Cell, Vol. 55, 273-280, October 21, 1988, Copyright 0 1988 by Cell Press
Molecular Cloning and Expression of the
Human Interferon-y Receptor
Michel Aguet,’ Zlatko Dembib,f
and Gilles Merlin*
* Institute of Immunology and Virology
University of Zurich
F! 0. B. CH-8028 Zurich
Switzerland
tcentral Research Units
F. Hoffmann-La Roche
CH-4005 Base1
Switzerland
*Unite lnstitut National de la Sante
et de la Recherche Medicale
196, lnstitut Curie
75231 Paris
France
Summary
A cDNA encoding the human interferon-y receptor
was isolated from a kg111 expression library using a
poiyclonal antireceptor antiserum. The gene for this
receptor was identified in a cosmid library and transfected lnto mouse ceils. The human interferon-y
receptor expressed in mouse cells displayed the same
binding properties as in human cells. However, transfected ceils were not sensitive to human IFN?, sug
gesting the need for species-specific
cofactors in
receptor function. As inferred from the cDNA sequence, the human interferon7
receptor shows no
similarities to known proteins and represents a novel
transmembrane receptor. It is most likely the product
of a single mRNA and a gene located on chromosome
6%
Introduction
lnterferons (IFNs) were discovered on the basis of their
antiviral activity, but they exert additional biological effects, including inhibition of cell growth and modulation of
certain immune reactions (Lengyel, 1982). Two families of
IFNs can be distinguished: IFNs-a/8 are produced in the
course of viral infections and play a crucial role in antiviral
defense (Stewart, 1979) IFN-y is produced by activated
T-cells, and although its physiological significance remains unclear, it probably plays an important role as a
macrophage activating factor and also in regulating antigen presentation (Janeway et al., 1984; Unanue, 1984;
Rosa and Fellous, 1984; Trinchieri and Perussia, 1985).
While a variety of biological effects are common to both
IFN classes, some effects are class-specific. Likewise, an
overlapping set of proteins is induced by both IFN classes
(Revel and Chebath, 1986) suggesting that common signalling pathways may be utilized (Kusari and Sen, 1986).
At the receptor level it is clear that IFNs al8 cross-react
with presumably common receptors (Aguet and Mogensen, 1984; Zoon and Arnheiter, 1984), while IFNr initiates
its biological effects through its own specific receptor system (Branca and Baglioni, 1981; Orchanski et al., 1984;
Merlin et al., 1985). The structure and function of IFN
receptors is poorly elucidated. Cross-linked complexes
between IFN-1 and its receptor with an M, ranging from
70,000 to 160,000 have been described (Sarkar and
Gupta, 1984; Littman et al., 1985; Celada et al., 1985;
Rashidbaigi et al., 1986; Uecer et al., 1986; Novick et al.,
1987). Despite this apparent heterogeneity, most binding
studies revealed only one class of 1FN-y binding sites with
a dissociation constant of about 10-l’ to lo-lo M (Sarkar
and Gupta, 1984; Littman et al., 1985; Celada et al., 1985;
Uecer et al., 1986; Novick et al., 1987). Different binding
and functional properties of IFNr receptors have been
described on macrophages (Orchansky et al., 1986;
Yoshida et al., 1988). In general, 1FN-y receptors seem to
be expressed to a lesser extent on normal cells (up to lo3
sites per cell) than on tumor cells. Thus, some human colon carcinoma and also B-cell lines were reported to express on the order of lo” binding sites per cell (Uecer et
al., 1986; Aguet and Merlin, 1987).
To elucidate their structure, we purified human IFN-y
receptors from human Raji cells by sequential affinity
chromatography on immobilized monoclonal antireceptor
antibodies and recombinant human IFNr (Aguet and
Merlin, 1987). Two major protein species of apparent M,
of 90,000 (p90) and 50,000 (~50) were highly enriched and
shown to bind human IFN-y specifically. Modification of
the conditions of receptor solubilization as well as proteolytic digestion experiments confirmed our previous statement that ~50 is most likely a proteoiytic degradation product of p90 (Mao et al., submitted).
Here, we present the isolation of a cDNA for the human
IFN-1 receptor and expression of the human IFNq receptor gene transfected into mouse cells. The molecular characterization of this receptor opens new possibilities for investigating the mode of action of lFN--r and should
facilitate the access to other elements involved in the putative signal transduction cascade. In addition, it will allow
the search or design of agonists and antagonists of IFN-?I
with a view toward influencing the course of some immunological disorders and inflammatory diseases.
Results and Discussion
Cloning of IFN-Y Receptor cDNA
The cloning strategy was based on the detection of
receptor-specific determinants on f3-galactosidase fusion
proteins expressed in a Xgtll cDNA library constructed
with oligo(dT) primed poly(A)+ mRNA from Raji cells. In a
first attempt, radioactively labeled lFN--r or monoclonal
antireceptor antibodies were used to screen the library under the same conditions as for revealing natural receptor
protein transferred to nitroceilulose (Aguet and Merlin,
1987) but no receptor-specific clones were isolated. To increase the chances of recognizing receptor-specific determinants, a polyclonal rabbit antireceptor antiserum was
abcdef
clones with no cross-reactivity at all (lane f). While the restriction enzyme maps were superimposable or overlapping in all nine immunologically cross-reactive clones, the
latter three clones displayed unrelated maps. Likewise,
DNA cross-hybridization was only observed for the nine
cross-reactive, but not for the three obviously unrelated
clones, which therefore were regarded as false positives
and not characterized further.
P90
P50
Figure 1. lmmunoreactivity of F’olyclonal Antireceptor
Natural Human IFN-y Receptor Protein
Antibodies
with
Purified natural receptor protein was subjected to SDS-PAGE, transferred to nitrocellulose as described previously (Aguet and Merlin,
1987) and revealed by incubation with the polyclonal antireceptor
antiserum and peroxidase conjugated protein A. Lanes a, and b: Immunoreactivity with receptor proteins p90 and ~50 of rabbit preimmune serum and rabbit antiserum respectively.
