Mutagenesis of the p53 Tumor Suppressor Gene
Studied in Saccharomyces cerevisiae
by
Deborah Jennie Moshinsky
B.A. in Chemistry, Immaculata College, Immaculata, PA (1992)
SUBMITTED TO THE DEPARTMENT OF CHEMISTRY
IN PARTIAL FULFILLMENT OF THE REQUIREMENTS
FOR THE DEGREE OF
Doctor of Philosophy
at the
MASSACHUSETTS INSTITUTE OF TECHNOLOGY
June 1998
@1998 Massachusetts Institute of Technology
All Rights Reserved
7T'h,
Signature of Author
K7
Certified by
-- ,)Department
of Chemistry
May 21, 1998
L
Dr G
d N. Wogan
Thesis Advisor
Accepted by
Dr. Dietmar Seyferth
Chairman, Departmental Committee on Graduate Students
i, i :'C NOLOGY
JUN I 51M9
I- IaR
kF:
5 it
This doctoral thesis has been examined by a committee of the Department of
Chemistry as follows:
. ,ofessor
J
(/
John M. Essigmann
Chairman
J
Professor
erld N. Wogan
Thesis Supervisor
Professor Steven R. Tannenbaum
Professor Peter C. Dedon
Mutagenesis of the p53 Tumor Suppressor Gene
Studied in Saccharomyces cerevisiae
by
Deborah J. Moshinsky
Submitted to the Department of Chemistry on May 21, 1998 in partial fulfillment
of the requirements for the degree of Doctor of Philosophy in Chemistry.
Abstract
Mutation of the p53 tumor suppressor gene, the product of which is an important
regulator of cell growth, represents the most common genetic alteration identified to date
in human cancers. The specific pattern of base alterations in the gene in certain tumor
types is often used to determine likely causes of the mutations and thus contributors to
carcinogenesis. This is done by identifying similarities between the mutation spectra of
the gene in cancers and patterns of mutations generated in selectable genes in model
systems after treatment with a particular carcinogen. However, sequence context effects
are known to influence sites of mutation, limiting the utility of comparing mutation
spectra of different genes. This work describes the characterization and use of a model
system to determine induced patterns of mutations directly on p 5 3 , thus circumventing
concerns about sequence context when comparisons are made with the gene in tumors.
The mutagenesis model system used is based on the fact that many mutations in
p53 inactivate the transcription activation function of the protein. This characteristic of
p53 was previously exploited to develop a selection method in Saccharomyces cerevisiae
whereby only cells with wild type protein can activate transcription of a gene that causes
a phenotypic change, thus distinguishing them from cells with mutant forms of the
protein. Here, this yeast selection method was first characterized for use in mutagenesis
studies by determining the mutation spectrum of human p53 cDNA following in vitro UV
treatment and replication in the cells. The mutation pattern was compared to that ofp53
in human skin tumors, which are thought to be caused by UV. Some similarities were
found between the two spectra, thus validating the method. A more rigorous comparison
between the two spectra was then begun by generating a large pool of UV-induced p53
mutants and analyzing for hotspot sites of mutation. Next, the selection system in the
yeast strain was modified to facilitate more efficient screening for mutants and cellular
mutagen modification. UV light was again used as a mutagen to validate that this
improved system is indeed efficient in selecting for cells containing mutantp53 and to
characterize the induced mutations resulting from this form of carcinogen treatment. In
all, selection for p53 mutants in yeast should prove to be a useful tool in the
determination of whether certain exogenous agents are likely to have caused mutations in
p53 in humans as a step in the carcinogenic process.
