0013-7227/08/$15.00/0
Printed in U.S.A.
Endocrinology 149(7):3643–3655
Copyright © 2008 by The Endocrine Society
doi: 10.1210/en.2007-1100
Glucocorticoids Induce Human Glycoprotein Hormone
␣-Subunit Gene Expression in the Gonadotrope
Ravid Sasson,* Sang H. Luu,* Varykina G. Thackray, and Pamela L. Mellon
Departments of Reproductive Medicine and Neuroscience, Center for Reproductive Science and Medicine, University of
California, San Diego, La Jolla, California 92093
The human glycoprotein hormone ␣-subunit (␣GSU) gene is
transcriptionally regulated by glucocorticoids in a cell typespecific fashion. In direct contrast to repression of ␣GSU by
glucocorticoids in placenta, glucocorticoid receptor (GR)
modulation in the pituitary is little understood. We show that
glucocorticoids stimulate the ␣GSU promoter in immortalized
pituitary gonadotrope-derived L␤T2 cells, whereas estrogens,
androgens, and progestins have no significant effect. Moreover, GR acts in a dose-dependent manner at physiological
concentrations of glucocorticoids. Transient transfection of
GR with dexamethasone (Dex) treatment further stimulates
the ␣GSU promoter, but this induction is severely diminished
using a receptor mutated in the DNA-binding domain. Truncation and cis mutations demonstrate that glucocorticoid response element 2 (GRE2) and cAMP-response element 2
(CRE2) within ⴚ168 bp of the human ␣GSU promoter are crit-
ical for induction. Moreover, dominant-negative CRE-binding
protein markedly inhibits basal but also Dex induction of
␣GSU promoter activity. Additionally, GR specifically binds
to GRE2 in the human ␣GSU promoter in vitro and to the 5ⴕ
region of the endogenous mouse ␣GSU gene in vivo. Furthermore, overexpression of the homeobox factor, Distal-less 3
that regulates this gene in placental cells through a site partially overlapping GRE2, blocks Dex induction of ␣GSU in
gonadotrope cells, indicating that placenta-specific expression of Dlx3 may interfere with GR, resulting in repression in
placental cells vs. induction in gonadotrope cells. These results demonstrate the stimulatory role played by glucocorticoids in ␣GSU gene expression in the pituitary gonadotrope,
in contrast to repression in placental cells, and highlight the
tissue-specific nature of steroid hormone action. (Endocrinology 149: 3643–3655, 2008)
T
repression of the transcription of both the common ␣GSU
and LH␤ subunit genes (1). More specifically, estrogens suppress ␣GSU transcription in vivo largely by suppressing hypothalamic GnRH, because estradiol had no effect on ␣-subunit mRNA synthesis in rat pituitary cells in vitro (3). In
addition, activated estrogen receptor (ER)-␣ failed to suppress expression of a chimeric human ␣-chloramphenicol
acetyltransferase (␣-CAT) vector in cotransfection studies in
␣T3-1 cells (4), a mouse cell line model for the developing
pituitary gonadotrope. Little is known about progesterone
actions on ␣-subunit transcription; it either reduces (5) or has
no effect in rat pituitaries (6). Androgens, like estrogens,
appear to suppress ␣-subunit expression. In vivo, testosterone suppressed ␣-subunit mRNA synthesis (7). The human
␣-CAT reporter gene was also repressed by testosterone
when transiently transfected into ␣T3-1 cells along with androgen receptor (AR) (8). This suppressive effect of androgens on human ␣-subunit transcription was found to be
mediated by protein-protein interactions with the two
cAMP-response element (CRE)-binding transcription factors
c-Jun and activating transcription factor 2 rather than direct
DNA binding by AR (9) because a high-affinity AR-binding
site located from ⫺111 to ⫺97 could be mutated without
affecting the repression (10).
Unlike gonadal steroids, the effect of glucocorticoids on
human ␣GSU gene expression at the level of gonadotropes
has not yet been characterized. The effects of glucocorticoids
in vivo on ␣-subunit gene expression are inconclusive. Several studies have demonstrated that corticosterone increased
(11), decreased (12), or had no effect (13) on ␣-subunit mRNA
in rat pituitary. In rat GH3 pituitary somatolactotropic cells,
HE GLYCOPROTEIN HORMONE ␣-subunit (␣GSU)
gene is expressed in pituitary gonadotropes and thyrotropes in all mammalian species as well as in primate and
equine placenta. It heterodimerizes with separate ␤-subunits
of the glycoprotein hormones, including those of LH, FSH,
TSH, and human chorionic gonadotropin (hCG) to give the
biologically active, heterodimeric hormones (reviewed in
Ref. 1). The common ␣-subunit and the four unique ␤-subunits are each the product of an individual, single-copy gene
(2). In the pituitary, LH and FSH are synthesized in the
gonadotrope and TSH is synthesized in the thyrotrope,
whereas hCG is a product of human placental trophoblast
cells. These hormones play critical roles in reproduction (LH
and FSH), growth and metabolism (TSH), and maintenance
of pregnancy (hCG).
Steroid hormones regulate gonadotropin subunit gene expression either by acting at the hypothalamus to alter GnRH
pulsatility or acting directly at the pituitary gonadotrope.
The negative feedback effects of gonadal steroids include
First Published Online April 10, 2008
* R.S. and S.H.L. contributed equally.
Abbreviations: AP-1, Activating protein-1; AR, androgen receptor;
CAT, chloramphenicol acetyltransferase; ChIP, chromatin immunoprecipitation; CRE, cAMP response element; CREB, CRE-binding protein;
Dlx3, Distal-less 3; DBD, DNA-binding domain; Dex, dexamethasone;
DN, dominant-negative; ER, estrogen receptor; GR, glucocorticoid receptor; GRE, glucocorticoid response element; ␣GSU, glycoprotein hormone ␣-subunit; hCG, human chorionic gonadotropin; JRE, junctional
regulatory element; luc, luciferase; PR, progesterone receptor.
Endocrinology is published monthly by The Endocrine Society (http://
www.endo-society.org), the foremost professional society serving the
endocrine community.
3643
3644
Sasson et al. • GR Induces ␣GSU Gene Expression in L␤T2 Cells
Endocrinology, July 2008, 149(7):3643–3655
which do not express endogenous ␣GSU, it has been shown
that coexpression of glucocorticoid receptor (GR) with the
human ␣GSU promoter increased activity (14), but the mechanisms of action of glucocorticoid induction of ␣-subunit
gene expression in GH3 cells have not been characterized. In
contrast to GR modulation of ␣-subunit gene expression in
the pituitary, the regulation of ␣-subunit gene expression by
glucocorticoids in human placental cells has been studied at
the molecular level. Several studies in the placental cell
model, JEG-3 human choriocarcinoma cells, showed that glucocorticoids can inhibit expression of the human ␣-subunit
gene by a mechanism involving mutual binding of ligandactivated GR and CRE-binding protein (CREB) (15, 16) that
is independent of specific DNA binding by GR.
Because the role of glucocorticoids in human ␣GSU gene
expression in pituitary gonadotropes has not yet been studied, we examined the responsiveness of the human ␣GSU
promoter to glucocorticoids at the level of the gonadotrope
and characterized the mechanism of action. Accordingly, we
used the L␤T2 gonadotrope-derived immortalized cell line as
a model system in which to study gonadotropin gene expression in a pure population of gonadotrope cells. The L␤T2
cell line endogenously expresses many markers of a mature
gonadotrope including ␣GSU, FSH␤, LH␤, GnRH receptor,
activin, activin receptors, follistatin, and inhibin (17). It has
also been shown to endogenously express GR and respond
to glucocorticoids (18). These properties make the L␤T2 cell
line an excellent model system for directly studying the regulation of gonadotropin gene expression by glucocorticoids
in a homologous model system. In the current study, we
demonstrate that glucocorticoids stimulate activity of human
␣GSU promoter in pituitary gonadotropes through direct
DNA binding of activated GR to a specific glucocorticoid-
response element in the ␣GSU proximal promoter. This is in
marked contrast to the mechanisms of suppression of the
same human ␣GSU gene by androgens in ␣T3-1 gonadotrope
cells and by glucocorticoids in placental cells, both of which
involve protein-protein interaction rather than direct DNA
binding. Thus, these studies illuminate the high degree of
tissue specificity and nuclear receptor specificity of the mechanisms of action of steroid hormones on gene expression.
Materials and Methods
Hormones
Promegestone (R5020) and methyltrienolone (R1881) were purchased
from NEN Life Science Products Life Sciences (Boston, MA), and 17␤estradiol, corticosterone, and dexamethasone (Dex) were purchased
from Sigma-Aldrich (St. Louis, MO).
Reporter plasmid construction
The reporter plasmid, ␣GSU-luc, contains a 1.8-kb fragment (⫺1760
to ⫹45) of the human ␣-subunit gene of the glycoprotein hormones
linked to the luciferase (luc) reporter gene in the vector pGL3 basic
(Promega Corp., Madison, WI). Deletions of the 1.8-kb promoter linked
to a CAT reporter gene were described previously (19). Some of these
deletions (⫺845, ⫺668, ⫺391, and ⫺224) were subcloned into the NheI
and BglII sites of pGL3 basic. For smaller deletions (⫺168, ⫺116, and
⫺90), PCR was performed using the appropriate primers (Table 1) to
create ␣GSU promoter truncations with HindIII and KpnI linkers in a
total volume of 100 ␮l. PCR conditions were as follows: 35 cycles consisting of 1 min at 95 C, 1 min at 55 C, and 1 min at 72 C and an extension
of 2 min at 72 C. These promoter truncations were then subcloned into
the HindIII and KpnI sites of pGL3 basic. Sequences of all promoter
fragments were confirmed with dideoxynucleotide sequencing by the
DNA Sequencing Shared Resource, University of California, San Diego,
Cancer Center. The receptor expression vectors all contained rat cDNAs
and were as follows: AR, pSG5-rAR (20); progesterone receptor (PR),
pCMV5-rPRB (provided by Benita Katzenellenbogen); GR, pSG5-rGR
(provided by Keith Yamamoto); and ER, pcDNA3.1-rER␣ (21). The dom-
TABLE 1. Oligonucleotides (5⬘ to 3⬘ orientation)
Sequencea
Primers/probes
Subcloning PCR oligonucleotide primers
aGSU reverse
⫺90␣GSU forward
⫺116␣ GSU forward
⫺168␣GSU forward
ChIP PCR oligonucleotide primers
Forward (⫺246 promoter)
Reverse (⫺54 promoter)
Forward (⫹932 coding region)
Reverse (⫹1169 coding region)
Mutagenesis oligonucleotides
mGRE1
mGRE2
mGRE3
mCRE1
mCRE2
mCRE1 ⫹ 2
EMSA oligonucleotide probes
⫺147␣GSU WT
⫺129␣GSU WT
⫺129mCRE2
⫺129mGRE2
⫺116␣GSU WT
⫺116mGRE2
⫺116mGRE3
⫺116mGRE2 ⫹ 3
a
Mutated sequences are underlined.