Lanes c-f: Immunoreactivity
with p90 and ~50 of various antiserum fractions
adsorbed and eluted from clone-specific Igtll proteins. Lane c: Eluate
from a nonreactive control clone; lane d: Eluate from immunoreactive
clone 2; lane e: Eluate from immunoreactive clone 16; lane f: Eluate
from immunoreactive clone 18.
used for screening. This antiserum was raised against
highly enriched receptor protein from human Raji cells
that had been affinity-purified as previously described
(Aguet and Merlin, 1987). As shown in Figure 1 (lanes a
and b), this antiserum, but not the preimmune serum, recognized both major receptor protein species p90 and ~50.
Among 2 x lo6 hgtll clones of an unamplified library,
the polyclonal antiserum revealed 12 immunoreactive
clones. To verify the specificity of these clones, the antiserum was adsorbed to the various clone-specific proteins
immobilized on nitrocellulose. Subsequently, the bound
antibody fraction was eluted at low pH and assayed for immunoreactivity with the natural receptor protein as shown
in Figure 1, lanes c-f. Interestingly, three types of immunoreactive hgtll clones could be distinguished by the
properties of the eluted antibodies, namely eight clones
with fusion proteins cross-reactive with determinants of
both natural receptor proteins (lane e), one clone with a
cross-reactivity restricted to p90 (lane d), and also three
cDNA Characterization
and Sequence
The sizes of the DNA inserts of the nine specific human
IFN-)I receptor cDNA clones were analyzed by EcoRl
digestion and gel electrophoresis. Clone 16 had the longest (2.1 kb) and clone 2 the shortest (1.2 kb) insert. All
clones except clone 2 had additional EcoRl sites in their
inserts. The insert of clone 16 is subdivided by EcoRl into
three fragments of distinct size (probes a, b, c in Figure
2A). Among the other clones, only the c fragments varied
in size, suggesting that they might originate from the 5’
end of the cDNAs. The insert of clone 2 hybridized only
to probe a. EcoRI-digested cDNA fragments coding for the
human IFN-y receptor were subcloned into Ml3 mp18 or
mp19 vectors and the nucleotide sequence was determined by the chain termination method (Sanger et al.,
1977). Both strands of the entire cDNA clones 2 and 16,
as well as parts of three additional cones, were sequenced with superimposable results. To rule out the existence of proximal sites, the sequences adjacent to internal
EcoRl Sites were verified by hybridization with overlapping synthetic 17-mers. To search for a possible heterogeneity and clones extending further upstream, the cDNA
probes 16a, b, c (Figure 2A) were used for screening a
hgtl0 and a ZAP cDNA library prepared from Raji and
Colo 205 cell poly(A)+ mRNA by the same procedure as
the hgtll library. All the selected clones displayed restriction enzyme maps indistinguishable from those of the already described clones. Several clones posessed inserts
of similar length to clone 16, but none of these inserts was
longer.
The 2101 base cDNA nucleotide sequence of clone 16
and the deduced amino acid sequence showed an open
reading frame of 1515 bases that spans the EcoRl fragments c, b, and part of a (Figures 2A and 28). The 3’ untranslated region (UT) extends for an additional 548 bases
and ends with a poly(A) tail that is preceded 14 bp upstream by a single polyadenylation signal (AATAAA). The
first initiation codon (ATG) is located 49 bp downstream of
the beginning of clone 16. To localize transcription initiation, Sl nuclease protection experiments were carried out
using genomic probes (see below) extending over 638
nucleotides upstream of clone 16. Hybridization to mRNAs
of both Raji and Colo 205 cells resulted in consistently superimposable patterns with at least five major transcription start sites located between 32 bp and 77 bp upstream
of the first ATG in clone 16 (unpublished data). The reading frame ends 75 bp upstream of this first ATG, which
most likely represents the translation start site, since it is
embedded in a consensus sequence typical of translation
initiation in vertebrates (Kozak, 1987). Moreover, it is followed by a sequence that could encode a hydrophobic
C
b
a
t
.
#16
*
#2
Amino
acids
1486
1
letAlaLeuLeuPheLeuLeuProLeuValMetGlnGlvV.SerArgAla
GAATTCCGCAGGCGCTCGGGGTTGGAGCCAGCGACCGTCGGTAGCAGCATGGCTCTCCTCTTTCTCCTACCCCTTGTCATGCAGGGTGTGAGCAGGGCT
20 .
40 .
GluMetGlyThrAlaAspLeuGlyProSerSerValProThrProThr
IleGluSerTyrAsnMetAsnProIleValTyrTrpGluTyr
Fi.i&am'
GAGATGGGCACCGCGGATCTGGGGCCGTCCTCAGTGCCTACACCAACTAATGTTACAATTGAATCCTATAACATGAACCCTATCGTATATTGGGAGTAC
60 .
80 .
GlnIleMetProGlnValProValPheThrValGluValLysAsnTyrGlyValLysAsnSerGluTrpIleAspAlaCysIle~~~~~.~.~~~HisHis
CAGATCATGCCACAGGTCCCTGTTTTTACCGTAGAGGTAAAGACTATGGTGTTAAGAATTCAGAATGGATTGGATTGATGCCTGCATC~TATTTCTCATCAT
100 .
AspHisValGlyAspProSerAsnSerLeuTrpValArgValLysAlaArgValGlyGlnLysGluSerAlaTyrAlaLysSer
Ty;Cys&
TATTGTAATATTTCTGATCATGTTGGTGATCCATCAAATTCTCTTTGGGTCAGAGTTAAAGCCAGGGTTGGACAAAAAGAATCTGCCTATGCAAAGTCA
140 .
120 .
