of hormonal regulation of PC expression at the molecular
level. In liver, kidney and adipose tissues, changes in the total amount of PC through
changes in the rate of enzyme synthesis is a key mechanism for long term regulation.
Short term regulation of PC is achieved by powerful allosteric activator acetyl-
CoA. The enzyme is all but inactive without bound acetyl-CoA. Accumulation of the
citric acid substrate acetyl-CoA therefore signals the need for more oxaloacetate. High
concentrations of ATP and NADH inhibits the citric acid cycle as this indicates a satisfied
demand for oxidative phosphorylation. Oxaloacetate undergoes gluconeogenesis during
these periods (Barritt, 1985).
PC activity in adipocytes is decreased after exposure to cAMP.
This is
accompanied by precipitous fall in the relative abundance of PC mRNA. Thus cAMP not
only exerts its effects on adipocyte PC by enzyme inactivation but may also affect PC
gene transcription and/or stability of the encoding mRNA. Other lipogenic enzymes, fatty
acid synthase, lipoprotein lipase and glycerophosphate dehydrogenase is also downregulated by cAMP, a known lipolytic agent (Zhang et al., 1995).
25
2.7.2 Pyruvate Carboxylase Gene Structure
The 4.0kb mRNA from mouse adipocyte PC is similar in size to the mRNA
encoding PC in other mammalian species. The PC mRNA includes a 3534 nucleotides
coding sequence and non-coding regions of 100 and 433 nucleotides at the 5' and 3' ends,
respectively. Five alternative forms of rat PC cDNA have been identified in the liver,
kidney, brain and adipose tissue and these are expressed in a tissue specific manner. Two
alternative forms of human PC cDNA have also been identified in liver. These PC
cDNA share a common coding region but differ in their 5'-untranslated region (UTR)
suggesting that they are generated by alternative splicing of the primary transcript. Tissue
specific expression of a single gene can be achieved by the production of several types of
mRNA by differential splicing of the intron-derived material from the 5' UTR of the
primary transcript. Southern blot analysis of the restriction enzyme digested rat genomic
DNA revealed that PC is encoded by a single copy gene. Alternative splicing also occurs
from the related biotin-enzyme, acetyl CoA carboxylase. Multiple forms of ACC mRNA
having the same coding sequence but differing in their 5' UTR have been identified in
both rat (5 forms) and human (2 forms). Alternative splicing at the 5' end of the single
rat ACC gene is under the control of two distinct promoters which are highly regulated
(Jitrapakdee et al., 1996).
The rat PC gene structure has been characterized by Jitrapakdee (1997). The rat
PC gene spans over 40 kilobases and is composed of 19 coding exons and 4 5'
untranslated regions.
Alternative transcription from two distinct promoters are
responsible for the production of different primary transcripts, which then are
differentially spliced to five species of mature transcripts. Class I mRNAs (rUTR A,
rUTR B and rUTR C), derived from proximal promoter (1B) are expressed in liver
kidney, adipose tissue and lactating mammary gland. Since liver and kidney are the
gluconeogenic tissues while adipose tissue and lactating mammary gland are major
lipophilic organs, 1B may mediate the transcript that is related to these metabolic
pathways. In contrast, class II mRNA (rUTR D and rUTR E) transcripts appear to be
transcribed from a distal promoter (1D) that is located 10 kb upstream from exon 1B.
This transcript is expressed in a wide variety of tissues, suggesting that this form of
26
transcript may be responsible for the synthesis of the enzyme that is used in a more
general anaplerotic role in cells. The proximal promoter is active in gluconeogenic and
lipogenic tissues and contains no TATA or CAAT boxes but includes a sequence that is
typical of housekeeping initiator protein I box while the distal promoter contains three
CAAT boxes and multiple Sp 1 binding sites.
Several potential transcription factor
binding sites such as AP2, cAMP response element binding protein (CREB) nuclear
factor-1 (NF-1), HNF-4, cMyb c-Myc and PEA-3 are present in exon 1B. Insulin response
elements (IRE) and a fat-specific element 1 (FSE1) are found in the rat promoter 1B.
There are also eleven copies of the unusual motif, TCCCC or TCCCCC arranged as
direct or inverted repeats in promoter 1B. Exon 1D has putative binding sites for c-Myc,
Sp 1 ,
AP1, PPAR and Ap2 transcription factors. Results of transient transfection assays
show that 153 and 187 base pairs, preceeding the transcription start sites of the proximal
and distal promoters, respectively, are required for basal transcription (Jitrapakdee et al.,
1997).
Recently, a 1.4 kb region of the mouse hepatic PC promoter has been cloned and
sequenced. Several common transcription factor binding elements have been predicted to
exist in this region as shown by computer aided sequence analysis. These are Spl, OCT-
1, HNF-4, CREB, CCAAT box and 17 E-boxes (Ryu, 1996; Sparrow, 1997). Ten of
these E-boxes are juxtaposed to putative TFII-I elements located within -1185 to -757 by
region, repeating every 39 nucleotides (Sparrow, 1997). Like the rat PC promoter region,
the mouse promoter region also has several repeats of the unusual sequence CCCCT. A
7.0 kb intron is located immediately upstream of the transcription start site. Within the
first 200 by of this intron are pyrimidine rich sequences which may possess a novel DNA
structure including a triple helix and a GAGA factor binding site (Ryu, 1996). Transient
transfection assays with the 1.4 kb region has shown that it has promoter activity (Ryu,
1996; Sparrow, 1997).
27
2.8 References
Abbott, B. D., Birnbaum, L. S., and Pratt, R. M. 1987. 2,3,7,8-TCDD-induced
hyperplasia of the uteral epithelium produces hydronephrosis in murine fetuses.
Teratology. 35: 329-334.
Abbott, B. D., Harris, M. W., and Birnbaum, L. S. 1992. Comparisons of the effects of
TCDD and hydrocortisone on growth factor expression provide insight into their
interaction in the embryonic mouse palate. Teratology. 45: 35-53.
Allen, J. R., and Norback, D. H. 1973. Polychlorinated biphenyl- and triphenyl- induced
gastric mucosal hyperplasia in primates. Science. 179: 498-499.
Allen, J. R., Barsotti, D. A. Van Miller, J. P., Abrahamson, L. J., and Lalich, J. J. 1977.
Morphological changes in monkeys consuming a diet containing low levels of
2,3 ,7,8-tetrachlorodibenzo-p-dioxin. Food and Cosmetic Toxicology. 15: 401410.
Antonsson, C., White law, M. L., McGuire, J., Gustafsson, J. -A., and Poellinger, L. 1995.
Distinct roles of the molecular chaperone hsp90 in modulating dioxin receptor
function via the basic helix-loop-helix and PAS domains. Molecular and Cellular
Biology. 15: 765.
Atkinson, R. 1991. Atmospheric lifetimes of dibenzo-p-dioxins and dibenzofurans.
Science of the Total Environment. 104: 17-33.
Burin, G. J. 1985. Regulation of enzymatic activity. In Pyruvate Carboxylase. eds. D. B.
Keech and J. C. Wallace, 141-177. Boca Raton, FL: CRC Press
Barsotti, D. A., Abrahamson, L. J., and Allen, J. R. 1979. Hormonal alterations in female
rhesus monkeys fed a diet containing 2,3,7,8-tetrachlorodibenzo-p-dioxin.
Bulletin of Environmental Contamination and Toxicology. 211:463-469.
Bastomsky, C. H. 1977. Enhanced thyroxine metabolism and high uptake goiter in rats
after single dose of 2,3,7,8-tetrachlorodibenzo-p-dioxin. Endocrinology. 101: 292297.
Becker, G. M., MuNulty, W. P., and Bell, M. 1979. Polychlorinated biphenyl induced
morphological changes in the gastric mucosa of the rhesus monkey. Laboratory
Investigations. 40: 373-383.
Bergard, A., Gradin, K., and Toftgard, R. 1992. The stability of dioxin-receptor ligands
influence cytochrome P4501A1 expression in human keratinocytes.
Carcinogenesis. 13:651-655.
28
Berghard, A., Gradin, K., Pongratz, L., White law, M., and Poellinger, L. 1993. Crosscoupling of signal transduction pathways: the dioxin receptor mediates induction
of P-4501A1 expression via a protein kinase C-dependant mechanism. Molecular
and Cellular Biology. 13: 677.
Birnbaum, L. S. 1991. Developmental toxicity of TCDD and related compounds: Species
sensitivities and differences. In Biological Basis for Risk Assessment of Dioxins
and Related Compounds. eds. M. A. Gallo, R. J. Scheuplein, and K. A. Heijden,
51-68. Cold Springs Harbor, NY: Banbury Report 35, Cold Springs Harbor
Laboratory Press.
Bombick, D. W. Jankun,
J. Tullis, K., and Matsumura, F. 1988. 2,3,7,8tetrachlorodibenzo-p-dioxin causes increases in expression of c-erb-A and levels
of protein-tyrosine kinases in selected tissues of responsive mouse strains.
Proceedings. National Academy of Sciences. U.S.A. 85: 4128-4132.
Bonsotti, D. A., Abrahamson, L. J., and Allen, J. R. 1979. Hormonal alterations in
female rhesus monkeys fed a diet containing 2,3,7,9-tetrachlorodibenzo-p-dioxin.
Bulletin of Environmental Contamination and Toxicology. 211: 463-469.
Bradfield, C. A., Kende, A. S., and Poland, A. 1988. Kinetic and equilibrium studies of
Ah receptor-ligand binding: use of [1251] 2-iodo-2,8-dibromodibenzo-p-dioxin.
Molecular Pharmacology. 34: 229-237.
Brinkman, V. A. and DeKok. A. 1980.
Production, properties and usage. In
Halogenated Biphenyls, Terphenyls, Napthalenes, Dibenzodioxins and Related
Products. ed. R. D. Kimbrough, 1-40. Amsterdam: North Holland Medical Press.
Carrier, F., Owens, R. A., Nebert, D. W., and Puga, A. 1992. Dioxin-dependant activation
of murine cyp 1 a-1 gene transcription requires protein kinase C-dependant
phosphorylation. Molecular and Cellular Biology. 12: 1856-1863.
Chahoud, I., Krowke, R., Schimnel, A., Merker, H., and Neubert, D. 1989. Reproductive
toxicity and pharmacokinetics of 2,3,7,8-tetrachlorodibenzo-p-dioxin. I. Effect of
high doses on the fertility of male rats. Archives of Toxicology. 63: 432-439.
Chen, H. S., and Perdew, G. H. 1994.
Subunit composition of the heherodimeric
cytosolic aryl hydrocarbon receptor complex. Journal of Biological Chemistry.
269: 27554-27558.
Choi, E. J., Toscano, D. G., Ryan, J. A., Riedel, N., and Toscano, W. A. 1991. Dioxin
induces transforming growth factor-a in human keratinocytes. Journal of
Biological Chemistry. 266: 9591-9597.
29
Courtney, K. D., Gaylor, D. W., Hogan, M. D., Falk, H. L., Bates, R. R., and Mitchell, T.
1970. Teratogenic evaluation of 2,4,5-T. Science. 168: 864-866.
Couture, L. A., Abbott, B. D., and Birnbaum, L. S. 1990. A critical review of the
developmental toxicity and teratogenicity of 2,3,7,8-tetrachlorodibenzo-p-dioxin:
Recent advances toward understanding the mechanism. Teratology. 42: 619-627.
Crow, K. D. 1970. Chloracne. Transactions. St. Johns Hospital. Dermatological Society.
56: 77-99.
Della Porta, G., Dragani, T. A., and Sozzi, G. 1987. Carcinogenic effects of infantile and
long-term 2,3,7,8-tetrachlorodibenzo-p-dioxin treatment in the mouse. Tumori.
73: 99-107.
De Vito, M. J., Thomas, T., Martin, E., Umbreit, T. H, and Gallo, M. A.
1992.
Antiestorgenic action of 2,3,7,8-tetrachlorodibenzo-p-dioxin: Tissue-specific
regulation of estrogen receptor in CD1 mice.
Toxicology and Applied
Pharmacology. 113: 284-292.
De Vito, M. J., and Birnbaum, L. S. 1994. Toxicology of dioxins and related chemicals.
In Dioxins and Health. ed. A. Schecter, 139-162. NY: Plenum Press.
Dolwick, K. M., Swanson, H. I., and Bradfield, C. A. 1993. In vitro analysis of the Ah
receptor domains involved in ligand-activated DNA recognition. Proceedings.
National Academy of Sciences. U.S.A. 90: 8566-8570.
Ema, M., Matsushita, N., Sogawa, K., Ariyama, T., Inazawa, T., Nemoto, T., Ota, M.,
Oshimura, M., and Fujii-Kuriyama, Y. 1994. Human aryl hydrocarbon receptor:
Function, expression and chromosomal assignment to 7p21. Journal of
Biochemistry. 116: 845-851.
Enan, E., Lui, P. C. C., and Matsumura, F. 1992. 2,3,7,8-Tetrachlorodibenzo-p-dioxin
causes reduction of glucose transporting activities in the plasma membranes of
adipose tissue and pancreas from guinea pig. Journal of Biological Chemistry.
267: 19785-19791.
Enan, E., and Matsumura, F. 1994. Significance of TCDD-induced changes in protein
phosphorylation in the adipocyte of male guinea pigs. Journal of Biochemical
Toxicology. 9: 159-170.
Faith, R. E., and Moore, J. A. 1977. Impairment of thymus-dependant immune function
by exposure of the developing immune system to 2,3,7,8-tetrachlorodibenzo-pdioxin (TCDD). Journal of Toxicology and Environmental Health. 3: 451-464.
30
Firestone, D. 1984. Chlorinated aromatic compounds and related dioxins and furans:
production uses and environmental exposure In Biological Mechanisms of Dioxin
Action. ed. A. Poland and R. D. Kimbrough, 3-16. NY: Banbury Report 18, Cold
Springs Harbor Laboratory Press.
Fowler, B. A., Lucier, G. W., Brown, H. W., and McDaniel, 0. S. 1973. Ultrastructural
changes in rat liver cells following a single oral dose of TCDD. Environmental
Health Perspectives. 5: 141-148.
Fukunaga, B. N., Probst, M. R., Reisz-Proszasz,
S.,
and Hankinson, 0. 1995.
Identification of functional domains of the aryl hydrocarbon receptor. Journal of
Biological Chemistry. 270: 29270-29278.
Gasiewitz, T. A., Holscher, M. A., and Neal, R. A. 1980. The effect of total parenteral
nutrition on the toxicity of 2,3,7,8-tetrachlorodibenzo-p-dioxin in the rat.
Toxicology and Applied Pharmacology. 54: 469-488.
Giavini, E. M., Prati, M., and Viswara, C. 1982. Rabbit teratology studies with 2,3,7,8tetrachlorodibenzo-p-dioxin. Environmental Research. 27: 74-78.
Giesy, J. P., Ludwig, J. P., and Tillitt, D. E. 1994. Dioxins, dibenzofurans, PCBs and
colonial fish-eating water birds In Dioxins and Health. ed. A. Schecter, 249-307.
NY: Plenum Press.
Ginner, M., Bergman, J., Canbillau, C., Alexandersson, M., Fernstrom, B., and
Gustafsson, J. -A. 1993. Interactions of indolo[3,2-b]carbazoles and related
polycyclic aromatic hydrocarbons with specific binding sites for 2,3,7,8tetrachlorodibenzo-p-dioxin in rat liver. Molecular Pharmacology. 44: 336-345.
Goldstein, J. A. 1980. Structure-activity relationships for the biochemical effects and the
relationship to toxicity. In Halogenated Biphenyls, Terphenyls, Napthalenes,
Dibenzodioxins and Related Products. ed. R. D. Kimbrough, 151-190.
Amsterdam: North Holland Medical Press.
Gupta, B. N., Vos, J. G., Moore, J. A., Zinkl, J. G., and Bullock, B. C. 1973.
Pathological effects of 2,3,7,8-tetrachlorodibenzo-p-dioxin in laboratory animals.
Environmental Health Perspectives. 5: 125-140.
Hankinson, 0. 1995. The aryl hydrocarbon receptor complex. Annual Review of
Pharmacology and Toxicology. 35: 307-340.
Hines, R. N., Mathis, J. M., and Jacobs, C. S. 1988. Identification of multiple regulatory
elements on the human cytochrome P4501A 1 . Carcinogenesis. 9: 1599-1605.
31
Hinton, D. E., Glaumann, H., Trump, and B. F. 1978. Studies on the cellular toxicity of
polychlorinated biphenyls (PCBs). I. Effects of PCBs on microsomal enzymes and
on synthesis and turnover of microsomal and cytoplasmic lipids of rat liver-a
morphological and biochemical study. Virchows Archives of Biochemistry. 27:
279-306.
Hites, R. A. 1991. Environmental behavior of chlorinated dioxins and furans. Accounts of
Chemical Research. 23: 194-201.
Hsu, S. T., Ma, C. I., Hsu, S. K. H., Wu, S. S., Hsu, N. H. M., Yeh, C. C., and Wu, S. B.
1985. Discovery and epidemiology of PCB poisoning in Taiwan: A four-year
followup. Environmental Health Perspectives. 59: 5-10.
Huff, J., Lucier, G., and Tritscher, A. 1994. Carcinogenicity of TCDD: Experimental,
mechanistic and epidemiological evidence. Annual Review of Pharmacology and
Toxicology. 34: 343-372.
Jitrapakdee, S., Walker, M. E., and Wallace, J. C. 1996. Identification of novel
alternatively spliced pyruvate carboxylase mRNAs with divergent 5'-untranslated
regions which are expressed in a tissue-specific manner. Biochemical and
Biophysical Research Communications. 223: 695-700.
Jitrapakdee, S., Booker, G. W. Cassady, A. I. and Wallace, J. C. 1997. The rat pyruvate
carboxylase gene structure. Journal of Biological Chemistry. 272: 20522-20530.
Jones, G., and Butler, H. W. 1973. A morphological study of the liver lesion induced by
2,3,7,8-tetrachlorodibenzo-p-dioxin in rats. Journal of Pathology. 112: 93-97.
Kadesh, T. 1993. Consequences of heteromeric interactions among helix-loop-helix
proteins. Cell Growth and Differentiation. 4: 49-55.
Kimbrough, R. D. 1974. The toxicity of polychlorinated polycyclic compounds and
related chemicals. Critical Reviews in Toxicology. 2: 445-489.
Kociba, R. J., Keyes, D. G., Beyer, J. E., Carreon, R. M., and Wade, C. E. 1978. Results
of a two-year chronic toxicity study and oncogenicity study of 2,3,7,8tetrachlorodibenzo-p-dioxin in rats. Toxicology and Applied Pharmacology. 46:
279-303.
Kociba, R. J., Keeler, P. A., Park, C. N., and Gehring, P J.
1979. 2,3,7,8Tetrachlorodibenzo-p-dioxin (TCDD): Results of a 13-week oral toxicity study in
rats. Toxicology and Applied Pharmacology. 35: 553-574.
32
Korza, G., and Ozols, J. 1988. Complete covalent structure of 60K-Da esterase isolated
from 2,3,7,8-tetrachlorodibenzo-p-dioxin induced rabbit liver microsomes.
Journal of Biological Chemistry. 263: 3486-3495.
Landers, J. P., and Bunce, N. J. 1991. The Ah receptor and the mechanisms of dioxin
toxicty. Biochemical Journal. 276: 273-287.
Landrigan, P. J. 1980. General population exposure to environmental concentrations of
halogenated biphenyls. In Halogenated Bi phenyls, Terphenyls, Napthalenes,
Dibenzodioxins and Related Products. ed. R. D. Kimbrough, 267-286.
Amsterdam: North Holland Medical Press.
Lin, F. H., Stohs, S. H., Birnbaum, L. S., Clark, G., Lucier, G. W., and Goldstein, J. A.
1991. The effects of 2,3,7,8-tetrachlorodibenzo-p-dioxin on the hepatic estrogen
and glucocorticoid receptors in congenic strains of Ah responsive and Ah nonresponsive C57BL/6J mice. Toxicology and Applied Pharmacology. 108: 129139.
Lucier, G. W., Tritscher, A., Goldsworthy, T., Foley, J., Clark, G., Goldstein, J., and
Maronpot, R. 1991. Ovarian hormones enhance 2,3,7,8-tetrachlorodibenzo-pdioxin mediated increases in cell proliferation and preneoplastic foci in a twostage model for rat hepatocarcinogenesis. Cancer Research. 51: 1391-1397.
Lucier, G. W., Sewall, C. H., Heuvel, V. J., Kanno, J., Tritscher, A. M., and Clark, G. C.
1993. 2,3,7,8-TCDD alterations of thyroid function in a rodent tumor promoter
model. Toxicologist. 13: 313
Lusska, A., Shen, E., and Whitlock, J. 1993. Protein-DNA interactions at a dioxinresponsive enhancer. Analysis of six bona fide DNA-binding sites for the liganded
Ah receptor. Journal of Biological Chemistry. 268: 6575-6580.
Luster, M. I., Boorman, G. A., Dean, J. H., Harris, M. W., Luebke, R. W., Singh, P., and
Moore, M. L. 1980. Examination of bone marrow, immunological parameters
and host susceptibility following Pre- and post-natal exposure to 2,3,7,8tetrachlorodibenzo-p-dioxin
(TCDD).
International
Journal
of
Immunopharmacology. 2: 301-310.
Ma, X., and Babish, J. G. 1993. Acute 2,3,7,8-tetrachlorodibenzo-p-dioxin exposure
results in enhanced tyrosyl phosphorylation and expression of murine hepatic
cyclin dependant
kinases. Biochemical and Biophysical Research
Communications. 197: 1070-1077.
Ma, Q., Doug, L. Q., and Whitlock, J. P. 1995. Transcriptional activation by the mouse
Ah receptor-interplay between multiple stimulatory and inhibitory functions.
Journal of Biological Chemistry. 270: 12697-12703.
33
Madhukar, B. V., Brewster, D. W., and Matsumura, F. 1984. Effects of in vivoadministered 2,3,7,8-tetrachlorodibenzo-p-dioxin on receptor binding of
epidermal growth factor in hepatic plasma membrane of rat, guinea pig, mouse
and hamster. Proceedings. National Academy of Sciences. U.S.A. 81: 7407-7411.
Manahan, S. E. 1994. Water pollution. In Environmental Chemistry. ed. S. E. Manahan,
179-222. Boca Raton, FL: CRC Press, Lewis Publishers.
Masuda, Y. 1994. The Yusho rice oil poisoning incident. In Dioxins and Health. ed. A.
Schecter, 633-659. NY; Plenum Press.
McConnell, E. E., Moore, J. A., and Dalgard, D. W. 1978.
Toxicity of 2,3,7,8Tetrachlorodibenzo-p-dioxin in rhesus monkeys (macacca mullata) following a
single oral dose. Toxicology and Applied Pharmacology. 43: 175-187.
McConnell, E. E., Moore, J. A. Haseman, J. K., and Harris, M. W. 1978.
The
comparative toxicity of chlorinated dibenzo-p-dioxins in mice and guinea pigs.
Toxicology and Applied Pharmacology. 44: 335-356.
McConnell, E. E. 1980. Acute and chronic toxicity, carcinogenesis, teratogenesis and
mutagenesis in animals. In Halogenated Biphenyls, Terphenyls, Napthalenes,
Dibenzodioxins and Related Products. ed. R. D. Kimbrough, 109-150.
Amsterdam: Elsevier North Holland Medical Press.
McConnell, E. E., Moore, J. A., Gupta, B. N., Rakes, A. H., Luster, M. I., and Parker, C.
E. 1980. The chronic toxicity of technical and analytical pentachlorophenol in
cattle. I. Clinicopathology. Toxicology and Applied Pharmacology. 52: 468-490.
McGuire, J., Whitelaw, M. L., Pongratz, I., Gustafsson, J. -A., and Poellinger, L. 1994. A
cellular factor stimulates ligand-dependant release of hsp90 from the basic helixloop-helix domain receptor. Molecular and Cellular Biology. 14: 2438-2446.
McNulty, W. P., Pomerantz, I., and Farrell, T. 1981. Chronic toxicity of 2,3,7,8tetrachlorodibenzofurans for rhesus monkeys. Food and Cosmetic Toxicology.
19: 57-65.
Meyer, B. K., Pray-Grant, M. G., Vanden Heuvel, J. P., and Perdew, G. H. 1998.
Hepatitis B virus X-associated protein 2 is a subunit of the unliganded aryl
hydrocarbon receptor core complex and exhibits transcriptional enhancer activity.
Molecular and Cellular Biology. 18(2): 978-988.
Moore, R. W., Parsons, J. A., Bookstaff, R. C., and Peterson, R. E. 1985. Androgenic
deficiency in male rats treated with 2,3,7,8-tetrachlorodibenzo-p-dioxins.
Toxicology and Applied Pharmacology. 79: 99-111.
34
Murre, C., Bain, G., Van Dijk, M. A., Engel, I., Furnari, B. A., Massari, M. E., Mathews,
J. R., Quong, M. W., Rivera, R. R., and Stuiver, M. H. 1994. Structure and
function of helix-loop-helix proteins. Biochemica et Biophysica Acta. 1218:129135.
Nambu, J. R., Lewis, J. 0., Wharton, K. A., and Crews, S. T. 1991. The Drosophilia
single-minded gene encodes a helix-loop-helix protein that acts as a master
regulator of CNS midline development. Cell. 67: 1157.
Nebert, D. W., and Gelboin, H. V. 1969. The in vivo and in vitro induction of aryl
hydrocarbon hydroxylase in mammalian cells of different species, tissues, strains
and developmental and hormonal states. Archives of Biochemistry and Biophysics.
134:76-89.
Nebert, D. W., Goujon, F. M., and Gielan, J. E. 1972. Aryl hydrocarbon hydroxylase
induction by polycyclic hydrocarbons: simple autosomal dominant trait in the
mouse. Nature. New Biology. 236: 107-110.
Nebert, D. W., Jensen, N. M., Perry, J. W., and Oka, T. 1980. Association between
ornithine decarboxylase induction and the Ah locus in mice treated with
polycyclic aromatic compounds. Journal of Biological Chemistry. 255: 68366842.
Nebert, D. W. 1989. The Ah locus: genetic differences in toxicity, cancer, mutation and
birth defects. Critical Reviews in Toxicology. 20: 153.
Nebert, D. W. Puga, A., and Vasiliou, V. 1993. Role of the Ah receptor and dioxininducible [Ah] gene battery in toxicity, cancer and signal transduction. Annuals.
New York Academy of Sciences. 685: 624-640.
Okey, A. B., Vella, L. M., and Harper, P. A. 1989. Detection and characterization of a
low affinity form of cytosolic Ah receptor in livers of mice nonresponsive to
induction of cytochrome P1-450 by 3-methylcholanthrene.
Molecular
Pharmacology. 35: 823-830
Okino, S. T., and Whitlock, J. P. 1995. Dioxin induced localized, graded changes in
chromatin structure-implications for CYP1A1 gene transcription. Molecular and
Cellular Biology. 15(7): 3714-3721
Parsons, J. R., and Storms, M. C. M. 1989. Biodegradation of chlorinated dibenzo-pdioxins in batch and continuous cultures of strain JBI. Chemosphere. 19: 12971308.
Parsons, J. R. 1992. Influence of suspended sediment on the biodegradation of
chlorinated dibenzo-p-dioxins. Chemosphere. 25: 1973-1980.
35
Piskorska-Pliszczynska, J., Keys, B., Safe, S., and Newman, M. S. 1986. Thecytosolic
binding affinities and AHH induction potencies of 29 polynuclear aromatic
hydrocarbons. Toxicology Letters. 34: 67-74.
R., and Tuomisto, J. 1994.
Short-term toxicity of 2,3,7,8tetrachlorodibenzo-p-dioxin in laboratory animals: effects, mechanisms and
animal models. Pharmacological Reviews. 46: 483-549.
Pohjanvitra,
Poland, A. P., Glover, E., and Kende, A. S. 1976. Stereospecific, high affinity binding of
2,3,7,8-tetrachlorodibenzo-p-dioxin by hepatic cytosol: Evidence that the binding
species is the receptor for the induction of aryl hydrocarbon hydroxylase. Journal
of Biological Chemistry. 251: 4936-4946.
Poland, A., and Knutson, J. C. 1982. 2,3,7,8-Tetrachlorodibenzo-p-dioxins and related
halogenated aromatic hydrocarbons: Examination of the mechanisms of toxicity.
Annual Review of Pharmacology and Toxicology. 22: 517-554.
Poland, A., Palen, D., and Glover, E. 1994. Analysis of the four alleles of the murine aryl
hydrocarbon receptor. Molecular Pharmacology. 46: 915.
Pongratz, I., Stromstedt, P. E., Mason, G. G. and Poellinger, L. 1991. Inhibition of the
specific DNA binding activity of the dioxin receptor by phosphatase treatment.
Journal of Biological Chemistry. 266: 16813-16817.
Puga, A., Nebert, D. W., and Carrier, F. 1992. Dioxin induced expression of c-fos and cjun proto-oncogenes and a large increase in transcription factor AP-1. DNA Cell
Biology. 11: 269-281.
Puhvel, S. M., Erlt, D. C., and Lynberg, C. A. 1984. Increased epidermal
transglutaminase activity following 2,3,7,8-tetrachlorodibenzo-p-dioxin: In vivo
and in vitro studies with mouse skin. Toxicology and Applied Pharmacology. 73:
42-47.
Rao, M. S., Subbarao, V., Prasad, J. D., and Scarpelli, D. G. 1988. Carcinogenicity of
2,3,7,8-tetrachlorodibenzo-p-dioxin
in
the
Syrian
golden
hamster.
Carcinogenesis. 9: 1677-1679.
Rappe, C. 1980. Chemical properties and analytical methods. In Halogenated Biphenyls,
Terphenyls, Napthalenes, Dibenzodioxins and Related Products. ed. R. D.
Kimbrough, 41-76. Amsterdam: Elsevier North Holland Medical Press.
Reisz-Proszasz, S., Probst, M. R., Fukunaga, B. N., and Hankinson, 0. 1994.
Identification of functional domains of the aryl hydrocarbon receptor nuclear
translocator protein (ARNT). Molecular and Cellular Biology. 14(9): 6075-6086.
36
Riddick, D. S., Huang, Y., Harper, P. A. Okey, A. B. 1994. 2,3,7,8-Tetrachlorodibenzo-pdioxin versus 3-methylcholanthrene: comparative studies of aromatic hydrocarbon
(Ah) receptor binding, transformation, and induction of CYP1A1 expression.
Journal of Biological Chemistry. 269: 12118-12128.
Romkes, M., and Safe, S. 1988. Comparative activities of 2,3,7,8-tetrachlorodibenzo-pdioxin and progesterone as antiestrogens in female rat uterus. Toxicology and
Applied Pharmacology. 92: 368-380.
Rossberg, M. 1986. Chlorinated hydrocarbons. In Ullman's Encyclopedia of Industrial
Chemistry. ed. W. Gerhartz, NY: VCH Publishers.
Roth, W., Voorman, R., and Aust, S. D. 1988. Activity of thyroid hormone-inducible
enzymes following treatment with 2,3,7,8-tetrachlorodibenzo-p-dioxin.
Toxicology and Applied Pharmacology. 92: 65-74.
Rowlands, J. C., McEwan, I. J., and Gustafsson, J. -A. 1996. Transactivation by the
human dioxin receptor and Amt proteins: direct interactions with basal
transcription factors. Molecular Pharmacology. 50: 538-548.
Rowlands, J. C., and Gustafsson, J, -A. 1997. Aryl hydrocarbon receptor mediated signal
transduction. Critical Reviews in Toxicology. 27: 109-134.
Ryu, B. 1996. Characterization of pyruvate carboxylase responses to 2,3,7,8tetrachlorodibenzo-p-dioxin exposure in C57BL/6J Ah" mice.
Thesis
Dieesrtation, Oregon State University, Corvallis, OR.
Safe, S., and Hutzinger, 0. 1990. PCDDs and PCDFs: Sources and Environmental
Impact. In Polychlorinated Dibenzo-p-Dioxins and -furans (PCDDs/PCDFs):
Sources and Environmental Impact, Epidemiology, Mechanisms of Action, Health
Risks. 3. eds. S. Safe and 0. Hutzinger, 1-20, Environmental Toxin Series 3.
Berlin: Springer-Verlag.
Schafer, M. W., Madhukar, B. V., Swanson, H. I., Tullis, K., and Denison, M. W. 1993.
Protein kinase C is not involved in Ah receptor transformation and DNA binding.
Archives of Biochemistry and Biophysics. 307: 267-271.
Shen, E., and Whitlock, J. 1989. The potential role of DNA-methylation in the response
to 2,3,7,8-tetrachlorodibenzo-p-dioxin. Journal of Biological Chemistry. 264:
17754-17758.
Sogawa, K., Iwabuchi, K., Abe, H., and Fujikuriyama, Y. 1995. Transcriptional
activation domains of the Ah receptor and Ah receptor nuclear translocator.
Journal of Cancer Research and Clinical Oncology. 121: 612-620.
37
Sparrow, B. R. 1997. Characterization of 2,3,7,8-tetrachlorodibenzo-p-dioxin (TCDD)
induced modification of hepatic pyruvate carboxylase gene expression in
C57BL/6J male mice. Thesis Dissertation. Oregon State University, Corvallis,
OR.
Sparschu, G. L., Dunn, F. L., and Rome, V. K. 1971. Study of the teratogenicity of
2,3,7,8-tetrachlorodibenzo-p-dioxin in rat. Food and Cosmetic Toxicology. 9, 405412.
Stohs, S. J., Abbott, B. D., Lin, F. H., and Birnbaum, L. S.