CCCAAGCTTAGTTAATGAAGTCCTCACCT
CCGGGTACCTCATTGGATGGAATTTC
CCGGGTACCTGGTAATTACACCAAGT
CCGGGTACCAGGGTTGAAACAAGAT
GAAAATGGCCAAATGCTCTC
TGTTCCCAGCTGCACATAAG
TGACTGGAGCTGGTGAGATG
GCTTCCAGGAGGCTAGGAGT
GGGTTGAAACAAGATAACATGAAATTGACGTCATGGTAAAAATTG
GTCATGGTAATTAGACCAACTAGGCTTCAATCATTGG
CAATCATTGGATGCAATTTCCTCTTGATCCCAGGGC
GAAACAAGATAAGATCAAATTGCTTGCATGGTAAAAATTGACG
GACGTCATGGTAAAAATTGCTTGCATGGTAATTACACCAAGTAC
GATAAGATCAAATTGCTTGCATGGTAAAAATTGCTTGCATGGTAATTAC
AAGATAAGATCAAATTGACGTCATGGTAAAAATTGACGTCATGGTA
AAAATTGACGTCATGGTAATTACACCAAGTACCCTTCAATCA
AAAATTGCTTGCATGGTAATTACACCAAGTACCCTTCAATCA
AAAATTGACGTCATGGTAATTAGACCAACTAGGCTTCAATCA
TGGTAATTACACCAAGTACCCTTCAATCATTGGATGGAATTTCCTGTTGATCCCAGGGC
TGGTAATTAGACCAACTAGGCTTCAATCATTGGATGGAATTTCCTGTTGATCCCAGGGC
TGGTAATTACACCAAGTACCCTTCAATCATTGGATCCAATTTCCTCTTCATCCCAGGGC
TGGTAATTACACCAACTAGGCTTCAATCATTCCATGGAATTTCCTCTTCATCCCAGGGC
Sasson et al. • GR Induces ␣GSU Gene Expression in L␤T2 Cells
inant-negative (DN) inhibitor of CREB, DN-CREB, originally called M1CREB, and its empty vector PRSET5 were described by Stauber et al. (22).
The GR-DBD and GRdim4 mutants were described by Thackray et al.
(18). The pCI-Dlx3 plasmid was kindly provided by Maria Morasso.
Mutagenesis
The QuikChange Site-Directed Mutagenesis Kit (Stratagene, La Jolla,
CA) was used to generate mutations in the CREs (CRE1 and CRE2) and
in the putative glucocorticoid response elements (GREs: GRE1, GRE2,
and GRE3). The mutagenesis was performed using the 1.8-kb ␣GSU-luc
plasmid and the appropriate oligonucleotides according to the manufacturer’s protocol (Table 1). All mutations were confirmed by
sequencing.
Cell culture and transient transfections
All transient transfections were performed in the L␤T2 cell line. Cells
were maintained in 10-cm plates in DMEM (Cellgro; Mediatech, Inc.,
Herndon, VA) supplemented with 10% fetal bovine serum (Omega
Scientific Inc., Tarzana, CA) at 37 C in 5% CO2. Cells were split into
12-well plates at 3 ⫻ 105 cells per well and transfected 24 h later. The cells
were transfected by FuGENE 6 transfection reagent (Roche Molecular
Biochemicals, Indianapolis, IN) according to the manufacturer’s protocol. Each well received 400 ng of a luc reporter construct as well as 100
ng of ␤-galactosidase reporter plasmid driven by a herpes virus thymidine kinase promoter as a control for transfection efficiency. Cells
were also transfected with 200 ng GR or empty vector, unless otherwise
noted and then serum starved for 6 h after transfection. After 18 h of
starvation, the cells were treated with one of the following treatments:
0.1% ethanol (vehicle control), 0.1% BSA (vehicle control), 0.1% ethanol
with 0.1% BSA (vehicle control), 100 nm Dex (unless otherwise noted),
10 nm GnRH (unless otherwise noted), or both 100 nm Dex and 10 nm
GnRH. Treatment with ethanol or Dex was for 24 h, and treatment with
0.1% BSA or GnRH was for 4 h, unless otherwise noted.
Luciferase and ␤-galactosidase assays
After hormonal or vehicle treatment, the cells were washed with 1⫻
PBS and then lysed with 0.1 m K-phosphate buffer (pH 7.8) containing
0.2% Triton X-100. After lysis, 20 ␮l of the cell extracts was transferred
to a 96-well Nunc luminometer plate. Luciferase activity was determined using a buffer containing the following: 100 mm Tris-HCl (pH
7.8), 15 mm MgSO4, 10 mm ATP, and 65 mm luciferin. The Galacto-light
␤-galactosidase assay (Tropix, Bedford, MA) was used to measure ␤-galactosidase activity according to the manufacturer’s protocol. To monitor the activity of these reporter genes, a Veritas Microplate Luminometer (Turner Biosystems) was used.
Chromatin immunoprecipitation (ChIP) assay
L␤T2 cells were grown to confluency in 15-cm plates, and proteins
were cross-linked to DNA by the addition of 1% formaldehyde directly
to the cell medium. The nuclear fraction was obtained and chromatin
was sonicated to an average length of 400 bp in sonication buffer (50 mm
HEPES, 140 mm NaCl, 1 mm EDTA, 1% Triton X-100, 0.1% Na-deoxycholate, and 0.1% SDS). The lysate was diluted with ChIP dilution buffer
[0.01% SDS, 1.1% Triton X-100, 1.2 mm EDTA, 16.7 mm Tris (pH 8), 167
mm NaCl] to a total of 3.5 ml and precleared with 100 ␮l Protein A/G
PLUS-Agarose beads (Santa Cruz Biotechnology, Santa Cruz, CA). Protein-DNA complexes were incubated overnight with the N499 GR rabbit
polyclonal antibody (provided by Keith Yamamoto) or a nonspecific
mouse IgG control (Santa Cruz Biotechnology) and precipitated with
Protein A/G beads (Santa Cruz Biotechnology). A fraction of the protein-DNA was not precipitated but set aside as the input. The agarose
beads were washed in the following order: low-salt wash buffer [0.1%
SDS, 1% Triton X-100, 2 mm EDTA, 20 mm Tris (pH 8), 150 mm NaCl],
high-salt wash buffer [0.1% SDS, 1% Triton X-100, 2 mm EDTA, 20 mm
Tris (pH 8), 500 mm NaCl], LiCl wash buffer [250 mm LiCl, 1% Nonidet
P-40, 1% Na-deoxycholate, 1 mm EDTA, 10 mm Tris (pH 8)] and twice
with Tris-EDTA buffer. The protein-DNA complexes were eluted with
elution buffer (1% SDS, 0.1 m NaHCO3) and the cross-links were reversed with the addition of 200 mm NaCl and incubation at 65 C for 4 h.
Endocrinology, July 2008, 149(7):3643–3655
3645
The DNA was phenol-chloroform extracted, precipitated, and then resuspended in 50 ␮l water. Primers used in PCR are listed in Table 1. PCR
conditions used were the following: 4 min at 95 C, followed by 26 cycles
consisting of 1 min at 95 C, 1 min at 60 C, and 1 min at 72 C and an
extension of 10 min at 72 C. The PCR product was labeled by including
[␣-32P]dATP in the nucleotide mix and run on a 5% acrylamide gel in
0.5⫻ Tris-borate-EDTA buffer. The gels were dried and subjected to
autoradiography.
Preparation of protein extracts
Full-length Flag-GR (kindly provided by Steve Nordeen) was overexpressed in Sf9 insect cells via a baculovirus expression system by the
University of Colorado Cancer Center Tissue Culture Core Facility. The
Sf9 cells were inoculated with virus at a multiplicity of infection of 1.0
and grown for an additional 48 h at 27 C. Cells containing GR were
treated for the last 24 h before harvest with 500 nm triamcinolone acetonide (final concentration), respectively. The cells were harvested by
centrifugation at 1500 rpm for 15 min, washed once in Tris-glycerol
buffer [10 mm Tris-HCl (pH 8.0) and 10% glycerol] and frozen as a pellet
at ⫺80 C. Sf9 cells were lysed in a homogenization buffer [20 mm
Tris-HCl (pH 7.5), 350 mm NaCl, 1 mm dithiothreitol, 10% glycerol, 0.5
␮g/ml leupeptin, 10 ␮g/ml bacitracin, 2 ␮g/ml aprotinin, 1 ␮g/ml
pepstatin]. All procedures were done at 0 – 4 C. The cell lysate was
centrifuged at 40,000 rpm for 30 min, and the supernatant was taken as
a soluble whole-cell extract.
EMSA
To determine whether GR could bind the proximal mouse ␣GSU
promoter, whole-cell extracts containing GR were incubated with 1 fmol
32
P-labeled oligonucleotide at 4 C for 30 min in a DNA-binding buffer
[10 mm HEPES (pH 7.8), 50 mm KCl, 5 mm MgCl2, 0.1% Nonidet P-40,
1 mm dithiothreitol, 2 ␮g poly(deoxyinosine-deoxycytosine), and 10%
glycerol]. The oligonucleotides were end-labeled with T4 DNA polymerase and [␥-32P]ATP. After 30 min, the DNA-binding reactions were
run on a 5% polyacrylamide gel (30:1 acrylamide-bisacrylamide) containing 2.5% glycerol in 0.5⫻ Tris-acetate-EDTA buffer. The N499 GR
rabbit polyclonal antibody was used to supershift GR, and nonspecific
rabbit IgG was used as a negative control for binding. A 1000-fold excess
of the relevant oligonucleotide was used for competition. Oligonucleotides used for EMSA are listed in Table 1.