Thesis Supervisor: Dr. Gerald N. Wogan
Title: Professor of Chemistry and Toxicology
Acknowledgements
Many people have helped me in numerous ways during my stay at MIT. First of
all, I would like to thank my advisor, Dr. Wogan, for assisting me in learning to be a
scientist, for always supporting my ideas, and for giving me the freedom to pursue them
(even when things weren't going quite as planned...). Zhuang, Paula, and Marlene were
very generous with their time in teaching me techniques and sharing their protocols in the
early days of graduate school when I, admittedly, didn't know much about how research
is done. I thank Rony, XQ, Chen (who is now called Richard), and again Zhuang for
many interesting scientific discussions and for their seemingly endless enthusiasm and
ideas; this was responsible for helping me to keep my spirits up when there was a lot of
hard work to be done and no end in sight. I am grateful to Professor Bill Thilly for
helping me to fully realize the importance of studying large sample sizes and for
interesting and enlightening discussions. I also thank Dr. Will Rand at Tufts Medical
School for his willingness to help in the statistical analysis of my data (in the last few
weeks of my graduate school career). Denise MacPhail - thanks for the assistance in
preparing the figures and tables for the papers, posters, and presentations through the
years, and for the fun discussions about ER we used to have (before your baby Emma
came along). Laura Trudel also seemed to always be around and willing to help out in any
way she could, even though she worked 'down in the basement.'
Many others worked in the lab during my time here - Jeongmi, Eddie Li, JJ,
Mark, Dierdre, Zhifeng, William, Fayad, Judy, Zhi, Faye, Bill, Dave, Jim, Debbie, Jill,
Marianne, and others. All of you aided me in determining how work should or should not
be done and contributed to an environment where I could perform to the best of my
ability. Misun in the past couple of years, and more recently, Burcak, have really been a
lot of fun to work near, with their good humor and willingness to 'talk science.'
I thank
Misun for being a good friend whom I could really talk to, for teaching me a little bit of
Organic Chemistry (enough to understand why her work wasn't going quite as
planned...), for being my pool playing buddy on Tuesdays at Flat Top Johnny's, and
most recently for devoting a lot of time to helping me with several of the figures in this
thesis. And what would I have done without Burcak's help when I started writing before
all the results were in?
Lawrence Calvin should be acknowledged for being a good friend and for helping
me to learn a multitude of things about myself and about life in general. Kathy Robbins,
whom I met during my stay in San Francisco for the internship at SUGEN, should be
thanked for being a friend and for putting up with my little obsessions. At SUGEN, one
helpful technique that Mario convinced me to try was spreading bacteria (or yeast) plates
with glass beads instead of a spreader. I'm noting it here because it saved me a lot of time
and frustration during the past year when I literally spread hundreds of plates. Harald,
Rachael, and my other co-workers at the company (Audie, Rick, Terence, Miloe, and
Gina) were a lot of fun to work with (and play pool against). Also, as Misun and Kathy
both know, this section wouldn't be complete without at least mentioning GF. If nothing
else, thank you for making my life a bit more interesting.
Finally, I'd like to thank my family; Mom, Dad, Alan, Grandma, and Grandpa thank you for being there for me, for believing in me, for your unending generosity, and
for always having a good meal prepared when I came to visit.