GluGluPheAlaValCysArgAspGlyLysIleGlyProProLysLe~spIleArgLysGluGluLysGlnIleMetIleAspIlePheHisProSer
GAAGAATTTGCTGTATGCCGAGATGGATTGGACCACCTAAACTGGATATCAGAAAGGAGGAGAAGCAAATCATGATTGACATATTTCACCCTTCA
160 .
180 .
ValPheValAsnGlyAspGluG1nGluValAspTyrAspProGluThrThrCysTyrIleArgValTyrAsnValTyrValArgMet~Glu
GTTTTTGTAAATGGAGACGAGCAGGAAGTCGATTATGATCCCGAAACTACCTGTTACATTAGGGTGTACAATGTGTGTATGTGAG~TG~CGG~GTGAG
200 .
IleGlnTyrLysIleLeuThrGlnLysGluAspAspCysAspGluIleGlnCysGlnLe~laIleProValSerSerLeuAsnSerGlnTyrCysVal
ATCCAGTATAAAATACTCACGCAGAAGGAAGATGATGATTGTGACGAGATTCAGTGCCAGTTAGCGATTCCAGTATCCTCACTGAATTCTCAGTACTGTGTT
240 .
220 .
SerAlaGluGlyValLeuHisValTrpGlyValThrThrGluLysSerLysGluValCysIleThrIlePhe~IleLy~Gly~
TCAGCAGAAGGAGTCTTACATGTGTGGGGTGTTACAACTGAAllAGTCAAAAGAAGTTTGTTTGTATTACCATTTTCAATAGCAGTATAGGTTCTCTTTGG
260 .
280 .
~CysPheTyrIleLysLysIleAsnProLeuLysGluLysSerIle
ATTCCAGTTGTTGCTGCTTTACTACTCTTTCTAGTGCTTAGCCTGGTATTCATCTGTTTTTATATTAAGAAAATTAATCCATTGAAGG~GCATA
300 .
IleLeuProLysSerLeuIleSerValValArgSerAlaThrLeuGluThrLysProGluSerLysTyrValSerLeuIleThrSerTyrGlnProPhe
ATATTACCCAAGTCCTTGATCTCTGTGGTAAGAAGTGCTACTTTAGAGACAAAACCTGAATCAAAATATGTATCACTCATCACGTCATACCAGCCATTT
340 .
320 .
SerLeuGluLysGluValValCysGluGluProLeuSerProAlaThrValProGlyMetHisThrGluAspAsnProGlyLysValGluHisThrGlu
TCCTTAGAAAAGGAGGTGGTCTGTGAAGAGCCGTTGTCTCCAGCAACAGTTCCAGGCATGCATACCGAAGACAATCCAGGAAAAGTGGAACATACAGAA
360 .
380
GluLeuSerSerIleThrGluValValThrThrGluGluAsnIleProAspValValProGlySerHisLeuThrProIleGl~rgG~uSerSerSer
GAACTTTCTAGTATAACAGAGTGGTGACTACTGAAGAAAATATTCCTGACGTGGTCCCGGGCAGCCATCTGACTCCAATAGAGAGAGAGAGTTCTTCA
400 .
ProLeuSerSer '-'
GluProGlySerIleAlaLeuAsnSerTyrHisSerArg~GluSerAspHisSerArgAsnGlyPheAsp
CCTTTAAGTAGTAACCAGTCTGAACCTGGCAGCATCGCTTTAAACTCGTATCGTATCACTCCAGRAATTGTTCTGAGAGTGATCACTCCAGAAATGGTTTTGAT
420 .
440 .
ThrAspSerSerCysLeuGluSerHisSerSerLeuSerAspSerGluPheProProAs~snLysGlyGluIleLysThrGluGlyGlnGluLeuIle
ACTGATTCCAGCTGTCTGGATCACATAGCTCCTTATCTGACTCAG~TTTCCCCC~T~T~GGTG~T~~CAG~GGAC~GAGCTCATA
460 .
ThrValIleLysAlaProThrSerPheGlyTyrAspLysProHisValLeuValAspLeuLeuValAspAspSerGlyLysGluSerLeuIleGlyTyr
ACCGTAATAAAAGCCCCCACCTCCTTTGGTTATGATAAACCACACATGTGCTAGTGGATCTACTTGTGGATGATAGCGGTAAAGAGTCCTTGATTGGTTAT
480 .
.
469
.
ArgProThrGluAspSerLysGluPheSerEnd
AGACCAACAGAAGATTCCAAAGAATTTTCATGAGATCAGCTAAGTTGCACCAACTTTGAAGTCTGATTTTCCTGGACAGTTTTCTGCTTTAATTTCATG
1585
AARAGATTATGATCTCAGAAATTGTATCTTAGTTGGTATCAACCAAATGGAGTGACTTAGTGTACATGAAAGCGTAAAGAGGATGTGTGGCATTTTCAC
1684
TTTTGGCTTGTAAAGTACAGACTTTTTTTTTTTTTTAAAC AAARAAAG~ATTGTAACTTATG~CCTTTACATCCAGATAGGTTACCAGTAACGGAACA
1783
TATCCAGTACTCCTGGTTCCTAGGTGAGCAGGTGATGCCCCAGGGACCTTTGTAGCCACTTCACTTTTTTTCTTTTCTCTGCCTTGG~ATAGCATATGT
1882
GTTTTGTAAGTTTATGCATACAGTAATTTTT~GT~TTTCAGAAGAAATTCTCGAAGCTTTTCAAAATTGGACTTAAAATCTAATTCAAACTAATAGAA
1981
TTAATGGAATATGTAAATAGAAACGTGTATATTTTTTATGAAACATTACAGTTAGAGATTTTT AAATAA;LGMTTTTAAAAcTC~
2080
ARAAAARAARAAAAAGGAATTc
B
1
100
199
298
397
496
595
694
793
692
991
1090
1169
1288
1367
Figure 2. Human IFN-r Receptor cDNA
(A) Schematic representation and restriction map of human IFN-y receptor cDNA. The coding region is shown as a box. The black boxes indicate
the location of the putative signal peptide and the transmembrane regions. 2, 16a, b, c respectively: probes used for hybridization.