Induction of
ethoxyresorufin-o-deethylase and inhibition of glucocorticoid receptor binding in
skin and liver of haired and hairless HRS/J mice by topically applied 2,3,7,8tetrachlorodibenzo-p-dioxin. Toxicology. 65 : 123-136.
1990.
Sutter, T. R., Guzman, K., Do ld, K. M., and Greenlee, W. F. 1991. Targets for dioxin:
genes for plasminogen activator inhibitor-2 and interleukin-113. Science. 254: 415418.
Swanson, H. I., Chan, W. K., and Bradfield, C. A. 1995. DNA binding specificities and
pairing rules of the Ah receptor, ARNT and SIM proteins. Journal of Biological
Chemistry. 270: 26292-26302.
Sweeney, M. H., Hornung, R. W., Wall, D. K., Fingerhut, M. A., and Halperin, W. E.
1992. Prevalence of diabetes and eleveted serum glucose levels in workers
exposed to 2,3,7,8-tetrachlorodibenzo-p-dioxin (TCDD), presented @ Dioxin
1992, Finland, August 24-28.
Taylor, J. S. 1974. Chloracne-A continuing problem. Cutis. 13: 585-591.
Theobald, H. M., and Peterson, R. E. 1994. Developmental and reproductive toxicity of
dioxins and other Ah receptor agonists. In Dioxins and Health. ed. A. Schecter,
309-346. NY: Plenum Press.
Thunberg, T. 1984. Effect of TCDD on Vitamin A and its relation to TCDD-toxicity. In
Biological Mechanisms of Dioxin Action. eds. A. Poland and R. D. Kimbrough,
333-344. Cold Springs Harbor. Banbury Report 18, NY: Cold Springs Harbor
Laboratory Press.
Tjian, R., and Maniatis, T. 1994. Transcriptional activation: a complex puzzle with few
easy pieces. Cell. 77: 5-8.
Toth, K., Somafai-Reele, S., Sugar, J., and Bence, J. 1979. Carcinogenicity of the
herbicide 2,4,5-trichlorophenoxyethanol containing dioxin and of pure dioxin in
Swiss mice. Nature. 278: 548-549.
38
Travis, C. C., Hattemer-Frey, H. A., and Slibergeld, E. 1989. Dioxin, dioxin everywhere.
Environmental Science and Technology. 23: 1061-1063.
Tysklind, M., Fangmank, I., Mankund, S., Lindskog, L., Thaning, L., and Rappe, C. 1993.
Atmospheric transport and transformation of polychlorinated dibenzo-p-dioxins
and dibenzofurans. Environmental Science and Technology. 27:2190-2197.
Umbreit, T. H., Hesse, E. J., MacDonald, G. J., and Gallo, M. A. 1987. Effects of
TCDD-estradion interactions in three strains of mice. Toxicology Letters. 40: 1-9.
Van Miller, J. P., Lalich, J. J., and Allen, J. R. 1977. Increased incidence of neoplasms
in rats exposed to low levels of tetrachlorodibenzo-p-dioxin. Chemosphere. 6:
537-544.
Vasiliou, V., Puga, A., and Nebert, D. W. 1992. Negative regulation of the murine
cytosolic aldehyde dehydrogenase-3 (Aldh-3c) gene by functional CYP1A1 and
CYP1A2 proteins. Biochemical Biophysical Research Communications. 187: 413419.
Vecchi, A., Mantovani, A., Sironi, M., Luini, M., Cairo, W., and Garattini, S. 1980.
Effect of acute exposure to 2,3,7,8-tetrachlorodibenzo-p-dioxin on humoral
antibody production in mice. Chemical and Biological Interactions. 30: 337-340.
Voet, D. and Voet, J. G. 1995. Other pathways of carbohydrate metabolism. In
Biochemistry. eds. D. Voet and J. G. Voet, 599-614. NY: John Wiley and Sons.
Vos, J. G., and Beems, R. B. 1971. Dermal toxicity studies of technical polychlorinated
biphenyls and fractions thereof in rabbits.
Toxicology and Applied
Pharmacology. 19: 617-633.
Vos, J. G., Moore, J. A., and Zinkl, J. G. 1974. Toxicity of 2,3,7,8-tetrachlorodibenzo-pdioxin (TCDD) in C57BL/6 mice. Toxicology and Applied Pharmacology. 29:
229-241.
Vos, J. G., Kreftenberg, H. W. B., Engel, A., Minderhoud, A., and Van Noorle Tansen, L.
M. 1978. Syudies on 2,3,7,8-tetrachlorodibenzo-p-dioxin induced immune
suppression and decreased resistance to infection: Endotoxin hypersensitivity,
serum zinc concentration and effect of thymosin treatment. Toxicology. 9: 75-84.
Vos, J. G., Faith, R. E., and Luster, M. I. 1980. Immune alterations. In Halogenated
Biphenyls, Terphenyls, Napthalenes, Dibenzodioxins and Related Products. ed.
R. D. Kimbrough, 241-266. Amsterdam: Elsevier North Holland Medical Press.
Wang, X., Porter, W., Krishnan, V., Narashiman, T. R., and Safe, S. 1993. Mechanism of
2,3,7,8-tetrachlorodibenzo-p-dioxin (TCDD)-mediated decrease of the nuclear
39
estrogen receptor in MCF-7 human breast cancer cells. Molecular and Cellular
Endocrinology. 96: 156-166.
Weber, L. W. D., Lebofsky, M., Greim, H., and Rozman, K. 1991. Key enzymes of
gluconeogenesis are dose-dependantly reduced in 2,3,7,8-tetrachlorodibenzo-pdioxin (TCDD)-treated rats. Archives of Toxicology. 65: 119-123.
Weber, L. W. D., Lebofsky, M., Stahl, B. U., Kettrup, A., and Rozman, K. 1992.
Comparative toxicity of four chlorinated dobenzo-p-dioxins (CDDs) and their
mixtures. Archives of Toxicology. 66: 478-483.
Webster, T., and Commoner, A. 1994. Overview: The dioxin debate. In Dioxins and
Health. ed. A. Schecter, 1-50. NY: Plenum Press.
Whitelaw, M. L., Gustafsson, J. -A., and Poellinger, L. 1994. Identification of
transactivation and repression functions of the dioxin receptor and its basic helixloop-helix/PAS partner factor Arnt: inducible versus constitutive modes of
regulation. Molecular and Cellular Biology. 14: 8343-8355.
Wolfe, W., Michalek, J., Miner, L., Needham, L., and Patterson, D. 1992. Diabetes
versus dioxin body burdens in veterans of Operation Ranch hand, Presented @
Dioxin 1992, Tampere, Finland, August 211-228.
Yamashita, F., and Hayashi, M. 1985.
Fetal PCB syndrome: Clinical features,
intrauterine growth retardation and possible alterations in calcium metabolism.
Environmental Health Perspectives. 59: 41-45.
Young A. L. 1988. The military use of herbicides in Vietnam. In Agent Orange and its
Associated Dioxin: Assessment of a Controversy. eds. A. L. Young and G. M.
Reggiani, 9-30. Amsterdam: Elsevier Science Publishers.
Zhang, J., Xia, W. L., and Ahmad, F. 1995. Regulation of pyruvate carboxylase in 3T3L1 cells. Biochemical Journal. 306: 205-210.
Zook, D. R., and Rappe, C. 1994. Environmental sources, distribution and fate of
polychlorinated dibenzodioxins, dibenzofurans and related organochlorines. In
Dioxins and Health. ed. A. Schecter, 79-114. NY: Plenum Press.
40
Chapter 3
Dietary Calorie Restriction Induces Hepatic Pyruvate Carboxylase in Pair-Fed
Controls for the C57BL/6J Mice Exposed to 2,3,7,8-Tetrachlorodibenzo-p-dioxin
Shukla Roy and Daniel P. Selivonchick
41
3.1 Abstract
Previous experiments with 2,3,7,8-tetrachlorodibenzo-p-dioxin (TCDD) have
shown that pyruvate carboxylase (PC) concentrations were elevated in C57BL/6J Ah"
mice that were pair-fed controls for experimental animals given 50 ,ug TCDD/kg.
Induction of PC was not observed in pair-fed controls of congenic Ah" mice in
comparable TCDD experiments. One possible explaination for the PC induction was that
component(s) in the corn oil vehicle differentially affected PC gene expression. The
strains differ only in their Ah (aryl hydrocarbon) receptor's affinity for TCDD, with the
Ah receptor of Ah" congenic mice having a ten fold lower affinity. Dose response
experiments with corn oil reveal that corn oil was not the cause of the PC induction in the
Ah" strain. Repeated measures analysis of food consumption data show that a significant
decrease in food intake occurs during the course of the experiment for Ah" mice given
doses
20 pg TCDD/kg (LSM ± SEM < 0). In Ahdid mice, reduced food intake occurs
only with the highest dose of TCDD (100 pg/kg).
comparison of food intake between control Ah'
Dunnette's multiple pair-wise
allowed free access to food and
those given TCDD display a significant difference between the controls and mice treated
with a dose >1 pg TCDD/kg (P < 0.05). No significant differences in food intake
between controls and animals treated with TCDD (1 to 100 pg/kg) occured in the Ahd/d
mice (P > 0.05). It is well known that starvation increases PC activity in animals.
Therefore, we proposed that induction of PC in mice that were pair-fed controls for the 50
pg TCDD/kg treated Ah'
was due to reduced food intake. PC concentrations and
activities were elevated by approximately two fold in both strains of mice after they were
restricted to the same amount of food that was consumed by Ah'
exposed to a 50
pg TCDD/kg dose. These results confirm our hypothesis that reduced food intake was
responsible for the PC induction observed in pair-fed controls of Ah" mice injected with
50 jig TCDD/kg dose.
42
3.2 Introduction
2,3,7,8-Tetrachlorodibenzo-p-dioxin (TCDD) is a persistent environmental
contaminant that is formed as a by-product during the synthesis of industrial chemicals
and incomplete combustion processes (Kopponen et al., 1994). TCDD elicits numerous
toxic effects in laboratory animals such as thymic atrophy, carcinogenesis, teratogenesis,
wasting syndrome and death. Most of the toxic effects of TCDD are mediated through a
transcription factor known as the aryl hydrocarbon (Ah) receptor. Members of the Ah
gene battery such as cytochrome P450 (1A1 and 1A2), glucuronosyl transferase,
aldehyde-3-dehydrogenase,
NAD(P)H:menadione
oxidoreductase,
glutathione-S-
transferase Ya subunit and ornithine decarboxylase, are induced by TCDD (Whitlock,
1993).
In addition, TCDD is known to down regulate several enzymes involved in
intermediary metabolism. Examples are phosphoenolpyruvate carboxykinase (Weber et
al., 1991), acetyl CoA carboxylase (McKim et al., 1991) and pyruvate carboxylase (PC)
(Ilian et al., 1996; Ryu et al., 1995; Sparrow et al., 1994; Weber et al., 1991).
Pyruvate carboxylase (EC 6.4.1.1.) catalyzes the first step in gluconeogenesis,
converting pyruvate to oxaloacetate (Barritt, 1985). Recently, we demonstrated that
intraperitonial (i p) administration of TCDD decreased PC protein, enzymatic activity
(Sparrow et al., 1994) and mRNA (Ilian et al., 1996) concentrations in C57BL/6J (Ah")
male mice. Congenic (Ahd/d) mice (Ilian et al., 1996; Ryu et al., 1995) also displayed a
reduction in PC concentration but at approximately a ten fold higher dose of TCDD.
Reduction in PC concentrations were dose and time dependent in both strains.
Reductions in PC protein concentrations and activities were associated with elevated
blood lactate concentration in TCDD exposed mice (Sparrow et al., 1994).
Toxicity of TCDD varies with species such that the LD50 in guinea pigs is 0.6
pg/kg while the LD50 in hamsters is 5051 pg/kg (Henck et al., 1981). The general
consensus is that the variability in susceptibility is due to a difference in the Ah
receptor(s) affinity for TCDD (Whitlock, 1993). In the case of PC, this observation is
supported by studies conducted in our laboratory that show significant reductions in PC
concentrations at 1 pg TCDD/kg dose in C57BL/6J Ah" mice possessing high affinity
Ah receptors, relative to controls (Sparrow et al., 1994). Ah" mice possessing low
43
affinity Ah receptors began to display reduced PC concentrations and activities at a dose
of 75 jig TCDD/kg (Ryu et al., 1995).
In both of the previous investigations, TCDD was administered (ip) via a corn oil
vehicle. In experiments employing a 50 ,ug TCDD/kg dose, PC concentrations were
consistently higher in the vehicle injected (ip) pair-fed control mice relative to animals
allowed free access to food. The latter animals were not injected with corn oil (Sparrow
et al., 1994). Induction of PC was observed in Ah" pair-fed control mice but not in the
pair-fed controls of the Ah" strain (Sparrow et al., 1994; Ryu et al., 1995). In principle,
the only difference between the two strains of mice is the affinity of the Ah receptor for
TCDD. These observations suggest that a component in corn oil may cause PC induction
in Ah" mice. The induction may be mediated through the Ah receptor (Ryu et al., 1995).
The capacity of corn oil constituents to modulate specific transcription has been
previously reported (Katsurade et al., 1990). Vegetable and fish oils containing n-6 and
n-3 fatty acids suppress
transcription of genes coding for lipogenic enzymes.
Transcription of acetyl coenzyme A carboxylase in rats is suppressed by 50% within 6 hrs
of adding corn oil to diet (Clarke and Jump, 1993).
Fatty acids are also known to
activate peroxisome proliferator activated receptor (PPAR). PPAR is a member of the
steroid nuclear receptor family and bears many structural similarities to the Ah receptor
(Gottlicher et. al., 1992). Here we report that the source of PC induction in the vehicle
injected, pair-fed controls of 50 aug TCDD/kg treated C57BL/6J Ah" mice was not
produced by corn oil products. Since starvation increases PC activity in animals, we
proposed that induction of PC in mice that were pair-fed controls for the 50 lig TCDD/kg
treated Ah" strain was due to reduced food intake. We have demonstrated that the
induction in PC was due to reduced food intake, which results as a consequence of
commonly accepted experimental design where pair-feeding is a necessary control.
Increase in PC concentrations were not observed in pair-fed controls of similarly treated
Ah" mice because food intake is not affected in this strain of mice at a 50 ,tig TCDD/ kg
dose.
44
3.3 Materials and Methods
3.3.1 Reagents
Polyacrylamide (99% pure), Kaleidescope molecular weight standards, avidin
conjugate and Zeta Probe membrane were purchased from BioRad (Richmond, CA).
Tween 20, 4-chloro- 1 -naphthol and 1-methyl -2-pyrrolidinone were obtained from Sigma
(St. Louis, MO). Coenzyme A, ATP, citrate synthase (EC 4.1.3.7), citrate lyase (EC
4.1.3.6), phosphotransacetylase (EC 2.3.1.8), malate dehydrogenase (EC 1.1.1.37), lactate
dehydrogenase (EC 1.1.1.27), acetyiphosphate (K-Li salt), NADH, and pyruvate were
obtained from Boehringer Mannheim (Indianapolis, IN). All other reagents were of the
highest quality available.
3.3.2 Animals
Eight week old male C57BL/6J Ahhib mice weighing 21-24 g were purchased
from Jackson Laboratory (Bar Harbor, MA) and housed individually in polycarbonate
cages. Eight breeding pairs of congenic C57BL/6J Ahd/d mice were a gift from Dr. Alan
Poland (University of Wisconsin, Madison, WI). The congenic mouse strain was bred by
backcross/intercross breeding between C57BL/6J and B6N *D2N(Ahd)N13F13 originally
bred by Dr. Daniel Nebert, National Institute of Child Health and Human Development
(Bethesda, MD).
This
breeding produced congenic mice [B6N*D2N (Ahd)
N13T13*B6JN28F28F3], which were homozygous for the Ahdid allele (Poland et al. 1989).
These mice were used to establish a colony that served as our source for this mouse
strain. Animals were maintained on Teklad rodent diet where protein and fat contents
were 24.48% and 4.4%, respectively (Harlan Teklad, Madison, WI). The mice were held
in a room at 22°C, 40-65% humidity, and a 12 hour light/dark cycle was implemented.
Shoe coverings, lab coats, and masks were required for admittance. Animal cages were
positioned on a rack facing a laminar flow system. This room was maintained as a clean
room with double entry. Cages were cleaned daily. Body weight and food intake of all
animals were recorded daily.
45
3.3.2.1 Animal Treatment
Corn oil dose response studies. Thirty C57BL/6J Ah" mice were randomly
separated and divided into five groups of six. Mice within each group were paired
according to weight.
The first three animals from each group were injected
intraperitonially (ip) with 1, 2, 4 or 8 mL corn oil/kg or 4 mL 0.9% saline/kg and allowed
free access to food. The last three animals from each group were maintained on the
amount of food consumed by their paired experimental counterparts.
Saline controls
were maintained to simulate stress conditions in experimental animals resulting from
injection and handling. Three additional animals without any treatment were allowed free
access to food.
3.3.2.2 Food Intake Data
Food consumption data were obtained from previously conducted, TCDD dose
response experiments where C57BL/6J Ahb'b mice had been injected (ip) with 1, 10, 20,
50, 75 or 100 ug TCDD/kg (Sparrow et al. 1994) and C57BL/6J Ahdid mice were
injected (ip) with 1, 20, 50, 75 or 100 ,ug TCDD/kg (Ryu et al., 1995). TCDD was
administered via a single dose in a 4 mL corn oil/kg vehicle.
3.3.2.3 Diet Restriction Studies
Nine male mice of each genetic strain (Ah" or Ahd'd) were randomly separated
into three groups. Three animals were injected (ip) with 4 mL corn oil/kg (approximately
100 ktL). The amount of food to be given daily (Table 1) was derived from a regression
line fitted to the average daily food intake of 15 C57BL/6J Ah" mice treated with 50 pg
TCDD/kg.
Three animals were injected with 4 mL 0.9% saline/kg of solution and
maintained on the same daily diet as the corn oil injected animals. Three additional
animals were allowed free access to food.
3.3.3 Protein Extraction
Eight days post-injection, mice were killed via CO2 asphyxiation. Livers were quickly
excised, separated from gall bladders, rinsed with 0.9% ice-cold saline and weighed
46
Table 3.1 Daily food ration of C57BL/6J Ahh/b and Aled mice in diet restriction studies'.
Day
Food Ration
(% body weight)
1
17.4%
2
17.3%
3
16.6%
4
16.1%
5
15.5%
6
15.0%
7
14.4%
8
13.9%
'Amount of food to be given per day was derived from a regression line fitted to the daily
average food intake of 15 C57BL/6J Ah b/b mice treated with 50 itg TCDD/kg
(r2 = 0.345)
47
followed by perfusion with 0.9% chilled saline. The tissues were minced with a razor
blade and placed in three volumes (w/v) of ice-cold homogenization buffer (Tris-HC1, 20
mmol/L, pH 7.4; mannitol, 0.3 mol/L; EDTA, 2 mmol/L; dithiothreitol, 1 mmol/L; and 4(2 -amino ethyl)-benzene sulfonyl fluoride, 2 mmol/L). Cell disruption was accomplished
using a 30 ml Potter-Elvehjem tissue homogenizer (glass on Teflon) at 4°C followed by
centrifugation at 29,000 x g for 10 minutes. The lipid layer of the supernant was removed
and the remaining supernant fractionated by centrifugation at 368,000 x g for 45 minutes
at 4°C. The supernant was concentrated using an Amicon (Beverly, MA) centriprep
device (30 kD exclusion limit).
Glycerol was added to the retentate to a final
concentration of 10% (w/w). The samples were divided into small portions, and stored a
-85°C. Protein concentration of the retentate was determined by a modification of the
Bradford method (Spector 1978), using bovine serum albumin as a standard.
3.3.4 Polyacrylamide Gel Electrophoresis and Western Blotting
Protein extracts (20 pg) were separated by sodium dodecyl sulfate polyacrylamide
gel electrophorsis (SDS-PAGE) as described earlier (Hames, 1990).
Kaleidescope
molecular weight standards were used as markers. Following electrophoresis, the gel was
equilibrated in transfer buffer (Tris, 25 mmol/L and glycine, 192 mmol/L, pH 8.3) for 25
minutes at room temperature to remove excess SDS and swell the gel. Zeta probe
membrane was bathed in transfer buffer for 15 minutes. Proteins were transferred onto
Zeta probe membranes for 90 minutes at 20 V constant voltage at 4°C using a Genie
blotter (Idea Scientific, Minneapolis, MN). Incubation and development of the blot was
completed as described by McKim et al. (1991). Western blots were analyzed by
densitometry using a Molecular Dynamics system and associated software.
3.3.5 Pyruvate Carboxylase Activity Assay
Pyruvate carboxylase activity assays were performed using the method of Berndt
et al. (1978). Protein extracts (150 pg) were combined with 600 pL of 167 mmol/L Tris-
HC1, pH 8.0, containing pyruvate, 2 pmol; ATP, 1 pmol; MgC12, 5 pmol; CoASH, 0.5
pmol; citrate synthase, 2 U; and phosphotransacetylase, 10 U; and incubated for 30
48
minutes at 37°C, to form citrate. Avidin inhibition (5 U) of pyruvate carboxylase was
used in assay controls to correct for any non-PC-mediated production of citrate. Citrate
concentrations were determined by measuring a decrease in absorbance at 339 nm as
described by Mollering (1985).
3.3.6 Statistical Analysis
Normalization of food consumption data for each mouse was carried out by
expressing food intake as a ratio of body weight. Feed intake indexed to body weight
accounted for mouse to mouse variation in body weight and for the decrease in body
weight that occured in TCDD treated animals. Food intake data were taken from several
TCDD dose response experiments conducted in our laboratory. Statistical analyses of
food intake data was performed using SAS/STAT Version 6 [SAS Institute, Cary, NC].
Data were treated as if they were derived from a completly randomized design as all
experimental conditions, except for the time block in which they were conducted, were
identical.
Univariate repeated measures analyses (average of day 7+8 minus average of
day 2+3) were performed to examine changes in food consumption patterns over the
course of the experiment (Zolman, 1993). Dunnett's pair-wise multiple comparison was
performed to examine differences between control animals allowed free access to food
and TCDD treated animals (Dunnett, 1955). Overall analysis of variance (ANOVA)
analysis (F-test) was used to look for evidence of a TCDD dose effect in each strain of
mice, after adjusting for unequal sample sizes. Data are expressed as least square means
(LSM) ± SEM. Results from diet restriction studies were analyzed by ANOVA using
Statgraphic Version 5.0 software. A P value less than 0.05 was considered significant in
all analyses.
49
3.4 Results
3.4.1 Corn Oil Dose Response Studies
Western blot analysis of PC from livers of C57BL/6J Ah" mice injected (ip) with
1, 2, 4 or 8 mL corn oil/kg showed that concentrations of the enzyme were not elevated in
these mice compared to saline injected controls or mice allowed free access to food
(Figure 3.1). Therefore, we conclude that corn oil components were not responsible for
PC elevation in livers of pair-fed control mice in TCDD experiments as previously
proposed (Ryu et al., 1995; Sparrow et al., 1994).
3.4.2 Analysis of food intake
Repeated measures analysis (average of days 7+8 minus average of days 2+3) of
food consumption to body weight ratios gave positive values (LSM ± SEM > 0) for Ah"
and Ah" mice allowed free access to food (data not shown). A positive LSM indicated
an increase in food consumption during the course of the experiment. LSM values were
also positive for Ah" mice given 1 or 10 pg TCDD/kg (Figure 3.2) and Ahdid mice given
1, 20, 50 or 75 itg TCDD/kg dose (Figure 3.3). In contrast, food consumption decreased
over an eight day period for Ah" mice given doses of TCDD _20 ug/kg (Fig. 2) and
Ahdid
mice given a dose of 100 ug TCDD/kg (Figure 3.3) where LSM ± SEM < 0.
Dunnett's pair-wise multiple comparison of the repeated measures data showed a
significant difference in food intake values between the control Ah" mice allowed free
access to food, and those treated with doses of TCDD > 1 ug TCDD/kg (P < 0.05). No
such difference was present in the repeated measures analysis data of Ahdid mice between
control animals allowed free access to food and TCDD treated animals (P > 0.05).
Overall ANOVA of the repeated measures data showed a strong evidence for a dose
effect of TCDD on food intake patterns of the Ah" strain (F (6,38) = 6.44, P < 0.0001).
No such effect was manifested in the Ahdid strain (F (5,15) = 1.41, P > 0.2).
50
Figure 3.1 Western blot analysis of hepatic pyruvate carboxylase from C57BL/6J Ah"
male mice from corn oil dose response experiment. Lanes 1 to 4 are samples from
animals injected with 8, 4, 2 and 1 mL corn oil / kg, respectively. Lane 5 is a sample
from 4 mL 0.9% saline / kg injected mice while lane 6 is a sample from animals allowed
free access to food. Protein (50 pg per lane) was loaded onto 10 x 10 x 0.08 cm SDSpolyacrylamide gels (3.5% stacking, 6% resolving) and separated at 150 V constant
voltage for 90 minutes at ambient temperature. Protein was transferred onto Zeta probe
membrane using 20 V constant voltage at 4°C for 90 minutes. Visualization was by
avidin-peroxidase staining using 4- chloro- l - napthol.
51
Nob,w domoomommiiierl.
1
Figure 3.1
2
3
4
5
6
52
Figure 3.2 Repeated measures analysis (average of days 7+8 - average of days 2+3) of
the food intake/body weight ratios of C57BL/6J Ah" mice injected with various doses of
TCDD. Values represent least squares mean (LSM) ± SEM, where n = 6, 6, 6, 15, 6 and
3 mice respectively, for treatment groups of 1, 10, 20, 50, 75 and 100 ,ug of TCDD/kg.
Dunette's pair-wise multiple comparison showed a significant difference (P < 0.05) in
LSM values between mice allowed free access to food and those treated with 10, 20, 50,
75 or 100 ug TCDD/kg dose.
53
... 0.07
+
t--
T
)1(
T
0.01
_0)
a)
I
CO
1
_.
co
-0
I
-0.03
0
0
X
Li_
-0.05
0
1
10
20
50
Dose ( ug TCDD/kg body weight)
Figure 3.2
75
100
54
Figure 3.3 Repeated measures analysis (average of days 7+8 - average of days 2+3) of
the food intake/body weight ratios of C57BL/6J Ahdid mice injected with various doses of
TCDD. Values represent least squares mean (LSM) ± SEM, where n = 3, 6, 3, 3 and 3
mice respectively, for treatment groups of 1, 20, 50, 75 and 100 ,ug of TCDD/kg.
Dunette's multiple pair-wise comparison showed no significant (P > 0.05) difference in
LSM values between mice allowed free access to food and those treated with any of the
doses of TCDD.
55
C7') 0.04
+
cv
co
>, 0.03
co
73
--q -0.03
-o
0
0
11- -0.04
-0.05
0
1
20
50
75
Dose (ug TCDD/kg body weight)
Figure 3.3
100
56
3.4.3 Diet restriction studies
Diet restriction studies were conducted with Ah" and Ah" mice. The studies
were performed to explore the possibility that restricted food intake induced the synthesis
of PC in livers of C57BL/6J Ah" pair-fed controls of mice treated with 50 ug TCDD/kg.
Animals were fed a daily diet determined from a regression line fitted to the average food
intake of 15 C57BL/6J Ah" mice treated with 50 ug TCDD/kg. The amount of food
given daily to mice in the diet restriction studies is shown in Table 1 as a percent of body
weight. We chose to use the food consumption data from the 50 ug TCDD/kg treated
animals because it was at this dose, that PC induction was observed in pair-fed controls
of Ah" mice but not in the pair-fed controls of the Ah" mice.
One group of animals was allowed free access to food. A second group was
maintained on a diet restricted regimen following a single injection (ip) with corn oil
(4 mL/kg). A third group was given 0.9% saline (4 mL/kg) (ip) and also maintained on a
diet restricted regimen. Eight days post injection, the mice were sacrificed, the livers
removed, pooled by group, processed and analyzed for PC concentrations and activity as
previously described (Sparrow et al., 1994). Pyruvate Carboxylase levels in each of the
samples was determined by densitometric analysis of western blots of PC from Ah"
(Figure 3.4) and
Ahdid
mice (Figure 3.5). A range of concentrations of pure PC from
bovine liver (Sigma) was run on SDS-PAGE and western blotted to generate a standard
curve (data not shown). Pyruvate Carboxylase constitutes 0.1% of total protein (8.3
pmol/mg total protein) in livers of mice allowed free access to food as determined from
densitometric analysis of western blots. Pyruvate Carboxylase levels and activities were
elevated two-fold in the diet restricted groups, irrespective of strain and independent of
either corn oil or saline treatment when compared to mice that were allowed free access
to food (Table 2).
57
Figure 3.4 Western blot analysis of hepatic pyruvate carboxylase from C57BL/6J Ah"
male mice subjected to diet restriction. Lanes 1 and 2 are 5 ng and 15 ng, respectively, of
pure bovine liver PC. Lane 3 and 4 are samples from 0.9% saline (4 mL/kg) injected mice
that were under diet restriction, lanes 5 and 6 are samples from corn oil (4 mL/kg)
injected mice under diet restriction and lanes 7 and 8 are samples from controls allowed
free access to food. Protein (20 ,ug per lane) was loaded onto 10 x 10 x 0.08 cm SDSpolyacrylamide gels (3.5% stacking, 6% resolving) and separated at 150 V constant
voltage for 90 minutes at ambient temperature. Protein was transferred onto Zeta probe
membrane using 20 V constant voltage at 4°C for 90 minutes. Visualization was by
avidin-peroxidase staining using 4-chloro- 1 -napthol.
58
1
Figure 3.4
2
3
4
5
6
7
59
Figure 3.5 Western blot analysis of hepatic pyruvate carboxylase from Ah" congenic
male mice subjected to diet restriction. Lane 1 corresponds to kaleidescope molecular
weight marker. Lanes 2, 3 and 4 are samples from animals allowed free access to food,
corn oil injected (4 mL/kg, diet restricted) and 0.9% saline injected (4 mL/kg, diet
restricted) mice, respectively. Top band of lanes 2, 3 and 4 represent acetyl-Coenzyme A
carboxylase and bottom band represents PC. Protein (20 lig per lane) was loaded onto 10
x 10 x 0.08 cm SDS-polyacrylamide gels (3.5% stacking, 6% resolving) and separated at
150 V for 90 minutes at room temperature. Protein was transferred onto Zeta probe
membrane using 20 V constant voltage at 4°C for 90 minutes. Visualization was by
avidin-peroxidase staining using 4-chloro- 1 -napthol.
60
1
Figure 3.5
2
3
4
61
Table 3.2 Concentration and Activity of pyruvate carboxylase (PC) in livers of control
and diet restricted C57BL6J Ah bib and congenic Ah did mice'
C57BU6J Ahbb mice
Diet
Treatment
C57BU61 Ahm mice
Concentration'
Activity
Concentration'
Activity
ng /pg
nmol.min'pg '
ng /pg
nmomin-lpg"
Control
None
1.04 ± 0.028'
0.33 ± 0.058'
0.71 ± 0.076'
0.38 ± 0.008'
Restricted
Corn oil
2.09 ± 0.014"
0.54 ± 0.0566
1.25 ± 0.229"
0.58 ± 0.090"
Restricted
0.9% Saline
1.97 ± 0.127"
0.65 ± 0.052"
0.93 ± 0.1096
0.63 ± 0.022"
'Data are expressed as means ± SD; n = 3 for all treatment groups. Means with different
letter superscripts differ significantly (ANOVA: P<0.05).
2PC concentrations were determined by densitometric analysis of samples on western
blots. A standard curve of PC vs optical density (r2 = 0.99) was used as reference.
62
3.5 Discussion
Our studies show that C57BL/6J Ah" mice exposed to TCDD decrease their food
intake in a dose dependant manner. A similar trend was not present in animals of the
congenic Ah" strain.
These data are consistent with the observation that lower
concentrations of TCDD are required to induce toxicity in the Ah" strain than the Ah"
strain. Greater susceptibility of the Ah" mice to TCDD toxicity is attributed to a tenfold higher affinity of the Ah receptor for TCDD (Okey et al., 1994).
Reduced food intake may be a survival response in animals exposed to TCDD. It
is well known, from a number of genotypes and species, that diet restriction can inhibit
chronic toxicity induced by physical, chemical and viral agents (Hart et al., 1992). For
example, calorie restriction reduced acute toxicity of pharmaceuticals such as the anti-
asthmatic isoproterenol and the antiviral drug ganciclovir by several fold (Hart et al.,
1995).
Calorie restriction increases survival rates and decreases spontaneous and
chemically induced tumors in animals (Albanes, 1987; Kritchevsky and Klurfeld, 1987).
Calorie restriction has also been shown to enhance the fidelity of DNA replication,
increase the repair of various forms of DNA damage (Haley-Zitlin and Richardson,
1994), decrease the formation of selected DNA adducts (Chou et. al., 1993), and decrease
oncogene expression (Hass et al., 1993), thus enhancing overall genetic stability.
Onset of hypophagia in Ah'
injected with 50 pg TCDD/kg resulted in
allocation of reduced amounts of food to their pair-fed controls compared to animals
allowed free access to food. In contrast, absence of hypophagia in similarly treated Ah"
mice resulted in food consumption patterns that were not significantly different from
animals allowed free access to food. Given the knowledge that starvation increases PC
activity in animals (Barritt et. al., 1976), we proposed that induction of PC in mice that
were pair-fed controls for the 50 pg TCDD/kg treated Ah" strain was due to reduced
food consumption and not to components of corn oil vehicle used to administer TCDD.