Table of Contents
Title Page
1
Abstract
3
Acknowledgements
4
Table of Contents
6
List of Figures
10
List of Tables
11
Abbreviations
12
Chapter 1. Background and Literature Review
13
Introduction
14
UV Light and Cancer
16
1. Molecular Genetics of Skin Cancer
16
2. UV-Induced DNA Damage
19
3. UV-Induced Mutagenesis
20
Model Systems
Premutagenic DNA Lesions
UV-C vs. Sunlight
Yeast vs. Mammalian Cells
Sequence Context Effects
The p53 Tumor Suppressor Gene
28
1. Structure and Functional Domains
29
2. Biochemical Functions
32
Sequence Specific DNA Binding and
Transcription Activation
Transcription Repression
3. Biological Roles
35
Growth Arrest
Apoptosis
Other Cellular Roles
4. Suppression of Transformation
39
Molecular Archaeology of p53 Mutations
42
1. Mutation Spectra Analysis
42
2. UV and Skin Tumors
43
3. Other Environmental Agents and Cancer
47
4. The Utility of Yeast Functional Assays
49
References
58
Chapter 2. UV-Induced Mutagenesis of Human p53 in a Vector
Replicated in Saccharomyces cerevisiae
75
Introduction
76
Materials and Methods
78
1. Plasmids and UV Treatment
78
2. Yeast Culture and Transformation
78
3. Plasmid Survival and Mutation Frequency
80
4. Statistical Analysis
80
5. Isolation and Characterization of Mutants
81
Mutant Prescreening
Plasmid Recovery
6. Hotspot Determination
Results
82
84
1. Reconstruction Experiment
84
2. UV-Induced Mutations
85
Plasmid Survival and Mutation Frequency
Mutation Spectrum
3. Spontaneous Mutations
88
Mutation Frequency
Mutation Spectrum
4. Site and Strand Specificity of Mutations
89
5. Mutation Comparison with Human Skin
90
Discussion
92
References
105
Chapter 3. Analysis of Hotspot Mutations Induced in Human p53
Following In Vitro UV Treatment and Replication in Yeast
109
Introduction
110
Materials and Methods
112
1. Yeast Cells and Plasmids
2. UV Treatment and Mutant Generation
3. Mutant DNA Isolation
4. CDCE Analysis
Results and Discussion
114
1. Mutant Generation
2. CDCE Analysis
References
120
Chapter 4. UV-Induced Mutagenesis of Human p53 : Analysis
Using a Double Selection Method in Yeast
121
Introduction
123
Materials and Methods
125
1. Yeast Strains, Media, and Plasmids
125
2. Reconstruction Experiment
126
3. UV Mutagenesis
127
4. Mutant Characterization
128
Yeast Functional Assay
Sequencing
Results
129
1. Alteration ofp53 Mutant Selection System
129
2. Reconstruction Experiment
129
3. UV Mutagenesis
130
4. Mutant Characterization
131
5. Spontaneous Mutation Frequency
133
Discussion
135
References
144
Chapter 5. Screening for CDK2 Inhibitors for Potential Use as
Chemotherapeutic Agents.
147
Introduction
148
Materials and Methods
150
1. Enzyme, Inhibitors, and Reagents
2. In Vitro CDK2/Cyclin A Inhibition Assay
Results and Discussion
151
References
155
Chapter 6. Conclusions and Suggestions for Future Research
157
List of Figures
Figure
Title
1-1
Multistage process of skin cancer
52
1-2
UV-induced DNA damage
53
1-3
UV-C and UV-B-induced DNA adducts
54
1-4
Schematic diagram of the p53 protein
55
1-5
Distribution ofp53 mutations in selected human cancers
56
1-6
Yeast functional assays
57
2-1
Distribution of spontaneous and UV-induced (300 J/m 2)
mutations in exons 5-8 ofp53 in pLS76
100
3-1
CDCE profile of wild type and mutant p53 standards
117
3-2
CDCE profile of pooled p53 mutant sample at various
temperatures
118
3-3
CDCE profile of wild type p53 control sample
119
4-1
pSS1CANla p53 mutant selection vector
139
4-2
yDM56p plated on selective medium
140
5-1
FGFR inhibitors
153
5-2
CDK2 inhibitors
154
List of Tables
Table
Title
1-1
p 5 3 transactivated genes
2-1
Mutation frequency of pLS76 wt following treatment with
UV light and replication in yeast
2-2
102
Site and strand specificity of spontaneous and
UV-induced mutations
2-4
101
Types of mutations in spontaneous and UV-induced
(300 J/m 2) pLS76 and in human cells
2-3
33
103
Comparison of p53 hotspot mutations generated in yeast
and in human sun-exposed skin
104
4-1
Reconstruction experiment
141
4-2
Spontaneous and UV-induced mutant fractions in yDM56p
142
4-3
Sequence alterations in spontaneous and UV-induced mutants
143
Abbreviations
(6-4) photoproducts
pyrimidine (6-4) pyrimidone photoproducts
AFB 1
aflatoxin B
AK
actinic keratosis
BaP
benzo(a)pyrene
BCC
basal cell carcinoma
CAK
CDK-activating kinase
CDCE
constant denaturant capillary electrophoresis
CDK
cyclin dependent kinase
CKI
CDK inhibitor