(6) Human IFN-7 cDNA nucleotide and predicted amino acid sequences. Hydrophobic putative leader and transmembrane regions are underlined.
Sites of potential asparagine-linked glycosylation are underlined with a dotted line. The poly(A)+ adenylation signal (AATAAA box) is underlined.
Nucleotide sequence analysis was carried out with cDNA inserts subcloned into Ml3 mp18 or mp19 vectors according to the chain elongation sequencing procedure (Sanger et al., 1977) using commercial and synthetic primers. This sequence has been deposited in the EMBUGenBank data
base (accession no. J03143).
(C) Hydropathy plot of the predicted human IFN-1 receptor amino acid sequence according to the method of Kyte and Doolittle (1982). Positive values
indicate increasing hydrophobicity.
At-@ Nd
cos
cos GIFR-10
6
a
b
c
2.3 kb
Figure 3. Transfection
of Mouse L1210 Cells
(A) Vector GIFR-10 used for transfecting the human IFN-Y receptor
gene into mouse L1210 cells. The gene segment indicated by a dotted
line is derived from the cosmid clone TCFP-2.8, while the other segment stems from cosmid clone TCFP-7.13 (During ligation of the two
cosmid clones, the Xhol site was not regenerated as indicated by the
brackets). The vector is shown as a double line. The neomycine resistance gene is the aminoglycosyl3’-phosphotransferase
gene from Tn5. Only relevant restriction sites used for constructing the hybrid cosmid clone are shown.
(6) Northern blot analysis of mRNA from untransfected Ll210 cells
(lane a) as compared with mRNA from transfected L1210 cells (lane b)
and Raji cells (lane c). Total and poly(A)+ mRNA were prepared according to standard protocols (Maniatis et al., 1982; Auffray and Rougeon, 1980).
signal peptide with a predicted cleavage site after amino
acid residue 17 (Figure 2C; Von Heijne, 1983). This cDNA
could encode a protein of 489 amino acids. In addition to
the putative N-terminal signal peptide, hydropathy index
computation of the translated sequence reveals a hydrophobic domain in the middle of the molecule (Figure 2C,
amino acids 246-288) compatible with a transmembrane
anchoring portion. Thus, this cDNA most likely contains
the complete coding region for the human IFNr receptor,
and the discrepancy between the cDNA length of 2.1 kb
and the mRNA length of 2.3 kb (see below, Figure 3) could
be due to the poly(A) tail as well as to an incomplete 5’UT
region. Computer-assisted searches in a sequence data
bank (GenBank, lntelligenetics Inc., Mountain View, CA)
did not reveal any significant similarity to known proteins.
The difference between the cDNA sequence of clone 2
(whose clone-specific antibodies recognize only the natural receptor protein p90, but not ~5.0) and the clones crossreactive with both p90 and ~50 resides only in the length
of the region coding for the N-terminal part of the receptor
(Figure 2A). Since both p90 and ~50 carry the binding site
for human IFNr it is reasonable to assume that clone 2
encodes a cytoplasmic part of the receptor missing in ~50,
which is most likely a proteolytic degradation product of
p90 (Mao et al., submitted). Altogether, these findings
strongly suggest an extracellular orientation of the N-terminal portion of the receptor chain. The putative extracellular domain contains five potential N-linked glycosylation
sites, while two are found on the putative cytoplasmic part.
Strikingly, 12% of all amino acids are serines, and several serine- and threonine-rich regions are indicative of
O-linked glycosylation (Nikaido et al., 1984, Russell et al.,
1984). Thus, glycosylation could well account for the discrepancy between the apparent M, of about 90,000 for
the purified natural receptor protein and the M, of about
54,000 predicted from the cDNA deduced amino acid sequence.
In conclusion, the deduced amino acid sequence of the
human IFNr receptor, although representative of a novel
protein with no resemblance to known proteins, reveals
structural features typical of cell surface receptors: it
starts with a signal peptide and contains a potential transmembrane domain in the middle of the molecule. The
N-terminal, most likely the extracellular domain (residues
l-245), should carry the ligand binding site(s), and the
rather large intracellular portion (residues 267-489) could
be involved in signal transduction.
In Raji cells, Colo 205 cells (a human colon carcinoma
line), human peripheral monocytes, U937 cells (a human
monocytic cell line), human peripheral blood lymphocytes, and human placental cells, the cDNA probes 16a,
b, c detected one single 2.3 kb transcript. Southern blot
analysis of genomic DNA suggests that this transcript is
most likely the product of a single gene (unpublished
data).
Chromosomal Location of the Human IFN-y
Receptor Gene
We confirmed the location of the cloned human IFN-y
receptor gene on chromosome 6q (Rashidbaigi et al.,
Cloning of the Human Interferon-r
277
Receptor
1986; Pfizenmaier et al., 1988) by Southern blot analysis
of the DNA isolated from 30 mouse-human cell hybrids.
Eleven hybrids carrying human chromsome 6 or its translocated long arm contained a 7.4 kb human-specific EcoRl
fragment that hybridized to the cDNA of clone 2 (Figure
2A). No cross-hybridizing fragments could be detected in
all but one of the residual hybrids. Five of those contained
only the short arm (p) of chromosome 6. Surprisingly, one
hybrid characterized as lacking human chromosome 6
contained the 7.4 kb EcoRl fragment. Since every other
human chromosome could be ruled out with at least eight
discordant hybrids, this seemingly chromosome 6-negative hybrid probably still contained parts of chromosome
6q, possibly due to an undetected translocational event.