Data normalization and statistical analysis
All experiments were performed in triplicate and repeated a minimum of three times. Transfection efficiency was controlled for by dividing all luc values by the corresponding ␤-galactosidase values. This
ratio was then expressed relative to the empty pGL3 plasmid to control
for hormone effects on the vector DNA. Asterisks represent values that
are significantly different from vehicle as determined by the Student’s
t test for independent samples or one-way ANOVA followed by the
Tukey-Kramer honestly significant difference post hoc test or by two-way
ANOVA using the statistical package JMP 5.0 (SAS, Cary, NC). Significance was set at P ⱕ 0.05. Daggers represent a synergistic relationship
as determined by a two-way ANOVA (23). The results are presented as
fold induction relative to the vehicle control.
Results
Glucocorticoids specifically regulate human ␣GSU gene
expression in L␤T2 gonadotrope cells
Understanding the molecular mechanisms of steroid modulation of human ␣GSU has been difficult due to heterogeneity of the anterior pituitary. Immortalized L␤T2 cells are a
model of a mature gonadotrope cell and express endogenous
steroid receptors including AR, PR, ER␣, and GR (18). To
investigate the effects of steroid hormones on the expression
of the human ␣GSU in pituitary gonadotropes, immortalized
L␤T2 cells were transiently transfected with the proximal 1.8
kb of the human ␣GSU promoter linked to a luc reporter gene
3646
Endocrinology, July 2008, 149(7):3643–3655
(1.8␣GSUluc) along with the appropriate steroid receptor
expression vector. Four steroid receptors were tested: AR,
PR, GR, and ER␣. The cells were treated with the appropriate
hormone, 10⫺7 m R5020 (synthetic progestin), 10⫺7 m R1881
(synthetic androgen), 10⫺7 m 17␤-estradiol, or 10⫺7 m Dex
(synthetic glucocorticoid), or with 0.1% ethanol (vehicle control) for 24 h before harvest. Treatment of the cells with Dex
resulted in approximately 5-fold induction, whereas treatment with androgens and estrogens did not have an effect,
and progestins stimulated a mere 1.4-fold induction (Fig.
1A).
To determine whether the effect of glucocorticoids on human ␣GSU gene expression was physiologically significant,
L␤T2 cells were transiently transfected with or without a GR
expression vector and treated with either Dex or with corticosterone, the physiological form of circulating glucocorticoids in mice. The results show that endogenous levels of
GR were sufficient for the stimulatory effect of Dex on human
␣GSU gene expression (Fig. 1B). Corticosterone had a stimulatory effect on human ␣GSU gene expression with exogenous expression of GR and a strong trend with endogenous
GR that did not reach statistical significance. Because treatment of the cells with Dex and transfected exogenous GR
showed a greater induction in comparison with endogenous
GR, subsequent experiments used these conditions to maximize the effect.
Sasson et al. • GR Induces ␣GSU Gene Expression in L␤T2 Cells
A
B
Glucocorticoids stimulate human ␣GSU gene expression in
a dose-dependent manner
L␤T2 cells were transfected with or without the GR expression vector and then treated with increasing concentrations of Dex to determine whether the induction of ␣GSU-luc
was dose dependent (Fig. 1C). For cells with both endogenous and exogenous transfected GR, a significant induction
occurred with hormone concentrations as low as 10⫺9 m. The
induction increased with higher concentrations of hormone
and the maximal dose was achieved at 10⫺7 m for both
endogenous and exogenous GR. These results showed that
regulation of ␣GSU by glucocorticoids occurs in a dosedependent manner and that physiological concentration of
glucocorticoids, 10⫺8 m (24), can induce the ␣GSU promoter.
GR binds the endogenous ␣GSU promoter in vivo
ChIP analysis was used to determine whether endogenous
GR binds to the endogenous mouse ␣GSU gene in live L␤T2
cells with the use of an antibody specific to the receptor. The
ChIP assay (Fig. 2A) showed that the antibody against GR
precipitated the mouse ␣GSU proximal promoter, demonstrating that GR specifically binds to the 5⬘ region of the
endogenous mouse gene (upper panel, lane 3). The mouse
␣GSU promoter (primers ⫺246 to ⫺54) was also amplified
from the input chromatin as a positive control for genomic
DNA preparation and PCR conditions (upper panel, lane 1).
Furthermore, the ␣GSU gene did not precipitate with the
nonspecific mouse IgG, used as a negative control (upper
panel, lane 2). As a control for specificity, primers encompassing part of the downstream coding region of the ␣GSU
gene (⫹932 to ⫹1169) were also used in PCR. Although these
primers amplified ␣GSU from the input chromatin as ex-
C
FIG. 1. A, Glucocorticoids specifically induce human ␣GSU gene expression
in L␤T2 gonadotrope cells. L␤T2 cells were transiently cotransfected with
the 1.8-kb ␣GSU-luc reporter gene and with 200 ng of the respective receptor expression vectors indicated on the graph. The cells were serum
starved overnight and then treated with 100 nM R1881 (synthetic androgen), R5020 (synthetic progesterone), Dex (synthetic glucocorticoid), or 17␤estradiol for 24 h. Luciferase activity was assayed and normalized to ␤-galactosidase activity and shown relative to the empty reporter vector. B, The
1.8-kb ␣GSUluc reporter gene was transiently transfected into L␤T2 cells
without (endogenous GR) or with (exogenous GR) the GR expression vector.
The cells were serum starved overnight and then treated for 24 h with 100
nM corticosterone, a natural glucocorticoid, or Dex, a synthetic glucocorticoid. C, The 1.8-kb ␣GSUluc reporter gene was transiently transfected into
L␤T2 cells without (endogenous GR) or with (exogenous GR) the GR expression vector. The cells were serum starved overnight and then treated
for 24 h with the indicated Dex concentrations (100 pM to 1 ␮M). Data
represent the mean ⫾ SEM of at least three experiments performed in
triplicate and are presented as fold induction relative to the vehicle control.
*, Dex induction is significantly different from the vehicle-treated control,
Student’s t test, P ⬍ 0.05.
Sasson et al. • GR Induces ␣GSU Gene Expression in L␤T2 Cells
A
B
Endocrinology, July 2008, 149(7):3643–3655
3647
DNA binding by GR is necessary for transcriptional
activation of the human ␣GSU promoter
Although the ChIP assay showed that there was binding
of GR to the ␣GSU promoter in live L␤T2 cells, this method
cannot determine whether the receptor binds directly to
DNA or indirectly, via another transcription factor. To determine whether direct DNA binding by GR plays a critical
role in the transactivation of ␣GSU by Dex, we transfected
L␤T2 cells with GR mutants deficient in DNA binding and
the ability to form homodimers. These mutant receptors included the GR-DNA-binding domain (DBD) mutant that has
C476W and R479Q mutations in the DBD, causing it to lose
the ability to bind DNA (25). The second mutant, GRdim4,
contains a dim1 mutation, A458T, which has been previously
described (26), as well as three other mutations (N454D,
R460D, and D462C); these mutations cause the receptor to
lose the ability to form dimers as well as interact with other
transcription factors, such as activating protein-1 (AP-1) (27).
After 24 h of 100 nm Dex treatment, we observed that the
induction of the ␣GSU promoter with the GR-DBD mutant
was reduced to levels of induction equivalent to those caused
by endogenous levels of GR, indicating that induction activity of the transfected, overexpressed GR was abolished by
this mutation. The activity of the endogenous GR did not
appear to be reduced by the transfected GR-DBD mutant, but
we expect that higher levels of the mutant GR might suppress
the endogenous response. In addition, the mutant GRdim4
also appeared to decrease induction levels in comparison
with the overexpressed wild-type receptor although not to a
statistically significant degree (Fig. 2B). These data indicate
that the DBD of GR is necessary to facilitate human ␣GSU
gene induction by glucocorticoids in pituitary gonadotrope
cells.
Multiple sites in the human ␣GSU promoter contribute to
glucocorticoid induction of the human ␣GSU
FIG. 2. A, GR binds to the ␣GSU promoter in vivo. ChIP was performed using the cross-linked protein/chromatin from L␤T2 cells
(treated with vehicle or 100 nM Dex) using antibodies directed against
GR or nonspecific IgG as a negative control: upper panel, PCR primers
(Table 1) encompassing the proximal promoter of ␣GSU (⫺246 to ⫺54)
were used to detect precipitation of genomic DNA; lower panel, PCR
primers encompassing the downstream ␣GSU-coding region (⫹932 to
⫹1169) were used as a control for specificity. PCR amplification was
performed on 0.2% of chromatin input. B, DNA binding by GR is
required to facilitate human ␣GSU gene expression. The 1.8-kb
␣GSUluc reporter gene was transiently cotransfected into L␤T2 cells
with the wild-type GR, GR-DBD mutant expression vector, or
GRdim4 mutant expression vector as indicated. The cells were serum
starved overnight and then treated with 100 nM Dex for 24 h. Data
represent the mean ⫾ SEM of at least three experiments performed in
triplicate and are presented as fold induction relative to the vehicle
control. The GR-DBD mutant response was significantly different
from the GR response. Levels of induction not connected by the same
letter are significantly different, using one-way ANOVA followed by
Tukey’s post hoc test, P ⬍ 0.05.
pected (lower panel, lane 1), no bands were amplified from the
precipitated DNA (lower panel, lanes 2 and 3), indicating that
GR specifically binds to the 5⬘ region of the ␣GSU gene.
To map the promoter elements required for glucocorticoid
responsiveness in the human ␣GSU promoter, truncation
analysis and transient transfections were used. Truncations
of the ␣GSU promoter were created to define the sequences
of importance. L␤T2 cells were transiently transfected with
the following truncations: ⫺845␣GSU, ⫺668␣GSU,
⫺391␣GSU, ⫺224␣GSU, ⫺168␣GSU, ⫺116␣GSU, and
⫺90␣GSU (Fig. 3).