CPD
cyclobutane pyrimidine dimer
FGFR
fibroblast growth factor receptor
IGF-I-R
insulin-like growth factor I receptor
LMPCR
ligation mediated PCR
PCNA
proliferating cell nuclear antigen
PTK
protein tyrosine kinase
RFLP/PCR
restriction fragment length polymorphism / PCR
RGC
ribosomal gene cluster
SCC
squamous cell carcinoma
TAF
TBP-associated factors
TBP
TATA-box binding protein
XP
xeroderma pigmentosum
1. Background and Literature Review
Introduction
The theory that cancer is a multistage process involving several mutations was
introduced in the early 1950's (1-3). Carcinogens were proposed to accelerate this
process by increasing the rate at which mutations occur. This concept was later refined
to incorporate the idea of clonal expansion, wherein a given cell acquires successive
mutations, each of which give it a proliferative advantage over surrounding cells (4).
The subsequent discovery of proto-oncogenes and tumor suppressor genes,
normal cellular genes that control cell growth, made it possible to begin to trace the genetic
changes that occur during carcinogenesis (reviewed in refs. 5, 6). In an elegant series of
studies, specific mutations in colorectal tumors of different stages of development were
documented in order to construct a genetic model for the progression of these tumors
(reviewed in refs. 7, 8). These studies revealed that mutations in certain proto-oncogenes
and tumor suppressor genes occur in a preferred order and that at least 7 different genetic
alterations are required for these tumors to reach a fully malignant state (8).
Although the fact that mutations are central to carcinogenesis is well established,
the precise role of environmental agents in promoting the process is still open to debate
(reviewed in refs. 9-11). In addition to agents that are mutagenic, many carcinogens have
been found that are not genotoxic (reviewed in ref. 12), and these could act by increasing
cellular proliferation, decreasing apoptosis, or altering gene expression by epigenetic
mechanisms such as changing DNA methylation status. Furthermore, the mutation
patterns in certain genes in many tumor types correlates more closely with those
characteristic of endogenous processes than with the patterns generated by specific
mutagens (8, 13).
The purpose of the work described in this thesis is to address whether certain
environmental agents directly induce the mutations seen in human tumors. This was
accomplished first by using a model system to analyze mutations in the p53 tumor
suppressor gene resulting from replication of the damaged DNA sequence in yeast. A
comparison was then made with the mutation pattern of the gene in human tumors to
determine whether they are similar. UV light was used as a mutagen to validate the
system; however, the method can be applied to the study of any carcinogen to establish
whether the agent induces mutations in p53 and to identify mutagenic carcinogens in
complex mixtures of compounds.
This chapter introduces the work first by reviewing what is known about the
carcinogenicity and mutagenicity of UV light, the mutagen used throughout these studies.
Then, an overview of the current knowledge about the importance of the p53 gene in
tumor suppression is presented. Finally, the significance of the work is illustrated by
presenting how the field of molecular archaeology is being used to determine the likely
cause of the mutations in certain tumor types through the analysis of mutation spectra.
UV Light and Cancer
An association between sunlight and skin cancer was first noted in the late 1800's
when the increased cancer susceptibility of fair skinned individuals exposed to a large
amount of sunlight was documented (14). Subsequent studies on laboratory animals
established that UV light was likely the carcinogenic agent inducing this effect (reviewed
in ref. 15). Wavelengths in the UV-A (320-400 nm) and UV-B (280-320 nm) regions of
the solar spectrum are thought to be responsible for the carcinogenicity of this agent
because they are able to penetrate the ozone layer and reach the earth. The incidence of
skin cancer has been increasing rapidly in recent years, and this has been attributed to
depletion of the ozone layer (which normally blocks shorter wavelength UV-C (190-280
nm) light) and an increased frequency of recreational activities involving exposure to the
sun (16).