Transfection and Expression of the Human IFN-)I
Receptor Gene
The approach for proving that the isolated cDNA indeed
codes for the human IFNr receptor was to isolate its gene
and to express it in cells that lack human IFN-T receptors.
Responsiveness to IFN? is common to many cells and tissues (Skoskiewicz et al., 1985), indicating that IFN-y
receptors are probably ubiquitous. Therefore, mouse cells
that are insensitive to human IFNr and do not bind human IFN-Y specifically were chosen for transfection experiments. Mouse B-cell leukemia L1210 cells were found
to be particularly suitable, since they displayed a very low
nonspecific binding of labeled human 1FN-y. The gene for
the human IFNr receptor was isolated from a human
genomic cosmid library (Figure 3A). Out of 8 x 105 cosmid clones, two were detected (cosTCFP-2.8 and 7.13)
using human IFNr receptor cDNA as a probe. Further
analysis of the cosmid clones showed that both had overlapping inserts of 35 kb. Although the overlapping region
comprised most of the exons, neither of the clones contained the whole gene (unpublished data). For transfections, a hybrid cosmid clone GIFR-10 was constructed that
contained the whole receptor gene together with the
G-418 resistance gene under the SV40 promoter (Figure
3A). GIFR-10 DNA was transfected into mouse L1210 cells
by electroporation. Cell clones resistant to G-418 appeared
after 3-5 weeks and were screened for specific binding of
i251-labeled human IFN-y. Roughly 30% of the resistant
clones expressed high affinity receptors for human IFNr,
although to a variable extent (at most 30% to 50% of the
expression in Raji cells). Some clones were further analyzed with regard to both the size of their transcripts and
the affinity of human IFNr binding. As exemplified for one
of these clones in Figure 38, mRNA specific for the human
IFNr receptor had the same size transcripts as in Raji cells
(the larger specific mRNA observed only in these transfectants was not characterized further and could be due to
aberrant processing). The dissociation constant determined by Scatchard analysis of saturation curves (Figure
4A) was the same as on Raji cells (5 x 10-l’ M) and within
the same order of magnitude as reported for a variety of human cells (Sarkar and Gupta, 1984; Littman et al., 1985;
Celada et al., 1985; Uecer et al., 1988; Novick et al., 1987).
Receptor protein from one transfectant was purified, subjected to SDS-PAGE, and transferred to nitrocellulose as
Table 1. MHC class I Antigen Expression on Mouse L 1210 Cells
Transfected with the Gene for the Human IFN-y Receptor
Untreated
Treated with
mouse IFN-T
untranfected
L1210 cells
14330 f 430
17420 +- 540
14200 2 390
1 B-7
14320 f 450
18190 + 430
14120 f 50
1110-4
15490 * 670
19470 + 510
15540 * 520
2/10-14
15390 f 390
18380 + 1040
15660 f
Transfectants
Treated with
human IFN-7
130
Untransfected mouse L 1210 cells and cells of three different transfected clones were preincubated for 24 hr under culture conditions
with 3 x lo-r0 M mouse or human IFN-y, or left untreated. Subsequently, the cells were incubated with a monoclonal antibody 34-l-2
hybridoma supernatant specific for MHC KdDd antigens that was
kindly provided by Dr. H. Hengartner, Instituteof Pathology, University
of Zurich. The binding of the monoclonal antibodies was revealed by
1z51-labeled protein A, and the results are indicated as cpm bound per
IO6 cells. Nonspecific binding of labeled protein A in the absence of
the specific monoclonal antibody was always below 500 cpm (not
shown).
described previously (Aguet and Merlin, 1987). Instead of
p90 and p50 purified from Raji cells, two slightly larger major proteins with M, of about 95,000 and 55,000 respectively, were specifically revealed by labeled human IFN-Y.
This difference from Raji cells could be due to variant
glycosylation also observed in human cell lines (Mao et al.,
submitted). To reveal in these mouse transfectants a possible interaction of the human and the murine IFNr receptor,
binding of both labeled human and mouse IFNr was
tested in the presence of unlabeled human and mouse IFNy or a monoclonal antihuman IFNr receptor antibody (AS;
Aguet and Merlin, 1987). As shown in Figure 48, no crossreactivity between human and mouse ligands was observed. Thus, the single transmembrane receptor chain
seems sufficient for high affinity ligand binding, but the
question of whether additional elements not necessarily involved in ligand binding are associated with this IFN-Y binding chain still remains open.
As a marker for biological responsiveness to human
IFN-Y, the enhancement by both mouse and human IFN-Y
of murine MHC class I antigens was compared in parental
and transfected cells (Table 1; for review, see Rosa and
Fellous, 1984). Mouse L1210 cells and also all the transfected clones thereof constitutively expressed MHC class
I antigens to a high degree, and this expression was only
slightly, but reproducibly, increased upon incubation with
mouse IFN-1. However, none of the transfectants tested
displayed an increased expression of MHC class I antigens
upon incubation with human IFNr. Likewise, 2’-5’-oligo(A)
synthetase, which can be induced by mouse IFN-T in both
parental (Fassio et al., 1986) and transfectant L1210 cells,
could not be induced by human lFN+y (data not shown).
Interestingly, in mouse-human somatic cell hybrids, human IFNr mediated enhancement of MHC class I antigen
expression was only observed when human chromosome
21 was present in addition to chromosome 6 (Jung et al.,
1987), suggesting a requirement of additional elements
A
B
150
9
60
i
&
60
ET- 40
gj
naling pathways (Sibley et al., 1987). It is not surprising
that the variety of highly specific ligand receptor interactions is paralleled by a similar degree of specificity for
other elements of the signaling cascade. In view of the
overlapping pattern of biological effects, a certain relationship of postreceptor events could be expected between
IFNr and IFNs-a/8. Besides, it is hard to speculate on the
receptor family to which the IFN-y receptor could belong.