Upon treatment with 100 nm Dex, the ability of glucocorticoids to induce ␣GSU expression was assayed. Levels of
expression induced by truncations ⫺846␣GSU, ⫺668␣GSU,
⫺391␣GSU, and ⫺168␣GSU were not significantly different
from those induced by the wild-type 1.8-kb ␣GSU promoter
(Fig. 3). Truncation of the promoter to ⫺90 bp resulted in a
loss of responsiveness to Dex. For truncation ⫺224␣GSU,
which showed about a 4-fold induction, there was a significant decrease in induction compared with ⫺668␣GSU and
⫺391␣GSU, but it was not significantly different from wild
type. Transfection of these truncations showed that there was
a significant loss of induction between ⫺168␣GSU and
⫺116␣GSU (4-fold decreased to 2-fold). These results suggest
that GR may act directly within the first 168 bp of the human
␣GSU at the level of the gonadotrope.
3648
Endocrinology, July 2008, 149(7):3643–3655
FIG. 3. Mapping the regions involved in induction of human ␣GSU by
GR. The 1.8-kb ␣GSUluc, ⫺845␣GSUluc, ⫺668␣GSUluc,
⫺391␣GSUluc, ⫺224␣GSUluc, ⫺168␣GSUluc, ⫺116␣GSUluc, or
⫺90␣GSUluc reporter genes were transiently transfected into L␤T2
cells along with the GR expression vector. The cells were serum
starved overnight and then treated for 24 h with 100 nM Dex. Data
represent the mean ⫾ SEM of at least three experiments performed in
triplicate and are presented as fold induction relative to the control.
The response with ⫺1.8 kb and with the truncations ⫺846, ⫺668,
⫺391, ⫺224, and ⫺168 bp are significantly different from the response with ⫺116 and ⫺90 truncations. Levels not connected by the
same letter are significantly different, using one-way ANOVA followed by Tukey’s post hoc test, P ⬍ 0.05.
We have previously identified GRE-binding sites in this
region of the human ␣GSU gene by deoxyribonclease I footprinting analysis with purified rat liver GR protein (15). This
analysis revealed three GR-binding sites (GRE1 through -3;
Fig. 4A), each of which exhibits partial homology with the
sequence of the consensus GRE (Fig. 4B) (28). To investigate
the importance of these GRE sites in GR-mediated induction
of human ␣GSU transcription, we created mutations by sitedirected mutagenesis in the context of the 1.8␣GSUluc reporter gene. Mutations were designed to destroy the homology of these sites to the consensus GRE in the G/C residues
critical for high-affinity binding while avoiding the creation
of new potential GREs (Fig. 4B and Table 1); these mutants
were designated mGRE1, mGRE2, and mGRE3.
Surprisingly, each of the three mutations decreased basal
expression of the ␣GSU gene individually (data not shown).
Because these GRE sites reside in the proximal region of the
promoter where transcriptional activity is high and binding
sites for known and unknown proteins are crowded together,
it is probable that mutating these sites disturbed the binding of
basal transcription factors. Mutations of GRE1 and GRE3 did
not prevent the response to Dex, whereas the Dex responsiveness with mutation of GRE2 showed a significant decrease
compared with the wild-type ␣GSU reporter gene (by 52%)
(Fig. 4C). These results show that the region from ⫺111 to ⫺97,
designated as GRE2, is necessary for glucocorticoid responsiveness. In addition to the three putative GRE sites, the two
tandem CRE sites, located between positions ⫺142 and ⫺117,
were also identified in the human ␣GSU promoter region
within the larger region shown to be important by truncation
analysis: ⫺168 and ⫺90. GR is known to interact with transcription factors CREB, activating transcription factor 3, and
AP-1, which bind to these CRE sites (29 –31). Thus, we investigated whether these sites are implicated in the ability of GR
Sasson et al. • GR Induces ␣GSU Gene Expression in L␤T2 Cells
to regulate transcription of human ␣GSU. Site-directed mutagenesis was used to introduce mutations in these CRE sites,
individually and simultaneously in the context of the 1.8␣GSUluc reporter gene (Table 1). Results from cotransfection of these
mutated promoters with the GR expression plasmid showed
that these CRE sites do have a partial role in ␣GSU induction
mediated by GR. As was shown by Schoderbek et al. (32), basal
levels of luc activity remained the same when CRE1 and CRE2
were individually mutated, but levels decreased by 49.8% when
both CRE sites were mutated (data not shown). Induction by
Dex was inhibited by the mutation of CRE2 to approximately
73%, but no significant inhibition was seen with mutation of the
CRE1 or with both mutations: CRE1 ⫹ 2 (Fig. 4C). Mutation of
both GRE2 and CRE2 did not show further significant decreases
in the induction by Dex compared with mutations of each site
individually (Fig. 4C). These results indicated that CRE2 and
GRE2 have functional activity important for glucocorticoid responsiveness of the human ␣GSU promoter.
The phosphorylation state of CREB affects the
transcriptional activation of the human ␣GSU promoter by
glucocorticoids
As a complimentary experiment to the involvement of CRE2
in GR signaling, we introduced a DN-CREB into L␤T2 cells.
This DN-CREB was designed to have an inactive kinase A
phosphorylation site by replacing serine at position 133 with
alanine (previously termed M1-CREB), which completely abolishes CREB transcriptional activity (33), although it does not
affect DNA binding. We therefore compared the DN-CREB
with the empty vector for interference with GR-activated transcription of human ␣GSU in L␤T2 cells. We found that DNCREB affected basal, as well as GR-induced, expression of human ␣GSU gene (Fig. 5A). Basal expression was reduced to 10%
of control, and Dex induction was reduced significantly by 44%
(Fig. 5B). This observation supports the results of the CRE2 cis
mutation and further indicates that this CRE site plays a role in
mediating the induction of ␣GSU by glucocorticoids. Moreover,
our data indicate that activation of CREB (by phosphorylation)
is required for basal expression and glucocorticoid induction of
the human ␣GSU gene.
GR binds to the ⫺111 GRE2 of the human ␣GSU promoter
To evaluate whether GR could bind directly to the GREs
in the proximal human ␣GSU promoter in vitro, an EMSA
was performed (Fig. 6). The probes were constructed from
the 5⬘ region of the proximal human ␣GSU promoter and
were designated ⫺147, ⫺129, and ⫺116 (Table 1). Because the
sites are located very close together, probe ⫺147 encompasses the GRE1, CRE1, and CRE2 sites; probe ⫺129 encompasses the CRE2 and GRE2 sites; and probe ⫺116 encompasses the GRE2 and GRE3 sites. We have previously shown
that GR binds to the ⫺381 hormone response element in the
mouse FSH␤ promoter (18), and this probe was used as a
positive control for GR binding (Fig. 6A, lanes 10 –12). Although we did not detect GR binding using L␤T2 nuclear
extracts (data not shown), we did observe binding of GR
overexpressed in Sf9 cells to the ⫺129 wild-type oligonucleotide probe (Fig. 6A, lanes 4 – 6) and the ⫺116 wild-type
oligonucleotide probe (Fig. 6A, lanes 7–9), whereas no bind-
Sasson et al. • GR Induces ␣GSU Gene Expression in L␤T2 Cells
Endocrinology, July 2008, 149(7):3643–3655
3649
A
B
FIG. 4. The cis elements involved in glucocorticoid regulation of human ␣GSU. A, Schematic representation of the 5⬘
proximal promoter of the human ␣GSU gene. The 220 bp of
5⬘ flanking sequences of the human ␣GSU promoter are
shown encompassing the steroidogenic factor-1 (SF-1) binding site, the CAAT element, the CREs (CRE1 and CRE2),
the JRE that is occupied in placental cells, the CAAT box,
the pituitary homeobox (Ptx) element, and the TATA element. Overlapping with some of these elements are the
putative GREs (GREs 1, 2, and 3). B, The sequences of three
GREs and a GRE consensus are shown. Boxes indicate conservation of the key G and C residues with the consensus
sequence. C, GRE2 and CRE2 have a significant role in the
induction of human ␣GSU by GR. The wild-type 1.8-kb
␣GSUluc reporter gene or one of the three GRE/CRE cis
mutants was transiently transfected into L␤T2 along with
GR expression vector. The cells were serum starved overnight and then treated for 24 h with 100 nM Dex. Data
represent the mean ⫾ SEM of at least three experiments
performed in triplicate and are presented as fold induction
relative to the vehicle control. Induction with the GRE2
mutant, CRE2 mutant, and/or double GRE2/CRE2 mutant
are significantly different from induction with wild-type
GR. Levels not connected by the same letter are significantly different, using one-way ANOVA followed by Tukey’s
post hoc test, P ⬍ 0.05.
C
ing to the ⫺147 wild-type oligonucleotide probe was observed. The resulting complexes in these lanes were supershifted by a GR-specific antibody (Fig. 6A, lanes 6, 9, and 12)
but not by IgG (Fig. 6A, lanes 5, 8, and 11). GR binding to
these elements was further examined by competition EMSA
(Fig. 6B), and results showed that complexes displayed selfcompetition (Fig. 6B, lanes 2 and 6) and failed to compete
with a probe with a GRE2 mutation (Fig. 6B, lanes 3 and 7)
or a probe with GRE2 and GRE3 mutations (Fig. 6B, lane 9).
The complexes successfully competed with the CRE2 mutant
probe (Fig. 6B, lane 4) and the GRE3 mutant probe (Fig. 6B,
lane 8). These results lead to the conclusion that GR can bind
directly to GRE2 in the human ␣GSU gene.
Overexpression of Dlx3 in L␤T2 cells inhibits the
transcriptional activation of the human ␣GSU promoter by
glucocorticoids
The homeobox factor, Distal-less 3 (Dlx3), is expressed in
the human choriocarcinoma cell line, JEG3, and in tropho-
blast cells, but not in the ␣T3-1 gonadotrope cell line. Dlx3
transactivates the human ␣-GSU gene in placental cells via
binding at the junctional regulatory element (JRE) located
from ⫺114 to ⫺106 (34). This element overlaps the GRE2
sequence by six nucleotides, covering the whole consensus
half-site on the 5⬘ side and sits between GRE2 and CRE2 (Fig.