Molecular Genetics of Skin Cancer
Exposure to UV light is considered to be a major risk factor for the development
of squamous cell carcinoma (SCC), basal cell carcinoma (BCC), and melanoma. The
cellular origins of SCC and BCC are epithelial keratinocytes, whereas melanoma originates
from melanocytes present in the epithelium. The role of sunlight in the development of
melanoma is more controversial than that for SCC or BCC (17), so this discussion will be
limited to the latter two cancer types.
Several studies have reported mutations in ras oncogenes in nonmelanoma skin
cancers in humans and mice with a frequency varying from 10 to 40% (reviewed in refs.
15, 18, 19). Ras proteins are involved in the promotion of cell growth, and mutation at
specific sites can result in constitutive activation causing uncontrolled cell proliferation.
The fact that the frequency of these mutations is low and variable implies that either
mutations in ras may not be of critical importance in the development of skin cancer or
that this represents just one of several pathways leading to malignancy (19).
Alterations in the p53 tumor suppressor gene have been detected at a relatively
high frequency in human skin tumors (=50% for SCC and BCC). Additionally, =40% of
UV-induced mouse tumors contain mutations in the gene (20). The base changes
observed in p53 from these tumors are similar to those induced in model systems by UV
light (discussed further below), implying that this agent is responsible for the mutations.
Furthermore, the fact that the mutations observed in the tumors all alter the amino acid
sequence of the protein implies that a loss of function occurred, which could lead to a
proliferative advantage of these mutant cells over other surrounding cells (21) in light of
the fact that p53 is a negative regulator of cell growth (reviewed in ref. 22 and discussed
below).
A more detailed explanation of how UV acts as a carcinogen with respect to
inactivation ofp53 was provided by Ziegler, et al. (23) in a study that examined the
timing ofp53 mutations in SCCs and also the UV-induced cellular response of mice that
lack functional p53. This study found that 60% of 45 actinic keratosis (AK; a precursor
for SCC) samples contained mutations in p 5 3 , implying that these mutations occur as an
early event in the carcinogenic process. Furthermore, irradiation of the skin of mice
lacking functional p53 failed to produce the 'sunburn cells', which were demonstrated to
be undergoing apoptosis, present in wild type mice. Mice in which one p53 allele was
disrupted had an intermediate level of apoptotic cells present following UV treatment.
The authors interpreted this to mean that UV can act as both a tumor initiator and
promoter by causing mutations in p53 in keratinocytes and then inducing apoptosis in
cells with wild type p53, thus allowing the mutants room to proliferate. Further exposure
to UV repeats the process, permitting expansion ofp53 mutants and perhaps the
accumulation of additional mutations relevant to cancer induction.
Numerous other studies also support the conclusion that p53 mutation occurs
early in skin cancer development (24-31). However, not all investigators agree that they
are necessarily causative. This reservation is mainly based on data indicating that normal
epithelial cells frequently contain p53 mutations that are often not identical to p53
mutations in adjacent precancerous or cancerous lesions from the same patient, implying
that the mutations are separate, perhaps coincidental events (28, 30). This is presently
an area of active research, and new clues as to the role ofp53 mutations in nonmelanoma
skin cancers will undoubtedly soon be uncovered.
Aside from inducing mutations inp53, UV light may also exert its carcinogenic
effect by immunosuppression and/or the induction of oxidative stress (reviewed in ref.
19). Additionally, data has been generated suggesting that mutations in other known or
putative tumor suppressor genes may also be important in the progression of BCC and/or
SCC (32-34). A generalized summary of the current knowledge of the molecular events
leading to skin cancer, depicted within the theme of multistage carcinogenesis, is
presented in Figure 1-1.