An interesting recent observation suggests that a biological response to IFN-?I can be elicited even across the species barrier when the IFN? receptor is bypassed by expression in mouse cells of a human IFNr cDNA devoid
of a signal peptide sequence. Thus, intracellular accumulation of human IFNn, in mouse cells results in a typical
induction of various 1FN-y response markers (San&au et
al., 1987). Whether the IFN-y receptor is the first element
of a signal transducing system or whether it functions as
a vehicle for transporting its ligand to intracellular receptors is a question that should be more readily answered
now that the primary structure of the human IFN--,+receptor has been elucidated.
Experimental Procedures
20
Pmductlon and Characterixatlon of a Polyclonal Rabbit
Antihuman 1FN-y Receptor Antiserum
0
abed
abed
Figure 4. Expression of the Human IFN-r Gene in Mouse L1210 Cells
(A) Saturation curve with 1251-labeled human IFN? on human Raji (0)
cells and on transfected mouse Ll210 cells (m) expressing the human
IFN? receptor. Raji cells and L1210 transfectants were incubated for
90 min at 4OC at various concentrations of labeled human IFN-1 as described elsewhere (Aguet, 1966). Nonspecific binding was determined
by simultaneous addition to labeled IFN-y of 30 nM unlabeled human
IFN-I. The specific binding (cpm per IO6 cells) is depicted as the
difference between total and nonspecific binding. Insert, Scatchard
plot of the same data.
(B) Binding of 1251-labeled mouse (A) or human (B) IFN-y to transfected mouse L1210 cells in the presence of control medium (a), or 30
nM unlabeled mouse(b), or human (c) IFN-y, or monoclonal antireceptor antibody supernatant A6 (d; Aguet and Merlin, 1967). The total binding at saturating concentrations of labeled IFN-y is indicated as 100%
binding.
for generating a biological response. Like the ligand with
its low cross-species binding activity, some of these seem
to be species-species. Although analysis of additional
markers of the response to IFNr and transfection of a variety of recipient cells are required to assess the functional
properties of human IFNr receptors expressed in mouse
cells, our preliminary findings also suggest that the expression of the human IFN-y receptor gene in heterologous cells is probably not sufficient to elicit a biological response to human IFN?. Nonetheless, this could well
facilitate the identification of additional elements required
for generating the various biological effects of IFN-y.
The mechanisms of signal transduction of the IFNy
receptor are not known, and the deduced sequence of the
cytoplasmic portion gives no hints to known receptor sig-
Human IFN-+r receptor protein from Raji cells was purified as described
previously (Aguet and Merlin, 1967). One rabbit was immunized by four
intramuscular injections of l-2 ug of purified receptor protein in complete or incomplete Freund’s adjuvant at intervals of 3 weeks, and bled
2 weeks after the last injection. The serum was exhaustively adsorbed
on sonicated E. coli Y1090 extracts coupled to Affigel-lO(BioRad). The
immunoreactivity of this antiserum was assayed as follows: purified
receptor protein was subjected to SDS-PAGE and electrophoretically
transferred to nitrocellulose as reported (Aguet and Merlin, 1967). Skim
milk-saturated nitrocellulose strips corresponding to the SDS-PAGE
lanes were incubated for 90 min at room termperature with the antiserum diluted l/400 in RPMI-1640 medium (Gibco) containing 10% FCS
(Gibco) and 10 m M HEPES buffer (pH 7.2). Subsequently the strips
were washed twice for 10 min in the same medium and incubated for
another 96 min with peroxidase conjugated protein A (Sigma), adjusted to 1 MS/ml in PBS (pH 7.2) containing 1% w/v dry skim milk. After
three washes of 10 min each, freshly prepared substrate solution (0.3
mg/ml chlornaphthol (Sigma), 10% methanol, 0.01% H& (Fluka) in
PBS) was added and incubated until the color reaction was readily visible (usually after about 20 min at room temperature). This was stopped
by replacing the substrate solution with Hz0
Construction and Screening of a kgtll cDNA Llbrary
cDNA sythesis and cloning into QtlO, kgtll, or UAP (Stratagene) were
carried out with oligo(dT) primed Raji ceil poly(A)+ mRNA according
to standard protocols (Huynh et al., 1965; Watson and Jackson, 1965)
using the Amersham cDNA synthesis kit. For screening the )igtll
cDNA library, fusion protein was induced and transferred to nitrocellulose membranes (Schleicher 8 Schuell, BA 65) according to standard
methods (Huynh et al., 1965). The membranes were reacted with the
antiserum as described above. lmmunoreactive clones were purified,
seeded to yield almost confluent plaques (about lo5 plaques per 140
m m plate), and transferred to nitrocellulose membranes. After incubation with the polyclonal antiserum, these membranes were washed
three times for 10 min each with PBS, and the bound antibody fraction
was eluted with 5 ml per membrane of 0.2 M glycine/HCl (pH 2.2), containing 0.1% w/v ovalbumine (Fluka). Subsequently, the eluted immunoglobulins were precipitated with 50% saturated (NH&SO.,, centrifuged for 20 min at 25,009 x g, redissolved in 1110 volume, dialyzed
against PBS, and assayed for immunoreactivity
with natural IFNq
receptor proteins as described above (Figure 1, lanes c-f).
Cloning of the Human Interferon-y
279
Receptor
Hybridization
Techniques
Southern and Northern blot hybridizations were carried out according
to standard techniques described elsewhere (Maniatis et al., 1982;
Snodgrass et al., 1985) using cDNA probes labeled by the random oligonucleotide primer labeling method.