7A). This overlap creates the potential for interference in
placental cells; Dlx-3 could interfere with GR binding to
GRE2 as well as its interaction with the CRE2 binding proteins. To address the mechanism of glucocorticoid induction
in gonadotrope cells vs. repression in placental cells, we
determined whether ectopic expression of Dlx3 in gonadotrope cells would alter glucocorticoid responsiveness on the
␣GSU gene. L␤T2 cells were transiently cotransfected with
GR, 100 ng of either Dlx3 expression vector or pCI empty
vector and with the 1.8-kb ␣GSU-luc reporter gene. As expected, the human ␣GSU gene was induced 6.6-fold after
Dex treatment (Fig. 7B). This induction was reduced 72% to
1.8-fold in the presence of Dlx3. There was no effect on basal
3650
A
Sasson et al. • GR Induces ␣GSU Gene Expression in L␤T2 Cells
Endocrinology, July 2008, 149(7):3643–3655
B
A
FIG. 5. DN-CREB decreases GR-induced expression of the human
␣GSU promoter. DN-CREB was overexpressed in L␤T2 cells that had
been transiently transfected with 1.8-kb ␣GSUluc and the GR expression vector. The cells were serum starved overnight and then
treated for 24 h with 100 nM Dex. Data represent the mean ⫾ SEM of
at least three experiments performed in triplicate. A, Bar graph depicting luc values normalized to ␤-galactosidase values; B, bar graph
presented as fold induction relative to the control for empty vector vs.
DN-CREB to show decrease in fold induction by Dex.
expression of human ␣GSU gene. These results indicate that
Dlx3 has an inhibitory effect on GR-induced expression of
human ␣GSU gene and provide a potential mechanism for
the differential effects of glucocorticoids in gonadotropes vs.
placental cells.
GnRH and activin synergistically modulate Dex-induced
human ␣GSU gene expression
Gonadotropes are known to be responsive to the regulation of GnRH and activin on the reproductive axis. For example, we have previously shown that activin regulates the
transcription of LH␤ and FSH␤ subunit genes in L␤T2 cells
(35, 36). In contrast, the ␣GSU gene is repressed by activin in
␣T3-1 gonadotrope cells (37). Additionally, GnRH has been
shown to induce transcription of FSH␤, LH␤, and ␣GSU
(38 – 40). More recently, we have shown that activin and
glucocorticoids synergistically regulate FSH␤ transcription
(41). Understanding how different hormones interact with
each other in the regulation of gonadotropin synthesis can
further elucidate the mechanisms of hormonal regulation of
gonadotropins. Therefore, we examined whether there was
cross-talk between the GnRH and glucocorticoid response as
well as activin and glucocorticoid response of the human
␣GSU gene in the gonadotrope cell.
L␤T2 cells were transiently transfected with the 1.8-kb
␣GSU-luc reporter plasmid and the GR expression vector.
Cells were treated with Dex, GnRH, or activin individually
or as cotreatments, and changes in luc activity were monitored (Fig. 8). Under these conditions, Dex alone induced
human ␣GSU gene expression by 8.4-fold over vehicle treatment. There was no statistically significant effect by activin
alone, although the trend supported the previous findings of
repression (37) (Fig. 8). However, the effect of cotreatment
B
FIG. 6. GR binds to the ⫺111 GRE2 of the human ␣GSU promoter.
Whole-cell extracts containing overexpressed GR from baculovirusinfected insect cells were incubated with 32P-labeled oligonucleotides
representing the three GREs as indicated (see Table 1) and compared
with a positive control probe from the mouse FSH␤ gene that has been
previously shown to bind GR. A, The N499 GR rabbit polyclonal
antibody was used to supershift GR, and nonspecific rabbit IgG was
used as a negative control for binding; B, 1000-fold excess of the
relevant oligonucleotide probes, either wild-type or mutant (Table 1),
was used for competition.
with activin and Dex resulted in reduction of Dex induction
by 65%, displaying an interactive repression as determined
by two-way ANOVA (23). In response to GnRH stimulation,
human ␣GSU expression was induced significantly to 33.5fold induction over vehicle treatment. Cotreatment of GnRH
Sasson et al. • GR Induces ␣GSU Gene Expression in L␤T2 Cells
FIG. 7. Overexpression of Dlx3 inhibits GR-induced human ␣GSU
promoter in L␤T2 cells. A, Sequence overlap of the JRE and the GRE2.
Sequence is shown from ⫺124 to ⫺97 of the human ␣GSU gene. The
rounded box indicates the sequence of CRE2, squared box indicates
the JRE sequence, and the oval indicates the full GRE2 with both 6-bp
half-sites and the 3-bp spacer. B, Either pCI empty vector or Dlx3
expression vector (100 ng) was overexpressed in L␤T2 cells that had
been transiently transfected with 1.8-kb ␣GSUluc and the GR expression vector. The cells were serum starved overnight and then
treated for 24 h with 100 nM Dex. Data represent the mean ⫾ SEM of
at least three experiments performed in triplicate and are presented
as fold induction relative to the vehicle control.
and Dex resulted in a significantly greater 71.2-fold induction. This interaction between GnRH and Dex on the ␣GSU
promoter was also determined to be synergistic by two-way
ANOVA. To test these effects with endogenous GR, L␤T2
cells were transiently transfected with 1.8-kb ␣GSU, but
without the addition of exogenous GR, and were subject to
the same hormone treatments. With the treatment of Dex
alone, human ␣GSU was induced 4.1-fold, activin had no
effect, and GnRH alone produced a 39.8-fold induction. Cotreatment with Dex and activin resulted in reduction of the
Dex induction of human ␣GSU gene expression by 53%, also
showing an interactive repression. Synergy was again observed with cotreatment of GnRH and Dex, resulting in a
significantly increased fold induction of 58.4 (Fig. 8). These
results indicate that GnRH and glucocorticoids synergistically interact to induce expression of the ␣GSU promoter at
the level of the gonadotrope, whereas activin interacts with
glucocorticoids to cause synergistic repression. Moreover,
these interactions can occur with the endogenous GR present
in the L␤T2 cells, although a more dramatic response is seen
upon addition of exogenous GR.
Discussion
Hormonal regulation of gonadotropin synthesis and secretion is exceptionally complex, involving, at the minimum,
pulsatile hypothalamic input of GnRH and gonadal input of
steroids and regulatory peptides (1). In addition, mounting
evidence suggests that glucocorticoids also have an impact
Endocrinology, July 2008, 149(7):3643–3655
3651
FIG. 8. GnRH and activin modulate Dex-induced human ␣GSU gene
expression synergistically. The 1.8-kb ␣GSUluc reporter gene was
transiently transfected into L␤T2 cells with or without overexpression of GR (200 ng). Cells were serum starved overnight and then
treated for 24 h with vehicle, 100 nM Dex, 10 nM GnRH, 10 ng/ml
activin, 100 nM Dex with 10 nM GnRH, or 100 nM Dex with 10 ng/ml
activin. Data represent the mean ⫾ SEM of at least three experiments
performed in triplicate and are presented as fold induction relative to
the control. Daggers (†) represent synergy between hormone treatments by two-way ANOVA, and asterisks (*) represent significant
induction by hormone by one-way ANOVA, P ⬍ 0.05.
on gonadotropin gene expression (11–16, 22, 42– 44). Our
study adds to this body of evidence by demonstrating a
direct transcriptional enhancement of the human ␣GSU gene
by glucocorticoids at the level of gonadotropes.
Although in vivo studies have shown that glucocorticoids
inhibit ␣-subunit secretion in humans (45– 48), rats (49, 50),
and mice (51), in the present study we, as well as others
(11–14, 18, 41), have shown that glucocorticoids play a positive role in gonadotropin subunit gene activation at the level
of the gonadotrope cell. Furthermore, because both progestin
and glucocorticoid levels peak during proestrus (52, 53), and
appear to be necessary for the secondary FSH surge (54, 55),
glucocorticoids may play a physiological role in the regulation of gonadotropin gene expression.
In the current study, we characterized the molecular mechanisms of glucocorticoid regulation of the human ␣GSU gene
in gonadotropes. Our results show that glucocorticoids activate the proximal promoter of human ␣GSU in immortalized mouse gonadotrope-derived L␤T2 cells in a dose-dependent manner with or without the overexpression of GR
(Fig. 1). The effect of glucocorticoids was hormone specific
and could not be demonstrated with other steroid hormones,
including estrogens, progestins, or androgens (Fig. 1). We
also provide evidence, using ChIP analysis, that the endogenous GR specifically binds to the 5⬘ region of the mouse
␣GSU gene in live L␤T2 cells. Moreover, the use of mutant
steroid receptors lacking the ability to bind DNA demonstrated that the DBD of GR is necessary to modulate human
␣GSU gene expression (Fig. 2). Additionally, we show that
3652
Endocrinology, July 2008, 149(7):3643–3655
GR binds to a GRE within the ␣GSU promoter in vitro using
gel shift analysis (Fig. 6). Furthermore, mutation of GRE2 or
CRE2 in the context of the ⫺1.8-kb ␣GSU-luc reporter gene
inhibited the responsiveness of ␣GSU to glucocorticoids (Fig.
4). Collectively, these results are the first to demonstrate that
GR can directly induce human ␣GSU gene expression within
the gonadotrope.
Once we established that the DBD of GR was necessary for
␣GSU gene induction, it was then crucial to map the regions
of the promoter to which GR binds. The responsiveness to
glucocorticoids mapped to the ⫺168-bp proximal region of
the promoter. Our data concur with the studies of Gurr and
Kourides (14) that demonstrated that ␣-subunit expression in
rat somatolactotrope GH3 cells was induced by Dex when
cotransfected with a glucocorticoid receptor expression plasmid. However, in contrast to our results in L␤T2 gonadotrope cells, in GH3 cells, sequences upstream of ⫺172␣GSU
were shown to be required for full Dex induction of human
␣GSU transcription (14). This suggests that in pituitary somatolactotrope cells, which do not normally express ␣GSU,
there are additional factors not present in gonadotrope cells
that interact with ␣GSU gene sequences upstream of ⫺172 to
enhance ␣GSU glucocorticoid-responsive transcription.