We have shown here that maintainance of both strains (Ah" and Ah") on the same
amount of food consumed by animals treated with 50 pg TCDD/kg induced liver PC
concentrations and activities by two-fold. Pyruvate Carboxylase induction was absent in
63
pair-fed controls of
Ahdid
mice because their TCDD treated counterparts did not
experience hypophagia at this dose (50 ,ug TCDD/kg).
Pair feeding can also lead to clinical changes in the animal such as weight loss.
C57BL/6J
Aht
and Ahdid congenic mice in the diet restriction studies exhibited a 9.36%
± 4% loss in body weight from day 2 to day 8 of the experiment. These values are similar
to those obtained from starvation experiments where 42 day old rats starved for 16 hours
lost 3 - 4% of body weight (Ma and Foster, 1986). Mice from our diet restriction studies
and pair-fed controls of C57BL/6J Ah'
mice in previously conducted TCDD
experiments appeared to be starved for food. These animals consumed their ration of
food within the first 12 hours and started eating immediately when given food the next
day. In contrast, control animals allowed free access to food showed a 4.9% ± 3.7% gain
in body weight. Weight loss in animals deprived of food occurs due to proteolysis of
muscle protein. Some of the amino acids released during muscle breakdown (alanine,
serine and cysteine) are a major source of carbon for gluconeogenesis during starvation
(Cahill, 1970). Breakdown of muscle during fasting results in wasting of the starved
animal; a phenomenon that is seen in TCDD intoxicated animals as well as their pair-fed
controls. Weight loss in the two groups occured at essentially the same rate and to nearly
the same extent (Peterson et al., 1984). Although total parenteral nutrition can prevent
weight loss in rats exposed to TCDD, these animals still die of TCDD intoxication
(Gaseiwicz et al., 1980).
Controlled feeding in laboratory animals have been shown to induce several drug
metabolizing (Hart et al. 1995) and gluconeogenic enzymes (Wimhurst and Manchester,
1970). Starvation induced gluconeogenesis (Wimhurst and Manchester, 1970) is a
mechanism for maintaining glucose homeostasis in the body (Seitz et al., 1976).
Pyruvate carboxylase, a key enzyme in gluconeogenesis, is also induced during
starvation.
Changes in PC activity are associated with fluctuations in other
gluconeogenic enzymes such as phosphoenolpyruvate carboxykinase (Seitz et al., 1976).
Increased cellular metabolism induced by thyroid hormones (Menahan and Wieland,
1969) and by neonatal development (Ballard and Oliver, 1963) and increases in the rate
of lipogenesis in developing adipocytes are other factors that cause changes in PC
64
concentrations (MacKall et al., 1976). Diabetes mellitus is known to enhance PC activity
(Owen et al., 1976).
Induction of PC during starvation (or pair-feeding) is thought to be hormonally
regulated although the exact molecular mechanisms by which this occurs still remains
unknown (Zhang et al., 1995). The upstream regulatory region(s) of the mouse PC gene
has been recently characterized in our laboratory. Although dioxin and the glucorticoid
and thyroid hormones are known to modulate PC gene transcription, the response
elements for nuclear receptors that bind these ligands are noticably absent from the PC
regulatory region (Ryu, 1996; Sparrow, 1997). Surprisingly, protein-DNA interaction
studies of the multiple E-box region (-1232 by to -637 bp) of the PC gene with nuclear
proteins from TCDD treated mice and their pair-fed controls, have shown that there is a
difference in binding pattern (Chapter 5, this thesis). Nuclear proteins from the pair-fed
controls bind with a much lower affinity to the E-box region than nuclear proteins from
TCDD-treated mice.
If we assume that the nuclear protein(s) binding to this E-box
region are negative regulators of transcription, then their reduced affinity due to calorie
restriction (pair-feeding)
would account for induction of PC during a pair-feeding
regimen.
In conclusion, data in the present study show that food consumption decreases in a
dose dependant manner in C57BL/6J
Ahb'b
mice exposed to TCDD. Such a decrease is
not observed in similarly treated C57BL/6J animals of the Ahdid strain. Reduction in the
quantity of food given to pair-fed controls of C57BL/6J Ah" mice treated with 50 iig
TCDD/kg results in induction of hepatic PC concentrations and activities in the controls.
Similarly treated pair-fed controls of the Ah" strain do not show an induction in hepatic
PC as food intake is not affected in their 50 Aig TCDD/kg treated counterparts. Results
from chapter 5 partially explains the mechanisms by PC might be induced in animals
under starvation or a pair-feeding regimen.
65
3.6 References
Albanes, D. 1987. Calorie intake, body weight and cancer: A review. Nutrition and
Cancer 9:199-240.
Ballard, F. J., and Oliver, I. J. 1963. Glycogen metabolism in embryonic chicken and
neonatal rat liver. Biochimica et Biophysica Acta. 71: 578-588.
Barritt, G. J., Zander, G. L., and Utter, M. F. 1976. The regulation of pyruvate
carboxylase activity in gluconeogenic tissue. In Gluconeogenesis: Its regulation
in mammalian species, eds. R. W. Hanson and M. A. Mehlman, 3-46. NY: John
Wiley and Sons.
Barritt, G. S. 1985. Regulation of enzyme activity. In Pyruvate Carboxylase, eds. D. B.
Keech and J. C. Wallace, 141-151, Boca Raton, FL: CRC press.
Berndt, J., Messner, B., Turkki, T. and Weissman, E. 1978. Optical assay of pyruvate
carboxylase in crude liver homogenates. Analytical Biochemistry 86: 154-158.
Cahill, G. F. Jr. 1970. Starvation in man. New England Journal of Medicine. 282: 668675.
Chou, M. W., Kong, J., Chung, K. T., and Hart R. W. 1993. Effect of calorie restriction
on the metabolic activation of xenobiotics. Mutation Research. 295: 223-235.
Clarke, S. D., and Jump, D. B. 1993. Regulation of gene transcription by polyunsaturated
fatty acids. Progress in Lipid Research. 32: 139-149.
Dunnett, C. W. 1955.
A multiple comparison proceedure for comparing several
treatments with control. Journal of American Statistical Association. 50: 10961121.
Gasiewicz, T. A., Holscher, M. A., and Neal, R. A. 1980. The effect of total parenteral
nutrition on the toxicity of 2,3,7,8-tetrachlorodibenzo-p-dioxin in the rat.
Toxicology and Applied Pharmacology. 54: 469-488.
Gottlicher, M., Widmark, E., Qiao, L., and Gustafsson, J. 1992. Fatty acids activate a
chimera of the clofibric acid-activated receptor and the glucocorticoid receptor.
Proceedings. National Academy of Sciences. USA. 89: 4653-4657.
Haley-Zitlin, V. and Richardson, A. 1994. Effect of dietary restriction on DNA repair
and DNA damage. Mutation Research. 295:237-245.
Hames, B. D. 1990. One-dimensional polyacrylamide gel electrophoresis.
In Gel
electrophoresis of proteins: A Practical Approach, 2nd ed., eds. B. D. Hames.
and D. Richwood, 6-50. NY: Oxford Press.
66
Hart, R. W., Chou, M., Feuers, R., Leakey, J., Duffy, P., Lyn-Cook, B., Turturro, A. and
Allaben, B. 1992. Caloric restriction and chemical toxicity/carcinogenesis.
Quality Assurance: Good Practice. Regulatory Law. 1: 120-131.
Hart, R. W., Keenan, K., Turturro, A., Abdo, K. M., Leaky, J. and Cook, B.L. 1995.
Symposium Overview: Calorie restriction and toxicity. Fundamental and Applied
Toxicology. 25: 184-195.
Hass, B., Hart, R. W., Lu, M. and Lyn-Cook, B. D. 1993. Effect of calorie restriction in
animals on cellular function, oncogene expression and DNA methylation in vitro.
Mutation Research. 295: 281-289.
W., New, M. A., Kociba, R. J., and Rao, K.S. 1981. 2,3,7,8Tetrachlorodibenzo-p-dioxin: Acute oral toxicity in hamsters. Toxicology and
Applied Pharmacology. 59: 405-407.
Henck, J.
Ilian, M. A., Sparrow, B. R., Ryu, B.W., Selivonchick, D. P. and Schaup, H.W. 1996.
Expression of hepatic pyruvate carboxylase mRNA in C57BL/6J Ah" and
congenic Ahdid mice exposed to 2,3,7,8-Tetrachlorodibenzo-p-dioxin. Journal of
Biochemical Toxicology. 11:51-56.
Katsurada, A., Iritani, N., Fukuda, H., Matsumura, Y., Nishimoto, N., Noguchi, T. and
Tanaka, T. 1990. Effects of nutrients and hormones on transcriptional and posttranscriptional regulation of acetyl-CoA carboxylase in rat liver. European
Journal of Biochemistry 190: 435-441.
Kopponen, P., Valttila, 0., Talka, E., Torronen, R., Tarhanen, J., Ruuskanen, J. and
Karenlampi, S. 1994. Chemical and biological 2,3,7,8-tetrachlorodibenzo-pdioxin equivalents in fly ash from combustion of bleached kraft pulp mill sludge.
Environmental Toxicology and Chemistry. 13: 143-148.
Kritchevsky, D., and Klurfeld, D. M. 1987. Calorie effects in experimental mammary
tumorigenesis. Americal Journal of Clinical Nutrition. 45: 236-242.
Ma, S. W. Y. and Foster D. 0. 1986. Starvation-induced changes in metabolic rate, blood
flow, and regional energy expenditure in rats. Canadian Journal of Physiology
and Pharmacology. 64:1252-1258.
MacKall J. C., Student, A. K., Polakis S. E., Efthimios, P. and Lane, M. D. 1976.
Induction of lipogenesis during differentiation in a "preadipocyte" cell line.
Journal of Biological Chemistry. 251: 6462-6464.
McKim, J. M. Jr., Marien, K., Schaup, H. W. and Selivonchick, D. P. 1991. Alterations
of hepatic acetyl-CoA carboxylase by 2,3,7,8-tetrachlorodibenzo-p-dioxin.
Lipids. 26: 521-525.
67
Menahan, L. A. and Wieland, 0. 1969. The role of thyroid function in the metabolism of
perfused rat liver with particular reference to gluconeogenesis. European Journal
of Biochemistry. 10:180-194.
Mollering, H. 1985. Citrate. In Methods of Enzymatic Analysis, 3rd ed.,
eds. H.
Bergmeyer, and F. M. Grab, 2-12, Germany: VCH
Okey, A. B., Riddick, D. S. and Harper, P. A. 1994. The Ah receptor: Mediator of the
toxicity of 2,3,7,8-tetrachlorodibenzo-p-dioxin (TCDD) and related compounds.
Toxicology Letters. 70: 1-22.
Owen, 0. E., Patel, M. S., Block B. S. B., Kreulen, T. H., Reiche, F. A. and Mozzoli, M.
A. 1976. Gluconeogenesis in normal, cirrhotic and diabetic humans. In
Gluconeogenesis: Its Regulation in Mammalian species. eds. R.W. Hanson, and
M. A.Mehlmen, 533-558, NY: John Wiley and Sons.
Peterson, R. E., Seefeld, M. D., Christian, B. J., Potter, C. L., Kelling, C. K. and Keesey,
R. E. 1984. The wasting syndrome in 2,3,7,8-tetrachlorodibenzo-p-dioxin toxicity:
Basic features and their interpretation. In Biological mechanisms of dioxin action.
eds. A. Poland, and R. D. Kimbrough, 291-308. Banbury Report 18, Cold Springs
Harbor NY: Cold Springs Harbor Laboratory Press.
Poland, A., Teitelbaum, P., Glover, E. and Kende, A. 1989. Stimulation of in vivo
hepatic uptake and in vitro hepatic binding of [1251] 2-Iodo-3,7,8-trichlorodibenzo-p-dioxin by the administration of agonists for the Ah receptor. Molecular
Pharmacology. 36: 121-127.
Ryu, B. W., Roy, S., Sparrow, B. R., Selivonchick, D. P. and Schaup, H. W. 1995. Ah
receptor involvement in mediation of pyruvate carboxylase levels and activity in
mice given 2,3,7,8-tetrachlorodibenzo-p-dioxin. Journal of
Biochemical
Toxicology. 10: 103-109.
Ryu, B. 1996. Characterization of pyruvate carboxylase responses to 2,3,7,8tetrachlorodibenzo-p-dioxin exposure in C57BL/6J All" mice. Thesis
Dissertation, Oregon State University, Corvalllis, OR.
SAS Institute Incorporated. 1995. SAS for Windows, Version 6.11. NC: SAS Institute
Incorporated.
Seitz, H. J., Kaiser, M., Krone, W., and Tarnowski, W. 1976. Physiologic significance of
glucocorticoids and insulin in the regulation of hepatic gluconeogenesis during
starvation in rats. Metabolism. 25: 1545-1555.
Sparrow, B. R., Thompson, C. S., Ryu, B. W., Selivonchick, D. P., and Schaup, H. W.
1994.
2,3,7,8-Tetrachlorodibenzo-p-dioxin induced alterations of pyruvate
68
carboxylase levels and lactate isozyme shifts in C57BL/6J male mice. Journal of
Biochemical Toxicology. 9: 329-335.
Sparrow, B. R. 1997. Characterization of 2,3,7,8-tetrachlorodibenzo-p-dioxin (TCDD)
induced modification of hepatic pyruvate carboxylase gene expression in
C57BL/6J male mice. Thesis Dissertation. Oregon State University, Corvallis,
OR.
Spector, T. 1978. Refinement of the coomassie blue method of protein quantitation.
Analytical Biochemistry. 86: 142-146.
Weber, L. W. D., Lebofsky, M., Helmut, G. and Rozman, K. 1991. Key enzymes of
gluconeogenesis are dose dependantly reduced in 2,3,7,8-Tetrachlorodibenzo-pdioxin (TCDD) treated rats. Archives of Toxicology. 65: 119-123.
Whitlock, J.
P. 1993. Mechanistic aspects of dioxin action. Chemical Research in
Toxicology. 6: 754-762.
Wimhurst J. M. and Manchester K. L. 1970. A comparison of the effects of diabetes
induced with either alloxan or streptozotocin and of starvation on the activities in
rat liver of the key enzymes of gluconeogenesis. Biochemical Journal. 120: 95103 .
Zhang, J., Xia, W. L. & Ahmad, F. 1995. Regulation of pyruvate carboxylase in 3T3-L1
cells. Biochemical Journal. 306: 205-210.
Zolman, J. F. 1993. Experimental design. In Biostatistics. Experimental design and
statistical inference. ed. J. F. Zolman, 40-74. NY: Oxford University Press.
69
Chapter 4
Identification of Transcriptional Initiation Complex Binding Site within the Hepatic
Pyruvate Carboxylase Promoter Region from C57BL/6J Mice
Shukla Roy and Daniel P. Selivonchick
70
4.1
Abstract
The regulatory region of the mouse pyruvate carboxylase (PC) gene immediately
upstream of the transcription start site (1.4 kb) has been recently cloned and sequenced in
our laboratory. Computer aided sequence analysis of the regulatory region revealed that
there are consensus sites for several transcription factors: Spl, NF-1, HNF-4, CCAAT
box, CREB and 17 E-boxes 10 of which are located adjacent to TFII I elements.
A
consensus sequence for an Inr element (+3 CAGTCTAG +10) was also found in this
region. Inr elements are present around the transcription start sites of many housekeeping
genes and are essential for transcription to begin from these genes. In order to investigate
whether the putative Inr element was functional, protein-DNA interaction studies were
conducted with a portion of the PC regulatory region (-238 by to +65 bp) containing the
Inr element. Electromobility shift assay (EMSA) of the DNA fragment (-238 by to +65
bp) with crude nuclear extracts from C57BL/6J mice liver demonstrated the formation of
a single protein-DNA complex. Competitive EMSAs with unlabelled probe confirmed
that nuclear protein(s) bound specifically to the fragment. DNAse I footprinting analysis
of the 303 by fragment in the presence of crude nuclear extracts showed a protected area
from -13 by to +57 bp. This area contains the Inr element and a CCAAT box. Proteins
binding to the CCAAT box have been shown to interact with the transcriptional
machinery and activate transcription.
71
4.2 Introduction
Pyruvate carboxylase (PC) catalyzes the ATP-dependant carboxylation of
pyruvate to oxaloacetate. This is the first step in the formation of glucose from pyruvate
and other three carbon precursors. PC is also an anaplerotic enzyme in that it senses the
need for carbon units and replenishes the citric acid cycle. PC participates in various
anabolic pathways including gluconeogenesis, lipogenesis and the synthesis of
neurotransmitter substances. Individuals deficient in PC experience lactic acidosis and
deterioration of the CNS (Barritt, 1985)
.
Hepatic pyruvate carboxylase protein and mRNA are downregulated in mice (Ilian
et al., 1997; Ryu et al., 1995; Sparrow et al., 1994) and rats (Weber et al., 1991) upon
exposure to TCDD. Studies in our laboratory indicate that such a decrease is Ah receptor
dependant. C57BL/6J mice with high affinity Ah receptors (Ah") begin to display a
reduction in PC concentration at a dose of 1µg TCDD/kg while a similar reduction in
C57BL/6J mice with low affinity Ah receptors (Ahd /d) occurs at a dose of 75 jig
TCDD/kg. The two strains of mice have the same genetic background differing only in
their Ah receptor(s) affinity for TCDD.
In order to elucidate the molecular mechanisms by which TCDD downregulates
PC at the transcriptional level, the 1.4 kb regulatory region of the mouse PC gene was
cloned and sequenced in our laboratory (Ryu, 1996; Sparrow, 1997).
Sequence
comparison of the hepatic PC promoter region from the two strains of mice Ah" and
Ahd/d) show that they are essentially identical (Sparrow 1997; Ryu 1996). Interestingly,
the mouse (Ryu, 1996; Sparrow, 1997) and the rat (Jitrapakdee et al., 1997) PC promoter
regions lacks dioxin response element(s) (DRE). It is well established that TCDD alters
the expression of several genes such as CYP1A 1, 1A2, glucuronosyl transferase and
glutathione-S-transferase Ya subunit via a signal transduction pathway that requires
direct interaction of the dioxin liganded Ah receptor with DRE(s) present in the promoter
regions of these genes (Whitlock, 1993). The possibility that DRE(s) might be located in
the PC regulatory region that is further upstream of 1.4 kb region, cannot be ruled out.
However, instances of genes that are altered by dioxin in an Ah receptor dependant and
DRE independent manner have been reported. For example, serum concentrations of
72
tumor necrosis factor-a (TNF-a) are enhanced in an AhR dependant manner. DRE
binding is not required in this case.
Once sequencing of the regulatory region of any gene is completed, it
is
customary to determine what transcription factors interact with it through protein-DNA
interaction studies.
Computer aided sequence analysis of the mouse (Ryu, 1996;
Sparrow, 1997) and rat (Jitrapakdee et al., 1997) PC promoter region revealed that it
lacks a TATA-box. TATA boxes are located approximately 30 by upstream of the
transcription start site of most genes. Assembly of the preinitiation complex (PIC) in
these genes occur by initial recognition of TATA box by the TATA binding protein
(TBP). TBP's are part of the transcriptional apparatus. However, most housekeeping
genes, that is genes that are expressed in all cells but at relatively low rates, do not
contain TATA boxes. Initiation of transcription in genes with TATA-less promoters
require the presence of initiator response elements (Inr) that encompass the transcription
start site (Voet and Voet 1995). Consensus sequence for an Inr element is located at +3
by to +10 by relative to the transcription start site of the mouse PC gene (Figure 1). This
is analogous to the recently cloned rat PC regulatory region which also lacks a TATA
box but has an Inr element at -5 by to +6 by region relative to the transcription start site
(Jitrapakdee et al., 1997).
Presence of a consensus site for a particular transcription factor does not always
guarantee protein binding. For example, sequence analysis of the distal control region of
quail MyoD reveals a cluster of 7 E-boxes. However, only 5 of the 7 E-boxes bind
specifically to bHLH transcription factors. Therefore, confirmation that the Inr element
of the mouse PC gene was specifically binding nuclear proteins was necessary to validate
the results of the sequence analysis. The present study describes protein-DNA interaction
studies of a region encompassing the transcription start site (-238 by to +65 bp) of the
mouse PC gene with hepatic crude nuclear extracts from C57BL/6J mice.
Competitive
electrophoretic mobility shift assays of the 303 by region (-238 by to +65 bp) with the
crude nuclear extracts were used to show specific protein binding to this region. DNase I
footprinting of this region was conducted to locate the exact location of protein binding in
this region. Computer aided sequence analysis of this region has previously shown that it
73
contains an Inr consensus element (+3 by to +10 bp) and a CCAAT box (+36 by to +41
bp) relative to the transcription start site (Figure 1). The CCAAT element has been found
in a wide variety of promoters such as those of thymidine kinase and hsp70 genes and
plays an essential role in their activity (McKnight and Tjian, 1986; Jones et al., 1988).
The present study identifies the transcriptional initiation complex binding site within the
C57BL/6J mouse hepatic PC promoter.
74
Figure 4.1 DNA sequence of hepatic pyruvate carboxylase upstream regulatory region
(1643 bp) and untranslated exon 1 from C57BL/6J mouse. The sequence was isolated
using inverse PCR. Consensus sites for E-boxes, TFII-I elements, Inr elements and
CCAAT box are indicated. Transcription factor analysis was performed using SIGNAL
SCAN software (Prestridge 1991) (Adapted from Sparrow, 1997).
75
- 1634 5'AAGCTTCAGGCTTAATGCAAACTTCAGGTCTCCACTATTGATGTCACCAAGTAGGAGGG
1575 CTTTCCCTCAGAGGATTTAAATTGGAGTCTGAACCATTGTCAACTACGAGGACTTCATGGT
- 1514 AACCATCCAACCAAGTACTCCCCTAATAGGGTACTGTGTGGTCTAAGTGAAAGCCTGCCCC
- 1453 CCATTCCCACTACTCTCTCTAGCCATGCTATCTTTTGGGATGAGGATGACAGGAGACATCT
- 1392 GGAATAGTGCCAGCCTGAAGGGCTGTAATTGGAAACACCTTCCCAAGAGGCACTGTTGTGA
- 1331 GGAAAGAGGATGGTCACATTAGATTAGGATGCCAGGACAGGTTGGGTCCCCTTTAGTACCC
-1270 AAACGAGGAATTCTGGGGGGCTTGGAGGGTACCACACTATTCAGTGCCCACCCAAGGTCTT
-1209 CCTACCACCCTAGGTGCTCTGCTTCTCTCTCACCTGACCCCCAGGCTCTATGATACCCCTG
E-box
- 1148 AGCTCTCTCACCTGACCCCCAGGCTCTATGATACCCCTGAGCTCTCTCACCTGACCCCCAA
TFII-I E-box
TFII-I E-box
-1087 GCTCTATGATACCCCTGAGCTCTCTCACCTGGCCCCCAAGCTCTATGATACCCCTGAGCTC
TFII-I
TFII-I E-box
-1026 TCTCACCTGACCCCCAGGCTCTATGATACCCCTGAGCTCTCTCACCTGACCCCCAGGCTCT
TFII-I E-box
E-box
ATGATACCCCTGAGCTCTCTCACCTGGCCCCCAAGCTCTATGATACCCCTGAGCTCTCTCA
- 965
TFII-I
TFII-I E-box
CCTGACCCCCAGGCTCTATGATACCCCTGAGCTCTCTCACCTGACCCCCAGGCTCTATGAT
- 904
TFII-I E-box
E-box
- 843
ACCCCTGAGCTCTCTCACCTGACCCCCAGGCTCTATGATACCCCTGAGCTCTCTCACCTGG
TFII-I E-box
TFII-I E-box
CCCCCAAGCTCTATGATACCCCTGAGCTGTGCAGACGGTTCTGTCCCTTCAGCTTTGAGAA
-782
- 721
TTTGCTGAGACTCAGGTGCAACTTGGTCAACCTTATCACTGGAGTTATCTCAGACCCTGGA
-660
ACTCAACACTCCGTTGGCTGTCACAACATCTGTGGGGCCCTAAGGGGACCCAGTGGGTCCA
- 599
CAGCTGTCCTGCGGCTGGATCTCTCTGGCTGATCATGATTTTAAAAGTTCCTGAGTGTAGG
-538
CCTGTGAGGGCAGTGGGATTCATTCAGTGAGGGAAAGGCTAGATCAGCTATGGAGATGCTT
- 477
AGGAACAAGGTGGTATGTTCTCTTGTCTGTGACGGCCTTGTCTTGTGTCTGGCAGTGCATT
- 416
GAATTAGGGGAGAGGCTGGTTGCAGCACAGGCCTCCTGTGACTGTAGTAGTGAACCAGCCT
- 355
TCAGGCTAATGTGACCCTTGCCCTCCATCATGCCTGGCACAGTCCCTACCAAGCAGCCTGT
- 294
CTAGGTACCATTCTACTTTCTGAGTGACATTTTTATGCCTTGAACTTCAAGTGGCAGTATG
- 233
TCCAAAATCCACCACAAAAGTCTGCAGCTGCTTTCTAGCAGGTATTGTCTTGTAATTCTGT
- 172
GTATTCCTGAGGGCCCAGGGAACAGGCTCTAGGCCACTGCTCATCTACTTTCTGCATGACC
-111
CACTGCCCCGCCTCTCTGGCCCGGCCCTCCTAGGCAGCCAGTGGCCCATGATGGCCTCAGG
-50
AGGCGGCGCCCCTTCCCCTGATTTCAGCCTTGGCTACAGCCCAGGCCTCCAGCAGTCTAG
+11
+64
TGCTGGAGAACTTTGTATTCTGGGGCCAATGACCTCGGGTGGAGCAGTTACTG
CTF/NF1
CCTGTGGATCCTCTATCACGTCCTCTGTGTGCAGCACACCTAGGTGCTTGGCT
+119
GGTACAAG
Inr
Figure 4.1
76
4.3 Materials and Methods
4.3.1 Preparation of Plasmid
A 425 by fragment containing 122 by of pGL3 plasmid sequence at the 3' end and
a 303 by region encompassing -238 by to +65 by of the PC proximal promoter region at
the 5' end was amplified from PCreg/luc I plasmid vector (Sparrow, 1997; Ryu, 1996) by
PCR using Tfl DNA polymerase (Epicenter Technologies, Madison, WI). PCreg/luc 1 is a
pGL3 basic vector (Stratagene, La Jolla, CA) with the 1.4 kb PC regulatory sequence
inserted
at
its
multiple
cloning
site.
TAGCATGCTGGCAGTATGTCCAAAATCCACCAC
The
3')
forward
primer
corresponded
to
(5'
PC
promoter region and had a sequence for Sal 1 cut site added its 5' end. The backward
primer (5' TAGTCGACTATGCAGTTGCTCTCCAGCGGTTC 3') corresponded to the
plasmid sequence and had an Sphl cut site added to its 5' end. Primer were synthesized
by Center for Gene Research and Biotechnology, Oregon State University. Primer pair
selection was done using Mac Vector software. The PCR product was extracted with
phenol:chloroform:isoamyl alcohol (25:24:1) (Life Technologies, Grand Island, NY) and
ethanol precipitated. A double digest of the precipitated fragment was carried out with
Sall and Sphl (New England Biolabs, Beverly, MA) which gave rise to a 425 by
fragment with a 5' and a 3' overhang on the non-coding strand. The digested fragment was
again extracted and precipitated in the above manner. The precipitated fragment was then
inserted into the multiple cloning site of a pBS vector (Stratagene, La Jolla, CA) with T4
ligase (Life Technologies, Grand Island, NY) to give PCP/pBS.
CaC12-heat shock (Sambrook et al., 1989a) was used to transform XL1-MRF'
Blue Escherichia coli (Stratagene, La Jolla, CA) with PCP/pBS vector. The transformed
bacterial cells were plated onto 100x10 mm LB agar plates containing 12.5 pg/mL
tetracycline and 60 ug/mL ampicillin.
X-Gal/IPTG (0.8 mg) in LB broth (Life
Technologies, Grand Island, NY) had been layered over each plates prior to inoculation
(Sambrook et al. 1989b) , which allowed for blue/white screening of colonies. The plates
were incubated at 37°C for 12 to 16 hours. White colonies were incubated overnight in
LB media containing 12.5 ,ug/mL tetracycline and 60 ug/mL ampicillin at 37°C with
vigorous shaking (350 r.p.m on a rotary shaker). To confirm fragment insertion, plasmids
77
were isolated from cells (Sambrook et al. 1989c) and subjected to restriction digest with
Sall and Sphl. A colony with the 425 by insert was cultured overnight in 500 mL LB
media containing 12.5 ug/mL tetracycline and 60 pg/mL ampicillin at 37°C with vigorous
shaking (350 r.p.m. on a rotary shaker), to produce large quantities of plasmid. PCP/pBS
was purified using a BIGGER PrepTM Plasmid DNA Preparation Kit (5 Prime to 3 Prime,
Boulder, CO). Plasmid concentration was determined spectrophotometrically at 260 nm.
4.3.2 Preparation of DNA Probe
Prior to labelling, the 425 by fragment was excised out of the PCP/pBS vector by
double digestion with Sall and Sphl such that the noncoding strand had a 5' and a 3'
overhang.
The fragment was separated form the rest of the plasmid by running the
digestion reaction through a low melt agarose gel (Intermountain Scientific, Rockland,
MA ). The gel section containing the 425 by fragment was cut out and subjected to
[3-agarase (New England Biolabs, Beverly, MA) digestion. DNA was then purified by
isopropanol extraction ((3-agarase kit) and ethanol precipitated (Ausebel, 1995). DNA
concentration was determined by fluorometry. The coding strand was then labelled at the
3' end by a fill-in reaction with a -[32P] -dTTP using Klenow fragment (Promega, PA).
Unincorporated nucleotides were removed by passing the reaction mix through a
Chroma-Spin TE-10 column (Clontech, Palo Alto, CA). Radioactivity of the labelled
fragment (cpm/ng) was determined on a LS 6000SC Beckman scintillation counter.
4.3.3 Preparation of Hepatic Crude Nuclear Extracts From C57BL/6J Ah" Mice
Livers from eight week old mice were minced with a razor blade and
homogenized in buffer 1 (10 mM HEPES (pH 7.6), 25 mM KC1, 0.15 mM spermidine,
1.0mM EDTA, 1.75 M sucrose and 10% glycerol) using Potter-Elvejhem homogenizer.
The homogenate was layered over buffer 1 and spun @ 94,000 x g in a AH-627 Sorvall
ultracentrifuge for 30 minutes. The nuclear pellet was homogenized in 9:1 (v/v) of buffer
1:glycerol.
The above proceedure was repeated once more with the nuclear pellet.
(Gorski et al. 1986) The pellet was suspended in 10 mL of nuclear lysis buffer (400 mM
NaCl, 10 mM HEPES-KOH @ pH 7.9, 1.5 mM MgC12, 0.1 mM EGTA, 0.5 mM DTT,
78
5% glycerol, 0.5 mM AEBSF and 0.5 ug/ml leupeptin spun at 100,000 x g for 1 hour in
@ 4°C. Precipitated material was removed by centrifugation @ 100,000 x g for one hour
in an SWTi55 rotor. The supernant was dialysed (Spectrum, CA) for four hours against
500mL of dialysis buffer (20 mM HEPES-KOH @ pH 7.9, 75 mM NaC1, 0.1 mM EDTA,
0.5 mM DTT, 20% glycerol, 0.5 mM AEBSF and 0.5 ug/ml leupeptin). Precipitated
material was removed by centrifugation @ 25,000 x g for 15 minutes. The supernant was
aliquoted and stored in liquid nitrogen (Hennighausen and Henry, 1987).
Protein
concentration was determined by the method of Bradford (Spector, 1978).
4.3.4 Electromobility Shift Assay
Two nanograms of a labelled DNA probe (30,000 cpm) consisting of -238bp to
+65bp of the mouse PC regulatory region was incubated with 1 jig of poly dI.dC, 0.05%
NP-40, binding buffer (20 mM Tris.HCL pH 7.5, 125 mM NaC1, 6.25 mM MgC12, 1.25
mM DTT and 10% glycerol) (Pharmacia Biotech, Uppsala, Sweden) and various
concentrations of crude nuclear extract for 20 minutes at room temperature.
For
competitive EMSA, the above reaction also contained excess cold probe. One-tenth
volume loading dye (250 mM Tris.HCI pH 7.5, 0.2% bromophenol blue, 0.2% xylene
cyanol and 40% glycerol) was added and the complexes were separated on a 3.0%
acrylamide-0.5% agarose composite gel (Efcavitch, 1990) at 140 V constant voltage @
4°C.
4.3.5 DNase I Footprinting Analysis
Approximately 30,000 cpm of [32P] -DNA probe was incubated with varying
concentrations of hepatic crude nuclear extracts from C57BL/6J mice for 20 minutes at
room temperature under the same conditions used for EMSAs. Proceedures for DNaseI
digestion were the same as that described in SureTrack Footprinting kit (Pharmacia
Biotech, Uppsala, Sweden). The reaction was incubated for 1 minute in the presence of
10 mM MgC12 and 5mM CaC12. Freshly diluted DNase 1 (Pharmacia Biotech, Uppsala,
Sweden) was added to the reaction mix and incubated for an additional minute. DNase 1
stop solution (768 mM sodium acetate, 128 mM EDTA, 0.56% SDS and 256 pg/mL
79
yeast tRNA) was added immediately.