Construction
of a Cosmid Containing the Entire Gene
for the Human IFN-1 Receptor
The TCFP-1 human cosmid library was prepared according to standard
techniques (Grosveld et al., 1982; Steinmetz et al., 1985) using sizeselected genomic DNA of the Epstein-Barr virus, transformed B-cell
line P-l, and the pTCF vector. Two clones (cosTCFP-2.8 and 7.13) were
selected using human IFN-y receptor cDNA as a probe. By ligation of
a 31 kb Sall-Xhol fragment from cosTCFP-7.13 to a 7.4 kb Sall-Xhol
fragment from cosTCFP-2.8, a cosmid GIFR-10 that contained the entire gene for the human IFN-y receptor (Figure 3) was constructed.
Transfection of Mouse Cells with the Gene
for the Human IFN-y Receptor
5 x 10s exponentially growing mouse L1210 cells were washed once
with cold PBS, resuspended in 0.5 ml of PBS, and incubated for 20 min
on ice with 10 fig of cosmid GIFR-10 DNA linearized with Pvul. Electroporation was carried out in a BioAad electroporator at 980 uF and
250-350 V. Transfectants were selected in culture medium (RPMI1640, 10% FCS) containing 1 mglml of G-418 (Gibco).
Labeling with jz51
Human recombinant IFN-y was labeled with rz51 as reported previously (Aguet and Merlin, 1987). Recombinant mouse IFN-y, kindly
provided by Dr. G. Adolf (Boehringer Ingelheim), and protein A (Pharmacia) was labeled to about 40 FCi/ng protein of lz51 under the same
conditions as human IFN-y.
Celada, A. R., Allen, I., Esparza, I., Gray, P W., and Schreiber, R. D.
(1985). Demonstration and partial characterization of the interferon-y
rsCeptOr on human mononuclear phagocytes. J. Clin. Invest. 76,21962205.
Fassio, A., Gariglio, M., Cofano, F., Cavallo, G., and Landolfo, S. (1988).
Functional characterization of murine cell lines expressing high, intermediate, or negative levels of surface receptors for interferon-y. J. Interferon Res. 8, 333-341.
Grosveld. F. G., Lund, T., Murray, E. J., Mellor, A. L., Dahl, H. H. M..
and Flavell, R. A. (1982). The construction of cosmid libraries which
can be used to transform eukaryotic cells. Nucl. Acids Res. 27, 671%
6732.
Huynh, T V., Young, R. A., and Davis, R. W. (1985). Constructing and
screening cDNA libraries in ygtl0 and ygtll. In DNA Cloning, Volume
I, D. Glover, ed. (Oxford: IRL Press), pp. 49-78.
Janeway, C. A., Bottomly, K., Babich, J., Conrad, f?, Conzen, S., Jones,
B., Kaye, J.. Katz, M., McVay, L., Murphy, D. B., and Tite, J. (1984).
Quantitative variation in la antigen expression plays a central role in
immune regulation. Immunol. Today 5, 99-105.
Jung, V., Rashidbaigi, A., Jones, C., Tischfeld, J. A., Sows, T. B., and
Pestka, S. (1987). Human chromosomes 6 and 21 are required for sensitivity to human interferon y. Proc. Natl. Acad. Sci. USA 84,4151-4155.
Kozak, M. (1987). An analysis of S-noncoding sequences from 699 vertebrate messenger RNAs. Nucl. Acids Res. 75, 8125-8148.
Kusari, J., and Sen, G. C. (1986). Regulation of synthesis and turnover
of an interferon-inducible
mRNA. Mol. Cell. Biol. 6. 2062-2067.
Kyte, J., and Doolittle, R. F. (1982). A simple method for displaying the
hydropathic character of a protein. J. Mol. Biol. 157, 105-132.
Lengyel, P (1982). Biochemistry of interferons and their actions. Annu.
Rev. Biochem. 57, 251-282.
Littman, S. J., Faltynek, C. R., and Baglioni, C. (1985). Binding of human recombinant lz51-interferon y to receptors on human cells. J. Biol.
Chem. 260, 1191-1195.
Acknowledgments
We are grateful to Drs. J. Lindenmann, M. Steinmetz, and C. Weissmann for comments on the manuscript, and to Drs. E. Falcoff and J.
Weissenbach for helpful discussions. The excellent technical assistance of E. Huf, K. McKune, and N. Grau is gratefully acknowledged.
We thank W. Bannwarth, H. Kiefer, and R. Schultze for synthesis of oligonucleotides, Dr. C. Weissmann (Institute of Molecular Biology I,
University of Zurich) for generously providing recombinant human IFNy, Dr. D. Cohen (C.E.P.H., Paris) for the B-cell line P-1, and Dr.
Grzeschik (University of Miinster, FRG) for kindly providing DNA from
somatic cell hybrids. This work was supported in part by the Kanton
of Zurich, the Swiss National Science Foundation, and I.N.S.E.R.M.
The costs of publication of this article were defrayed in part by the
payment of page charges. This article must therefore be hereby
marked “advertisement” in accordance with 18 U.S.C. Section 1734
solely to indicate this fact.
Maniatis, T., Frisch, E. F., and Sambrook, J. (1982). Molecular Cloning:
A Laboratory Manual (Cold Spring Harbor, New York: Cold Spring Harbor Laboratory).
Merlin, G., Falcoff. E., and Aguet, M. (1985). ‘251-labeled human interferons a, 5 and y: comparative receptor-binding data. J. Gen. Virol. 66,
1149-l 152.
Nikaido, T., Shimizu. A., Ishida, N., Sabe, H., Teshigawara, K., Maeda,
M., Uchiyama, T., Yodoi, J., and Honjo, T. (1984). Molecular cloning of
cDNA encoding human interleukin-2 receptor. Nature 377, 631-635.
Novick, D., Orchansky, P., Revel, M., and Rubinstein, M. (1987). The
human interferon-y receptor: purification, characterization, and preparation of antibodies. J. Biol. Chem. 262, 8483-8487.
Orchansky, P, Novick, D., Fischer, G., and Rubinstein, M. (1984). Type
I and type II interferon receptors. J. Interferon Res. 4, 275-282.
Received April 25, 1988; revised July 21, 1988.