The human ␣GSU promoter has several regions that are
known to be involved in basal and regulated expression in
the pituitary; the pituitary glycoprotein hormone basal element (PGBE), which includes the ␣-basal elements (␣BE1 and
-2), the gonadotrope-specific element (GSE) that binds steroidogenic factor 1 (SF-1), a consensus GATA site that binds
GATA-3, and tandem CREs that bind CREB and AP-1 (56 –
58). We had previously identified three putative GREs (15)
in the region of the human ␣GSU promoter. Our cis-mutation
analysis now shows that GRE2 and CRE2 (Fig. 4) are involved in the responsiveness of ␣GSU to glucocorticoids in
pituitary gonadotrope cells. Additionally, gel-shift analysis
demonstrated that GR binds to this specific GRE in the human ␣GSU gene in vitro (Fig. 6). In a previous study of
repression of ␣GSU by GR in placental cells, GR-DBD protein
had been shown to bind GRE2 in vitro, either as a dimer or
monomer. However, these studies did not detect functional
activity for this GRE in glucocorticoid repression of the ␣GSU
promoter (22). Additionally, of the three putative GREs,
GRE2 bears the highest degrees of identity to the known
consensus for GR and evolutionary conservation. In the human ␣GSU promoter, GRE2 retains nine matches to the 12
defined nucleotides of the consensus GRE, whereas GRE1
has seven and GRE3 has six. In the mouse ␣GSU promoter,
GRE2 retains six matches to the 12 defined nucleotides of the
consensus GRE, whereas GRE1 has five and GRE3 has three.
Thus, our current studies demonstrate that GRE2, a fairly
conserved GRE, is a novel functional site for regulation of
␣GSU by glucocorticoids. Moreover, it was surprising to find
that mutations in CRE2 reduced the responsiveness to glucocorticoids, yet mutations in CRE1, which comprises an
identical sequence, did not have any effect. We propose that
the reason for this is a matter of proximity between regulatory elements within the promoter. There are only 5 bp between CRE2 and GRE2, and the configuration of the ␣GSU
promoter is such that the center of CRE2 is 10 bp from the
center of the 5⬘ half-site of the GRE2 and 10 additional base
Sasson et al. • GR Induces ␣GSU Gene Expression in L␤T2 Cells
pairs from the center of the 3⬘ half-site of GRE2 (Fig. 7A),
placing the binding proteins on the same side of the helix.
Therefore, we hypothesize that the transcription factors that
bind CRE2 might directly interact with GR to increase the
stabilization of binding to GRE2. This proposition is also
supported by the fact that GR can bind to other transcription
factors including AP-1 and CREB (25, 59), both of which bind
to CRE sites. Coactivator proteins that are known to interact
with both CREB/AP-1 family members and nuclear receptors may act as bridge proteins across such a small distance
of DNA. For example, four-and-a-half-LIM-only protein 2
(60) is a multifunctional coactivator that interacts with both
CREB and steroid hormone receptors. Such proteins are
thought to function as adaptors or scaffolds to support the
assembly of multimeric protein complexes. Additionally, the
nonphosphorylated DN-CREB reduced the induction of
␣GSU mediated by GR (Fig. 5), indicating that the activation
of CREB by phosphorylation may have a role in GR-induced
human ␣GSU gene expression. Interestingly, double cis mutations of GRE2 and CRE2 did not interfere with the stimulatory effect of GR on human ␣GSU gene expression any
further than each mutation individually.
The effect of glucocorticoids on ␣GSU transcription is dependent on the cell type in which the gene is expressed.
Induction by GR in the pituitary gonadotrope model is in
contrast with the inhibitory effect of GR on human ␣GSU
gene expression in JEG-3 placental cells (15, 16, 22). The
placental studies have shown that glucocorticoid-dependent
repression of human ␣GSU gene expression does not require
binding of GR to the GRE but is dependent on a mechanism
involving protein-protein interactions of GR with CREB. It is
suggested that GR and CREB may interact directly in vivo
possibly through a third protein or, more likely, may sequester a mutually required target protein in placental cells.
In light of these data, we propose that the inability of glucocorticoids to activate human ␣GSU transcription in placental cells may result from a masking of the GR-binding
sites on the ␣GSU gene by regulatory proteins present in
placental cells that are not expressed in gonadotrope cells
(61). For example, Dlx3, a homeodomain protein expressed
in JEG-3 choriocarcinoma cells, but not in ␣T3-1 gonadotrope
cells, binds to a site termed the JRE (34) located just 3⬘ to CRE2
that is important for placental expression and is directly
overlapping with the 5⬘ half of the GRE2 sequence in the
human ␣GSU gene (bases shared are ⫺111 ATTACA ⫺106;
see Fig. 7A). This places the JRE between the CRE2 and GRE2
while overlapping the 5⬘ half-site of GRE2, perhaps interfering not only with GR binding but also with GR interaction
with proteins bound to CRE2, or with bridging coactivators
binding both CREB and GR. In fact, mutation of the JRE
reduces basal expression in placental but not ␣T3-1 pituitary
immature gonadotrope cells (62). Furthermore, mutation of
the JRE reduces cAMP induction of human ␣GSU transcription in placental JEG-3 cells (34), but its effect on glucocorticoid regulation has not been tested in JEG-3 cells. In fact,
introduction of Dlx3 into L␤T2 cells does interfere with GR
induction of human ␣GSU expression, dramatically reducing
Dex induction. Therefore, Dlx3 may play a role in the celltype-specific effect of glucocorticoids on ␣GSU transcription.
On the other hand, the differences between the actions of
Sasson et al. • GR Induces ␣GSU Gene Expression in L␤T2 Cells
GR on ␣GSU in placental vs. pituitary gonadotrope cells may
lie in a different complement of proteins binding to the CREs.
Heckert et al. (63) showed that the identities of the proteins
binding to the CREs in the human and rat ␣GSU genes are
similar but differ in concentration in the ␣GSU-expressing
placental vs. pituitary gonadotrope cell models. Alternatively, the lack of necessity for DNA binding of GR to the
␣GSU GRE2 in placental cells may be a result of a lack of
tissue-specific cofactors necessary for the actions of GR or
bridging to CRE-binding proteins. Additionally, it can also
be hypothesized that in the absence of DNA binding of GR
to the GRE in the ␣GSU promoter in placental cells, the GR
acts as negative regulator of ␣-subunit transcription whereby
GR and CREB or AP-1 compete for a coactivator protein such
as CREB-binding protein or p300. The involvement of such
mechanisms has been examined in other systems. For example, GR interferes with Oct-2A-dependent transcription in
a DNA-binding-independent manner in HeLa cells but apparently not in lymphoid cells (64). In this case, the involvement of a putative rate-limiting coactivator was proposed.
Furthermore, because GnRH is a key hormone regulating
␣GSU transcription in gonadotropes, it was important to
examine whether there was cross-talk between responses to
these hormones. Our results revealed a synergistic relationship between GnRH and glucocorticoids (Fig. 8), uncovering
a novel mechanism that remains to be further studied. This
newly found synergism and the implied involvement of
CREB bring more insight to the mechanism of GR-induced
␣GSU gene expression. Studies have previously shown that
GnRH-stimulated CREB phosphorylation is necessary for
transcriptional activation of the ␣GSU gene in the pituitary
(65). Additionally, GR and CREB have been shown to synergistically activate the transcription of composite promoters, such as that of phosphoenolpyruvate carboxykinase
(PEPCK) and somatostatin, which, like the ␣GSU promoter,
contain both GRE and CRE sequences that are close in proximity (59, 66). These studies revealed a protein-protein interaction in vitro between GR and CREB that might account
for the role of the CRE in the glucocorticoid response of the
PEPCK gene (59) and could contribute to the GnRH-glucocorticoid synergy on the ␣GSU gene. In addition to synergism between GR and CREB, interaction between GR and
other transcription factors such as nuclear factor 1, specificity
protein 1, and CACCC-binding proteins in genes encoding
tyrosine amino transferase and rat tryptophan oxygenase
(67, 68) have also been reported. Therefore, the synergistic
transcriptional activation of ␣GSU may involve the interactions between CREB and GR when they are both bound to
their proximal response elements. Interestingly, our results
with CREB overexpression (data not shown) suggest that
overexpression of this molecule alone is insufficient for a
synergistic induction with GR. This is probably due to the
requirement not just for CREB molecules, but also for phosphorylated CREB, to induce transcriptional activation (69).
Activin, a member of the TGF␤ family of growth factors,
can regulate the transcription of genes by binding specific
serine/threonine kinase receptors (70). These receptors then
activate the intracellular signaling system that involves Smad
proteins as intracellular signaling mediators. There are three
classes of Smad proteins: receptor-regulated Smads (R-
Endocrinology, July 2008, 149(7):3643–3655
3653
Smad), comediator Smads (Co-Smad), and inhibitory Smads
(I-Smad) (70). Through these different classes of Smad, activin can cause activation or repression of gene transcription.
In our results, activin treatment did not show induction of
human ␣GSU expression but rather produced a small repression of about 27% (Fig. 8). More significant levels of
repression of human ␣GSU by activin were previously
shown by Attardi et al. (37) in ␣T3-1 cells that did not express
GR. These cells express higher basal levels of ␣GSU expression compared with L␤T2 cells, which may explain the
higher repression levels of ␣GSU transcription by activin
(71). Moreover, in our results in L␤T2 cells, activin synergistically repressed Dex-induced human ␣GSU gene expression (Fig. 8). Interestingly, a recent study in our lab has
shown that activin and glucocorticoids synergistically activate transcription of the FSH␤ gene in L␤T2 cells (41). These
findings indicate that there are response elements in the
␣GSU promoter, not found in the FSH␤ promoter, that allow
for transcriptional repression by activin. Likewise, there may
be response elements in the FSH␤ promoter that are not
found in the ␣GSU promoter that allow for transcriptional
activation by activin. Attardi et al. (37) used a series of 5⬘
deletions (⫺507 to ⫺133) of the mouse ␣GSU promoter to
map regions that were essential for activin responsiveness.
They found significant stepwise losses of activin responsiveness when sequences between ⫺507 and ⫺424, ⫺424 and
⫺288, and ⫺288 and ⫺205 bp were eliminated. However,
these elements may be species specific and do not infer any
interaction between activin responsiveness and glucocorticoid responsiveness for the human ␣GSU promoter. The
interaction between activin and glucocorticoid regulation of
the human ␣GSU promoter is thus highly specific to the cell
type and target gene.