The digested fragments were extracted with
phenol:chloroform (1:1 v/v) and ethanol precipitated. The precipitate was suspended in
loading dye (95% deionized formamide, 10 mM EDTA, 0.3% bromophenol blue and
0.3% xylene cyanol) and denatured at 80°C for 3 minutes. The digested fragments were
run on a 10% acrylamide/7M Urea gel for 6 hours @ 48°C. Following electrophoresis,
the gel was bathed in 12% acetic acid-10% methanol solution for 15 minutes then
transferred to 3MM Whatman paper and dried for 2 hours at 80°C. The dried gel was
wrapped in saran wrap and exposed with Dupont Cronex Plus intensifying screens for 48
hours to Kodak X-Omat film at -80°C (Sambrook et al., 1989d).
4.3.6 Sanger Dideoxy Sequencing of PCP/pBS
Manual sequencing of PCP/pBS was done using SequiTherm EXCELTMII DNA
Sequencing kit (Epicentre Technologies, Madison, WI) using [a3211-ATP labelled
backward primer (section 4.3.1). This reaction was run alongside the footprint of the 425
by fragment to determine the sequence of the protected area (data not shown).
80
4.4 Results
Protein-DNA interacion studies using the PC promoter region and hepatic crude
nuclear extracts from C57BL/6J Ah" mice were conducted to identify a transcription
initiation complex binding site. Electrophoretic mobility shift assay (EMSA) of the
labelled 303 by PC promoter region (-238 by to +65 bp) (Figure 4.2) with hepatic crude
nuclear extracts from C57BL/6J mice showed a single band shift. In order to determine if
this protein-DNA complex was due to was specific binding, competitive electromobility
shift assays were done with cold fragment (-238 by to +65 bp) (Figure 4.3). The cold
probe eliminated protein-DNA complex formation even at a 10 fold excess. This proved
that protein(s) from the crude nuclear extract that were binding to the 303 by region of the
PC gene encompassing the transcription start site (-238 by to +65 bp), in a specific
manner (Figure 4.3).
To locate the exact site at which the protein(s) bound to the 303 by region, a
DNase I footprinting analysis of the fragment with crude nuclear extracts was conducted.
Footprinting of this region showed a protected area from -13 by to + 57 by relative to the
transcription initiation start site (Figure 4.4).
The sequence bound by protein was
determined by running a Sanger dideoxy reaction (Epicentre Technologies) of the
fragment along side the footprint (data not shown). These results show that the proximal
promoter region of the mouse PC gene binds proteins in a sequence specific manner at the
region encompassing the Inr element and the CCAAT box.
81
Figure 4.2 Electromobility Shift Assay of proximal promoter region (-238 by to +65 bp)
of the pyruvate carboxylase gene from C57BL/6J mice. Lane 1 correponds to 2.0 ng
[a32P] -dTTP -probe alone. Lane 2 to 5 correspond to binding reactions with 2 ng [a3211dTTP-probe and 0.1 pg, 0.5 ,ug, 1.0 pg or 2.0 pg, respectively, of hepatic crude nuclear
extract from C57BL/6J mice. Details of binding reaction conditions are described in
section 4.3.4 Reactions were separated on a 3.0% acrylamide:0.5% agarose composite
gel as described in section 4.3.4.
82
Figure 4.2
83
Figure 4.3 Competitive Electromobility Shift Assay of the hepatic pyruvate carboxylase
proximal promoter region (-238 by to +65 bp) from C57BL/6J mice. Lane 1 corresponds
to 2 ng of labelled probe alone. Lane 2 corresponds to binding reaction of 2 ng [a3211dTTP-probe with 0.9 ug hepatic crude nuclear extract. Lanes 3 to 7 correspond to
binding reactions with 2 ng [a32P] -dTTP -probe and 0.9 ug hepatic crude nuclear extract
in the presence of 1 ng, 10 ng, 50 ng and 100 ng, respectively, of cold specific competitor
DNA (-238 by to +65 bp). Reactions were performed and run on a composite gel as
described in section 4.3.4.
84
1
Figure 4.3
2
3
4
5
6
7
85
Figure 4.4 DNase I footprinting analysis of the hepatic pyruvate carboxylase proximal
promoter region (-238 by to +65 bp) from C57BL/6J mice. Lane 1 is [oe2P] -dTTP-probe
alone digested with 1.0U DNAse 1. Lane 2 is [a32P] -dTTP -probe in the presence of 1 ug
protein. Lane 3 is [a32P] -dTTP -probe in the presence of 1 pg protein digested with 1.0U
DNAse 1. Lane 4 is [a32P] -dTTP -probe in the presence of 2 pg protein digested with
1.0U DNAse 1. Lane 5 is [a3211-dTTP-probe in the presence of 4 pg protein digested
with 1.0U DNase I. Binding reaction conditions were identical to those in EMSA
(Section 4.3.4.). Digested products were separated on a 6% acrylamide/7M Urea gel
(Section 4.3.5.). Sequence of the protected area was determined from dideoxy sequencing
reaction of the PCP/pBS plasmid using backward primer (Section 4.3.6.).
__
....
87
4.5 Discussion
DNase I footprinting analysis of the proximal promoter region (-238 by to +65 bp)
encompassing the transcription start site exhibits a protected area extending from -13 by
to +57 bp. Sequence analysis of the PC promoter region has previously shown that a
consensus site for an initiator response element (Inr) is present at +3 by to +10 by
(CAGTCTAG) and a CCAAT sequence element is present at the +36 by to +41 by
region relative to the transcription start site (Sparrow 1997; Ryu 1996).
Thus,
transcription factors that interact with the Inr element and the CCAAT box are candidate
proteins binding to the protected area. Protection of large areas surrounding the
transcription start site have been reported before. For example, the Ubx homeotic gene of
the Drosophila Melanogaster has a 41 by region downstream of transcription start site
protected by partially purified nuclear proteins. (Biggin and Tjian, 1990). Existence of
Inr elements downstream of transcription start site is not uncommon. A large number of
cellular and viral genes utilize elements that are located downstream of the start site. In
many cases, the genes that utilize these downstream elements lack a conventional TATA
box in the -20 to -30 region (Ayer and Dynan, 1990).
Instances of CCAAT sequences located downstream of transcription initiation site
have also been observed before. The CCAAT/enhancer-binding protein 8 (C/EBP8) is
autoregulated by its binding to two CCAAT sequences located 3 kb downstream of the
transcription start site (Yamada, 1998).
A CCAAT sequence is present 17 by
downstream of the transcription start site in the rabbit major histocompatibility complex
class H gene (Sittisombut, 1988). Factors binding to CCAAT boxes have been shown to
be necessary for transcription (Maity et al., 1998).
It is
quite likely that the
transcriptional machinery assembled at the PC-Inr interacts with protein(s) binding at the
CCAAT box (+36 by to +41 bp) to initiate transcription.
The mechanism of transcriptional initiation from TATA-less promoters with Inr
elements is not as well characterized as TATA containing promoters. Several Inr binding
proteins have been discovered. In the following sections a brief review of transcriptional
initiation from TATA containing promoters and current knowledge of nuclear factors
88
interacting with Inr element is provided. There are also several CCAAT box binding
proteins. As such, a brief review of CCAAT box binding proteins is also given.
4.5.1 The General Transcription Machinery
The expression of most genes is controlled primarily at the transcriptional level.
Most structural genes require the presence of seven general transcription factors (GTF)
for initiation of transcription. The seven GTFs are TFIIA, TFIIB, TFIID, TFIIE, TFIIF,
TFIIH and TFIIJ. These GTFs combine, in a sequential manner along with RNAPII to a
promoter region close to the transcriptional start site. This structure is known as a
preinitiation complex (PIC) which supports a basal level of transcription. The
preinitiation complex (PIC) of the transcriptional machinery contains approximately 30
subunits with an aggregate mass of 2100 kDa. In higher eukaryotes, TFIID is composed
of TATA binding factor (TBP) and TATA associated factors (TAFs). TBP is the only
protein in the PIC that can bind to DNA (TATA box) and hence provides a site of
nucleation for RNAPII and the rest of the GTFs which are transcriptionally competent
complex. The TATA box whose consensus sequence is TATAa/tAa/t, is present in most
promoters approximately 30 by upstream of the transcription initiation site (Voet and
Voet, 1995).
Several class II genes however lack TATA boxes (Voet and Voet, 1995). These
are mostly housekeeping genes composed of dihydrofolate reductase (DHFR) (Means and
Farnham, 1990), and phorphobilinogen deaminase (PBGD) (Beaupain et al., 1990),
among many others. TATA-less promoters contain an 11-bp element surrounding the
transcription start site, known as the initiator element (Inr), whose presence is sufficient
to direct RNAII to the correct start site (Voet and Voet, 1995). Transcriptional initiation
from TATA-less promoters require the participation of many of the same GTFs that
initiate transcription from TATA box-containing promoters (Roeder, 1996).
The Inr plays a dominant role in vivo in transcriptional initiation from TATA-less
as well as TATA containing promoters.
An essential component of the transcription
machinery for almost all TATA containing promoters studied is TFIID (Voet and Voet,
1995). Although the binding of TFIID to the TATA motif provides a nucleation site for
89
transcription complex formation on TATA-containing promoters, this is not the case for
TATA-less promoters. In TATA-less promoters, the Inr element plays an essential role in
complex formation. Recognition of Inr by an Inr binding protein (ITF) provides a means
by which a transcription competent complex can assemble (Weis and Reinberg, 1992)
.
4.5.2 The Family of Initiator Elements
Unlike the highly conserved TATA motifs, Inr elements fall into five categories
based on sequence homology. These include the terminal deoxynucleotide transferase
(TdT), the porphobilinogen deaminase (PBGD)
,
dihydrofolate reductase (DHFR),
ribosomal protein gene and the adeno associated virus p5 promoters. The mechanism by
which a transcriptionally competent complex assembles at each of the Inr elements is not
well understood (Weis and Reinberg, 1992). Recently Sp 1 has been reported to interact
with itself or with other transcription factors such as NF-kB, GATA-1 and YY-1 (proteins
binding to Inr) to synergistically enhance the transcription driven by the promoter
containing the GC box and the corresponding factor binding sequences (Kobayashi et al.,
1996)
4.5.2.1 Terminal Deoxynucleotidyl Transferase Gene Promoter
The TATA-less promoter of TdT gene has an Inr element with the consensus
sequence -3 CTCANTCT +5.
TdT-Inr is capable of initiating transcription in in vitro
and in vivo systems (Smale and Baltimore, 1989). It has been demonstrated that TBP is
necessary for transcription from TATA-less promoters containing the TdT-Inr (Smale et
al.,
1990).
The
Inr
sequences
of
adenovirus
major
late
(ML)
(-5
GTCCTCACTCTCTTCCG +1 and (Va2 (-5 GTCTCAGAGTGGTCCG +11) promoters
are homologous to that of the TdT gene (Smale and Baltimore, 1989; Carcamo et al.
1990). The TdT family Inr (-3 CTCA +1) is weakly recognized by RNAPII itself (Weis
and Reinberg, 1992). Furthermore, RNAPII along with TBP, TFIID and TFIIF are able to
form a stable complex on the Inr of the adenovirus ML and IVa2 promoters in the
absence of a TATA motif (Carmaco et al., 1991). However it is not yet clear how a
transcriptionally competent complex is formed at the TdT family of Ines (Weis and
90
Reinberg, 1992). TdT-Inr and the initiator element in adenovirus major late (AdML Inr 1)
promoter are also bound specifically by a 120 kD polypeptide known as TFII-I.
It
from the adenovirus major late promoter and
is
supports basal transcription
immunologically related to the helix-loop-helix activator USF (Roy et. al., 1991). The
mouse PC Inr (+3 CAGTCTAG +10) element sequence is most closely related to the
TdT-Inr (-3 CTCANTCT +5). Therefore, it is quite likely that the TFII I polypeptide or
the RNAP II itself are interacting directly with the mouse PC-Inr element.
4.5.2.2 Porphobilinogen Deaminase Gene Promoter
The erythroid specific human PBGD gene has a TATA-less promoter. The Inr
element present at the PBGD promoter is sufficient for accurate in vitro transcription
initiation. The PBGD Inr element (+2 TTCTGGAGAC +11) has some homology with
the downstream region of the TdT-Inr (+2 TTCTGGAGAC +11). However, the PBGD
does not require TFIID for transcriptional initiation from its promoter. A nuclear protein
present in erythroid and non-erythroid cells (Beaupain et al., 1990) has been shown to
bind specifically to the PBGD Inr as shown by competitive EMSA. Details about this
protein are not yet known.
4.5.2.3 Dihydrofolate Reductase Gene Promoter
The DHFR promoter has an Inr element with the consensus sequence (-11
ATTTCGCGCCAAACCT +5) (Means and Farnham, 1990).
A 54 kd cellular
transcription factor E2F (Blake and Azizkhan, 1989), is able to bind to the hamster DHFR
initiation site (+2 TTCGCGCCAAA +13). E2F was originally identified for its role in
activating transcription from the adenovirus E2 promoter (Kovesdi et al., 1986).
Hypoxanthine
phosphoribosyl
transferase,
KiRas,
3-phosphoglycerate
kinase,
osteonectin, interferon regulatory factor-1 and SURF-1 (Means and Farnham, 1990) are
several housekeeping promoters with Inr elements similar to E2F binding site. It was
later discovered that E2F is the same protein as housekeeping initiator protein 1 (HIP-1)
found to bind to the mouse DHFR Inr (Farnham and Means, 1990; Means and Farnham,
1990). The COOH terminal domain of RNAII major subunit is required for transcription
91
to occur from the DHFR promoter (Thompson et al., 1989). Details of E2F interaction
with RNAPII is not yet known (Weis and Reinberg,1992).
4.5.2.4 Ribosomal Protein Promoter
Mammalian ribosomal protein (rp) promoters (rpL30, rpL32 and rpS16) initiate
transcription specifically in the absence of the TATA box. The Inr elements of the rp
promoters (-4 CTTCCCTTTTCC +8) contain a unique polypyrimidine tract (Hariharan
and Perry, 1990). Mutations in the Inr of rp promoters decreases transcription. The
mouse 8 protein binding is critical for proper functioning of the rpL30 promoter
(Hariharan et al., 1989). The 8 factor is analogous to NF-El and YY1 proteins which are
described in more detail below.
4.5.2.5 Adeno Associated Virus Promoter
The adeno associated virus requires the p5+1 Inr (CTCCATTTT) for transcription
initiation to begin. Specific transcription is observed in the presence of the p5+1 element
(Seto et al., 1991). A 68 kd protein from human cells known as YY1 binds to the p5+1
element (Shi et al., 1991). YY1 is necessary for basal level transcription from adeno-
associated virus P5 promoter (Seto et al., 1991). YY1 is zinc finger protein with four
C2H2 finger motifs within its C-terminal domain and reveals a stretch of each acidic and
histidine side chains near its amino terminus (Hariharan et al., 1989). The YY-1 protein
is encoded by the same gene as NF -E 1. NF-E1 binds to the negative-acting sequences of
the immunoglobulin ICE-3 enhancer and is also a zinc-finger protein (Park and Atchinson,
1991). NF-El is the human homologue of the mouse 8 protein, which binds to ribosomal
protein gene promoters (Park et al., 1991), described above.
4.5.3 The CCAAT Motif
CCAAT element(s) are present at approximately 80 by upstream of the
transcription start site of many genes. These element(s) are required for the promoter(s)
to function optimally (Wingender, 1993). CCAAT elements have been divided into three
categories based on the effect of a CCAAT motif mutation on promoter activity (Maity
92
and Crombrugghe, 1998). Mutations in the CCAAT motifs of group 1 promoters (mouse
albumin (Maire et al., 1989), human blood coagulation factor X (Hung and High, 1996))
causes a decrease in transcription, in the absence of stimulatory influences. Mutations in
CCAAT motifs of group 2 promoters, alter transcription regulation by various inducing
agents (Maity and Crombrugghe, 1998). For example, the thrombospondin 1 promoter
activity is induced in the presence of serum. Upon mutating its CCAAT motif, an 8090% reduction in promoter activity is observed (Frameson and Bornstein, 1993). The
protein products of group 3 promoters are necessary for cell growth and viability.
Mutations in the CCAAT element of group 3 promoters alter transcriptional regulation
occuring during the cell cycle (Isaacs et al., 1996; Wang et al., 1997).
Several CCAAT binding factors have been discovered. These proteins have their
own sequence preference and have different effects on transcription. These CCAAT
binding factors are regulated in a cell and stage-specific manner (Wingender, 1993).
4.5.3.1 CCAAT Binding Factor (CBF)
CBF is a heterodimeric transcriptional activator made up of two different subunits
(A and B) with Mr of 41 and 39 la respectively (Hatamochi et al., 1988). CBF
specifically recognizes the CCAAT element. Peptides A and B are essential for binding
to DNA and activating transcription (Maity et al., 1988). CBF stimulates transcription
from several promoters. An example is the a2(I) collagen promoter that requires CBF
binding at its CCAAT motif in order to activate
transcription (Karsenty and de
Crombrugghe, 1990).
4.5.3.2 The Erythroid-Specific GATA Factors
GATA factors bind to consensus sequences ((AC)(CT)(AT)ATC(AT)(CT). They
are necessary for erythroid differentiation. These are zinc finger proteins that regulates
globin synthesis through multiple binding sites (Wingender, 1993). GATA factors bind
to promoter sequences of several erythroid specific genes among the PBGD (Eleouet and
Romeo, 1993).
93
4.5.3.3 Enhancer Binding Protein (C/EBP)
C/EBP is a leucine zipper protein that binds to its recognition sequence
(T(TG)NNG(TC)AA(TG) as a dimer. Its activity is correlated with cell differentiation.
The first two CCAAT-binding activities to have been identified were CTF/NF-1 and
C/EBP. C/EBP is heat stable and binds DNA via its leucine zipper and associated basic
region (Wingender, 1993).
4.5.3.4 CCAAT-Transcription Factor / Nuclear Factor-1 (CTF/NF-1)
CTF consists of a series of polypeptides with Mr from 52 to 66 kD. It was first
detected for its binding to the CCAAT box of HSV-1 tk promoter of the a-globin
promoter. CTF is functionally equivalent to the human nuclear factor (NF-1). NF-1 has
been shown to bind to the replication origin of adenovirus-2 and to direct initiation of
viral DNA synthesis through a direct interaction with the adenoviral DNA polymerase.
NF-1 possess a transcriptional activating domain that is enriched in proline residues.
CTF/NF-1 from rat liver has been shown to stimulate transcription in reconstituted
extracts.
CTF/NF-1 is not heat stable. (Wingender, 1993). Tijan et al., 1990 have
demonstrated that transcriptional activation by CTF/NF-1 requires association with TFIID
fraction. This presents the possibility of direct protein-protein interaction between factors
binding to the CCAAT box and Inr element present in the mouse PC promoter region.
In summary, the present study has illustrated that proteins from hepatic crude
nuclear extracts of C57BL/6J mice protect the 13 by to +57 by region of the mouse PC
promoter. The protected area contains an Inr element and a CCAAT box, indicating that
Inr binding and CCAAT box binding factors are responsible for the protection. TF II I or
RNAP II are the most likely candidate proteins interacting with the PC Inr. It is quite
likely that protein-protein interaction between factors binding to the PC Inr and CCAAT
box occur and are necessary for transcriptional initiation from the mouse PC promoter.
94
4.6 References
Ausubel, F. M. 1995. Preparation and analysis of DNA. In Short Protocols in
Molecular Biology: A Compendium of Methods from Current Protocols in
Molecular Biology. 3rd edn., 2.1.1- 2.1.2 NY: John Wiley and Sons.
Ayer, D.E. and Dynan, W. S. 1990. A downstream-element-binding factor facilitates
assembly of a functional preinitiation complex at the simian virus 40 major late
promoter. Molecular and Cellular Biology. 10: 3635-3645.
Barritt, G. J. 1985. Regulation of enzymatic activity. In Pyruvate Carboxylase, eds. D.
B. Keech and J. C. Wallace, 142. Boca Raton, FL: CRC Press.
Beaupain, D., Eleouet, J. F. and Romeo, P. H. 1990. Initiation of transcription of the
erythroid promoter of the porphobilinogen deaminase gene is regulated by a cisacting sequence around the cap site. Nucleic Acids Research. 18: 6509-6515.
Biggin, M. and Tjian, R. 1988. Transcription Factors that activate the ultrabithorax
promoter in developmentally staged extracts. Cell. 53: 699-711.
Blake, M. C., Azizkhan, J. C. 1989. Transcription factor E2F is required for effecient
expression of the hamster dihydrofolate reductase gene in vitro and in vivo.
Molecular and Cellular Biology. 9: 4994-5002.
Carcamo, J., Maldonado, E., Aim, M., Ha, I., Kasai, Y., Flint, J., and Reinberg, D. 1990.
A TATA-like sequence located downstream of the transcription initiation site is
required for expression of an RNA polymerase II transcribed.
Genes and
Development. 4:1611-1622.
Carmaco, J., Buckbinder, L., Reinberg, D. 1991. The initiator directs the assembly of a
transcription factor ILD-dependant transcription complex. Proceedings. National
Academy of Sciences. USA. 88: 8052-8056.
Efcavitch, J. W. 1990. Gel electrophoresis of nucleic acids. A practical. eds. D.
Rickwood and B. Hames, 124. NY: Oxford University Press.
Eleouet, J and Romeo, P. 1993. CCACC-binding or simian-virus-40-protein-1-binding
proteins cooperate with human GATA-1 to direct erythroid-specific transcription
and mediate 5' hypersensitive site 2 sensitivity of a TATA-less promoter.
European Journal of Biochemistry. 212:763-770
Farnham, P. J. and Means, A. L. 1990 Sequences downstream of the transcription
initiation site modulate the activity of the murine dihydrofolate reductase
promoter. Molecular and Cellular Biology. 10: 1390-1398.
95
Frameson, P. and Bornstein, P. 1993. A serum response element and a binding site for
NF-7 mediate the serum response of the thrombospondin 1 gene. Journal of
Biological Chemistry. 268: 4989-4996.
Gorski, K., Carneiro, M. and Schibler, U. 1986. Tissue -specific in vitro transcription
from the mouse albumin promoter. Cell. 47: 767-776.
Hariharan, N., Kelley, D. and Perry, R. P. 1989. Equipotent mouse ribosomal protein
promoters have a similar architecture that includes internal sequence elements.
Genes and Development. 3: 1789-1800.
Hariharan, N. and Perry, R. P. 1990. Functional dissection of a mouse ribosomal protein
promoter: Significance of the polypyrimidine initiator and an element in the
TATA-box region. Proceedings. National Academy of Sciences. USA. 87: 15261530.
Hatamochi, A., Golumbek, P. T., van Schaftingen, E. and de Crombrugghe, B. 1988. A
CCAAT DNA binding factor consisting of two different components that are both
required for DNA binding. Journal of Biological Chemistry. 263: 5940-5947.
Hennighausen, L. and Henry, K.L. 1987. Interaction of protein and DNA in vitro.
Methods in Enzymology. 152:722-723.
Hung, H. L. and High, K. A. 1996.
Liver-enriched transcription factor HNF-4 and
ubiquitous factor NF-Y are critical for expression of blood coagulation factor X.
Journal of Biological Chemistry. 271: 2323-2331.
Ilian, M. A., Sparrow, B. R.., Ryu, B., Selivonchick, D. P. and Schaup, H. W. 1996.
Expression of hepatic pyruvate carboxylase mRNA in C57BL/6J Ahb/b and
Ahd/d mice exposed to 2,3,7,8-tetrachlorodibenzo-p-dioxin.
Journal of
Biochemical Toxicology. 11: 51-56.
Isaacs, R. J., Harris, A. L. and Hickson, I. D. 1996. Regulation of human topoisomerase
1 alpha gene promoter in confluence arrested cells.
Journal of Biological
Chemistry. 271: 16741-16747.
Jitrapakdee, S., Grant, B. W. Cassady, I. A. and Wallace, J. C. 1997. The rat pyruvate
carboxylase gene structure. Journal of Biological Chemistry. 272: 20522-20530.
Jones, N. C., Rigby, P. W. J. and Ziff, E. B. 1988. Trans-acting protein factors and the
regulation of eukaryotic transcription. Genes and Development. 2: 267-281.
Karsenty, G., and de Crombrugghe, B. 1990. Two different negative and one positive
regulatory factors interact with a short promoter segment of the alpha 1 (I)
collagen gene. Journal of Biological Chemistry. 265: 9934-9942.
96
Kobayashi, A. Sogawa, K. and Kuriyama, Y. 1996. Cooperative interaction between
AhR-ARNT and Sp 1 for the drug inducible expression of CYP1A1 gene. Journal
of Biological Chemistry. 271: 12310-12316.
Kovesdi, I., Reichel, R., Nevins, J. 1986. Identification of a cellular transcription factor
involved in ElA trans-activation. Cell. 45: 219-228.
Maire, P., Wuarin, J. and Schibler, U. 1989. The role of cis-acting promoter element in
tissue-specific albumin gene expression. Science. 244: 343-346.
Maity, S. N., Golumbek, P. T., Karsenty, G. and de Crombrugghe, B. 1988. Selective
activation of transcription by a novel CCAAT binding factor. Science. 241: 582585.
Maity, S. N. and Crombrugghe B. 1998. Role of the CCAAT-binding protein CBF/NFY in transcription. Trends in Biochemical Sciences. 23: 174-178.
McKnight, S. and Tjian, R.
1986.
Transcriptional selectivity of viral genes in
mammalian cells. Cell. 46: 795-805.
Means, A. L. and Farnham, P. J.
Transcription initiation from dihydrofolate
reductase promoter is positioned by HIP1 binding at the initiation site. Molecular
and Cellular Biology. 10: 653-661.
1990.
Park, K. and Atchison, M L. 1991. Isolation of candidate repressor/activator, NF-E1
(YY-1, 8), that binds to the immunoglobulin lc 3' enhancer and immunoglobulin
heavy-chain (El site. Proceedings. National Academy of Sciences. USA. 88:
9804-9808.
Roeder, R. G. 1996. The role of general initiation factors in transcription by RNA
polymerase H. Trends in Biochemical Sciences. 21: 327-335.
Roy, A. L., Miesteremst, P. P. and Roeder, R. G. 1991. Cooperative interaction of an
initiator-binding transcription initiator factor and the helix-loop-helix activator
USF. Nature. 354:245-248.
Ryu, B., Roy, S., Sparrow, B. R., Selivonchick, D. P. and Schaup, H. W. 1995. Ah
receptor involvement in mediation of pyruvate carboxylase levels and activity in
mice given 2,3,7,8-tetrachlorodibenzo-p-dioxin. Journal of Biochemical
Toxicology. 10:103-109.
Ryu, B. 1996.
Characterization of pyruvate carboxylase responses to 2,3,7,8-
Tetrachlorodibenzo-p-dioxin exposure in C57BL6J
dissertation, Oregon State University, Corvallis, OR.
Ah" mice.
Thesis
97
Sambrook, J., Fritsch, E. F., and Maniatis, T. 1989a. Protocol H: Fresh competent E. coli
prepared using calcium chloride. In Molecular Cloning. A Laboratory Manual,
2nd edn., 1.82-1.84. New York: Cold Spring Harbor Laboratory Press.
Sambrook, J., Fritsch, E. F. and Maniatis, T. 1989b. Identification of bacterial colonies
that contain recombinant plasmids. In Molecular Cloning. A Laboratory Manual,
2nd edn., 1.85-1.86. New York: Cold Springs Harbor Laboratory Press.
Sambrook, J., Fritsch, E. F., and Maniatis, T. 1989c. Small-scale preparation of plasmid
DNA. In Molecular Cloning. A Laboratory Manual, 2nd edn., 1.25-1.28. New
York: Cold Springs Harbor Laboratory Press.
Sambrook, J., Fritsch, E. F., and Maniatis, T. 1989d. Gel Electrophoresis of DNA. In
Molecular Cloning. A Laboratory Manual, 2nd edn., 6.3-6.48. New York: Cold
Springs Harbor Laboratory Press.
Seto, E., Shi, Y. and Shenk, T. 1991. YY1 is an initiator sequence-binding protein that
directs and activated transcription in vitro. Nature. 354: 241-245.
Shi, Y., Seto, E., Chang, L. S. and Shenk, T. 1991. Transcriptional repression by YY1, a
human GL1-Kruppel-related protein, and relief of repression by E 1 A protein.
Cell. 67: 377-388.
Sittisombut, N. 1988. Two distinct nuclear factors bind the conserved regulatory
sequences of a rabbit major histocompatibility complex class II gene. Molecular
and Cellular Biology. 8: 2034-2041.
Smale, S. T. and Baltimore, D. 1989. The initiator as a transcriptional control element.
Cell. 57: 103-113.
Smale, S. T., Schmidt, M. C., Berk, A. J., Baltimore, D. 1990. Transcriptional activation
by Sp 1 as directed through TATA it initiator: Specific requirement for
mammalian transcription factor BD. Proceedings. National Academy of
Sciences. USA. 87: 4509-4513.
Sparrow, B. R., Thompson, C. S., Ryu, B. W., Selivonchick, D. P. and Schaup, H. W.
1994.
2,3,7,8-Tetrachlorodibenzo-p-dioxin induced alterations of pyruvate
carboxylase levels and lactate dehydrogenase isozyme shifts in C57BL/6J male
mice. Journal of Biochemical Toxicology. 9: 329-339.
Sparrow, B. R. 1997. Characterization of 2,3,7,8-tetrachlorodibenzo-p-dioxin (TCDD)
induced modification of hepatic pyruvate carboxylase gene expression in
C57BL/6J male mice. Thesis dissertation. Oregon State University, Corvallis,
OR.
98
Spector, T. 1978. Refinement of the coomassie blue method of protein quantitation.
Analytical Biochemistry. 86: 142-146.
Thompson, N. E., Steinberg, T. H., Aronson, D. B. and Burgess, R. R. 1989. Inhibition
of in vivo and in vitro transcription by monoclonal antibodies prepared against
wheat germ RNA polymerase II that react with the heptapeptide repeat of
eukaryotic RNA polymerase II. Journal of Biological Chemistry.
264:11511-
11520.
Voet, D. and Voet, J. G. 1995. Eukaryotic gene expression. In Biochemistry. eds. D. Voet
and J. G. Voet, 1154. NY: John Wiley and Sons.
Wang, Q., Zambetti, G. P. and Suttle, D. P. 1997. Inhibition of DNA topoisomerase H
alpha gene expression by the p53 tumor suppressor. Molecular and Cellular
Biology. 17: 389-397.
Weber,
L. W. D., Lebofsky, M., Helmut, G., and Rozman, K. 1991. Key enzymes of
gluconeogenesis are dose dependantly reduced in 2,3,7,8-tetrachlorodibenzo-pdioxin (TCDD) treated rats. Archives of Toxicology. 65: 119-123.
Weis, L. and Reinberg, D. 1992. Transcription by RNA polymerase H: initiator-directed
formation of transcription-competent complex. FASEB. 6: 3300-3309.
Whitlock, J. P., Jr. Mechanistic aspects of dioxin action. 1993. Chemical Research in
Toxicology. 6: 754-763.
Wingender, E. 1993. Ubiquitous DNA-binding transcription factors. In Gene Regulation
in Eukaryotes. ed. E. Wingender, 75-113. Germany: VCH.
Yamada, T., Tsuchiya, T., Osada, S., Nishihara, T. and Imagawa, M.
1998.
CCAAT/Enhancer-binding protein 8 gene expression is mediated by
autoregulation through downstream binding sites. Biochemical and Biophysical
Research Communications. 242: 88-92.
99
Chapter 5
Comparison of DNA Binding Patterns of Hepatic Crude Nuclear Extracts from
2,3,7,8-Tetrachlorodibenzo-p-dioxin Treated and Untreated C57BL/6J Mice to the
Multiple E-box Region within the Pyruvate Carboxylase Promoter
Shukla Roy and Daniel P. Selivonchick
100
5.1
Abstract
The pyruvate carboxylase regulatory region is unusual in that it has consensus
sites for sixteen E-boxes. Ten of the E-boxes are juxtaposed to TFII I elements in the
-
790 by to -1148 by region. E boxes bind basic helix-loop-helix type of proteins (bHLH).
Aryl hydrocarbon receptor nuclear translocator (ARNT) is a class B type of bHLH
transcription factor. The ARNT protein plays a critical role in hypoxic induction of
angiogenesis and aryl hydrocarbon (Ah) receptor mediated signal transduction. In the
presence of dioxin, ARNT heterodimerizes with the Ah receptor and alters the expression
of numerous genes. In previous studies, transient co-transfection of hepa 1 c 1 c7 cells with
the PC promoter region and an ARNT encoding plasmid (pBM5/NEO/M1-1 ARNT)
suppressed the dioxin induced PC promoter activity. These results indicated that ARNT
might be involved in downregulation of PC by TCDD.
In the present study
electromobility shift assays (EMSA) of the multiple E-box region with hepatic crude
nuclear extracts from C57BL/6J mice have been employed to illustrate nuclear protein(s)
intearction with this region. Increasing the nuclear protein concentration in the binding
reaction causes greater shift(s) in the protein-DNA complex. A plot of nuclear protein
concentration (ug) in the binding reaction versus mobility of the protein-DNA complex
relative to free probe (Rf) produced a saturation curve. The hyperbolic nature of the
curve suggests that multiple proteins are binding to the E-box region and that occupancy
of the E-boxes increases with increasing nuclear protein concentration.
Competitive
EMSAs of the E-box region with specific and non-specific cold competitor probes
confirmed that the protein-DNA complex was due to specific protein binding.
An
antibody to the mouse ARNT protein (BEARNT) was used to investigate if the nuclear
protein binding to the E-box region was ARNT. However, BERANT failed to supershift
the protein DNA complex. These results indicate that the nuclear protein(s) binding to the
PC multiple E-box is not ARNT. EMSAs of the multiple E-box region with hepatic
crude nuclear extracts from mice treated with a 75 pg TCDD/kg injected and their pair
fed controls. The DNA binding patterns of nuclear proteins from the TCDD injected
mice were identical to those of untreated controls, described above. However, nuclear
proteins from the pair-fed controls bound with a reduced affinity to the E-box region.