UV-Induced DNA Damage
One of the cellular targets for sunlight induced damage is DNA. Much work has
gone into characterizing the nature of the base damage produced in an attempt to
determine the mechanism of mutagenesis by UV. The types and frequency of DNA
adducts resulting from UV-treatment are dependent upon the wavelength of the light and
the DNA sequence context (reviewed in refs. 35, 36). An overview of the damage caused
by different wavelengths of UV is shown in Figure 1-2. UV-C (190-280 nm), which is
blocked by the ozone layer yet is used in many studies of UV induced mutagenesis in
model systems, induces primarily cyclobutane pyrimidine dimers (CPDs) and to a lesser
extent pyrimidine (6-4) pyrimidone photoproducts (35). Other lesions such as TpA
photodimers (37), 8,8-adenine dehydrodimers (38), purine photoproducts (39), and
adducts involving 5-methylcytosine (40) have also been detected at a low frequency
following high dose in vitro DNA treatment, and cytosine photohydrate has been
reported to form in vivo =-100 times more slowly than cyclobutane pyrimidine dimers
(41). UV-B (280-320 nm) induces mainly the same DNA lesions as UV-C, except that
313 nm light can cause isomerization of the (6-4) photoproduct to form the Dewar
isomer. The chemical structures of a TpT CPD, (6-4) photoproduct, and Dewar isomer
are depicted in Figure 1-3. UV-A (320-400 nm) is different in that it causes DNA damage
indirectly through the generation of oxygen radicals mediated by endogenous
photosensitizers (Figure 1-2; ref. 36).
Early studies showed that CPDs are formed preferentially at TpT sites over TpC
and CpT, and that formation at CpC sites is the least frequent (42-44). For the (6-4)
photoproduct, the frequency is highest for TpC, then CpC and TpT, and lowest for CpT
sites (45, 46). However, formation of these two lesions also depends on longer range
sequence context effects, as they both tend to occur within long runs of dipyrimidines
(47). More recently, sensitive techniques have been developed that enable investigators
to determine the sites of CPD and (6-4) photoproduct lesions at nucleotide resolution in
cellular DNA (reviewed in ref. 48). This allows the mapping of DNA damage that occurs
in genes in their endogenous state and the determination of the effects of chromatin
structure on final base damage. This should lead to clearer insight into the rules that
govern which sites are ultimately damaged by UV in cellular DNA.
UV-Induced Mutagenesis
Countless studies have been performed to investigate the mutational effects of UV
irradiation in various mammalian, yeast, and bacterial systems. The consensus mutational
pattern from each cell type is that GC to AT transitions predominate at dipyrimidine
sequences (reviewed in ref. 35). This section will discuss results derived from the
investigation of shuttle vectors in mammalian and yeast cells as representative examples
of the findings of the majority of the studies and to highlight the similarities of the
mutation pattern produced in these two cell types.
Model Systems
Shuttle vectors are circular DNA extrachromosomal plasmids that contain
sequences necessary for replication in bacterial and other cell types such as mammalian
(49) or Saccharomyces cerevisiae (50). Those used for mutagenesis studies also carry a
'target' gene in which inactivation by mutation causes a phenotypic change in either
bacterial or yeast cells to allow mutant identification and selection. Mammalian shuttle
vectors that carry the bacterial supF gene (pZ 189 and derivatives) and a yeast vector
carrying the SUP4-o gene as a mutation target (YCpMP2) have been used extensively for
the study of UV-induced mutagenesis (35, 51-57 and references therein). Both of these
genes encode suppressor tRNAs that can read through either amber (supF) or ochre
(SUP4-o) stop codons. The particular bacterial or yeast indicator strains in which these
vectors are propagated contain strategically placed amber or ochre codons within genes
that cause a phenotypic change in the cells. Thus, in cells with functional suppressor
tRNAs, the selection gene is transcribed, whereas in cells with mutant suppressor
tRNAs, the selection gene cannot be fully transcribed, leading to the phenotypic change.