Orchansky, P, Rubinstein, M., and Fischer, D. G. (1986). The interferon-y receptor in human monocytes is different from the one in nonhematopoetic cells. J. Immunol. 736, 169-173.
References
Pfizenmaier, K., Wiegmann, K., Scheurich, P, Kronke, M., Merlin, G.,
Aguet, M., Knowles, B. B., and Ucer, U. (1988). High affinity human
interferon-y binding capacity is encoded by a single receptor gene located in proximity to c-ros on human chromosome region 6q16 to 6q22.
J. Immunol. 741, 856-860.
Aguet, M. (1986). Procedures for studying
mouse cells. Meth. Enzymol. 719, 321-325.
binding
of interferon
to
Aguet. M., and Mogensen, K. E. (1984). Interferon receptors. In Interferon 5, I. Gresser, ed. New York Academic Press, pp. 1-22.
Aguet, M.. and Merlin, G. (1987). Purification of human y interferon
receptors by sequential affinity chromatography on immobilized monoclonal antireceptor antibodies and human y interferon. J. Exp. Med.
165, 988-999.
Anderson, P., Yip, Y. K., and Vilcek, J. (1982). Specific binding of rz51-human interferon-y to high affinity receptors on human fibroblasts. J. Biol.
Chem. 257. 11301-11304.
Auffray, C., and Rougeon, F. (1980). Purification of mouse immunoglobulin heavy chain messenger RNA from total myeloma tumor RNA.
Eur. J. Biochem. 107; 303-314.
Branca, A. A., and Baglioni. C. (1981). Evidence that type I and type
II interferon have different receptors. Nature 294, 768-770.
Rashidbaigi, A., Langer, J. A., Jung, V., Jones, C.. Morse, H. G., Tischfeld, J. A., Trill, J. S., Kung, A., and Pestka. S. (1986). The gene for the
human immune interferon receptor is located on chromosome 6. Proc.
Natl. Acad. Sci. USA 83, 384-388.
Revel, M.. and Chebath. J. (1986). Interferon-activated
166-170.
genes, TIBS 71,
Rosa, F, and Fellous, M. (1984). The effect of gamma-interferon
MHC antigens. Immunol. Today 5, 261-262.
on
Russell, D. W., Schneider, W. J.. Yamamoto, T., Luskey, K. L., Brown,
M. S., and Goldstein, J. L. (1984). Domain map of the LDL receptor:
sequence homology with the epidermal growth factor precursor. Cell
37, 577-585.
San&au,
J., Sondermeyer,
I??,B&anger,
F., Falcoff, R., and Vaquero,
Cell
260
C. (1967). Intracellular human v-interferon triggers an antiviral state in
transformed murine L cells. Proc. Natl. Acad. Sci. USA 84,2906-2910.
Sanger, F., Nicklen, S., and Coulson, A. R. (1977). DNA sequencing
with chain-terminating inhibitors. Proc. Natl. Acad. Sci. USA 74,54635467.
Sarkar, F. l-f., and Gupta, S. L. (1964). Receptors for human y interferon:
binding and cross-linking of 1251-labeled recombinant human y interferon to receptors on WISH cells. Proc. Natl. Acad. Sci. USA 81,
5160-5164.
Sibley, D. R., Benovic, J. L., Caron, M. G., and Lefkowitz, R. J. (1967).
Regulation of transmembrane signaling by receptor phosphorylation.
Cell 48, 913-922.
Skoskiewicz, M. J., Colvin, R. B., Schneeberger, E. E., and Russell,
P S. (1965). Widespread and selective induction of major histocompatibility antigens in vivo by y interferon. J. Exp. Med. 162, 1645-1664.
Snodgrass, H. R., Dembic, Z., Steinmetz, M., and von Boehmer, H.
(1965). Expression of T-cell antigen receptor genes during fetal development in the thymus. Nature 315, 232-233.
Steinmetz, M., Stephan, D., Dastoornikoo, G. R., Gibb, E., and Romaniuk, R. (1965). Methods in molecular immunology: chromosomal walking in the major histocompatibility
complex. In Immunological
Methods, Volume 3 (I. Levkovits and B. Pernis, eds. (New York: Academic Press), pp. l-19.
Stewart, W. E. (1979). The Interferon
Verlag).
System. (New York: Springer-
Trinchieri, G., and Perussia, B. (1965). Immune interferon: a pleiotropic
lymphokine with multiple effects. Immunol. Today 6, 131-136.
Uecer, U., Bartsch, M., Scheurich, P, Berkovic, D., Ertel, C., and
Pfizenmaier, K. (1966). Quantitation and characterization of yinterferon receptors on human tumor cells. Cancer Res. 46, 5339-5343.
Unanue, E. R. (1964). Anitgen-presenting
Annu. Rev. Immunol. 2, 395-426.
function of the macrophage.
Von Heijne, G. (1963). Patterns of amino acids near signal-sequence
cleavage sites. Eur. J. Biochem. 733, 17-21.
Watson, C. J., and Jackson, J. F (1965). An alternative procedure for
the synthesis of double-stranded cDNA for cloning in phage and plasmid vectors. In DNA Cloning, Volume I, D. Glover, ed. (Oxford: IRL
Press), pp. 79-66.
Yoshida, R., Murray, H. W., and Nathan, C. F (1966). Agonist and antagonist effects of interferon o. and 6 on activation of human macrophages. Two classes of interferon y receptors and blockade of the high
affinity sites by interferon a or 6. J. Exp. Med. 767, 117l-1165.
Zoon, C., and Arnheiter, H. (1964). Studies on the interferon receptors.
Pharmac. Ther. 24, 259-276.
Note Added
in Proof
In contrast to the transfected mouse cell clones described herein, additional clones were selected that are responsive to human IFN-r with
regard to both the enhancement of MHC class I antigens and antiviral
protection (G. Garotta, personal communication).