101
This inducates that TCDD downregulation of PC does not occur through the E-box
region. The reason for this reduced binding is still not clear. However, calorie restriction
has been shown to alter the binding affinity of several transcription factors.
102
5.2 Introduction
Alteration of gene expression by 2,3,7,8-tetrachlorodibenzo-p-dioxin (TCDD) has
been studied extensively in in vitro systems as well as whole animal models. Induction of
numerous drug metabolizing enzymes occur as a result of direct interaction of dioxin
liganded Ah receptor with xenobiotic response element (XRE) present in the promoter
regions of these genes. Examples of XRE containing genes are CYP1A1 (Denison et al.,
1989; Wu and Whitlock, 1993), CYP1A2 (Quattrochi et al., 1994), glutathione-S-
transferase Ya subunit (Pimental et al., 1993), NAD(P)H:Quinone Oxidoreductase
(Favreau and Pickett, 1991) and aldehyde-3-dehydrogenase (Takimoto et al., 1994).
Genes involved in the control of cell growth and differentiation such as
plasminogen activator inhibitor (PAI-2), interleukin-1 beta (IL-1(3) and transforming
growth factor-alpha (TGF-a) are induced by TCDD but not through an XRE binding
mechanism. (Rowlands and Gustafsson, 1997). Modulation of several proteins and
mRNAs by TCDD are not AhR dependant. These include ornithine decarboxylase
(Nebert et al., 1980), a 60 kDa microsomal esterase (Korza and Ozols, 1988), malic
enzyme activity (Roth et al., 1988), transforming growth factor-I31 protein and mRNA
(Abott et al., 1992), aldehyde dehydrogenase isozyme ALD3m (Vasiliou et al., 1992),
interleukin 113 mRNA (Sutter et al., 1991), epidermal transglutaminase (Puhvel et al.,
1984), protein kinase C activity (Bombick et al., 1985; Wolfle et al., 1993), c-erbA
messenger RNA levels, phosphorylation of pp60src and Ras-associated GTP binding
(Bombick et al., 1988). AhR dependant regulation of genes is justified by two criteria.
The first is that responsiveness segregates with the Ah" allele in the mouse while non or
reduced responsiveness segregates with the Ahd allele. The second is that the response
does not occur in AhR or ARNT deficient mutants of the Hepa 1 cic7 cells (Hankinson,
1995).
The mechanism(s) by which dioxin modulates the above genes through a non-
AhR mediated pathway is not yet clear. Intermediary metabolism enzymes such as
acetyl-CoA
carboxylase
(ACC)
(McKim
et
al.,
1991),
phosphoenolpyruvate
carboxykinase (PEPCK) (Weber et al., 1991) and rat as well as mouse PC are all down-
103
regulated by dioxin. The promoters of these genes also lack XRE's but the downregulation is AhR dependant.
The mouse PC upstream regulatory region was recently cloned and sequenced.
Computer aided sequence analysis of the PC promoter showed that consensus elements
for ten evenly spaced E boxes (CACCTG) juxtaposed to TFII I elements exist in the
-1148 by to -790 by region, relative to the transcriptional start site (Figure 3.1). E-boxes
bind helix-loop-helix (HLH) type transcription factors such as Myc, USF, Myo D and
ARNT. TFII I binds to Inr elements and facilitates the binding of TFIID thereby
promoting the subsequent sequential assembly of RNA polymerase H preinitiation
complex in TATA-less genes (Roeder, 1991). Evidence for TFII I interactions with HLH
type proteins (USF and myc) is present (Wingender, 1993; Roy and Roeder, 1994). It has
been shown that the CAC halves of DRE(s) and E-boxes are recognized by the ARNT
protein (Sogawa et al., 1995).
Based on the above information, it was postulated that ARNT was binding to the
E-boxes and TFII I was binding to its elements juxtaposed to the E-boxes and that
protein-protein interactions between the two types of transcription factors were
influencing transcriptional regulation (Sparrow, 1997). Studies by Jitrapakdee et al.,
(1996) indicated that the 5' untranslated region of the rat PC gene is divergent due to
alternative splicing of PC transcripts. Depending upon the tissue, the rat PC leader
sequence ranges from 59 to 222 nucleotides in length. Multiple TFII I elements would
allow for proper spatial positioning between the Inr and the TFII I to compensate for
varying lengths of the PC untranslated region (Sparrow, 1997). It was also hypothesized
that TCDD treatment influenced ARNT binding to the E-boxes which eventually led to
down-regulation of PC transcription (Sparrow, 1997).
In order to investigate if ARNT was indeed involved in PC down-regulation by
TCDD, transient transfection assays were done in Hepa 1 cic7 cells containing high
affinity Ah receptors. Transient transfection of Hepa 1 c 1 c7 cells with a luciferase plasmid
containing the PC promoter region showed that in the presence of TCDD PC promoter
activity was increased. Co-transfection of the Hepa 1 c 1 c7 cells with the ARNT encoding
plasmid (pBM5/NEO/M1-1) and the plasmid containing the PC promoter region showed
104
suppression of TCDD induced PC promoter activity. Therefore, the possibility for the
involvement of ARNT in regulation of the PC promoter was feasable (Sparrow, 1997).
Tertiary structure analysis of the PC gene reveals a novel spiral structure in the E-
box region. The spiralling is such that nine of the elements are positioned in a manner to
form a trio of phased elements, i.e., every third element is positioned in line with one
another. The close proximity hints of possible protein-protein interactions among the
elements (Sparrow, 1997).
The possibility of the involvement of ARNT in dioxin
mediated downregulation of PC through E-boxes and the unusual tertiary structure of the
multiple E-box region (-1232 by to -637 bp) led us to conduct protein-DNA interaction
studies with this region.
First, electromobility shift assays (EMSAs) of the multiple E-box region with
hepatic crude nuclear extracts from C57BL/6J mice were done to investigate if nuclear
proteins bound to this region. Results of the EMSAs indicated that nuclear protein(s)
were binding to the multiple E-box region and that this binding is sequence specific. An
antibody to the ARNT protein (BEARNT) was utilized to investigate if it was the ARNT
protein that was binding to the E-box region. However, BEARNT did not recognize the
protein-DNA complex. Therefore we can conclude that it is not the ARNT protein that is
binding to the multiple E-box region of the PC promoter region.
EMSAs of the multiple E-box region with crude nuclear proteins from mice that
were treated with 75 µg TCDD/kg were also done to see if protein binding patterns would
change upon TCDD exposure. Nuclear proteins from TCDD treated mice bound in
exactly the same fashion as nuclear proteins from ad libitum, untreated controls indicating
that the E-box region is not involved in dioxin mediated downregulation of PC. However,
nuclear proteins from animals that were pair-fed controls for the TCDD treated mice
bound to the E-box region with a greatly reduced affinity. It is plausable that calorie
restriction alters the binding of nuclear proteins to the E-box region and this is the cause
of PC induction in the pair-fed controls.
105
5.3 Materials and Methods
5.3.1 Preparation of Plasmid
A 607 by fragment encompassing -1232 by to -639 by of the PC upstream
regulatory region was amplified from PCreg/luc 1 plasmid vector (Sparrow, 1997; Ryu,
1996) by PCR using Tfl DNA polymerase (Epicentre Technologies, Madison, WI).
PCreg/lucl is a pGL3-basic luciferase vector (Stratagene, La Jolla, CA) with the 1.4 kb
PC regulatory sequence (-1359 by to + 65 bp) inserted into its multiple cloning site. The
forward primer (5'-TAGCATGCATTCAGTGCCCACCCAAGGTCTTC-3') correspond
to the 5' end to the 607 by fragment and had a Sall cut site added to its 5' end. The
backward primer (5'-TAGTCGACGTTGTGACAGCCAACGGAGTGTTG-3')correspond
to the 3' end of the 607 by fragment and had an Sphl site attached at its 5' end. Primers
were synthesized by Center for Gene Research and Biotechnology, Oregon State
University.
Primer pair selection was done using Mac Vector software.
The PCR
product was extracted with phenol:chloroform:isoamyl alcohol (25:24:1) (Life
Technologies, Grand Island, NY) and ethanol precipitated (Ausubel, 1995). A double
digest of the precipitated fragment was carried out with Sall and Sphl (New England
Biolabs, Beverly, MA) which gave rise to a 607 by fragment with a 5' and a 3' overhang
on the non coding strand. The digested fragment was again extracted and precipitated in
the above manner. The digested fragment was inserted into the multiple cloning site of a
pBS vector (Stratagene, La Jolla, CA) with T4 ligase (Life Technologies, Grand Island,
NY) to give PCE-box/pBS.
CaC12-heat shock (Sambrook et al. 1989a) was used to transform XL1-MRF' Blue
Escherichia coli (Stratagene, La Jolla, CA) with PCE-box/pBS vector. The transformed
bacterial cells were plated onto 10x100mm LB agar plates containing 12.5 pg/mL
tetracycline and 60 ug/mL ampicillin. X-Gal/IPTG (0.8 mg) in 100 1/1 of LB broth (Life
Technologies, Grand Island, NY) was layered over each
plate 4 hours prior to
inoculation (Sambrook et al., 1989b) which allowed for blue/white screening of colonies.
The plates were incubated at 37°C for 12 to 16 hours. White colonies were incubated
overnight in LB media containing 12.5 ,ug/mL tetracycline and 60 pg/mL ampicillin at
37°C with vigorous shaking (350 r.p.m on a rotary shaker).
To confirm fragment
106
insertion, plasmids were were isolated from cells (Sambrook et al., 1989c) and subjected
to restriction digest with Sall and Sphl. A colony with the 607 by insert was cultured
overnight in 500 mL LB media containing 12.5 ,ug/mL tetracycline and 60 pg/mL
ampicillin at 37°C with vigorous shaking (350 r.p.m on a rotary shaker), to produce large
quantities of plasmid. PCE-box/pBS was purified using a BIGGER PrepTM Plasmid
DNA Preparation Kit (5 Prime to 3 Prime, Boulder, CO). Plasmid concentration was
determined spectrophotometrically at 260 nm.
5.3.2 Preparation of DNA probe
Prior to labelling, the 607 by fragment was excised out of the PCE-box/pBS
vector by double digestion with Sall and Sphl such that the non coding strand had a 5'
and a 3' overhang. The fragment was separated from the rest of the plasmid by running
the digestion reaction through a low melt agarose gel (Intermountain Scientific,
Rockland, MA).
The gel section containing the 607 by fragment was cut out and
subjected to f3- agarase digestion (New England Biolabs, Beverly, MA). DNA was then
purified by isopropanol extraction (P-agarase) and ethanol precipitation (Ausubel, 1995).
The coding strand was then labelled at the 3' end by a fill-in reaction with [cc-32P] -dTTP
using Klenow fragment (Promega, PA). Unincorporated nucleotides were removed by
passing the reaction mix through a Chroma-Spin TE-10 column (Clontech, Palo Alto,
CA). Radioactivity of the labelled fragment was determined on a LS6000 SC Beckman
scintillation counter.
5.3.3 TCDD Treatment of C57BL/6J Mice
Twenty, eight week old male C57BL/6J mice were purchased from Jackson
laboratories (Bar Harbor, MA). Mice were housed individually in cages and maintained
on chow from Harlan Teklad. Mice were kept in a room maintained by laboratory animal
resources (LAR) for the duration of the experiment. After a three day acclimation period,
mice were paired according to weight. Ten mice, one from each pair, were injected
intraperitonially (ip) with 75 ,ug TCDD/kg. The TCDD solution used was the same as
that described by Sparrow et al. (1994). The paired counterparts were injected with the
107
same volume of corn oil vehicle. TCDD treated mice were fed ad libitum. The vehicle
injected mice were given a ration of food consumed by their TCDD treated counterparts.
Food intake and body weight were monitored daily.
5.3.4 Preparation of Hepatic Crude Nuclear Extracts from C57BL/6J Mice
On day nine post treatment, livers were excised from mice and gall bladders
removed. The livers were perfused with 0.9% ice cold saline solutions, pooled together
and minced with a razor blade. The pooled samples were homogenized in buffer 1 (10
mM HEPES (pH 7.6), 25 mM KC1, 0.15 mM spermidine, 1.0 mM EDTA, 1.75 M
sucrose and 10% glycerol) using Potter-Elevjhem homogenizer. The homogenate was
layered over buffer 1 and spun @ 94,000 x g in an AH-627 Sorvall Ultracentrifuge rotor
for 30 minutes. The nuclear pellet was homogenized in 9:1 (v/v) of buffer 1 : glycerol.
The above proceedure was repeated once more with the nuclear pellet (Gorski et al.,
1986). The pellet was suspended in 10 mL of nuclear lysis buffer (400 mM NaC1, 10
mM HEPES-KOH @ pH 7.9, 1.5 mM MgC12, 0.1 mM EGTA, 0.5 mM DTT, 5%
glycerol, 0.5 mM AEBSF and 0.5 pg/mL leupeptin) and slowly stirred for an hour in a
cold room. Precipitated material was removed by centrifugation @ 100,000 x g for one
hour in an SWTi55 rotor. The supernant was dialysed (Spectrum, CA) in for four hours
500 mL dialysis buffer (20 mM HEPES-KOH pH 7.9, 75 mM NaCl, 0.1 mM EDTA, 0.5
mM DTT, 20% glycerol, 0.5 mM AEBSF and 0.5 ,ug/mL leupeptin. Precipitated material
was removed by centrifugation @ 25,000 x g for 15 minutes.
The supernant was
aliquoted and stored in liquid nitrogen.
5.3.5 Electromobility Shift Assay
Two nanograms of labelled DNA probe (30,000 cpm) consisting of -1232 by to 639 by of the mouse PC regulatory region was incubated with 1 ug of poly dI.dC, 0.05%
NP-40, binding buffer (20 mM Tris.HC1 pH 7.5, 125 mM NaC1, 6.25 mM MgC12, 1.25
mM DTT and 10% glycerol) (SureTrack Footprinting Kit, Pharmacia Biotech, Uppsala,
Sweden) and varying concentrations of crude nuclear extracts for 20 minutes at room
temperature. For competitive EMSA, cold specific probe (607 by fragment) or cold non-
108
specific probe (Pvu II cut fragment from pBS vector) was also present in the above
reaction mix. One-tenth volume loading dye (250 mM Tris.HC1 ph 7.5, 0.2%
bromophenol blue, 0.2% xylene cyanol and 40% glycerol) was added and the complexes
were separated on a 1.2% vertival agarose gel in 0.5 x TBE buffer. Electrophoresis was
done in a cold room @140V constant voltage. Bands were visualized by autoradiography
after overnight exposure of gel @ -80°C (X-OMAT, Sigma).
5.3.6 Supershift Assays with aARNT Antibody
The Anti-ARNT antibody BEARNT (Pollenz et
al.
1994) was graceously
provided by the laboratory of Dr. Nancy Kerkvleit (Oregon State University, Corvallis,
OR). BEARNT is a polyclonal antibody produced in rabbit using a protein expressed in
bacteria corresponding to amino acids 318 to 773 of B-1 ARNT as the antigen. ARNT
antibodies were coincubated for 20 minutes at room temperature along with 8 ug hepatic
crude nuclear extract from 75 ,ug TCDD/kg treated mice, 2 ng of labelled E-box
fragment, 1 ug of poly dI.dC, 0.05% NP-40 and binding buffer (20mM Tris.HC1 ph 7.5,
125 mM NaC1, 6.25 mM MgC12, 1.25 mM DTT and 10% glycerol). Reactions were
loaded and run on a 1.5% vertical agarose as described above (section 5.2.5).
109
5.4 Results
The results of the present study obtained by EMSA show that the upstream
regulatory region of the PC gene containing multiple E-boxes (-1232 by to -637 bp) is
bound by protein(s) from hepatic crude nuclear extracts of C57BL/6J mice (Figure 5.1).
An unusual feature of this particular EMSA is that in the presence of protein all of the
free probe is bound. In a standard EMSA, only a portion of the labelled probe is bound by
protein. This indicated that the nuclear protein(s) are binding with high affinity to the Ebox region (personnel communications, Dr. Victor Hsu, Oregon State University). As the
extract concentration is increased in the assay, a greater shift in the protein-DNA complex
occurs, relative to the free probe (Figure 5.1). A graded decrease in mobility of the bound
fragment as a function of increasing extract concentration supports the idea that there are
multiple protein(s) binding to multiple sites in this region and that increasing the extract
concentration causes more of these sites to be occupied. A plot of crude nuclear extract
(lig protein) vs. extent of DNA-protein complex shift (Rf) revealed that this was a
hyperbolic phenomenon (Figure 5.2). The hyperbolic nature of the shift suggests that
increasing the extract concentration leads to greater occupancy of the E-box sites and that
a saturation point is reached at higher concentrations of protein (16 pg). The hyperbolic
pattern of protein binding also suggests that a non-cooperative type of interaction is
occurring i.e. binding of one protein does not have a synergistic effect on further protein
binding (Travers, 1993). A sigmoidal binding curve would support a cooperative type of
interaction being involved in protein binding (Travers, 1993).
Competitive EMSAs prove that the complex formation is due to specific binding
of nuclear protein(s) to the E-box region. A non-specific cold competitor DNA fragment
(part of pBS plasmid) does not interfere with complex formation whereas a specific
competitor DNA (cold probe) prevents the complex formation by sequestering proteins
binding to the E-box region (Figure 5.3).
In order to investigate if nuclear proteins from TCDD treated mice bind in the same
manner to the E-box region as nuclear proteins from untreated animals, EMSAs were
conducted with crude nuclear extracts from mice that had been previously injected with
TCDD. TCDD treated mice had fatty livers with reticulation when compared to livers
110
Figure 5.1 Electromobility Shift Assay of hepatic pyruvate carboxylase multiple E-box
region (-1232 by to -639 bp) from C57BL/6J mice. Lanes 1 to 5 represent binding
reactions of 2 ng [a3211-dTTP-probe with 0 ,ug, 2 ug, 4 ,ug, 8 ,ug and 16 ,ug hepatic crude
nuclear extract from C57BL/6J mice. Protein-DNA binding reaction conditions are
described in section 5.3.5. Reactions were separated on a 1.2% agarose gel as described
in section 5.3.5.
2
Figure 5.1
3
4
5
112
Figure 5.2 Protein-DNA complex mobility on a 1.2% agarose gel as a function of crude
nuclear extract concentration. Distance travelled by the protein-DNA complex relative to
free probe (Rf) is plotted against protein concentration (ug) in the binding reaction.
Values were calculated from EMSA in Figure 5.1. The hyperbolic nature of the curve
strongly suggests saturation of protein binding sites on the multiple E-box region with
increasing protein concentration.
113
0.8
0.6-
0.2-
0
0
I
I
I
5
10
15
ug of nuclear protein
Figure 5.2
20
114
Figure 5.3 Competitive Electromobility Shift Assay of the hepatic pyruvate carboxylase
multiple E-box region from C57BL/6J mice. Lanes 1 to 5 correspond to binding
reactions with 2 ng [a32P] -dTTP -probe and 0 pg, 2 pg, 4 pg, 8 pg or 16 pg, respectively,
of hepatic crude nuclear extract from C57BL/6J mice. Lanes 6 to 8 correspond to 2 ng
[a32P] -probe and 8 ug hepatic crude nuclear extract in the presence of 10x, 50x and 100x
cold specific competitor probe (-1232 by to -639 bp), respectively. Lanes 9 to 12
correspond to 2 ng [a32P] -dTTP -probe and 8 ug hepatic crude nuclear extract in the
presence of 10x, 50x and 100x of cold non-specific competitor DNA (-400bp fragment
from pBS plasmid), respectively. Reaction conditions and gel electrophoretic conditions
are described in section 5.3.5.
115
1
Figure 5.3
2345
678
9 10 11
116
from pair-fed, vehicle treated controls. Body weight to liver weight ratios for the TCDD
treated mice were 0.0716 ± 0.014 and 0.053 ± 0.016 for the pair-fed control animals.
These are typical signs of TCDD toxicity.
Surprisingly, the binding patterns of nuclear proteins from mice treated with
TCDD (Figure 5.4) were identical to nuclear proteins from ad libitum controls (Figure
5.1). However, nuclear proteins from the pair-fed controls bound to E-box region very
weakly (Figure 5.4). A clear band shift failed to occur even at 16 ,ug of nuclear protein.
The reason for this weaker binding is unclear. It is possible that calorie restriction due to
pair-feeding leads to depletion of the nuclear factors or their auxiliary proteins that bind
to the E-box region.
Previously, transient transfection assays with Hepa 1 c 1 c7 cells showed that
TCDD induced PC promoter activity from a luciferase vector. The reason for PC
promoter activity induction by TCDD in an in vitro system as opposed to a suppression of
PC expression by TCDD in an in vivo system is still not clear. It is important to note that
only a portion of the PC upstream regulatory region was utilized in the transient
transfection assays. Furthermore, ARNT suppressed the induction of PC promoter activity
caused by TCDD. This led us to believe that ARNT was interacting with the PC
promoter region, probably with the E-box site(s) and altering PC promoter activity
(Sparrow, 1997).
An attempt was made to identify the protein(s) binding to the multiple E-box
region. E-boxes are bound by basic helix-loop-helix type of transcription factors. In order
to test the hypothesis that ARNT is binding to the E-boxes, an ARNT antibody was added
to the binding reaction described above. The expectation was that if ARNT was indeed
binding to the E-box region then the protein-DNA complex would be supershifted by the
ARNT antibody. However, a-ARNT failed to shift the protein-DNA complex (Figure
5.5), suggesting that it is not the ARNT protein binding to the multiple E-box region. A
bHLH other that ARNT is interacting with the E-box. DNase I footprinting analysis of
the E box region with crude nuclear extracts did not show a protected region. Faliure to
obtain a footprint of this region is probably due to the fact that unpurified proteins were
117
Figure 5.4 Comparison of DNA-binding activities of crude nuclear extracts from 75 pg
TCDD/kg treated C57BL/6J mice and their pair-fed controls to the multiple E-box
region. Lanes 1 to 5 correspond to binding reactions of 2 ng [a3211-dTTP-probe and 0
pg, 2 pg, 4 pg, 8 pg or 16 pg of crude nuclear extract from pair-fed controls of 75 ,ug
TCDD/kg treated C57BL/6J mice. Lanes 6 to 10 correspond to binding reactions of 2 ng
[a32P] -dTTP with 0 ug, 2 pg, 4 pg, 8 pg or 16 ,ug of crude nuclear extract from 75 pg
TCDD/kg treated C57BL/6J mice. Binding reactions and gel electrophoretic conditions
are described in section 5.3.5.
118
2
Figure 5.4
34
5
6
7
8 9 10
119
Figure 5.5 Electromobility Shift Assay of the hepatic pyruvate carboxylase multiple Ebox region in the presence of Anti-ARNT antibody (BEARNT). Lane 1 corresponds to 2
ng [a32P] -dTTP -probe alone. Lane 2 corresponds to 2 ng [a3211-dTTP-probe and 1.26 ng
of BEARNT. Lane 3 to 6 correspond to a binding reaction containing [a32P] -dTTPprobe, 8 lig of crude nuclear extract and 12.6 ng, 6.3 ng 2.5 ng and 1.26 ng of BEARNT,
respectively. Reaction conditions are described in section 5.3.6. Gel electrophoretic
conditions are identical to those used in section 5.3.6.
120
Figure 5.5
121
used in the reactions.
In most cases, footprinting of a particular DNA fragment is
conducted with purified proteins.
122
5.5 Discussion
Computer aided sequence analysis of upstream regulatory region of the mouse PC
gene showed that it contains ten putative E-box sequences (CACCTG), each one
juxtaposed to a TFII-I element (AGCTCTCT). This decamer of elements commences at -
790 by and repeats every 39 nucleotides ending at -1148 bp. The PC regulatory region
from -1232 by to -637 by does not contain response elements for any other transcription
factors. Therefore only bHLH and TFII-I are potential candidates for proteins binding to
this region. Result of EMSAs of this E-box region supports the existence of multiple
protein binding sites. Increasingly the nuclear extract concentration in the binding
reaction causes an increasingly greater shift of the E box region thereby indicating that
more of the protein binding sites are being occupied. The presence of multiple E box
elements at the regulatory region of genes is not uncommon. For example, a 230 by
region within the quail myoD promoter has a cluster of seven E-boxes. Five of the seven
E-boxes have site specificity for MyoD homo- or heterodimer binding (Pinney et al.,
1995). In fact, a single E-box in itself is not functional, but requires additional E-boxes or
binding sites for other transcription factors. This requirement for multiple E-boxes or
sequences for other transcription factors suggests a high degree of cooperativity for
transcriptional activation (Wingender, 1993a)
5.5.1 The E-box Motif and Basic Helix Loop Helix (bHLH) Transcription Factors
The E box element was first discovered as three protein binding sites within the
enhancer region of the heavy chain immunoglobulin gene. This trio of binding sequences
originally referred to as 11E1, 11E2 and 11E3, gave rise to the terms "E-box" or "E-motif".
Subsequently, the E box motif (CANNTG) has been identified in the control regions of
many genes involved in mitogenesis, neurogenesis, sex-determination and haematopoesis.
The two central nucleotides commonly are either GC or CG. E-boxes are recognized by
members of the basic helix loop helix (bHLH) family of transcription factors. The
binding affinity of bHLH transcription factors to E-boxes is influenced by the central two
nucleotides of the hexamer (NN) and by flanking nucleotides.
This allows bHLH
proteins to bind E boxes in a sequence specific manner. Most bHLH factors bind as
123
dimers to the consensus hexamer sequence CANNTG with each monomer contacting
bases in only one half-site. The binding specificity is mediated by a highly conserved
glutamic acid / arginine pair in the basic region. Many of the HLH proteins can bind an
overlapping group of different E boxes (Antonsson et al., 1995).
Basic helix loop helix proteins have been categorized either by their preference for
binding E box sequences (Class A, B and C) or by their tissue specific expression (Class I
to VI). Based on their E box binding preference, AP4, Myo D, E12, E47 and Tal-1
belong to class A and bind to the consensus sequence 5' CAGCTG 3'. MYC, USF,
MAX, TF3, TFEB and ARNT belong to class B and bind to the consensus sequence 5'
CACGTG 3'. Class C is made up of AhR, SIM and HIF1-a with consensus sequence
binding sites 5' TC/TGC GCA/GA 3', 5' GTA/GC GC/TAC 3' and 5' G/TAC GTGC 3',
respectively (Rowlands and Gustafsson, 1997). E2A, E2-2 and HTF4 are three distinct
but evolutionarily related genes that encode bHLH proteins of class A. Most tissues
express class A proteins and are often required for proper functioning of class B bHLH
proteins (Doyle et al., 1994).
The HLH proteins have also be divided into different classes based on their tissue
specific expression. One class of helix loop helix proteins is ubiquitously expressed and
can form either homo and / or heterodimers with other class I proteins, or heterodimerize
with members of class II. This class of proteins are involved in B cell, muscle and
pancreatic specific gene regulation and include E12, E47 and E2-2.
Class II HLH
proteins include Myo D, myogenin, myf5 and members of achaete-chute complex. Class
III HLH proteins contain myc related proteins, each of them involved in growth control,
including c-myc, N-myc and L-myc (Murre et al., 1994). Members of class III proteins
such as Myc and Max, do not heterodimerize with class I or II proteins (Bonven et al.,
1995). Genes expressed in a tissue specific manner such as immunoglobulin and exocrine
pancreas are regulated by helix loop helix proteins (Clark and Docherty, 1993). HLH
proteins that interact with myc, including mad and max, represent class IV. Class V
proteins contain HLH proteins lacking a DNA binding domain, including emc and Id.
Two HLH proteins, hairy and enhancer of split, characterized by the presence of a proline
in their basic region, represent class VI group of HLH proteins (Murre et. al., 1994).
124
5.5.1.1 The E2-box Motif (CACCTG)
The E box motif CACCTG is known as E2. It is present in the promoter region of
a diverse array of genes such as immunoglobulin type genes, most exocrine pancreas type
genes, choline acetyltransferase and plant storage protein phasolin, among many others.
The bHLH transcription factors binding to E2 can be either activators or repressors of
transcriptional initiation. The E 12 and E47 products of the E2A gene are ubiquitously
expressed bHLH transcription factors that bind to CACCTG element in the
immunoglobulin heavy chain enhancer and activate it They heterodimerize with other
bHLH proteins such as MyoD, achaete-scute T4 and tal -1, and may have a high regulatory
potential (Wingender, 1993b). E47 binds tightly as a homodimer to CACCTG motif
(Eilenberger et al., 1994).
Other activators binding to the CACCTG motif is CACCTG panl, CAN and
MITF. CACCTG pant is present in acinar cells and it binds to a CACCTG hexamer that
is part of a conserved 20-bp sequence of most exocrine pancreas-specific gene promoters.
The rat chymotrypsin B, amylase 2A, and elastase I are three such exocrine pancreatic
genes. This CACCTG is also bound by adenovirus major late transcription factor (MLTF)
which is an inhibitor of transcriptional activation (Miester et al., 1989). The CACCTG
motif present in the promoter region of bean seed storage protein fi-phaseolin and binds a
protein known as CAN and is a positive cis element (Kawagoe et al., 1994). The mi locus
of mice encodes a bHLH protein called MITF. The c-kit receptor tyrosine kinase gene
contains a CACCTG motif that is bound by MITF and this interaction is indispensible
for c-kit expression (Tsujimura et al., 1996).
Many E2-boxes are known to be the site of competition between bHLH activators
and a widespread repressor. These repressors interact with activators to play crutial roles
in developmental gene regulation. In well studied cases of transcriptional regulatory
elements controlling developmental specificities, it is found that a binding site of a
repressor overlaps with a binding site of an activator so that regulators of opposite effects
compete for occupancy of the same site. In most cases, the repressor is more widely
distributed in spatial and temporal terms that the activators. Thus in the majority of cell
types the repressor occupies the element and shuts off expression of the gene, and only
125
under conditions in which binding of the activator to the element dominates over that of
the repressor is expression of the gene turned on (Sekido et al., 1994).
SEF1
(8-crystallin/E2-box factor 1) is
a widely distributed repressor of
transcription which binds at the E2-box sequence, CACCTG. SEF1 has been shown to
compete with E47 to bind to the E2 element and repress gene activation in transfected
cells. 8EF1 also suppresses MyoD-dependant activation of the muscle creatine kinase
enhancer. AreB6 (human), ZEB (human) and BZP (hamster) are homologues of SEF1
(Sekido et al., 1996). The same scenario holds true for regulatory elements of myocytespecific genes such as AChR8 in which the MyoD family proteins bind to an E2-box and
activate transcription. Mutational analysis of the regulatory elements indicate the
existance of the repressor(s) protein which still remains to be identified. The cholinergic
neuron-specific expression of the human choline acetyltransferase gene contains a
silencer E2 box in the -2195 to -2409 promoter region. Nuclear proteins from cholinergic
cells binding to these silencers are responsible for silencer activity (Li et al., 1995).
5.5.1.2 Aryl Hydrocarbon Receptor Nuclear Translocator (ARNT) Transcription Factor
ARNT plays a major role in regulating the gene expression of several drug
metabolizing enzymes. It is a class B bHLH factor that also contains a PAS domain
which is conserved between ARNT, the dioxin receptor (AhR), and the drosophila
developmental regulator Sim and the drosophila cicardian rhythm regulatory protein PER.
ARNT binds to the E-box element (CACGTG) as a homodimer.
It also forms a
heterodimer with PER, SIM and AhR by means of the PAS and HLH domains in a
cooperative way (Sogawa et al., 1995). Arnt dimerizes with the structurally related
bHLH/PAS dioxin receptor in a ligand dependant manner with xenobiotic or dioxin
response elements (XRE) present in promoters of several drug metabolizing enzymes and
activates their transcription. The XRE motif (TNGCGTG) bears little resemblance to
consensus E box motifs, and is not recognized by either ARNT or dioxin receptor alone.
Furthermore, the dioxin-activated AhR-ARNT heterodimer does not bind the CACGTG
E box motif. ARNT was originally found as a factor forming a complex with AhR
(Antonsson et al., 1995).
126
ARNT is also involved in other signal transduction pathways. Enhancers of
several of genes that are involved in cellular response to low oxygen levels (hypoxia)
have hypoxia response elements (HREs). These genes include erythropoetin (EPO), the
glycolytic enzymes aldolase A (ALDA), phosphoglycerate kinase
(PGK1), and
1
pyruvate kinase M (PKM). HREs are bound by hypoxia inducible factor (HIF-1) and
ARNT heterodimers. ARNT can also form heterodimers with SIM and bind to SIM
dependant enhancer element upstream of the Drosophila Tl gene. The significance of
ARNT-ARNT, ARNT-HIF- 1 a and ARNT-SIM interactions for AhR mediated signal
transduction has not yet been determined. ARNT may assume a central role in signal
transduction by bHLH/PAS proteins, and because ARNT homodimers bind to the same
E-boxes as MAX complexes, these two signal transduction pathways would seem to be
overlapping and perhaps in competition with one another. ARNT therefore is directly
involved in determining the DNA-binding activity of three unique transcription factor
complexes (ARNT-ARNT, ARNT-AhR and ARNT-HIF-1a), each controlling its own set
of genes. The equilibrium between these different ARNT complexes may determine the
cellular level of response to TCDD and related compounds (Rowlands and Gustafsson,
1997).