In summary, our findings demonstrate that glucocorticoids, upon binding and activating GR, directly induce the
expression of human ␣GSU gene at the level of the gonadotrope and that this regulation occurs through binding of
the ligand-bound receptor to the ⫺111 GRE (GRE2) in the
proximal promoter. Additionally, this activation is specific to
GR because other steroid receptors such as PR, AR, and ER,
did not induce human ␣GSU gene expression. These studies
also indicate that the ⫺124 CRE2 mediates this mechanism,
most likely through the transcription factor CREB, which has
been previously shown to interact with GR and to have a
stimulatory synergistic effect on promoter transcription. In
conjunction with the findings that glucocorticoids can upregulate expression of FSH␤ gene directly at the level of the
gonadotrope, it makes physiological sense that the ␣GSU is
also up-regulated by glucocorticoids to produce a functional
FSH heterodimer.
Acknowledgments
We thank Djurdjica Coss and other members of the Mellon lab for
helpful discussions and comments. We thank Susan Mayo for technical
assistance. We thank Jorma Palvimo for the pSG5-rAR plasmid, Benita
Katzenellenbogen for the pCMV5-rPRB plasmid, and Keith Yamamoto
for the pSG5-rGR plasmid and the N499 GR rabbit polyclonal antibody.
We also thank Margaret Shupnik for providing the pcDNA3.1-ER␤
plasmid and Mark Lawson for the human 1.8␣GSU-luc plasmid. We
thank Maria Morasso for the pCI-Dlx3 plasmid. We also thank the
University of Colorado Cancer Center Tissue Culture Core Facility for
Sasson et al. • GR Induces ␣GSU Gene Expression in L␤T2 Cells
3654 Endocrinology, July 2008, 149(7):3643–3655
baculovirus production and the University of California San Diego Cancer Center DNA Sequencing Shared Resource for dideoxynucleotide
sequencing.
Received August 9, 2007. Accepted March 28, 2008.
Address all correspondence and requests for reprints to: Pamela L.
Mellon, Department of Reproductive Medicine, University of California
San Diego, 9500 Gilman Drive, La Jolla, California 92093-0674. E-mail:
pmellon@ucsd.edu.
This work was supported by the National Institute of Child Health
and Human Development, National Institutes of Health (NIH), through
a cooperative agreement (U54 HD012303) as part of the Specialized
Cooperative Centers Program in Reproduction and Infertility Research
(P.L.M.). This work was also supported by NIH Grant R01 HD020377 (to
P.L.M.). S.H.L. was supported by an Endocrine Society Student Summer
Research Fellowship. V.G.T. was supported by NIH F32 DK065437 and
NIH T32 HD007203. P.L.M. is a member of the Biomedical Sciences
Graduate Program.
Present address for R.S.: Betastim Corp., 2 Hatohen Street, POB 3143,
Caesarea, Israel, 38900.
Present address for S.H.L.: Department of Epidemiology, UCLA
School of Public Health Box 951772, Los Angeles, California 90095-1772.
Disclosure summary: The authors have nothing to disclose.
References
1. Gharib SD, Wierman ME, Shupnik MA, Chin WW 1990 Molecular biology
of the pituitary gonadotropins. Endocr Rev 11:177–199
2. Fiddes JC, Goodman HM 1981 The gene encoding the common ␣-subunit of
the four human glycoprotein hormones. J Mol Appl Genet 1:3–18
3. Shupnik MA 1996 Gonadotropin gene modulation by steroids and gonadotropin-releasing hormone. Biol Reprod 54:279 –286
4. Keri RA, Andersen B, Kennedy GC, Hamernik DL, Clay CM, Brace AD, Nett
TM, Notides AC, Nilson JH 1991 Estradiol inhibits transcription of the human
glycoprotein hormone ␣-subunit gene despite the absence of a high affinity
binding site for estrogen receptor. Mol Endocrinol 5:725–733
5. Dalkin AC, Haisenleder DJ, Ortolano GA, Suhr A, Marshall JC 1990 Gonadal
regulation of gonadotropin subunit gene expression: evidence for regulation
of follicle-stimulating hormone-␤ messenger ribonucleic acid by nonsteroidal
hormones in female rats. Endocrinology 127:798 – 806
6. Kerrigan JR, Dalkin AC, Haisenleder DJ, Yasin M, Marshall JC 1993 Failure
of gonadotropin-releasing hormone (GnRH) pulses to increase luteinizing
hormone ␤-messenger ribonucleic acid in GnRH-deficient female rats. Endocrinology 133:2071–2079
7. Paul SJ, Ortolano GA, Haisenleder DJ, Stewart JM, Shupnik MA, Marshall
JC 1990 Gonadotropin subunit messenger RNA concentrations after blockade
of gonadotropin-releasing hormone action: testosterone selectively increases
follicle-stimulating hormone ␤-subunit messenger RNA by posttranscriptional
mechanisms. Mol Endocrinol 4:1943–1955
8. Clay CM, Keri RA, Finicle AB, Heckert LL, Hamernik DL, Marschke KM,
Wilson EM, French FS, Nilson JH 1993 Transcriptional repression of the
glycoprotein hormone ␣-subunit gene by androgen may involve direct binding
of androgen receptor to the proximal promoter. J Biol Chem 268:13556 –13564
9. Jorgensen JS, Nilson JH 2001 AR suppresses transcription of the ␣-glycoprotein hormone subunit gene through protein-protein interactions with cJun
and activation transcription factor 2. Mol Endocrinol 15:1496 –1504
10. Heckert LL, Wilson EM, Nilson JH 1997 Transcriptional repression of the
␣-subunit gene by androgen receptor occurs independently of DNA binding
but requires the DNA-binding and ligand-binding domains of the receptor.
Mol Endocrinol 11:1497–1506
11. Ringstrom SJ, McAndrews JM, Rahal JO, Schwartz NB 1991 Cortisol in vivo
increases FSH␤ mRNA selectively in pituitaries of male rats. Endocrinology
129:2793–2795
12. Kilen SM, Szabo M, Strasser GA, McAndrews JM, Ringstrom SJ, Schwartz
NB 1996 Corticosterone selectively increases follicle-stimulating hormone
␤-subunit messenger ribonucleic acid in primary anterior pituitary cell culture
without affecting its half-life. Endocrinology 137:3802–3807
13. McAndrews JM, Ringstrom SJ, Dahl KD, Schwartz NB 1994 Corticosterone
in vivo increases pituitary follicle-stimulating hormone (FSH)-␤ messenger
ribonucleic acid content and serum FSH bioactivity selectively in female rats.
Endocrinology 134:158 –163
14. Gurr JA, Kourides IA 1989 Regulation of the transfected human glycoprotein
hormone ␣-subunit gene by dexamethasone and thyroid hormone. DNA
8:473– 480
15. Akerblom IE, Slater EP, Beato M, Baxter JD, Mellon PL 1988 Negative
regulation by glucocorticoids through interference with a cAMP responsive
enhancer. Science 241:350 –353
16. Chatterjee VK, Madison LD, Mayo S, Jameson JL 1991 Repression of the
human glycoprotein hormone ␣-subunit gene by glucocorticoids: evidence for
17.
18.
19.
20.
21.
22.
23.
24.
25.
26.
27.
28.
29.
30.
31.
32.
33.
34.
35.
36.
37.
38.
39.
40.
41.
42.
receptor interactions with limiting transcriptional activators. Mol Endocrinol
5:100 –110
Pernasetti F, Vasilyev VV, Rosenberg SB, Bailey JS, Huang HJ, Miller WL,
Mellon PL 2001 Cell-specific transcriptional regulation of FSH␤ by activin and
GnRH in the L␤T2 pituitary gonadotrope cell model. Endocrinology 142:2284 –
2295
Thackray VG, McGillivray SM, Mellon PL 2006 Androgens, progestins and
glucocorticoids induce follicle-stimulating hormone ␤-subunit gene expression at the level of the gonadotrope. Mol Endocrinol 20:2062–2079
Horn F, Windle JJ, Barnhart KM, Mellon PL 1992 Tissue-specific gene expression in the pituitary: the glycoprotein hormone ␣-subunit gene is regulated
by a gonadotrope-specific protein. Mol Cell Biol 12:2143–2153
Ikonen T, Palvimo JJ, Janne OA 1998 Heterodimerization is mainly responsible for the dominant negative activity of amino-terminally truncated rat
androgen receptor forms. FEBS Lett 430:393–396
Resnick EM, Schreihofer DA, Periasamy A, Shupnik MA 2000 Truncated
estrogen receptor product-1 suppresses estrogen receptor transactivation by
dimerization with estrogen receptors ␣ and ␤. J Biol Chem 275:7158 –7166
Stauber C, Altschmied J, Akerblom AE, Marron JL, Mellon PL 1992 Mutual
cross-interference between glucocorticoid receptor and CREB inhibits transactivation in placental cells. New Biol 4:527–540
Slinker BK 1998 The statistics of synergism. J Mol Cell Cardiol 30:723–731
Griffin JE, Ojeda SR 2000 Textbook of endocrine physiology. 4th ed. New
York: Oxford University Press
Heck S, Kullmann M, Gast A, Ponta H, Rahmsdorf HJ, Herrlich P, Cato AC
1994 A distinct modulating domain in glucocorticoid receptor monomers in the
repression of activity of the transcription factor AP-1. EMBO J 13:4087– 4095
Reichardt HM, Kaestner KH, Tuckermann J, Kretz O, Wessely O, Bock R,
Gass P, Schmid W, Herrlich P, Angel P, Schutz G 1998 DNA binding of the
glucocorticoid receptor is not essential for survival. Cell 93:531–541
Rogers SL, Nabozny G, McFarland M, Pantages-Torok L, Archer J, Kalkbrenner F, Zuvela-Jelaska L, Haynes N, Jiang H, Four mutations in the GR
dimerization domain result in perinatal lethal mice. Keystone Symposia, Nuclear Receptors: Steroid Sisters, Keystone, CO 2004, p 194 (Abstract 316)
Beato M, Arnemann J, Chalepakis G, Slater E, Willmann T 1987 Gene regulation by steroid hormones. J Steroid Biochem 27:9 –14
Diamond M, Miner J, Yoshinaga S, Yamamoto K 1990 Transcription factor
interactions: Selectors of positive or negative regulation from a single DNA
element. Science 249:1266 –1272
Hoeppner MA, Mordacq JC, Linzer DI 1995 Role of the composite glucocorticoid response element in proliferin gene expression. Gene Expr 5:133–141
Xie J, Bliss SP, Nett TM, Ebersole BJ, Sealfon SC, Roberson MS 2005 Transcript profiling of immediate early genes reveals a unique role for activating
transcription factor 3 in mediating activation of the glycoprotein hormone
␣-subunit promoter by gonadotropin-releasing hormone. Mol Endocrinol 19:
2624 –2638
Schoderbek WE, Kim KE, Ridgway EC, Mellon PL, Maurer RA 1992 Analysis
of DNA sequences required for pituitary-specific expression of the glycoprotein hormone ␣-subunit gene. Mol Endocrinol 6:893–903
Gonzalez GA, Montminy MR 1989 Cyclic AMP stimulates somatostatin gene
transcription by phosphorylation of CREB at serine 133. Cell 59:675– 680
Roberson MS, Meermann S, Morasso MI, Mulvaney-Musa JM, Zhang T 2001
A role for the homeobox protein Distal-less 3 in the activation of the glycoprotein hormone ␣-subunit gene in choriocarcinoma cells. J Biol Chem 276:
10016 –10024
Bailey JS, Rave-Harel N, Coss D, McGillivray SM, Mellon PL 2004 Activin
regulation of the follicle-stimulating hormone ␤-subunit gene involves Smads
and the TALE homeodomain proteins Pbx1 and Prep1. Mol Endocrinol 18:
1158 –1170
Coss D, Thackray VG, Deng CX, Mellon PL 2005 Activin regulates luteinizing
hormone ␤-subunit gene expression through smad-binding and homeobox
elements. Mol Endocrinol 19:2610 –2623
Attardi B, Klatt B, Little G 1995 Repression of glycoprotein hormone ␣-subunit
gene expression and secretion by activin in ␣T3-1 cells. Mol Endocrinol 9:1737–
1749
Ben-Menahem D, Shraga-Levine Z, Mellon PL, Naor Z 1995 Mechanism of
action of gonadotropin-releasing hormone upon gonadotropin ␣-subunit
mRNA levels in the ␣T3-1 cell line: Role of Ca⫹⫹ and protein kinase C. Biochem
J 309:325–329
Coss D, Jacobs SB, Bender CE, Mellon PL 2004 A novel AP-1 site is critical
for maximal induction of the follicle-stimulating hormone ␤ gene by gonadotropin-releasing hormone. J Biol Chem 279:152–162
Turgeon JL, Kimura Y, Waring DW, Mellon PL 1996 Steroid and pulsatile
gonadotropin-releasing hormone (GnRH) regulation of luteinizing hormone
and GnRH receptor in a novel gonadotrope cell line. Mol Endocrinol 10:439 –
450
McGillivray SM, Thackray VG, Coss D, Mellon PL 2007 Activin and glucocorticoids synergistically activate follicle-stimulating hormone ␤-subunit
gene expression in the immortalized L␤T2 gonadotrope cell line. Endocrinology 148:762–773
Leal AM, Blount AL, Donaldson CJ, Bilezikjian LM, Vale WW 2003 Regulation of follicle-stimulating hormone secretion by the interactions of activin-A,
Sasson et al. • GR Induces ␣GSU Gene Expression in L␤T2 Cells
43.
44.
45.
46.
47.
48.
49.
50.
51.
52.
53.
54.
55.
56.
57.
dexamethasone and testosterone in anterior pituitary cell cultures of male rats.
Neuroendocrinology 77:298 –304
Sakakura M, Takebe K, Nakagawa S 1975 Inhibition of luteinizing hormone
secretion induced by synthetic LRH by long-term treatment with glucocorticoids in human subjects. J Clin Endocrinol Metab 40:774 –779
Breen KM, Karsch FJ 2004 Does cortisol inhibit pulsatile luteinizing hormone
secretion at the hypothalamic or pituitary level? Endocrinology 145:692– 698
Wilbur JF, Utiger RD 1969 The effect of glucocorticoids on thyrotropin secretion. J Clin Invest 48:2096 –2103
Faglia G, Ferrari C, Beck-Peccoz P, Spada A, Travaglini P, Ambrosi B 1973
Reduced plasma thyrotropin response to thyrotropin releasing hormone after
dexamethasone administration in normal subjects. Horm Metab Res 5:289 –292
Re RN, Kourides IA, Ridgway EC, Weintraub BD, Maloof F 1976 The effect
of glucocorticoid administration on human pituitary secretion of thyrotropin
and prolactin. J Clin Endocrinol Metab 43:338 –346
Nicoloff JT, Fisher DA, Appleman Jr MD 1970 The role of glucocorticoids in
the regulation of thyroid function in man. J Clin Invest 49:1922–1929
Marceau H, Delgado A, MacIntosh-Hardt B, Fortier C 1972 Metabolic clearance and secretion rates of TSH following adrenalectomy and corticosterone
administration in the rat. Endocrinology 90:973–980
Fang VS, Shian LR 1981 Adrenal influence on pituitary secretion of thyrotropin and prolactin in rats. Endocrinology 108:1545–1551
Ross DS, Ellis MF, Milbury P, Ridgway EC 1987 A comparison of changes
in plasma thyrotropin ␤- and ␣-subunits, and mouse thyrotropic tumor thyrotropin ␤- and ␣-subunit mRNA concentrations after in vivo dexamethasone
or T3 administration. Metabolism 36:799 – 803
Buckingham JC, Dohler KD, Wilson CA 1978 Activity of the pituitary-adrenocortical system and thyroid gland during the oestrous cycle of the rat. J
Endocrinol 78:359 –366
Nichols DJ, Chevins PF 1981 Plasma corticosterone fluctuations during the
oestrous cycle of the house mouse. Experientia 37:319 –320
Tebar M, Uilenbroek JT, Kramer P, van Schaik RH, Wierikx CD, Ruiz A, de
Jong FH, Sanchez-Criado JE 1997 Effects of progesterone on the secondary
surge of follicle-stimulating hormone in the rat. Biol Reprod 57:77– 84
Szabo M, Kilen SM, Saberi S, Ringstrom SJ, Schwartz NB 1998 Antiprogestins suppress basal and activin-stimulated follicle-stimulating hormone
secretion in an estrogen-dependent manner. Endocrinology 139:2223–2228
Heckert LL, Schultz K, Nilson JH 1995 Different composite regulatory elements direct expression of the human ␣-subunit gene to pituitary and placenta.
J Biol Chem 270:26497–26504
Barnhart KM, Mellon PL 1994 The orphan nuclear receptor, steroidogenic
factor-1, regulates the glycoprotein hormone ␣-subunit gene in pituitary gonadotropes. Mol Endocrinol 8:878 – 885
Endocrinology, July 2008, 149(7):3643–3655
3655
58. Steger DJ, Hecht JH, Mellon PL 1994 GATA-binding proteins regulate the
human gonadotropin ␣-subunit gene in placenta and pituitary. Mol Cell Biol
14:5592–5602
59. Imai E, Miner JN, Mitchell JA, Yamamoto KR, Granner DK 1993 Glucocorticoid receptor-cAMP response element-binding protein interaction and the
response of the phosphoenolpyruvate carboxykinase gene to glucocorticoids.
J Biol Chem 268:5353–5356
60. Johannessen M, Moller S, Hansen T, Moens U, Van Ghelue M 2006 The
multifunctional roles of the four-and-a-half-LIM only protein FHL2. Cell Mol
Life Sci 63:268 –284
61. Jorgensen JS, Quirk CC, Nilson JH 2004 Multiple and overlapping combinatorial codes orchestrate hormonal responsiveness and dictate cell-specific
expression of the genes encoding luteinizing hormone. Endocr Rev 25:521–542
62. Budworth PR, Quinn PG, Nilson JH 1997 Multiple characteristics of a pentameric regulatory array endow the human ␣-subunit glycoprotein hormone
promoter with trophoblast specificity and maximal activity. Mol Endocrinol
11:1669 –1680
63. Heckert LL, Schultz K, Nilson JH 1996 The cAMP response elements of the
␣-subunit gene bind similar proteins in trophoblasts and gonadotropes but
have distinct functional sequence requirements. J Biol Chem 271:31650 –31656
64. Wieland S, Döbbeling U, Rusconi S 1991 Interference and synergism of
glucocorticoid receptor and octamer factors. EMBO J 10:2513–2521
65. Duan WR, Shin JL, Jameson JL 1999 Estradiol suppresses phosphorylation of
cyclic adenosine 3⬘,5⬘-monophosphate response element binding protein
(CREB) in the pituitary: evidence for indirect action via gonadotropin-releasing
hormone. Mol Endocrinol 13:1338 –1352
66. Liu JL, Papachristou DN, Patel YC 1994 Glucocorticoids activate somatostatin
gene transcription through co-operative interaction with the cyclic AMP signalling pathway. Biochem J 301:863– 869
67. Schüle R, Muller M, Kaltschmidt C, Renkawitz R 1988 Many transcription
factors interact synergistically with steroid receptors. Science 242:1418
68. Strähle U, Schmid W, Schütz G 1988 Synergistic action of the glucocorticoid
receptor with transcription factors. EMBO J 7:3389 –3395
69. Hagiwara M, Alberts A, Brindle P, Meinkoth J, Feramisco J, Deng T, Karin
M, Shenolikar S, Montminy M 1992 Transcriptional attenuation following
cAMP induction requires PP-1-mediated dephosphorylation of CREB. Cell
70:105–113
70. Ethier JF, Findlay JK 2001 Roles of activin and its signal transduction mechanisms in reproductive tissues. Reproduction 121:667– 675
71. Fowkes RC, King P, Burrin JM 2002 Regulation of human glycoprotein hormone ␣-subunit gene transcription in L␤T2 gonadotropes by protein kinase C
and extracellular signal-regulated kinase 1/2. Biol Reprod 67:725–734
Endocrinology is published monthly by The Endocrine Society (http://www.endo-society.org), the foremost professional society serving the
endocrine community.