The central role of ARNT in dioxin mediated signal transduction and the fact that
it is a bHLH protein that binds to E-boxes led us to question if it was involved in
suppression of PC via TCDD. Transient co-transfection assays involving the PC
regulatory region and an ARNT encoding plasmid were done in Hepa 1 cic7 cells. These
studies indicated that ARNT suppresses the promoter activity of PC gene in the presence
of dioxin. However supershift assays of the PC E-box region and hepatic nuclear extracts
with the ARNT antibody showed that ARNT does not interact directly with the E-box
region.
5.5.1.3 The TFII-I element: Interaction Between bHLH Proteins and TFII-I
TFII-I is a single polypeptide of 120 kD that interacts specifically with a
pyrimidine-rich Inr element (consensus YAYTCYY) present in the adenovirus major late
promoter
(AdML),
human
immunodeficiency
virus
(HIV-1)
and
terminal
127
deoxynucleotidyl transferase (TdT) promoters (Roy et al., 1994). TFII-I can increase
AdML core promoter transcription in an Inr element dependant manner (Roy et al.,
1991). The pyrimidine rich sequence AGCTCTCT of the human immunodeficiency
virus-1 promoter region bound by TFII-I is identical to the TFII-I element present in the
multiple E-box region. In addition to interacting with Inr elements, TFII-I is also capable
of forming heterodimers with bHLH proteins such as USF and cMYC at the E-box
elements. TFII-I also interacts cooperatively with USF at the Inr. The fact that TFII-I and
USF are immunologically related suggests that TFII-I is a HLH protein. Unlike USF-
TFII-I interactions which induce activity of AdML promoter containing the E-box
element, Myc-TFII-I interactions have an inhibitory effect on transcription initiation. The
ability of TFII-I to interact at multiple promoter elements may aid novel communication
mechanisms between upstream regulatory factors and the general transcriptional
machinery (Roy and Roeder, 1994). Given the above information, it is possible that a
bHLH protein and TFII-I polypeptide bind at the E-box-TFII-I elements in the multiple Ebox region of the PC promoter.
5.5.2 Possibe Mechanism for Induction of PC in Pair-Fed Control Mice
It is well established that TCDD decreases pyruvate carboxylase (Ryu et al., 1996;
Sparrow et al., 1994) while pair-feeding increases PC in mice (Roy et al., 1998). Fasting
or calorie restiction in animals limits blood glucose available for fuel (Cahill, 1970). The
alpha cells of the islets of langerhans secrete glucagon in response to lower blood glucose
levels. Glucagon stimulates the liver to release glucose into the blood stream. A decrease
in blood glucose stimulates gluconeogenesis via the hormonal alterations. Plasma thyroid
and glucocorticoid hormone levels increase in response to calorie restriction. Thyroid
hormones function by increasing gluconeogenic enzymes such as PEPCK (Gurney et al.,
1993) and PC (Wienberg and Utter, 1979) whereas a direct effect of glucocorticoids on
PC has still not been demonstrated. However, glucocorticoids have been shown to
enhance gluconeogenesis. Dexamethasone, a synthetic glucocorticoid analog, increases
pyruvate carboxylation in rat mitochondria (Martin et al., 1984) and sheep (Fowden et al.,
1993) liver. Dexamethasone caused an increase in glucose production in isolated
128
hepatocytes from starved rats (Jones et al., 1993). The steroid/thyroid hormones function
by binding to their respective nuclear receptors within the cell. Upon binding to the
hormones, the receptors translocate to the nucleus and bind to response elements of genes
involved in gluconeogenesis and thereby regulating their transcription (Moudgil, 1994).
The gluconeogenic enzyme PEPCK has functional thyroid and glucocorticoid response
elements in its upstream regulatory region of its gene (Gurney et al., 1994). But the rat as
well as the mouse PC gene lack either thyroid or glucocorticoid response elements.
Therefore, the transcription of this gene must be altered by an indirect mechanism during
periods of starvation or pair feeding. Reduced binding of nuclear proteins to the E-box
region might be responsible for induction of PC in the pair-fed control mice assuming
that these proteins are suppressors of transcription.
5.5.3 Reduced Binding Affinity of Nuclear Proteins to the PC E-box Region
Pair-feeding of mice might very well decrease the concentrations or binding
affinity of bHLH transcription factor to the E-box region. Alteration of transcription
factor binding patterns or transcription factor concentrations as a result of nutritional
changes is not rare. Restriction of dietary protein resulted in a number of specific changes
in the DNA-binding activity of various transcription factors. A 40% reduction in the
DNA binding activity of HNF-4 was measured by EMSA, with no changes in the levels
of this protein as indicated by western blots. The overall DNA binding activity of C/EBP
alpha and beta was increased in protein restricted animals in the absence of a change in
the amount of the full length forms of the two proteins (Marten et al., 1996).
The sequestration of the bHLH transcription factor binding to the E box region by
a negative regulator such as the Id protein might be the cause of reduced nuclear protein
binding to the E-box region of the PC gene. The Id protein is itself a HLH protein lacking
the basic domain and thus acts as a repressor when associated with other HLH proteins as
has been demonstrated for E12, E47 and MyoD. Id is ubiquitously expressed, although at
varying levels in cells that can be induced to differentiate (MEL, F9 and F3 cells), Id
mRNA levels are reduced and in primary adult tissues Id is expressed to only 2-5% of the
129
level of undifferentiated cell lines (Benezra et al., 1990). Id protein dimerizes with bHLH
proteins and inhibits their binding to the DNA enhancer element known as as E-box.
The cDNA or genes of proteins closely related to Id have been isolated from
murine or human sources which display very similar structural and functional features.
These are mouse HLH462 and Id2 and human Id2 (Wingender, 1993b). They can be
induced by serum, by platlet derived growth factor and appear to be generally downregulated during differentiation. They associate with E2A gene products such as E47 but
not with TFE3, USF or AP4. By repressing the DNA binding activity of bHLH proteins,
Id proteins inhibit transcription of tissue-specific genes in myoblasts, hematopoietic
precursor cells and other types of undifferentiated cells.
Serum starvation results in
disappearance of the Id gene transcript in most types of cultured cells, and often results in
the differentiation of these cells (Biggs et al., 1995). In osteoblastic cell lines, Id mRNA
levels can be induced by glucocorticoids (Ogata and Noda, 1991). In SENCAR rats a 60
% reduction in calorie intake increased plasma glucocorticoid levels by upto 10 fold.
However, no change in glucocorticoid receptor localization to the nucleus was observed
(Yaktine et al., 1998). Since a restricted calorie intake induces serum glucocorticoid
levels and glucocorticoids induce the expression of Id, we can postulate that pair-feeding
might lead to increased expression of Id or Id like proteins. An increased concentration of
the Id protein would result in sequestration of the bHLH protein binding to the multiple
E-box region. This scenario would explain the faliure of nuclear proteins from pair fed
controls to bind to the E box region (Figure 5.6).
I have demonstrated in a previous study that pair-feeding of mice induces hepatic
PC concentrations (Chapter 3). In addition, pair-feeding also greatly reduces the binding
capability of nuclear proteins to the E-box region (Chapter 5). Based on these two
results, it is reasonable to conclude that the bHLH protein binding to the PC E-box region
is a repressor of the PC gene transcription.
130
5.6 References
Abbott, B. D., Harris, M. W. and Birnbaum, L. S. 1992. Comparisons of the effects of
TCDD and hydrocortisone on growth factor expression provide insight into their
interaction in the embryonic mouse palate. Teratology. 45: 35-53.
Antonsson, C., Arulampalam, V., White law, M. L., Pettersson, S. and Poellinger, L.
1995. Constitutive function of the basic helix-loop-helix/PAS factor ARNT.
Journal of Biological Chemistry. 270: 13968-13972.
Ausubel, F. M. 1995. Preparation and Analysis of DNA. In Short Protocols in
Molecular Biology: A Compendium of Methods from Current Protocols in
Molecular Biology. 3rd edn., 2.1.1-2.1.2 NY: John Wiley and Sons.
Benezra, R. Davis, R. L. Lockshon, D. Turner, D.L. and Wientraub, H. 1990. The protein
Id: A negative regulator of Helix-Loop-Helix DNA Binding Proteins. Cell. 61:4959.
Biggs, J. R., Zhang, Y. and Murphy, E. V. 1995. Repression of Id2 (Inhibitor of
Differentiation) Gene Promoter During Exit from the Cell Cycle. Journal of
Cellular Physiology. 164: 249-258.
Bombick, D. W., Madhukar, B. V., Brewster, D. W. and Matsumura, F. 1985. TCDD
(2,3,7,8-tetrachlorodibenzo-p-dioxin) causes increases in protein kinases
particularly protein kinase C in the hepatic plasma membrane of the rat and the
guinea pig. Biochemical and Biophysical Research Communications. 127: 296302 .
Bombick, D. W., Jankun, J., Tullis, K, and Matsumura,
F.
1988. 2,3,7,9-
Tetrachlorodibenzo-p-dioxin causes increases in expression of c-erd-A and levels
of protein-tyrosine kinases in selected tissues of responsive mouse strains.
Proceedings. National Academy of Sciences. USA. 85: 4128-4132.
Bonven, B. J., Nielsen, A. L., Norby, P. L., Redersen, F. S. and Jorgensen, P. 1995. EBox variants direct formation of distinct complexes with the basic helix-loophelix protein ALF1. Journal of Molecular Biology. 249: 564-575.
Cahill, G. F. Jr. 1970. Starvation in man. New England Journal of Medicine. 282: 668675.
Clark, A. R. and Docherty, K. 1993. Cell-specific gene expression in the islets of
langerhans: E boxes and TAAT boxes. Biochemical Society Transactions. 21:
154-159.
131
Denison, M. S., Fisher, J. M. and Whitlock, J. P. Jr. 1989. Protein-DNA interaction at
recognition sites for the dioxin-Ah receptor complex. Journal of Biological
Chemistry. 264:16478-16482
.
Doyle, K., Zhang, Y., Baer, R. and Bina, M. 1994. Distinguishable patterns of protein-
DNA interactions involving complexes of basic helix-loop-helix proteins.
Journal of Biological Chemistry. 269: 12099-12105.
Eilenberger, T., Fass, D., Arnaud, M. and Harrison, S. 1994. Crystal structure of
transcription factor E47: E-box recognition by a basic region helix-loop-helix
dimer. Genes and Development. 8: 970-980.
Favreau, L. V. and Pickett, C. B.
1991. Transcriptional regulation of the rat
NAD(P)H:quinone reductase gene.
Identification of regulatory elements
controlling basal level expression and inducible expression by planar aromatic
compounds and phenolic antioxidants. Journal of Biological Chemistry. 266:
4556-4561.
Fowden, A. L., Mijovic, J., and Silver, M. 1993. The effects of cortisol on hepatic and
renal gluconeogenic enzyme activities in the sheep fetus during late gestation.
Journal of Endocrinology. 137: 213-222.
Gorski, K., Carneiro, M. and Schibler, U. 1986. Tissue -specific in vitro transcription
from the mouse albumin promoter. Cell. 47: 767-776.
Gurney, A. L., Park, E. A., Liu, J., Giralt, M., McGrane, M. M., Patel, Y. M., Crawford,
D. R., Niziel, S. E., Savon, S., and Hanson, R. H. 1994. Metabolic regulation of
gene transcription. Journal of Nutrition. 124: 1533S-1539S.
Hankinson, 0. 1995. The Aryl Hydrocarbon Complex. Annual Review of Pharmacology
and Toxicology. 35: 307-340.
Jitrapakdee, S., Walker, M. E. and Wallace, J. C. 1996.
Identification of novel
alternatively spliced pyruvate carboxylase mRNA's with divergent 5'-untranslated
regions which are expressed in a tissue specific manner. Biochemical and
Biophysical Research Communications. 223: 695-700.
Jones, C. G., Hothi, S. K., and Titheradge, M. A. 1993. Effects of dexamethasone on
gluconeogenesis, pyruvate kinase, pyruvate carboxylase and pyruvate
dehydrogenase flux in isolated hepatocytes. Biochemical Journal. 289. 821-828.
Kawagoe, Y., Campell, B. R. and Murai, N. 1994. Synergism between CACGTG (Gbox) and CACCTG cis-elements is required for activation of the bean seed storage
protein p-phaseolin gene. The Plant Journal. 5: 885-890.
132
Korza, G. and Ozols, J. 1988. Complete covalent structure of 60-kDa esterase isolated
from 2,3,7,8-tetrachlorodibenzo-p-dioxin induced rabbit liver microsomes.
Journal of Biological Chemistry. 263: 3486-3495.
Li, Y.P., Baskin, B., Davis, R., Wu, D. and Hersh, L. B. 1995. A cell type-specific
silencer in the human choline acetyltransferase gene requiring two distinct and
interactive E boxes. Molecular Brain Research. 30: 106-114.
Marten, N. W., Sladek, F. M. and Straus, D. S. 1996. Effect of dietary protein restriction
on liver transcription factors. Biochemical Journal. 317: 361-370.
Martin, A. D., Allan, E. H., and Titheradge, M. A. 1984. The stimulation of
mitochondrial pyruvate carboxylation after dexamethasone treatment of rats.
Biochemical Journal. 219: 107-115.
McKim, J. M., Marien, K., Schaup, H. W. and Selivonchick, D. P. 1991. Alterations of
hepatic Acetyl-CoA Carboxylase by 2,3,7,8-Tetrachlorodibenzo-p-dioxin. Lipids.
26:521-525.
Miester, A., Weinrich, S. L., Nelson, C. and Rutter, W. J. 1989. The Chymotrypsin
Enhancer Core. Journal of Biological Chemistry. 264: 20744-20751.
Moudgil, V. K. 1994. Steroid/nuclear receptor superfamily. Recent advances and relation
to healts and disease. In Steroid Hormone Receptors: Basic and Clinical Aspects.
Ed. V. K. Moudgil, 1-46. Berlin: Birkenhauser.
Murre, C., Bain, G., Dijk, M. A., Engel, I., Furnari, B. A., Massari, M. E., Matthews, J.
R., Quong M. W. Rivera, R. R. and Stuiver, M. H. 1994. Structure and function of
helix-loop-helix proteins. Biochemica et Biophysica Acta. 1218:129-135
Nebert, D. W., Jensen, N. M., Perry, J. W. and Oka, T. 1980. Association between
ornithine decarboxylase induction and the Ah locus in mice treated with
polycyclic aromatic compounds. Journal of Biological Chemistry. 255: 68366842.
Ogata, T. and Noda, M. 1991. Expression of Id, A negative regulator of helix-loop-helix
DNA binding proteins, is down-regulated at confluence and enhanced by
dexamethasone in a mouse osteoblastic cell line, MC3T3E1. Biochemical and
Biophysical Research Communications. 180: 1194-1199.
Pimental, R. A., Liang, B., Yee, G. K., Wilhelmsson, A., Poellinger, L. and Paulson, K.
E. 1993. Dioxin receptor and C/EBP regulate the function of glutathione-S-
transferase Ya gene xenobiotic response element.
Biology. 13: 4365-4373.
Molecular and Cellular
133
Pinney, D. F., Brousse, F. C., Faerman, A., Shani, M. Maruyama, K. and Emerson, C. P.
1995.
Quail MyoD is regulated by a complex array of cis-acting control
sequences. Developmental Biology. 170: 21-38.
Pollenz, R. S., Sattler, C. A. and Poland, A. 1994. The Aryl Hydrocarbon receptor and
Aryl Hydrocarbon receptor nuclear translocator protein show distinct subcellular
localizations in hepal cic7 cells by immunofluorescence microscopy. Molecular
Pharmacology. 45: 428-438.
Puhvel, S. M., Ertl, D. C. and Lynberg, C. A. 1984.
Increased epidermal
transglutaminase activity following 2,3,7,8-tetrachlorodibenzo-p-dioxin: In vivo
and in vitro studies with mouse skin. Toxicology and Applied Pharmacology. 73:
42-47.
Quattrochi, L. C., Vu, T. and Tukey, R. H. 1994. The human CYP1A2 gene and induction
by 3-methylcholanthrene. Journal of Biological Chemistry. 269:6949-6954.
Roeder, R. G. 1991. The complexities of eukaryotic transcription initiation: regulation of
preinitiation complex assembly. Trends in Biochemical Sciences. 16: 402-408.
Roth, W., Voorman, R. and Aust, S. D. 1988. Activity of thyroid-hormone inducible
enzymes following treatment with 2,3,7,8-tetrachlorodibenzo-p-dioxin.
Toxicology and Applied Pharmacology. 92: 65-74.
Rowlands, J. C. and Gustafsson, J-A. 1997. Aryl hydrocarbon receptor-mediated signal
transduction. Critical Reviews in Toxicology. 27: 109-134.
Roy, A. L., Miesterernst, M., Pognonec, P. and Roeder, R. G.
Cooperative
interaction of an initiator-binding transcription initiation factor and the helix-loophelix activator USF. Nature. 354: 245-248.
1991.
Roy, A. L. and Roeder, R. G. 1994. Initiator element binding protein TFII -I: A tale of
two sites. Indian Journal of Biochemistry and Biophysics. 31: 14-19.
Roy, S., Sparrow, B. R., Ryu, B. W., Schaup, H. W. and Selivonchick, D. P. 1998.
Dietary calorie restriction induced hepatic pyruvate carboxylase in pair-fed
controls for the C57BL/6J mice exposed to 2,3,7,8-tetrachlorodibenzo-p-dioxin.
Environmental and Nutritional Interactions. In Press.
Ryu, B.
1996.
Characterization of pyruvate carboxylase responses to 2,3,7,8-
Tetrachlorodibenzo-p-dioxin exposure in C57BL6J
dissertation, Oregon State University, Corvallis, OR.
Ahdid
mice.
Thesis
134
Sambrook, J., Fritsch, E. F., and Maniatis, T. 1989a. Protocol II: Fresh competent E. Co li
prepared using calcium chloride. In Molecular Cloning. A Laboratory Manual,
2nd edn., 1.82-1.84. NY: Cold Spring Harbor Laboratory Press.
Sambrook, J., Fritsch, E. F., and Maniatis, T. 1989b. Identification of bacterial colonies
that contain recombinant plasmids. In Molecular Cloning. A Laboratory Manual,
2nd edn., 1.85-1.86. NY: Cold Spring Harbor Laboratory Press.
Sambrook, J., Fritsch, E. F., and Maniatis, T. 1989c. Small scale preparation of plasmid
DNA. In Molecular Cloning. A Laboratory Manual, 2nd edn., 1.25-1.28. Nw\ew
York: Cold Spring Harbor Laboratory Press.
Sekido, R. Murai, K., Funahashi, J., Kamachi, Y., Sehara, A. F. Nabeshima, Y. and
Kondoh, H. 1994. The 8-Crystallin Enhancer-Binding protein SEF1 is a repressor
of E2-box-mediated gene activation. Molecular and Cellular Biology. 14: 56925700.
Sekido, R., Takagi, T., Okanami, M., Moribe, H., Yamamura, M., Higashi, Y. and
Kondoh, H. 1996. Organization of the gene encoding transcriptional repressor
SEF1 and cross-species conservation of its domains. Gene. 173: 227-232.
Sogawa, K., Nakano, R., Kobayashi, A., Kikuchi, Y., Ohe, N., Natsuki, M. and
Kuriyama, Y. F. 1995. Possible function of the Ah receptor nuclear translocator
(Arnt) homodimer in transcriptional regulation. Proceedings. National Academy
of Sciences. USA. 92: 1936-1940.
Sparrow, B. R., Thompson, C. S., Ryu, B. W., Selivonchick, D. P. and Schaup, H. W.
1994.
2,3,7,8-Tetrachlorodibenzo-p-dioxin induced alterations of pyruvate
carboxylase levels and lactate dehydrogenase isozyme shifts in C57BL/6J male
mice. Journal of Biochemical Toxicology. 9: 329-339.
Sparrow, B. R. 1997. Characterization of 2,3,7,8-tetrachlorodibenzo-p-dioxin (TCDD)
induced modification of hepatic pyruvate carboxylase gene expression in
C57BL/6J male mice. Thesis Dissertation. Oregon State University, Corvallis,
OR.
Sutter, T. R. Guzman, K., Dold, K. M. and Greenlee, W. F. 1991. Targets for dioxin:
genes for plasminogen activator inhibitor-2 and interleukin-113. Science. 254:
415-418.
Takimoto, K., Lindahl, R., Dunn, T. J., and Pitot, H. C. 1994. Structure of the 5'
flanking region of class 3 aldehyde dehydrogenase in the rat. Archives of
Biochemistry and Biophysics. 312: 539-546.
135
Travers, A. 1993. DNA-Protein Interactions: Sequence specific recognition. In DNAProtein Interactions. ed. A. Travers 52-86, London: Chapman and Hall.
Tsujimura, T., Morii, E., Nozaki, M., Hashimoto, K., Moriyama, Y., Takebayashi, K.,
Kondo, T., Kanakura, Y. and Kitamura, Y. 1996. Involvement of transcription
factor encoded by the mi locus in the expression of c-kit receptor tyrosine kinase
in cultured mast cells of mice. Blood. 88: 1225-1233.
Vasiliou, V., Puga, A. and Nebert, D. W. 1992. Negative regulation of the murine
cytosolic aldehyde dehydrogenase-3 (Aldh-3c) gene by CYP1A1 and CYP1A2
proteins. Biochemical and Biophysical Research Communications.
419.
187: 413-
Weber, L. W. D., Lebofsky, M., Helmut, G. and Rozman, K. 1991. Key enzymes of
gluconeogenesis are dose dependantly reduced in 2,3,7,8-Tetrachlorodibenzo-pdioxin treated rats. Archives in Toxicology. 65: 119-123.
Wienberg, M. B. and Utter, M. F. 1979. Effect of thyroid hormone on the turnover of the
rat liver pyruvate carboxylase and pyruvate dehydrogenase. Journal of Biological
Chemistry. 254: 9492-9499.
Wingender, E. 1993a. Ubiquitous DNA-binding transcription factors. In Gene Regulation
in Eukaryotes. ed. E. Wingender 75-113. Germany: VCH.
Wingender, E. 1993b. Regulation of Cell Division and Differentiation by Helix-LoopHelix Proteins. In Gene Regulation in Eukaryotes. ed. E. Wingender 180-203.
Germany: VCH.
Wolfle, D., Schmutte, C. and Marquardt, H. 1993. Effects of 2,3,7,8-tetrachlorodibenzo-
p-dioxin on protein kinase C and inositol phosphate metabolism in primary
cultures of rat hepatocytes. Carcinogenesis. 14: 2283-2287.
Wu, L. and Whitlock, J. Jr.
1993. Mechanisms of dioxin action: receptor-enhancer
interactions in intact cells. Nucleic Acids Research. 21: 119-125.
Yaktine, A. L., Vaugn, R., Blackwood, D., Duysen, E. and Birt, D. F. 1998. Dietary
energy restriction in the SENCAR mouse: elevation of glucocorticoid hormone
levels but no change in distribution of glucocorticoid receptor in epidermal cells.
Molecular Carcinogenesis. 21: 62-69.
136
Chapter 6
Conclusions
Research presented in this thesis provide new information on the regulation of
hepatic pyruvate carboxylase in dioxin treated C57BL/6J mice and their pair-fed controls.
Previous studies have demonstrated that short term exposure of C57BL/6J mice to TCDD
reduces hepatic PC activity, protein and mRNA concentrations in a dose and time
dependant manner. This downregulation of PC by TCDD was Ah receptor dependant. An
interesting observation made in our laboratory during the TCDD dose response
experiments was that PC protein levels were elevated in the pair-fed controls of TCDD
treated mice relative to ad libitum controls and the TCDD injected mice. This induction
occurred in the pair-fed controls of Ah" strain of mice injected with a 50 µg TCDD/kg
dose (Sparrow et al., 1994). However, induction of PC protein was not observed in pair-
fed controls of Ah" strain of mice injected with a 50 µg TCDD/kg dose (Ryu et al.,
1995).
Starvation is a well known inducer of PC and TCDD treated mice experience
cachexia (reduced food intake). Since pair-fed controls are allowed only the amount of
food consumed by their TCDD treated counterparts, we speculated that calorie restriction
was causing induction of PC in the pair-fed controls. Data from the first study (chapter 3)
illustrate that food consumption decreases in a dose dependant manner in C57BL/6J Ah'
mice exposed to TCDD. Such a decrease is not observed in similarly treated C57BL/6J
animals of the Ah" strain. Ah'
experienced hypophagia at
doses
20 jug
TCDD/kg. On the other hand, Ah" mice experienced hypophagia only at a high dose of
100 pg TCDD/kg. These data indicated that pair-fed controls of the 50 µg TCDD/kg
Ah" mice received a ration of food that was less than the amount consumed by ad lib
controls. The food ration of the Ah" strain of mice was not affected at this dose.
Based on the results from our food intake data we hypothesized that reduced food
intake was inducing PC in the pair-fed controls of Ah" mice injected with a 50 /./g
137
TCDD/kg dose. To test our hypothesis, we conducted calorie restriction experiments
where C57BL/6J mice of both strains (Aht
and Ahd/d) were given a ration of food
consumed by Ah" mice injected with a 50 pg TCDD/kg dose. PC levels were induced in
both strains of mice under calorie restriction compared to ad libitum controls. Therefore
results from these experiments illustrate that a pair-feeding regimen is responsible for PC
induction in pair-fed controls of Ah" mice given a 50 pg TCDD/kg dose. Similarly
treated pair-fed controls of the Ahdid strain do not show an induction in hepatic PC as
food intake is not affected in their 50 pg TCDD/kg treated counterparts.
In order to elucidate the molecular mechanisms by which PC is regulated
subsequent to dioxin exposure or a pair-feeding regimen the mouse PC upstream
regulatory region was recently cloned and sequenced in our laboratory. Computer aided
sequence analysis of the regulatory region revealed that there are consensus sites for
several transcription factors: Sp 1 , NF-1, HNF-4, CCAAT box, CREB and 17 E-boxes
(CACCTG). Ten of these E-boxes are located adjacent to TFII I elements in the 1148 by
to 790 by relative to the transcription start site (Sparrow, 1997). A consensus sequence
for an Inr element (+3 CAGTCTAG +10) was also found.
Inr elements are present
around the transcription start sites of many housekeeping genes lacking TATA boxes and
are essential for transcription to begin from these genes. Presence of a consensus site for
a transcription factor in a DNA sequence does not guarantee binding of the transcription
factor to the site. To investigate whether the putative Inr element was functional, proteinDNA interaction studies were conducted with a portion of the PC regulatory region (-238
by to +65 bp) containing the Inr element, as described in chapter 4. Electromobility shift
assay (EMSA) of the DNA fragment (-238 by to +65 bp) with crude nuclear extracts from
C57BL/6J mice liver showed a single band shift. Competitive EMSAs with cold probe
confirmed that nuclear protein(s) bound specifically to the fragment.
DNase I
footprinting analysis of the 303 by fragment in the presence of crude nuclear extracts
showed a protected area from -13 by to +57 bp. This area contains the Inr element and a
CCAAT box. Factors binding to the CCAAT box have been shown to interact with the
transcriptional machinery and activate transcription. Future studies would include
identification of the protein(s) interacting with the mouse PC Inr element. Based on
138
consensus sequence homology, the PC Inr most closely resembles the TdT family of Inr
elements. The TFII I polypeptide has been shown to interact with TdT Inr raising the
possibility that it is TFII I that is directly interacting with PC Inr and forming a nucleation
site for the transcription apparatus.
Although dioxin and the glucorticoid and thyroid hormones are known to
modulate PC gene transcription, the response elements for nuclear receptors that bind
these ligands are noticably absent from the PC regulatory region (Ryu, 1996; Sparrow,
1997). The pyruvate carboxylase regulatory region is unusual in that it has consensus sites
for sixteen E-boxes. E boxes bind basic helix-loop-helix type of proteins (bHLH). Aryl
hydrocarbon receptor nuclear translocator (ARNT) is a class B type of bHLH
transcription factor. The ARNT protein plays a critical role in hypoxic induction of
angiogenesis and aryl hydrocarbon (Ah) receptor mediated signal transduction. In the
presence of dioxin, ARNT heterodimerizes with the Ah receptor and alters the expression
of numerous genes. In previous studies, transient co-transfection of hepa 1 c 1 c7 cells with
the PC promoter region and an ARNT encoding plasmid (pBM5/NEO/M1-1 ARNT)
suppressed the dioxin induced PC promoter activity. These results strongly suggested the
involvement of ARNT in dioxin mediated downregulation of PC (Sparrow, 1997).
Tertiary structure analysis of the PC gene reveals a novel spiral structure in the E-
box region. The spiralling is such that nine of the elements are positioned in a manner to
form a trio of phased elements, i.e., every third element is positioned in line with one
another. The close proximity hints of possible protein-protein interactions among the
elements (Sparrow, 1997).
The possibility of the involvement of ARNT in dioxin
mediated downregulation of PC through E-boxes and the unusual tertiary structure of the
multiple E-box region (-1148 by to -790 bp) led us to conduct protein-DNA interaction
studies with this region (Chapter 5).
Results of EMSAs involving the multiple E-box region and hepatic crude nuclear
extracts from C57BL/6J mice demonstrate that this region is bound by nuclear proteins.
An unusual feature of this particular EMSA is that in the presence of protein all of the
free probe is bound. In a standard EMSA, only a portion of the labelled probe is bound by
protein. This indicated that the nuclear protein(s) are binding with high affinity to the E-
139
box region (personnel communications, Dr. Victor Hsu, Oregon State University). As the
extract concentration is increased in the assay, a greater shift in the protein-DNA complex
occurs, relative to the free probe. A graded decrease in mobility of the bound fragment as
a function of increasing extract concentration supports the idea that there are multiple
protein(s) binding to multiple sites in this region and that increasing the extract
concentration causes more of these sites to be occupied. A plot of crude nuclear extract
(ug protein) vs. extent of DNA-protein complex shift (Rf) revealed that this was a
hyperbolic phenomenon. The hyperbolic nature of the shift suggests that increasing the
extract concentration leads to greater occupancy of the E-box sites and that a saturation
point is reached at higher concentrations of protein (16 pg). The hyperbolic pattern of
protein binding also suggests that a non-cooperative type of interaction is occurring i.e.
binding of one protein does not have a synergistic effect on further protein binding
(Travers, 1993).
A sigmoidal binding curve would support a cooperative type of
interaction being involved in protein binding (Travers, 1993).
Competitive EMSAs of the E-box region prove that the complex formation is due
to specific binding of nuclear protein(s) to the E-box region. A non-specific cold
competitor DNA fragment (part of pBS plasmid) does not interfere with complex
formation whereas a specific competitor DNA (cold probe) prevents the complex
formation by sequestering proteins binding to the E-box region. Coincubation of the PC
multiple E-box region and hepatic nuclear extracts with the ARNT antibody showed that
ARNT does not interact directly with the E-box region. Therefore, a bHLH protein other
than ARNT is interacting with the multiple E-box region of the PC gene.
EMSAs of the E-box region were also done with nuclear extracts from TCDD
treated mice and their pair-fed controls. The purpose of these assays were to investigate
whether TCDD treatment would alter nuclear protein binding pattern to the E-box region.
Nuclear proteins from TCDD treated mice bind to the E-box region in exactly the same
fashion as nuclear proteins from untreated, ad lib mice (hyperbolic nature), indicating that
the E-boxes are probably not involved in TCDD mediated downregulation of PC.
Surprisingly, nuclear proteins from the pair-fed controls of TCDD treated mice bind with
a much lower affinity to the E-box region than nuclear proteins from TCDD-treated mice.
140
Pair-feeding of mice might very well decrease the concentrations or binding affinity of
bHLH transcription factor to the E-box region. Alteration of transcription factor binding
patterns or transcription factor concentrations as a result of nutritional changes is not rare.
For example, a 40% reduction in the DNA binding activity of HNF-4 was measured by
EMSA, with no changes in the levels of this protein (Marten et al., 1996).
The sequestration of the bHLH transcription factor binding to the E box region by
a negative regulator such as the Id protein might be the cause of reduced nuclear protein
binding to the E-box region of the PC gene. The Id protein is itself a HLH protein lacking
the basic domain and thus acts as a repressor when associated with other HLH proteins as
has been demonstrated for E12, E47 and MyoD. By repressing the DNA binding activity
of bHLH proteins, Id proteins inhibit transcription of tissue-specific genes in myoblasts,
hematopoietic precursor cells and other types of undifferentiated cells.
In SENCAR rats a 60 % reduction in calorie intake increased plasma
glucocorticoid levels by upto 10 fold. However, no change in glucocorticoid receptor
localization to the nucleus was observed (Yaktine et al., 1998). Id mRNA levels can be
induced by glucocorticoids (Ogata and Noda, 1991). Since a restricted calorie intake
induces serum glucocorticoid levels and glucocorticoids induce the expression of Id, we
can postulate that pair-feeding might lead to increased expression of Id or Id like proteins.
An increased concentration of the Id protein would result in sequestration of the bHLH
protein binding to the multiple E-box region. This scenario would explain the faliure of
nuclear proteins from pair fed controls to bind to the E box region. Based on the facts that
pair-feeding of mice induces hepatic PC concentrations and also greatly reduces the
binding capability of nuclear proteins to the PC multiple E-box region, it is reasonable to
conclude that the bHLH protein binding to the PC E-box region is a repressor of the PC
transcription.
The E box motif present in the mouse PC regulatory region is CACCTG and is
known as E2. E2 boxes are present in the promoter region of a diverse array of genes
such as immunoglobulin type genes, most exocrine pancreas type genes, choline
acetyltransferase and plant storage protein phasolin, among many others. The bHLH
141
transcription factors binding to E2 can be either activators or repressors of transcriptional
initiation.
Many E2-boxes are known to be the site of competition between bHLH activators
and a widespread repressor. These repressors interact with activators to play crutial roles
in developmental gene regulation. In well studied cases of transcriptional regulatory
elements controlling developmental specificities, it is found that a binding site of a
repressor overlaps with a binding site of an activator so that regulators of opposite effects
compete for occupancy of the same site. In most cases, the repressor is more widely
distributed in spatial and temporal terms that the activators. Thus in the majority of cell
types the repressor occupies the element and shuts off expression of the gene, and only
under conditions in which binding of the activator to the element dominates over that of
the repressor is expression of the gene turned on (Sekido et al., 1994). It is quite likely
that this scenario also applies to the PC gene regulatory region. Under normal
physiological conditions, PC gene expression occurs at basal levels. However under
conditions of stress or starvation, PC gene expression is induced.
Future studies involving the multiple E-box region would include identification of
the nuclear factor(s) interacting with it. Affinity column chromatography can be used to
purify the factor and N-terminal sequencing can be used to identify the factor.
Identification of the multiple E-box region binding protein may reveal the mechanisms by
which PC is regulated at the genetic level. Although downregulation of PC by dioxin is
Ah receptor dependant, it is most likely DRE independent. Reduction in PC levels in
C57BL/6J mice probably occurs as a secondary or tertiary response to TCDD toxicity
subsequent to hormonal fluctuations.
142
References
Marten, N. W., Sladek, F. M. and Straus, D. S. 1996. Effect of dietary protein restriction
on liver transcription factors. Biochemical Journal. 317: 361-370.
Ogata, T. and Noda, M. 1991. Expression of Id, A negative regulator of helix-loop-helix
DNA binding proteins, is down-regulated at confluence and enhanced by
dexamethasone in a mouse osteoblastic cell line, MC3T3E1. Biochemical and
Biophysical Research Communications. 180: 1194-1199.
Ryu, B., Roy, S., Sparrow, B. R., Selivonchick, D. P. and Schaup, H. W. 1995. Ah
receptor involvement in mediation of pyruvate carboxylase levels and activity in
mice given 2,3,7,8-tetrachlorodibenzo-p-dioxin. Journal of Biochemical
Toxicology. 10:103-109.
Sekido, R. Murai, K., Funahashi, J., Kamachi, Y., Sehara, A. F. Nabeshima, Y. and
Kondoh, H. 1994. The 8-Crystal lin Enhancer-Binding protein SEF1 is a repressor
of E2-box-mediated gene activation. Molecular and Cellular Biology. 14: 56925700.
Sparrow, B. R., Thompson, C. S., Ryu, B. W., Selivonchick, D. P. and Schaup, H. W.
1994.
2,3,7,8-Tetrachlorodibenzo-p-dioxin induced alterations of pyruvate
carboxylase levels and lactate dehydrogenase isozyme shifts in C57BL/6J male
mice. Journal of Biochemical Toxicology. 9: 329-339.
Sparrow, B. R. 1997. Characterization of 2,3,7,8-tetrachlorodibenzo-p-dioxin (TCDD)
induced modification of hepatic pyruvate carboxylase gene expression in
C57BL/6J male mice. Thesis Dissertation. Oregon State University, Corvallis,
OR.
Travers, A. 1993. DNA-Protein Interactions: Sequence specific recognition. In DNAProtein Interactions. ed. A. Travers 52-86, London: Chapman and Hall.
Yaktine, A. L., Vaugn, R., Blackwood, D., Duysen, E. and Birt, D. F. 1998. Dietary
energy restriction in the SENCAR mouse: elevation of glucocorticoid hormone
levels but no change in distribution of glucocorticoid receptor in epidermal cells.
Molecular Carcinogenesis. 21: 62-69.
143
Bibliography
Abbott, B. D., Birnbaum, L. S., and Pratt, R. M. 1987. 2,3,7,8-TCDD-induced
hyperplasia of the uteral epithelium produces hydronephrosis in murine fetuses.
Teratology. 35: 329-334.
Abbott, B. D., Harris, M. W., and Birnbaum, L. S. 1992. Comparisons of the effects of
TCDD and hydrocortisone on growth factor expression provide insight into their
interaction in the embryonic mouse palate. Teratology. 45: 35-53.
Albanes, D. 1987. Calorie intake, body weight and cancer: A review. Nutrition and
Cancer 9:199-240.
Allen, J. R., and Norback, D. H. 1973. Polychlorinated biphenyl- and triphenyl- induced
gastric mucosal hyperplasia in primates. Science. 179: 498-499.
Allen, J. R., Barsotti, D. A. Van Miller, J. P., Abrahamson, L. J., and Lalich, J. J. 1977.
Morphological changes in monkeys consuming a diet containing low levels of
2,3 ,7,8-tetrachlorodibenzo-p-dioxin. Food and Cosmetic Toxicology. 15: 401410.
Antonsson, C., White law, M. L., McGuire, J., Gustafsson, J. -A., and Poellinger, L. 1995.
Distinct roles of the molecular chaperone hsp90 in modulating dioxin receptor
function via the basic helix-loop-helix and PAS domains. Molecular and Cellular
Biology. 15: 765
Atkinson, R. 1991. Atmospheric lifetimes of dibenzo-p-dioxins and dibenzofurans.
Science of the Total Environment. 104: 17-33.
Ausubel, F. M. 1995. Preparation and analysis of DNA. In Short Protocols in
Molecular Biology: A Compendium of Methods from Current Protocols in
Molecular Biology. 3rd edn., 2.1.1- 2.1.2 NY: John Wiley and Sons.
Ayer, D.E. and Dynan, W. S. 1990. A downstream-element-binding factor facilitates
assembly of a functional preinitiation complex at the simian virus 40 major late
promoter. Molecular and Cellular Biology. 10(7): 3635-3645.
Ballard, F. J., and Oliver, I. J. 1963. Glycogen metabolism in embryonic chicken and
neonatal rat liver. Biochimica et Biophysica Acta. 71: 578-588.
Barritt, G. J., Zander, G. L., and Utter, M. F. 1976. The regulation of pyruvate
carboxylase activity in gluconeogenic tissue. In Gluconeogenesis: Its regulation
in mammalian species, eds. R. W. Hanson and M. A. Mehlman, 3-46. NY: John
Wiley and Sons.
144
Barritt, G. S. 1985. Regulation of enzyme activity. In Pyruvate Carboxylase, eds. D. B.
Keech and J. C. Wallace, 141-151, Boca Raton, FL: CRC press.
Barsotti, D. A., Abrahamson, L. J., and Allen, J. R. 1979. Hormonal alterations in female
rhesus monkeys fed a diet containing 2,3,7,8-tetrachlorodibenzo-p-dioxin.
Bulletin of Environmental Contamination and Toxicology. 211:463-469.
Bastomsky, C. H. 1977. Enhanced thyroxine metabolism and high uptake goiter in rats
after single dose of 2,3,7,8-tetrachlorodibenzo-p-dioxin. Endocrinology. 101: 292297.
Beaupain, D., Eleouet, J. F. and Romeo, P. H. 1990. Initiation of transcription of the
erythroid promoter of the porphobilinogen deaminase gene is regulated by a cisacting sequence around the cap site.. Nucleic Acids Research. 18(22): 6509-6515.
Becker, G. M., MuNulty, W. P., and Bell, M. 1979. Polychlorinated biphenyl induced
morphological changes in the gastric mucosa of the rhesus monkey. Laboratory
Investigations. 40: 373-383.
Benezra, R. Davis, R. L. Lockshon, D. Turner, D.L. and Wientraub, H. 1990. The protein
Id: A negative regulator of Helix-Loop-Helix DNA Binding Proteins. Cell. 61:4959.
Bergard, A., Gradin, K., and Toftgard, R. 1992. The stability of dioxin-receptor ligands
influence cytochrome P4501A1 expression in human keratinocytes.
Carcinogenesis. 13:651-655.
Berghard, A., Gradin, K., Pongratz, L., Whitelaw, M., and Poellinger, L. 1993. Crosscoupling of signal transduction pathways: the dioxin receptor mediates induction
of P-4501A1 expression via a protein kinase C-dependant mechanism. Molecular
and Cellular Biology. 13: 677-
Berndt, J., Messner, B., Turkki, T. and Weissman, E. 1978. Optical assay of pyruvate
carboxylase in crude liver homogenates. Analytical Biochemistry 86: 154-158.
Transcription Factors that activate the ultrabithorax
promoter in developmentally staged extracts. Cell. 53: 699-711.
Biggin, M. and Tjian, R. 1988.
Biggs, J. R., Zhang, Y. and Murphy, E. V. 1995. Repression of Id2 (Inhibitor of
Differentiation) Gene Promoter During Exit from the Cell Cycle. Journal of
Cellular Physiology. 164: 249-258.
Birnbaum, L. S. 1991. Developmental toxicity of TCDD and related compounds: Species
sensitivities and differences. In Biological Basis for Risk Assessment of Dioxins
and Related Compounds. eds. M. A. Gallo, R. J. Scheuplein, and K. A. Heijden,
145
51-68. Cold Springs Harbor, NY: Banbury Report 35, Cold Springs Harbor
Laboratory Press.
Blake, M. C., Azizkhan, J. C. 1989. Transcription factor E2F is required for effecient
expression of the hamster dihydrofolate reductase gene in vitro and in vivo.
Molecular and Cellular Biology. 9: 4994-5002.
Bombick, D. W., Madhukar, B. V., Brewster, D. W. and Matsumura, F. 1985. TCDD
(2,3,7,8-tetrachlorodibenzo-p-dioxin) causes increases in protein kinases
particularly protein kinase C in the hepatic plasma membrane of the rat and the
guinea pig. Biochemical and Biophysical Research Communications. 127: 296302.
Bombick, D. W., Jankun, J., Tullis, K, and Matsumura,
F.
1988. 2,3,7,9Tetrachlorodibenzo-p-dioxin causes increases in expression of c-erd-A and levels
of protein-tyrosine kinases in selected tissues of responsive mouse strains.
Proceedings. National Academy of Sciences. USA. 85: 4128-4132.
Bonsotti, D. A., Abrahamson, L. J., and Allen, J. R. 1979.
Hormonal alterations in
female rhesus monkeys fed a diet containing 2,3,7,9-tetrachlorodibenzo-p-dioxin.
Bulletin of Environmental Contamination and Toxicology. 211: 463-469.
Bonven, B. J., Nielsen, A. L., Norby, P. L., Redersen, F. S. and Jorgensen, P. 1995. EBox variants direct formation of distinct complexes with the basic helix-loophelix protein ALF1. Journal of Molecular Biology. 249: 564-575.
Bradfield, C. A., Kende, A. S., and Poland, A. 1988. Kinetic and equilibrium studies of
Ah receptor-ligand binding: use of [1251] 2-iodo-2,8-dibromodibenzo-p-dioxin.
Molecular Pharmacology. 34: 229-237.
Brinkman, V. A. and DeKok. A. 1980.
Production, properties and usage. In
Halogenated Biphenyls, Terphenyls, Napthalenes, Dibenzodioxins and Related
Products. ed. R. D. Kimbrough, 1-40. Amsterdam: North Holland Medical Press.
Cahill, G. F. Jr. 1970. Starvation in man. New England Journal of Medicine. 282: 668675.
Carcamo, J., Maldonado, E., Ahn, M., Ha, I., Kasai, Y., Flint, J., and Reinberg, D. 1990.
A TATA-like sequence located downstream of the transcription initiation site is
required for expression of an RNA polymerase II transcribed.
Genes and
Development. 4:1611-1622.
Carmaco, J., Buckbinder, L., Reinberg, D. 1991. The initiator directs the assembly of a
transcription factor HD-dependant transcription complex. Proceedings. National
Academy of Sciences. USA. 88: 8052-8056.
146
Carrier, F., Owens, R. A., Nebert, D. W., and Puga, A. 1992. Dioxin-dependant activation
of murine cyp 1 a-1 gene transcription requires protein kinase C-dependant
phosphorylation. Molecular and Cellular Biology. 12: 1856-1863.
Chahoud, I., Krowke, R., Schimnel, A., Merker, H., and Neubert, D. 1989. reproductive
toxicity and pharmacokinetics of 2,3,7,8-tetrachlorodibenzo-p-dioxin. I. Effect of
high doses on the fertility of male rats. Archives of Toxicology. 63: 432-439.
Chen, H. S., and Perdew, G. H. 1994.
Subunit composition of the heherodimeric
cytosolic aryl hydrocarbon receptor complex. Journal of Biological Chemistry.
269: 27554-27558.
Choi, E. J., Toscano, D. G., Ryan, J. A., Riedel, N., and Toscano, W. A. 1991. Dioxin
induces transforming growth factor-a in human keratinocytes. Journal of
Biological Chemistry. 266: 9591-9597.
Chou, M. W., Kong, J., Chung, K. T., and Hart R. W. 1993. Effect of calorie restriction
on the metabolic activation of xenobiotics. Mutation Research. 295: 223-235.
Clark, A. R. and Docherty, K. 1993. Cell-specific gene expression in the islets of
langerhans: E boxes and TAAT boxes. Biochemical Society Transactions. 21:
154-159.
Clarke, S. D., and Jump, D. B. 1993. Regulation of gene transcription by polyunsaturated
fatty acids. Progress in Lipid Research. 32: 139-149.
Courtney, K. D., Gaylor, D. W., Hogan, M. D., Falk, H. L., Bates, R. R., and Mitchell, T.
1970. Teratogenic evaluation of 2,4,5-T. Science. 168: 864-866.
Couture, L. A., Abbott, B. D., and Birnbaum, L. S. 1990. A critical review of the
developmental toxicity and teratogenicity of 2,3,7,8-tetrachlorodibenzo-p-dioxin:
Recent advances toward understanding the mechanism. Teratology. 42: 619-627.
Crow, K. D. 1970. Chloracne. Transactions. St. Johns Hospital. Dermatological Society.
56: 77-99.
Della Porta, G., Dragani, T. A., and Sozzi, G. 1987. Carcinogenic effects of infantile and
long-term 2,3,7,8-tetrachlorodibenzo-p-dioxin treatment in the mouse. Tumori.
73: 99-107.
Denison, M. S., Fisher, J. M. and Whitlock, J. P. Jr. 1989. Protein-DNA interaction at
recognition sites for the dioxin-Ah receptor complex. Journal of Biological
Chemistry. 264(28):16478-16482
.
147
De Vito, M. J., Thomas, T., Martin, E., Umbreit, T. H, and Gallo, M. A.
1992.
Antiestorgenic action of 2,3,7,8-tetrachlorodibenzo-p-dioxin: Tissue-specific
regulation of estrogen receptor in CD1 mice.
Toxicology and Applied
Pharmacology. 113: 284-292.
De Vito, M. J., and Birnbaum, L. S. 1994. Toxicology of dioxins and related chemicals.
In Dioxins and Health. ed. A. Schecter, 139-162. NY: Plenum Press.
Dolwick, K. M., Swanson, H. I., and Bradfield, C. A. 1993. In vitro analysis of the Ah
receptor domains involved in ligand-activated DNA recognition. Proceedings.
National Academy of Sciences. U.S.A. 90(18): 8566-8570.
Doyle, K., Zhang, Y., Baer, R. and Bina, M. 1994. Distinguishable patterns of protein-
DNA interactions involving complexes of basic helix-loop-helix proteins.
Journal of Biological Chemistry. 269(16): 12099-12105.
Dunnett, C. W. 1955.
A multiple comparison proceedure for comparing several
treatments with control. Journal of American Statistical Association. 50: 10961121.
Efcavitch, J. W. 1990. Gel electrophoresis of nucleic acids. A practical. eds. D.
Rickwood and B. Hames, 124. NY: Oxford University Press.
Eilenberger, T., Fass, D., Arnaud, M. and Harrison, S. 1994. Crystal structure of
transcription factor E47: E-box recognition by a basic region helix-loop-helix
dimer. Genes and Development. 8: 970-980.
Eleouet, J and Romeo, P. 1993. CCACC-binding or simian - virus -40- protein -1- binding
proteins cooperate with human GATA-1 to direct erythroid-specific transcription
and mediate 5' hypersensitive site 2 sensitivity of a TATA-less promoter.
European Journal of Biochemistry. 212:763-770
Ema, M., Matsushita, N., Sogawa, K., Ariyama, T., Inazawa, T., Nemoto, T., Ota, M.,
Oshimura, M., and Fujii-Kuriyama, Y. 1994. Human aryl hydrocarbon receptor:
Function, expression and chromosomal assignment to 7p21. Journal of
Biochemistry. 116(4): 845-851.
Enan, E., Lui, P. C. C., and Matsumura, F. 1992. 2,3,7,8-Tetrachlorodibenzo-p-dioxin
causes reduction of glucose transporting activities in the plasma membranes of
adipose tissue and pancreas from guinea pig. Journal of Biological Chemistry.
267: 19785-19791.
Enan, E., and Matsumura, F. 1994. Significance of TCDD-induced changes in protein
phosphorylation in the adipocyte of male guinea pigs. Journal of Biochemical
Toxicology. 9: 159-170.
148
Faith, R. E., and Moore, J. A. 1977. Impairment of thymus-dependant immune function
by exposure of the developing immune system to 2,3,7,8-tetrachlorodibenzo-pdioxin (TCDD). Journal of Toxicology and Environmental Health. 3: 451-464.
Farnham, P. J. and Means, A. L. 1990 Sequences downstream of the transcription
initiation site modulate the activity of the murine dihydrofolate reductase
promoter. Molecular and Cellular Biology. 10(4): 1390-1398.
Favreau, L. V. and Pickett, C. B.
1991. Transcriptional regulation of the rat
NAD(P)H:quinone reductase gene.
Identification of regulatory elements
controlling basal level expression and inducible expression by planar aromatic
compounds and phenolic antioxidants. Journal of Biological Chemistry. 266(7):
4556-4561.
Firestone, D. 1984. Chlorinated aromatic compounds and related dioxins and furans:
production uses and environmental exposure In Biological Mechanisms of Dioxin
Action. ed. A. Poland and R. D. Kimbrough, 3-16. NY: Banbury Report 18, Cold
Springs Harbor Laboratory Press.
Fowden, A. L., Mijovic, J., and Silver, M. 1993. The effects of cortisol on hepatic and
renal gluconeogenic enzyme activities in the sheep fetus during late gestation.
Journal of Endocrinology. 137(2): 213-222.
Fowler, B. A., Lucier, G. W., Brown, H. W., and McDaniel, 0. S. 1973. Ultrastructural
changes in rat liver cells following a single oral dose of TCDD. Environmental
Health Perspectives. 5: 141-148.
Frameson, P. and Bornstein, P. 1993. A serum response element and a binding site for
NF-7 mediate the serum response of the thrombospondin 1 gene. Journal of
Biological Chemistry. 268: 4989-4996.
Fukunaga, B. N., Probst, M. R., Reisz-Proszasz,
S.,
and Hankinson, 0. 1995.
Identification of functional domains of the aryl hydrocarbon receptor. Journal of
Biological Chemistry. 270: 29270-29278.
Gasiewitz, T. A., Holscher, M. A., and Neal, R. A. 1980. The effect of total parenteral
nutrition on the toxicity of 2,3,7,8-tetrachlorodibenzo-p-dioxin in the rat.
Toxicology and Applied Pharmacology. 54: 469-488.
Giavini, E. M., Prati, M., and Viswara, C. 1982. Rabbit teratology studies with 2,3,7,8tetrachlorodibenzo-p-dioxin. Environmental Research. 27: 74-78.
149
Giesy, J. P., Ludwig, J. P., and Mitt, D. E. 1994. Dioxins, dibenzofurans, PCBs and
colonial fish-eating water birds In Dioxins and Health. ed. A. Schecter, 249-307.
NY: Plenum Press.
Gillner, M., Bergman, J., Canbillau, C., Alexandersson, M., Fernstrom, B., and
Gustafsson, J. -A. 1993. Interactions of indolo[3,2-b]carbazoles and related
polycyclic aromatic hydrocarbons with specific binding sites for 2,3,7,8tetrachlorodibenzo-p-dioxin in rat liver. Molecular Pharmacology. 44(2): 336345
Goldstein, J. A. 1080. Structure-activity relationships for the biochemical effects and the
relationship to toxicity. In Halogenated Biphenyls, Terphenyls, Napthalenes,
Dibenzodioxins and Related Products. ed. R. D. Kimbrough, 151-190.
Amsterdam: North Holland Medical Press.
Gorski, K., Carneiro, M. and Schibler, U. 1986. Tissue -specific in vitro transcription
from the mouse albumin promoter. Cell. 47: 767-776.
Gott licher, M., Widmark, E., Qiao, L., and Gustafsson, J. 1992. Fatty acids activate a
chimera of the clofibric acid-activated receptor and the glucocorticoid receptor.
Proceedings. National Academy of Sciences. USA. 89: 4653-4657.
Gupta, B. N., Vos, J. G., Moore, J. A., Zinkl, J. G., and Bullock, B. C. 1973.
Pathological effects of 2,3,7,8-tetrachlorodibenzo-p-dioxin in laboratory animals.
Environmental Health Perspectives. 5: 125-140.
Gurney, A. L., Park, E. A., Liu, J., Giralt, M., McGrane, M. M., Patel, Y. M., Crawford,
D. R., Niziel, S. E., Savon, S., and Hanson, R. H. 1994. Metabolic regulation of
gene transcription.
Haley-Zitlin, V. and Richardson, A. 1994. Effect of dietary restriction on DNA repair
and DNA damage. Mutation Research. 295:237-245.
In Gel
Hames, B. D. 1990. One-dimensional polyacrylamide gel electrophoresis.
electrophoresis of proteins: A Practical Approach, 2nd ed., eds. B. D. Hames.
and D. Richwood, 6-50. NY: Oxford Press.
Hankinson, 0. 1995. The aryl hydrocarbon receptor complex. Annual Review of
Pharmacology and Toxicology. 35: 307-340.
Hariharan, N., Kelley, D. and Perry, R. P. 1989. Equipotent mouse ribosomal protein
promoters have a similar architecture that includes internal sequence elements.
Genes and Development. 3: 1789-1800.
Hariharan, N. and Perry, R. P. 1990. Functional dissection of a mouse ribosomal protein
promoter: Significance of the polypyrimidine initiator and an element in the
150
TATA-box region. Proceedings. National Academy of Sciences. USA. 87: 15261530.
Hart, R. W., Chou, M., Feuers, R., Leakey, J., Duffy, P., Lyn-Cook, B., Turturro, A. and
Allaben, B. 1992. Caloric restriction and chemical toxicity/carcinogenesis.
Quality Assurance: Good Practice. Regulatory Law. 1: 120-131.
Hart, R. W., Keenan, K., Turturro, A., Abdo, K. M., Leaky, J. and Cook, B.L. 1995.
Symposium Overview: Calorie restriction and toxicity. Fundamental and Applied
Toxicology. 25: 184-195.
Hass, B., Hart, R. W., Lu, M. and Lyn-Cook, B. D. 1993. Effect of calorie restriction in
animals on cellular function, oncogene expression and DNA methylation in vitro.
Mutation Research. 295: 281-289.
Hatamochi, A., Golumbek, P. T., van Schaftingen, E. and de Crombrugghe, B. 1988. A
CCAAT DNA binding factor consisting of two different components that are both
required for DNA binding. Journal of Biological Chemistry. 263(12): 5940-5947.
Henck, J. W., New, M. A., Kociba, R. J., and Rao, K.S. 1981. 2,3,7,8-tetrachlorodibenzop-dioxin: Acute oral toxicity in hamsters. Toxicology and Applied Pharmacology.
59: 405-407.
Hennighausen, L. and Henry, K.L. 1987. Interaction of protein and DNA in vitro.
Methods in Enzymology. 152:722-723.
Hines, R. N., Mathis, J. M., and Jacobs, C. S. 1988. Identification of multiple regulatory
elements on the human cytochrome P4501A1. Carcinogenesis. 9(9): 1599-1605.
Hinton, D. E., Glaumann, H., Trump, and B. F. 1978. Studies on the cellular toxicity of
polychlorinated biphenyls (PCBs). I. Effects of PCBs on microsomal enzymes and
on synthesis and turnover of microsomal and cytoplasmic lipids of rat liver-a
morphological and biochemical study. Virchows Archives of Biochemistry. 27:
279-306.
Hites, R. A. 1991. Environmental behavior of chlorinated dioxins and furans. Accounts of
Chemical Research. 23: 194-201.
Hsu, S. T., Ma, C. I., Hsu, S. K. H., Wu, S. S., Hsu, N. H. M., Yeh, C. C., and Wu, S. B.
1985. Discovery and epidemiology of PCB poisoning in Taiwan: A four-year
followup. Environmental Health Perspectives. 59: 5-10.
Huff, J., Lucier, G., and Tritscher, A. 1994. Carcinogenicity of TCDD: Experimental,
mechanistic and epidemiological evidence. Annual Review of Pharmacology and
Toxicology. 34: 343-372.
151
Liver-enriched transcription factor HNF-4 and
Hung, H. L. and High, K. A. 1996.
ubiquitous factor NF-Y are critical for expression of blood coagulation factor X.
Journal of Biological Chemistry. 271(4): 2323-2331.
Ifian, M. A., Sparrow, B. R., Ryu, B.W., Selivonchick, D. P. and Schaup, H.W. 1996.
Expression of hepatic pyruvate carboxylase mRNA in C57BL/6J Ah" and
congenic Ahdid mice exposed to 2,3,7,8-Tetrachlorodibenzo-p-dioxin. Journal of
Biochemical Toxicology. 11:51-56.
Isaacs, R. J., Harris, A. L. and Hickson, I. D. 1996. Journal of Biological Chemistry. 271:
16741-16747.
Jitrapakdee, S., Walker, M. E., and Wallace, J. C. 1996. Identification of novel
alternatively spliced pyruvate carboxylase mRNAs with divergent 5'-untranslated
regions which are expressed in a tissue-specific manner. Biochemical and
Biophysical Research Communications. 223: 695-700.
Jitrapakdee, S., Grant, B. W. Cassady, I. A. and Wallace, J. C. 1997. The rat pyruvate
carboxylase gene structure. Journal of Biological Chemistry. 272(33):2052220530.
Jones, G., and Butler, H. W. 1973. A morphological study of the liver lesion induced by
2,3,7,8-tetrachlorodibenzo-p-dioxin in rats. Journal of Pathology. 112: 93-97.
Jones, N. C., Rigby, P. W. J. and Ziff, E. B. 1988. Trans-acting protein factors and the
regulation of eukaryotic transcription. Genes and Development. 2: 267-281.
Jones, C. G., Hothi, S. K., and Titheradge, M. A. 1993. Effects of dexamethasone on
gluconeogenesis, pyruvate kinase, pyruvate carboxylase and pyruvate
dehydrogenase flux in isolated hepatocytes. Biochemical Journal. 289. 821-828.
Kadesh, T. 1993. Consequences of heteromeric interactions among helix-loop-helix
proteins. Cell Growth and Differentiation. 4(1): 49-55.
Karsenty, G., and de Crombrugghe, B. 1990. Two different negative and one positive
regulatory factors interact with a short promoter segment of the alpha 1 (I)
collagen gene. Journal of Biological Chemistry. 265(17): 9934-9942.
Katsurada, A., Iritani, N., Fukuda, H., Matsumura, Y., Nishimoto, N., Noguchi, T. and
Tanaka, T. 1990. Effects of nutrients and hormones on transcriptional and post-
transcriptional regulation of acetyl-CoA carboxylase in rat liver. European
Journal of Biochemistry 190: 435-441.
152
Kawagoe, Y., Campell, B. R. and Murai, N. 1994. Synergism between CACGTG (Gbox) and CACCTG cis-elements is required for activation of the bean seed storage
protein /3- phaseolin gene. The Plant Journal. 5(6): 885-890.
Kimbrough, R. D. 1974. The toxicity of polychlorinated polycyclic compounds and
related chemicals. Critical Reviews in Toxicology. 2: 445-489.
Kobayashi, A. Sogawa, K. and Kuriyama, Y. 1996. Cooperative interaction between
AhR-ARNT and Spl for the drug inducible expression of CYP1A1 gene. Journal
of Biological Chemistry. 271(21): 12310-12316.
Kociba, R. J., Keyes, D. G., Beyer, J. E., Carreon, R. M., and Wade, C. E. 1978. Results
of a two-year chronic toxicity study and oncogenicity study of 2,3,7,8tetrachlorodibenzo-p-dioxin in rats. Toxicology and Applied Pharmacology. 46:
279-303.
Kociba, R. J., Keeler, P. A., Park, C. N., and Gehring, P J.
2,3,7,8Tetrachlorodibenzo-p-dioxin (TCDD): Results of a 13-week oral toxicity study in
1979.
rats. Toxicology and Applied Pharmacology. 35: 553-574.
Kopponen, P., Valttila, 0., Talka, E., Torronen, R., Tarhanen, J., Ruuskanen, J. and
Karenlampi, S. 1994. Chemical and biological 2,3,7,8-tetrachlorodibenzo-pdioxin equivalents in fly ash from combustion of bleached kraft pulp mill sludge.
Environmental Toxicology and Chemistry. 13: 143-148.
Korza, G., and Ozols, J. 1988. Complete covalent structure of 60K-Da esterase isolated
from 2,3,7,8-tetrachlorodibenzo-p-dioxin induced rabbit liver microsomes.
Journal of Biological Chemistry. 263: 3486-3495.
Kovesdi, I., Reichel, R., Nevins, J. 1986. Identification of a cellular transcription factor
involved in ElA trans-activation. Cell. 45: 219-228.
Kritchevsky, D., and Klurfeld, D. M. 1987. Calorie effects in experimental mammary
tumorigenesis. Americal Journal of Clinical Nutrition. 45: 236-242.
Landers, J. P., and Bunce, N. J. 1991. The Ah receptor and the mechanisms of dioxin
toxicty. Biochemical Journal. 276: 273-287.
Landrigan, P. J. 1980. General population exposure to environmental concentrations of
halogenated biphenyls. In Halogenated Biphenyls, Terphenyls, Napthalenes,
Dibenzodioxins and Related Products. ed. R. D. Kimbrough, 267-286.
Amsterdam: North Holland Medical Press.
153
Li, Y.P., Baskin, B., Davis, R., Wu, D. and Hersh, L. B. 1995. A cell type-specific
silencer in the human choline acetyltransferase gene requiring two distinct and
interactive E boxes. Molecular Brain Research. 30: 106-114.
Lin, F. H., Stohs, S. H., Birnbaum, L. S., Clark, G., Lucier, G. W., and Goldstein, J. A.
1991. The effects of 2,3,7,8-tetrachlorodibenzo-p-dioxin on the hepatic estrogen
and glucocorticoid receptors in congenic strains of Ah responsive and Ah nonresponsive C57BL/6J mice. Toxicology and Applied Pharmacology. 108: 129139.
Lucier, G. W., Tritscher, A., Goldsworthy, T., Foley, J., Clark, G., Goldstein, J., and
Maronpot, R. 1991. Ovarian hormones enhance 2,3,7,8-tetrachlorodibenzo-pdioxin mediated increases in cell proliferation and preneoplastic foci in a twostage model for rat hepatocarcinogenesis. Cancer Research. 51: 1391-1397.
Lucier, G. W., Sewall, C. H., Heuvel, V. J., Kanno, J., Tritscher, A. M., and Clark, G. C.
1993. 2,3,7,8-TCDD alterations of thyroid function in a rodent tumor promoter
model. Toxicologist. 13: 313
Lusska, A., Shen, E., and Whitlock, J. 1993. Protein-DNA interactions at a dioxinresponsive enhancer. Analysis of six bona fide DNA-binding sites for the liganded
Ah receptor. Journal of Biological Chemistry. 268(9): 6575-6580.
Luster, M. I., Boorman, G. A., Dean, J. H., Harris, M. W., Luebke, R. W., Singh, P., and
Moore, M. L. 1980. Examination of bone marrow, immunological parameters
and host susceptibility following Pre- and post-natal exposure to 2,3,7,8Journal
of
International
(TCDD).
tetrachlorodibenzo-p-dioxin
Immunopharmacology. 2: 301-310.
Ma, S. W. Y. and Foster D. 0. 1986. Starvation-induced changes in metabolic rate, blood
flow, and regional energy expenditure in rats. Canadian Journal of Physiology
and Pharmacology. 64:1252-1258.
Ma, X., and Babish, J. G. 1993. Acute 2,3,7,8-tetrachlorodibenzo-p-dioxin exposure
results in enhanced tyrosyl phosphorylation and expression of murine hepatic
Biochemical and Biophysical Research
cyclin dependant kinases.
Communications. 197: 1070-1077.
Ma, Q., Doug, L. Q., and Whitlock, J. P. 1995. Transcriptional activation by the mouse
Ah receptor-interplay between multiple stimulatory and inhibitory functions.
Journal of Biological Chemistry. 270(21): 12697-12703.
MacKall J. C., Student, A. K., Polakis S. E., Efthimios, P. and Lane, M. D. 1976.
Induction of lipogenesis during differentiation in a "preadipocyte" cell line.
Journal of Biological Chemistry. 251: 6462-6464.
154
Madhukar, B. V., Brewster, D. W., and Matsumura, F. 1984.
Effects of in vivo-
2,3,7,8-tetrachlorodibenzo-p-dioxin on receptor binding of
epidermal growth factor in hepatic plasma membrane of rat, guinea pig, mouse
and hamster. Proceedings. National Academy of Sciences. U.S.A. 81: 7407-7411.
administered
Maire, P., Wuarin, J. and Schibler, U. 1989. The role of cis-acting promoter element in
tissue-specific albumin gene expression. Science. 244: 343-346.
Maity, S. N., Golumbek, P. T., Karsenty, G. and de Crombrugghe, B. 1988. Selective
activation of transcription by a novel CCAAT binding factor. Science. 241: 582585.
Maity, S. N. and Crombrugghe B. 1998. Role of the CCAAT-binding protein CBF/NFY in transcription. Trends in Biochemical Sciences. 23: 174-178.
Manahan, S. E. 1994. Water pollution. In Environmental Chemistry. ed. S. E. Manahan,
179-222. Boca Raton, FL: CRC Press, Lewis Publishers.
Marten, N. W., Sladek, F. M. and Straus, D. S. 1996. Effect of dietary protein restriction
on liver transcription factors. Biochemical Journal. 317: 361-370.
Martin, A. D., Allan, E. H., and Titheradge, M. A. 1984. The stimulation of
mitochondrial pyruvate carboxylation after dexamethasone treatment of rats.
Biochemical Journal. 219(1): 107-115.
Masuda, Y. 1994. The Yusho rice oil poisoning incident. In Dioxins and Health. ed. A.
Schecter, 633-659. NY; Plenum Press.
McConnell, E. E., Moore, J. A., and Dalgard, D. W. 1978.
Toxicity of 2,3,7,8Tetrachlorodibenzo-p-dioxin in rhesus monkeys (macacca mullata) following a
single oral dose. Toxicology and Applied Pharmacology. 43: 175-187.
McConnell, E. E., Moore, J. A. Haseman, J. K., and Harris, M. W. 1978.
The
comparative toxicity of chlorinated dibenzo-p-dioxins in mice and guinea pigs.
Toxicology and Applied Pharmacology. 44: 335-356.
McConnell, E. E. 1980. Acute and chronic toxicity, carcinogenesis, teratogenesis and
mutagenesis in animals. In Halogenated Biphenyls, Terphenyls, Napthalenes,
Dibenzodioxins and Related Products. ed. R. D. Kimbrough, 109-150.
Amsterdam: Elsevier North Holland Medical Press.
McConnell, E. E., Moore, J. A., Gupta, B. N., Rakes, A. H., Luster, M. I., and Parker, C.
E. 1980. The chronic toxicity of technical and analytical pentachlorophenol in
cattle. I. Clinicopathology. Toxicology and Applied Pharmacology. 52: 468-490.
155
McGuire, J., White law, M. L., Pongratz, I., Gustafsson, J. -A., and Poellinger, L. 1994. A
cellular factor stimulates ligand-dependant release of hsp90 from the basic helixloop-helix domain receptor. Molecular and Cellular Biology. 14: 2438-2446.
McKim, J. M. Jr., Marien, K., Schaup, H. W. and Selivonchick, D. P. 1991. Alterations
of hepatic acetyl-CoA carboxylase by 2,3,7,8-tetrachlorodibenzo-p-dioxin.
Lipids. 26: 521-525.
McKnight, S. and Tjian, R.
1986.
Transcriptional selectivity of viral genes in
mammalian cells. Cell. 46: 795-805.
McNulty, W. P., Pomerantz, I., and Farrell, T. 1981. Chronic toxicity of 2,3,7,8tetrachlorodibenzofurans for rhesus monkeys. Food and Cosmetic Toxicology.
19: 57-65.
Means, A. L. and Farnham, P. J. 1990. Transcription initiation from dihydrofolate
reductase promoter is positioned by HIP1 binding at the initiation site. Molecular
and Cellular Biology. 10(2): 653-661.
Menahan, L. A. and Wieland, 0. 1969. The role of thyroid function in the metabolism of
perfused rat liver with particular reference to gluconeogenesis. European Journal
of Biochemistry. 10:180-194.
Meyer, B. K., Pray-Grant, M. G., Vanden Heuvel, J. P., and Perdew, G. H. 1998.
Hepatitis B virus X-associated protein 2 is a subunit of the unliganded aryl
hydrocarbon receptor core complex and exhibits transcriptional enhancer activity.
Molecular and Cellular Biology. 18(2): 978-988.
Miester, A., Weinrich, S. L., Nelson, C. and Rutter, W. J. 1989. The Chymotrypsin
Enhancer Core. Journal of Biological Chemistry. 264(34): 20744-20751.
Mollering, H. 1985. Citrate. In Methods of Enzymatic Analysis, 3rd ed.,
eds. H.
Bergmeyer, and F. M. Grab, 2-12, Germany: VCH
Moore, R. W., Parsons, J. A., Bookstaff, R. C., and Peterson, R. E. 1985. Androgenic
deficiency in male rats treated with 2,3,7,8-tetrachlorodibenzo-p-dioxins.
Toxicology and Applied Pharmacology. 79: 99-111.
Moudgil, V. K. 1994. Steroid/nuclear receptor superfamily. Recent advances and relation
to healts and disease. In Steroid Hormone Receptors: Basic and Clinical Aspects.
Ed. V. K. Moudgil, 1-46. Berlin: Birkenhauser.
Murre, C., Bain, G., Van Dijk, M. A., Engel, I., Furnari, B. A., Massari, M. E., Mathews,
J. R., Quong, M. W., Rivera, R. R., and Stuiver, M. H. 1994. Structure and
156
function of helix-loop-helix
1218(2):129-135.
proteins.
Biochemica
et Biophysica Acta.
Nambu, J. R., Lewis, J. 0., Wharton, K. A., and Crews, S. T. 1991. The Drosophilia
single-minded gene encodes a helix-loop-helix protein that acts as a master
regulator of CNS midline development. Cell. 67: 1157
Nebert, D. W., and Gelboin, H. V. 1969. The in vivo and in vitro induction of aryl
hydrocarbon hydroxylase in mammalian cells of different species, tissues, strains
and developmental and hormonal states. Archives of Biochemistry and Biophysics.
134(1):76-89
Nebert, D. W., Goujon, F. M., and Gielan, J. E. 1972. Aryl hydrocarbon hydroxylase
induction by polycyclic hydrocarbons: simple autosomal dominant trait in the
mouse. Nature. New Biology. 236(65): 107-110.
Nebert, D. W., Jensen, N. M., Perry, J. W., and Oka, T. 1980. Association between
ornithine decarboxylase induction and the Ah locus in mice treated with
polycyclic aromatic compounds. Journal of Biological Chemistry. 255: 68366842.
Nebert, D. W. 1989. The Ah locus: genetic differences in toxicity, cancer, mutation and
birth defects. Critical Reviews in Toxicology. 20: 153
Nebert, D. W. Puga, A., and Vasiliou, V. 1993. Role of the Ah receptor and dioxininducible [Ah] gene battery in toxicity, cancer and signal transduction. Annuals.
New York Academy of Sciences. 685: 624-640.
Ogata, T. and Noda, M. 1991. Expression of Id, A negative regulator of helix-loop-helix
DNA binding proteins, is down-regulated at confluence and enhanced by
dexamethasone in a mouse osteoblastic cell line, MC3T3E1. Biochemical and
Biophysical Research Communications. 180(3): 1194-1199.
Okey, A. B., Vella, L. M., and Harper, P. A. 1989. Detection and characterization of a
low affinity form of cytosolic Ah receptor in livers of mice nonresponsive to
Molecular
induction of cytochrome P 1-450 by 3-methylcholanthrene.
Pharmacology. 35(6): 823-830
Okey, A. B., Riddick, D. S. and Harper, P. A. 1994. The Ah receptor: Mediator of the
toxicity of 2,3,7,8-tetrachlorodibenzo-p-dioxin (TCDD) and related compounds.
Toxicology Letters. 70: 1-22.
Okino, S. T., and Whitlock, J. P. 1995. Dioxin induced localized, graded changes in
chromatin structure-implications for CYP1A1 gene transcription. Molecular and
Cellular Biology. 15(7): 3714-3721.
157
Owen, 0. E., Patel, M. S., Block B. S. B., Kreulen, T. H., Reiche, F. A. and Mozzoli, M.
A. 1976. Gluconeogenesis in normal, cirrhotic and diabetic humans. In
Gluconeogenesis: Its regulation in mammalian species. eds. R.W. Hanson, and
M. A.Mehlmen, 533-558, NY: John Wiley and Sons.
Park, K. and Atchison, M L. 1991. Isolation of candidate repressor/activator, NF-E1
(YY-1, 8), that binds to the immunoglobulin lc 3' enhancer and immunoglobulin
heavy-chain (El site. Proceedings. National Academy of Sciences. USA. 88:
9804-9808.
Parsons, J. R., and Storms, M. C. M. 1989. Biodegradation of chlorinated dibenzo-pdioxins in batch and continuous cultures of strain JBI. Chemosphere. 19: 12971308.
Parsons, J. R. 1992. Influence of suspended sediment on the biodegradation of
chlorinated dibenzo-p-dioxins. Chemosphere. 25: 1973-1980.
Peterson, R. E., Seefeld, M. D., Christian, B. J., Potter, C. L., Kelling, C. K. and Keesey,
R. E. 1984. The wasting syndrome in 2,3,7,8-tetrachlorodibenzo-p-dioxin toxicity:
Basic features and their interpretation. In Biological mechanisms of dioxin action.
eds. A. Poland, and R. D. Kimbrough, 291-308. Banbury Report 18, Cold Springs
Harbor NY: Cold Springs Harbor Laboratory Press.
Pimental, R. A., Liang, B., Yee, G. K., Wilhelmsson, A., Poellinger, L. and Paulson, K.
E. 1993. Dioxin receptor and C/EBP regulate the function of glutathione-S-
transferase Ya gene xenobiotic response element.
Molecular and Cellular
Biology. 13(7): 4365-4373.
Pinney, D. F., Brousse, F. C., Faerman, A., Shani, M. Maruyama, K. and Emerson, C. P.
1995.
Quail MyoD is regulated by a complex array of cis-acting control
sequences. Developmental Biology. 170: 21-38.
Poland, A. P., Glover, E., and Kende, A. S. 1976. Stereospecific, high affinity binding of
2,3,7,8-tetrachlorodibenzo-p-dioxin by hepatic cytosol: Evidence that the binding
species is the receptor for the induction of aryl hydrocarbon hydroxylase. Journal
of Biological Chemistry. 251(16): 4936-4946
Poland, A., and Knutson, J. C. 1982. 2,3,7,8-Tetrachlorodibenzo-p-dioxins and related
halogenated aromatic hydrocarbons: Examination of the mechanisms of toxicity.
Annual Review of Pharmacology and Toxicology. 22: 517-554.
Poland, A., Teitelbaum, P., Glover, E. and Kende, A. 1989. Stimulation of in vivo
hepatic uptake and in vitro hepatic binding of [125I] 2-Iodo-3,7,8-trichlorodibenzo-p-dioxin by the administration of agonists for the Ah receptor. Molecular
Pharmacology. 36: 121-127.
158
Poland, A., Palen, D., and Glover, E. 1994. Analysis of the four alleles of the murine aryl
hydrocarbon receptor. Molecular Pharmacology. 46: 915
Pollenz, R. S., Sattler, C. A. and Poland, A. 1994. The Aryl Hydrocarbon receptor and
Aryl Hydrocarbon receptor nuclear translocator protein show distinct subcellular
localizations in hepal c 1 c7 cells by immunofluorescence microscopy. Molecular
Pharmacology. 45: 428-438.
Piskorska-Pliszczynska, J., Keys, B., Safe, S., and Newman, M. S. 1986. Thecytosolic
binding affinities and AHH induction potencies of 29 polynuclear aromatic
hydrocarbons. Toxicology Letters. 34(1): 67-74.
of 2,3,7,8tetrachlorodibenzo-p-dioxin in laboratory animals: effects, mechanisms and
Pohjanvitra,
R.,
and
Tuomisto,
J.
1994.
Short-term
toxicity
animal models. Pharmacological Reviews. 46(4):483-549.
Pongratz, I., Stromstedt, P. E., Mason, G. G. and Poellinger, L. 1991 Inhibition of the
specific DNA binding activity of the dioxin receptor by phosphatase treatment.
Journal of Biological Chemistry. 266(25): 16813-16817.
Puga, A., Nebert, D. W., and Carrier, F. 1992. Dioxin induced expression of c-fos and cjun proto-oncogenes and a large increase in transcription factor AP-1. DNA Cell
Biology. 11(4): 269-281.
Puhvel, S. M., Erlt, D. C., and Lynberg, C. A. 1984. Increased epidermal
transglutaminase activity following 2,3,7,8-tetrachlorodibenzo-p-dioxin: In vivo
and in vitro studies with mouse skin. Toxicology and Applied Pharmacology. 73:
42-47.
Quattrochi, L. C., Vu, T. and Tukey, R. H. 1994. The human CYP1A2 gene and induction
by 3-methylcholanthrene. Journal of Biological Chemistry. 269(9):6949-6954.
Rao, M. S., Subbarao, V., Prasad, J. D., and Scarpelli, D. G. 1988. Carcinogenicity of
golden
hamster.
in
the
Syrian
2,3,7,8-tetrachlorodibenzo-p-dioxin
Carcinogenesis. 9: 1677-1679.
Rappe, C. 1980. Chemical properties and analytical methods. In Halogenated Biphenyls,
Terphenyls, Napthalenes, Dibenzodioxins and Related Products. ed. R. D.
Kimbrough, 41-76. Amsterdam: Elsevier North Holland Medical Press.
Reisz-Proszasz, S.,
Probst, M. R., Fukunaga, B. N., and Hankinson, 0.
1994.
Identification of functional domains of the aryl hydrocarbon receptor nuclear
translocator protein (ARNT). Molecular and Cellular Biology. 14(9): 6075-6086.
159
Riddick, D. S., Huang, Y., Harper, P. A. Okey, A. B. 1994. 2,3,7,8-Tetrachlorodibenzo-pdioxin versus 3-methylcholanthrene: comparative studies of aromatic hydrocarbon
(Ah) receptor binding, transformation, and induction of CYP1A1 expression.
Journal of Biological Chemistry. 269: 12118-12128.
Robinson, B. H., Oei, J., Sherwood, W. G., Applegarth, D., Wong, L., Haworth, J.,
Goodyear, P. Casey, R. and Zaleski, L. A. 1984. The molecular basis for the two
different clinical presentations of classical pyruvate carboxylase deficiency.
American Journal of Human Genetics. 36: 283-294.
Roeder, R. G. 1991. The complexities of eukaryotic transcription initiation: regulation of
preinitiation complex assembly. Trends in Biochemical Sciences. 16: 402-408.
Roeder, R. G. 1996.
The role of general initiation factors in transcription by RNA
polymerase II. Trends in Biochemical Sciences. 21(9): 327-335.
Romkes, M., and Safe, S. 1988. Comparative activities of 2,3,7,8-tetrachlorodibenzo-pdioxin and progesterone as antiestrogens in female rat uterus. Toxicology and
Applied Pharmacology. 92: 368-380.
Rossberg, M. 1986. Chlorinated hydrocarbons. In Ullman's Encyclopedia of Industrial
Chemistry. ed. W. Gerhartz, NY: VCH Publishers.
Roth, W., Voorman, R., and Aust, S. D. 1988. Activity of thyroid hormone-inducible
treatment with 2,3,7,8-tetrachlorodibenzo-p-dioxin.
enzymes following
Toxicology and Applied Pharmacology. 92: 65-74.
Rowlands, J. C., McEwan, I. J., and Gustafsson, J. -A. 1996. Transactivation by the
human dioxin receptor and Amt proteins: direct interactions with basal
transcription factors. Molecular Pharmacology. 50(3): 538-548.
Rowlands, J. C., and Gustafsson, J, -A. 1997. Aryl hydrocarbon receptor mediated signal
transduction. Critical Reviews in Toxicology. 27(2): 109-134.
Roy, A. L., Miesterernst, M., Pognonec, P. and Roeder, R. G.
1991. Cooperative
interaction of an initiator-binding transcription initiation factor and the helix-loophelix activator USF. Nature. 354: 245-248.
Roy, A. L. and Roeder, R. G. 1994. Initiator element binding protein TFII-I: A tale of
two sites. Indian Journal of Biochemistry and Biophysics. 31: 14-19.
Roy, S., Sparrow, B. R., Ryu, B. W., Schaup, H. W. and Selivonchick, D. P. 1998.
Dietary calorie restriction induced hepatic pyruvate carboxylase in pair-fed
controls for the C57BL/6J mice exposed to 2,3,7,8-tetrachlorodibenzo-p-dioxin.
Environmental and Nutritional Interactions. In Press.
160
Rutledge, S. L., Snead, 0. C., Kelly, D. R. Kerr, D. S., Swann, J. W., Spink, D. L. and
Martin, D. L. 1989. Pyruvate carboxylase deficiency: Acute exacerbation after
ACTH treatment of infantile spasms. Pediatric Neurology. 5: 249-252.
Ryu, B. W., Roy, S., Sparrow, B. R., Selivonchick, D. P. and Schaup, H. W. 1995. Ah
receptor involvement in mediation of pyruvate carboxylase levels and activity in
Biochemical
mice given 2,3,7,8-tetrachlorodibenzo-p-dioxin. Journal of
Toxicology. 10: 103-109.
Ryu, B. 1996.
Characterization of pyruvate carboxylase responses to 2,3,7,8-
tetrachlorodibenzo-p-dioxin exposure in C57BL6J
dissertation, Oregon State University, Corvallis, OR.
Ahdid
mice.
Thesis
Safe, S., and Hutzinger, 0. 1990. PCDDs and PCDFs: Sources and Environmental
Impact. In Polychlorinated Dibenzo-p-Dioxins and -furans (PCDDs/PCDFs):
Sources and Environmental Impact, Epidemiology, Mechanisms of Action, Health
Risks. 3. eds. S. Safe and 0. Hutzinger, 1-20, Environmental Toxin Series 3.
Berlin: Springer-Verlag.
Sambrook, J., Fritsch, E. F., and Maniatis, T. 1989a. Protocol II: Fresh competent E. coli
prepared using calcium chloride. In Molecular Cloning. A Laboratory Manual,
2nd edn., 1.82-1.84. New York: Cold Spring Harbor Laboratory Press.
Sambrook, J., Fritsch, E. F. and Maniatis, T. 1989b. Identification of bacterial colonies
that contain recombinant plasmids. In Molecular Cloning. A Laboratory Manual,
2nd edn., 1.85-1.86. New York: Cold Springs Harbor Laboratory Press.
Sambrook, J., Fritsch, E. F., and Maniatis, T. 1989c. Small-scale preparation of plasmid
DNA. In Molecular Cloning. A Laboratory Manual, 2nd edn., 1.25-1.28. New
York: Cold Springs Harbor Laboratory Press.
Sambrook, J., Fritsch, E. F., and Maniatis, T. 1989d. Gel Electrophoresis of DNA. In
Molecular Cloning. A Laboratory Manual, 2nd edn., 6.3-6.48. New York: Cold
Springs Harbor Laboratory Press.
SAS Institute Incorporated. 1995. SAS for Windows, Version 6.11. NC: SAS Institute
Incorporated.
Schafer, M. W., Madhukar, B. V., Swanson, H. I., Tullis, K., and Denison, M. W. 1993.
Protein kinase C is not involved in Ah receptor transformation and DNA binding.
Archives of Biochemistry and Biophysics. 307(2): 267-271.
Seitz, H. J., Kaiser, M., Krone, W., and Tarnowski, W. 1976. Physiologic significance of
glucocorticoids and insulin in the regulation of hepatic gluconeogenesis during
starvation in rats. Metabolism. 25: 1545-1555.
161
Sekido, R. Murai, K., Funahashi, J., Kamachi, Y., Sehara, A. F. Nabeshima, Y. and
Kondoh, H. 1994. The 8-Crystal lin Enhancer-Binding protein SEF1 is a repressor
of E2-box-mediated gene activation. Molecular and Cellular Biology. 14(9):
5692-5700.
Sekido, R., Takagi, T., Okanami, M., Moribe, H., Yamamura, M., Higashi, Y. and
Kondoh, H. 1996. Organization of the gene encoding transcriptional repressor
(EF1 and cross-species conservation of its domains. Gene. 173: 227-232.
Seto, E., Shi, Y. and Shenk, T. 1991. YY1 is an initiator sequence-binding protein that
directs and activated transcription in vitro. Nature. 354: 241-245.
Shen, E., and Whitlock, J. 1989. The potential role of DNA-methylation in the response
to 2,3,7,8-tetrachlorodibenzo-p-dioxin. Journal of Biological Chemistry. 264:
17754-17758.
Shi, Y., Seto, E., Chang, L. S. and Shenk, T. 1991. Transcriptional repression by YY1, a
human GL1-Kruppel-related protein, and relief of repression by E 1 A protein.
Cell. 67: 377-388.
Sittisombut, N. 1988. Two distinct nuclear factors bind the conserved regulatory
sequences of a rabbit major histocompatibility complex class II gene. Molecular
and Cellular Biology. 8(5): 2034-2041.
Smale, S. T. and Baltimore, D. 1989. The initiator as a transcriptional control element.
Cell. 57: 103-113.
Smale, S. T., Schmidt, M. C., Berk, A. J., Baltimore, D. 1990. Transcriptional activation
by Sp 1 as directed through TATA it initiator: Specific requirement for
mammalian transcription factor IID. Proceedings. National Academy of
Sciences. USA. 87: 4509-4513.
Sogawa, K., Iwabuchi, K., Abe, H., and Fujikuriyama, Y. 1995. Transcriptional
activation domains of the Ah receptor and Ah receptor nuclear translocator.
Journal of Cancer Research and Clinical Oncology. 121(9-10): 612-620.
Sogawa, K., Nakano, R., Kobayashi, A., Kikuchi, Y., Ohe, N., Natsuki, M. and
Kuriyama, Y. F. 1995. Possible function of the Ah receptor nuclear translocator
(Amt) homodimer in transcriptional regulation. Proceedings. National Academy
of Sciences. USA. 92: 1936-1940.
Sparrow, B. R., Thompson, C. S., Ryu, B. W., Selivonchick, D. P. and Schaup, H. W.
1994.
2,3,7,8-Tetrachlorodibenzo-p-dioxin induced alterations of pyruvate
carboxylase levels and lactate dehydrogenase isozyme shifts in C57BL/6J male
mice. Journal of Biochemical Toxicology. 9: 329-339.
162
Sparrow, B. R. 1997. Characterization of 2,3,7,8-tetrachlorodibenzo-p-dioxin (TCDD)
induced modification of hepatic pyruvate carboxylase gene expression in
C57BL/6J male mice. Thesis dissertation. Oregon State University, Corvallis,
OR.
Sparschu, G. L., Dunn, F. L., and Rome, V. K. 1971. Study of the teratogenicity of
2,3,7,8-tetrachlorodibenzo-p-dioxin in rat. Food and Cosmetic Toxicology. 9, 405412.
Spector, T. 1978. Refinement of the coomassie blue method of protein quantitation.
Analytical Biochemistry. 86: 142-146.
Stohs, S. J., Abbott, B. D., Lin, F. H., and Birnbaum, L. S.
1990.
Induction of
ethoxyresorufin-o-deethylase and inhibition of glucocorticoid receptor binding in
skin and liver of haired and hairless HRS/J mice by topically applied 2,3,7,8tetrachlorodibenzo-p-dioxin. Toxicology. 65: 123-136.
Sutter, T. R., Guzman, K., Do ld, K. M., and Greenlee, W. F. 1991. Targets for dioxin:
genes for plasminogen activator inhibitor-2 and interleukin-10. Science. 254: 415418.
Swanson, H. I., Chan, W. K., and Bradfield, C. A. 1995. DNA binding specificities and
pairing rules of the Ah receptor, ARNT and SIM proteins. Journal of Biological
Chemistry. 270(44):26292-26302.
Sweeney, M. H., Hornung, R. W., Wall, D. K., Fingerhut, M. A., and Halperin, W. E.
1992. Prevalence of diabetes and eleveted serum glucose levels in workers
exposed to 2,3,7,8-tetrachlorodibenzo-p-dioxin (TCDD), presented @ Dioxin
1992, Finland, August 24-28.
Takimoto, K., Lindahl, R., Dunn, T. J., and Pitot, H. C. 1994. Structure of the 5'
flanking region of class 3 aldehyde dehydrogenase in the rat. Archives of
Biochemistry and Biophysics. 312(2): 539-546.
Taylor, J. S. 1974. Chloracne-A continuing problem. Cutis. 13: 585-591.
Theobald, H. M., and Peterson, R. E. 1994. Developmental and reproductive toxicity of
dioxins and other Ah receptor agonists. In Dioxins and Health. ed. A. Schecter,
309-346. NY: Plenum Press.
Thompson, N. E., Steinberg, T. H., Aronson, D. B. and Burgess, R. R. 1989. Inhibition
of in vivo and in vitro transcription by monoclonal antibodies prepared against
wheat germ RNA polymerase II that react with the heptapeptide repeat of
eukaryotic RNA polymerase II. Journal of Biological Chemistry. 264:1151111520.
163
Thunberg, T. 1984. Effect of TCDD on Vitamin A and its relation to TCDD-toxicity. In
Biological Mechanisms of Dioxin Action. eds. A. Poland and R. D. Kimbrough,
333-344. Cold Springs Harbor. Banbury Report 18, NY: Cold Springs Harbor
Laboratory Press.
Tjian, R., and Maniatis, T. 1994. Transcriptional activation: a complex puzzle with few
easy pieces. Cell. 77(1): 5-8.
Toth, K., Somafai-Reele, S., Sugar, J., and Bence, J. 1979. Carcinogenicity of the
herbicide 2,4,5-trichlorophenoxyethanol containing dioxin and of pure dioxin in
Swiss mice. Nature. 278: 548-549.
Travers, A. 1993. DNA-Protein Interactions: Sequence specific recognition. In DNAProtein Interactions. ed. A. Travers 52-86, London: Chapman and Hall.
Travis, C. C., Hattemer-Frey, H. A., and Slibergeld, E. 1989. Dioxin, dioxin everywhere.
Environmental Science and Technology. 23: 1061-1063.
Tsujimura, T., Morii, E., Nozaki, M., Hashimoto, K., Moriyama, Y., Takebayashi, K.,
Kondo, T., Kanakura, Y. and Kitamura, Y. 1996. Involvement of transcription
factor encoded by the mi locus in the expression of c-kit receptor tyrosine kinase
in cultured mast cells of mice. Blood. 88(4): 1225-1233.
Tysklind, M., Fangmank, I., Mankund, S., Lindskog, L., Thaning, L., and Rappe, C. 1993.
Atmospheric transport and transformation of polychlorinated dibenzo-p-dioxins
and dibenzofurans. Environmental Science and Technology. 27:2190-2197.
Umbreit, T. H., Hesse, E. J., Macdonald, G. J., and Gallo, M. A. 1987. Effects of TCDDestradion interactions in three strains of mice. Toxicology Letters. 40: 1-9.
Van Miller, J. P., Lalich, J. J., and Allen, J. R. 1977. Increased incidence of neoplasms
in rats exposed to low levels of tetrachlorodibenzo-p-dioxin. Chemosphere. 6:
537-544.
Vasiliou, V., Puga, A., and Nebert, D. W. 1992. Negative regulation of the murine
cytosolic aldehyde dehydrogenase-3 (Aldh-3c) gene by functional CYP1A1 and
CYP1A2 proteins. Biochemical Biophysical Research Communications. 187: 413419.
Voet, D. and Voet, J. G. 1995. Other pathways of carbohydrate metabolism. In
Biochemistry. eds. D. Voet and J. G. Voet, 599-614. NY: John Wiley and Sons.
Voet, D. and Voet, J. G. 1995. Eukaryotic gene expression. In Biochemistry. eds. D. Voet
and J. G. Voet, 1154. NY: John Wiley and Sons.
164
Vos, J. G., and Beems, R. B. 1971. Dermal toxicity studies of technical polychlorinated
Toxicology and Applied
biphenyls and fractions thereof in rabbits.
Pharmacology. 19: 617-633.
Vos, J. G., Moore, J. A., and Zinkl, J. G. 1974. Toxicity of 2,3,7,8-tetrachlorodibenzo-pdioxin (TCDD) in C57BL/6 mice. Toxicology and Applied Pharmacology. 29:
229-241.
Vos, J. G., Kreftenberg, H. W. B., Engel, A., Minderhoud, A., and Van Noorle Tansen, L.
M. 1978. Syudies on 2,3,7,8-tetrachlorodibenzo-p-dioxin induced immune
suppression and decreased resistance to infection: Endotoxin hypersensitivity,
serum zinc concentration and effect of thymosin treatment. Toxicology. 9: 75-84.
Vos, J. G., Faith, R. E., and Luster, M. I. 1980. Immune alterations. In Halogenated
Biphenyls, Terphenyls, Napthalenes, Dibenzodioxins and Related Products. ed.
R. D. Kimbrough, 241-266. Amsterdam: Elsevier North Holland Medical Press.
Wang, X., Porter, W., Krishnan, V., Narashiman, T. R., and Safe, S. 1993. Mechanism of
2,3,7,8-tetrachlorodibenzo-p-dioxin (TCDD)-mediated decrease of the nuclear
estrogen receptor in MCF-7 human breast cancer cells. Molecular and Cellular
Endocrinology. 96: 156-166.
Wang, Q., Zambetti, G. P. and Suttle, D. P. 1997. Molecular and Cellular Biology. 17:
389-397.
Weber,
L. W. D., Lebofsky, M., Helmut, G., and Rozman, K. 1991. Key enzymes of
gluconeogenesis are dose dependantly reduced in 2,3,7,8-tetrachlorodibenzo-pdioxin (TCDD) treated rats. Archives of Toxicology. 65: 119-123.
Weber, L. W. D., Lebofsky, M., Stahl, B. U., Kettrup, A., and Rozman, K. 1992.
Comparative toxicity of four chlorinated dobenzo-p-dioxins (CDDs) and their
mixtures. Archives of Toxicology. 66: 478-483.
Webster, T., and Commoner, A. 1994. Overview: The dioxin debate. In Dioxins and
Health. ed. A. Schecter, 1-50. NY: Plenum Press.
Weis, L. and Reinberg, D. 1992. Transcription by RNA polymerase II: initiator-directed
formation of transcription-competent complex. FASEB. 6: 3300-3309.
Whitelaw, M. L., Gustafsson, J. -A., and Poellinger, L. 1994. Identification of
transactivation and repression functions of the dioxin receptor and its basic helixloop-helix/PAS partner factor Arnt: inducible versus constitutive modes of
regulation. Molecular and Cellular Biology. 14(12): 8343-8355.
165
Whitlock, J. P. 1993. Mechanistic aspects of dioxin action. Chemical Research in
Toxicology. 6: 754-762.
Wienberg, M. B. and Utter, M. F. 1979. Effect of thyroid hormone on the turnover of the
rat liver pyruvate carboxylase and pyruvate dehydrogenase. Journal of Biological
Chemistry. 254(19): 9492-9499.
Wimhurst J. M. and Manchester K. L. 1970. A comparison of the effects of diabetes
induced with either alloxan or streptozotocin and of starvation on the activities in
rat liver of the key enzymes of gluconeogenesis. Biochemical Journal. 120: 95103.
Wingender, E. 1993a. Ubiquitous DNA-binding transcription factors. In Gene Regulation
in Eukaryotes. ed. E. Wingender 75 -1.13. Germany: VCH.
Wingender, E. 1993b. Regulation of Cell Division and Differentiation by Helix-LoopHelix Proteins. In Gene Regulation in Eukaryotes. ed. E. Wingender 180-203.
Germany: VCH.
Wolfe, W., Michalek, J., Miner, L., Needham, L., and Patterson, D. 1992. Diabetes
versus dioxin body burdens in veterans of Operation Ranch hand, Presented @
Dioxin 1992, Tampere, Finland, August 211-228.
Wolfle, D., Schmutte, C. and Marquardt, H. 1993. Effects of 2,3,7,8-tetrachlorodibenzo-
p-dioxin on protein kinase C and inositol phosphate metabolism in primary
cultures of rat hepatocytes. Carcinogenesis. 14: 2283-2287.
Wu, L. and Whitlock, J. Jr. 1993. Mechanisms of dioxin action: receptor-enhancer
interactions in intact cells. Nucleic Acids Research. 21: 119-125.
Yaktine, A. L., Vaugn, R., Blackwood, D., Duysen, E. and Birt, D. F. 1998. Dietary
energy restriction in the SENCAR mouse: elevation of glucocorticoid hormone
levels but no change in distribution of glucocorticoid receptor in epidermal cells.
Molecular Carcinogenesis. 21(1): 62-69.
1998.
Yamada, T., Tsuchiya, T., Osada, S., Nishihara, T. and Imagawa, M.
CCAAT/Enhancer-binding protein 8 gene expression is mediated by
autoregulation through downstream binding sites. Biochemical and Biophysical
Research Communications. 242: 88-92.
Yamashita, F., and Hayashi, M. 1985.
Fetal PCB syndrome: Clinical features,
intrauterine growth retardation and possible alterations in calcium metabolism.
Environmental Health Perspectives. 59: 41-45.
166
Young A. L. 1988. The military use of herbicides in Vietnam. In Agent Orange and its
Associated Dioxin: Assessment of a Controversy. eds. A. L. Young and G. M.
Reggiani, 9-30. Amsterdam: Elsevier Science Publishers.
Zhang, J., Xia, W. L., and Ahmad, F. 1995. Regulation of pyruvate carboxylase in 3T3L1 cells. Biochemical Journal. 306: 205-210.
Zolman, J. F. 1993. Experimental design. In Biostatistics. Experimental design and
statistical
inference. ed. J. F. Zolman, 40-74. NY: Oxford University Press.
Zook, D. R., and Rappe, C. 1994. Environmental sources, distribution and fate of
polychlorinated dibenzodioxins, dibenzofurans and related organochlorines. In
Dioxins and Health. ed. A. Schecter, 79-114. NY: Plenum Press.