Bredberg et al. (58) established that the predominant base alterations that occurred
in the UV-irradiated supF gene following passage of the vector through normal human
fibroblasts were GC to AT transitions, which represented 73% of the base substitutions.
Transversions occurred in 25% of the cases, with GC to TA the most common.
Furthermore, all of the base changes occurred at dipyrimidine sequences, most notably
TC and CC sites, which are potential sites of formation of CPDs and (6-4)
photoproducts. This predominance of GC to AT mutations at dipyrimidines is in accord
with the vast majority of UV mutagenesis studies of cellular genes in mammalian systems
(35, 59-62) and other studies using the supF containing shuttle vector following
replication in a variety of mammalian cell backgrounds (35, 51, 53, 54, 56, 57). These
data support the validity of shuttle vectors for the study of mutagenic mechanisms by
UV in human cells, as the mutation endpoints were the same in both cases. Also of note
is the fact that tandem CC to TT base changes occur in both shuttle vector and cellular
gene systems, and these are considered to be mutations specific to treatment with UV
light, as they rarely occur following modification by any other mutagen studied to date
(63).
In the SUP4-o gene carried on an episomal vector in yeast, UV treatment of whole
cells also resulted in predominantly GC to AT transitions (66% of the total base
substitutions), with >90% at dipyrimidine sequences that were mostly either TC or CC
sites (64). However, AT to GC transitions occurred at a higher frequency (nearly 20%)
than that found in mammalian systems, and although CC to TT transitions were
recovered, they were rare. Other studies of UV-induced mutagenesis in yeast also
showed a higher frequency of AT to GC transitions than that seen with mammalian cell
systems (65, 66), perhaps indicating that there may be some differences in the processes
leading to mutagenesis in these two cell types.
Experiments on UV mutagenesis with DNA repair deficient cells derived from
patients with xeroderma pigmentosum (XP) and with excision repair deficient yeast
strains have also been performed. XP is a disorder characterized by sun sensitivity and a
>1000 fold increased risk of sunlight induced skin cancer, and cells from these individuals
lack the ability to perform nucleotide excision repair (67). Investigations using these cells
as hosts to passage UV irradiated supF containing shuttle vectors have demonstrated that
the types of base changes and sequence specificity are similar to those in repair proficient
cells. Notable differences in the two spectra were the higher frequency of GC to AT
transitions in XP cells along with a less frequent occurrence of GC to TA transversions
and multiple base changes (not including tandem CC to TT; refs. 58, 68, 69). Since XP
cells are unable to repair UV photoproducts and mutated sites occur predominantly at
dipyrimidines, this strongly suggests that GC to AT mutations result directly from base
misincorporation during replication of the damaged template. The same pattern, i.e., a
higher incidence of GC to AT transitions and lower frequency of GC to TA
transversions, was also observed in excision repair deficient yeast compared to repair
proficient cells (70).
Premutagenic DNA Lesions
The main premutagenic DNA lesions in both yeast and mammalian cells appear to
be the CPDs. Data in support of this was obtained in photoreactivation studies. Yeast
and E. coli cells contain a photoreactivating enzyme (DNA photolyase) that uses visible
light to selectively break the cyclobutane ring of CPDs, thus repairing the lesions (71).
Two studies that examined UV mutagenesis of in vitro modified DNA after passage
through mammalian cells found that treatment of the DNA with E. coli photolyase prior
to transfection into the cells reduced the mutation frequency by at least 80% (72, 73). A
similar study in yeast that used a defined wavelength light source to induce the cellular
photolyase after treatment of whole cells with UV also reduced the mutation frequency
by =75% (74). In these studies, however, the induced mutation frequency after
photoreactivation was still 5-10 fold over background, indicating that either other lesions
are mutagenic as well or that photoreactivation was not 100% effective in removing the
CPDs.
UV-C vs. Sunlight
Most UV mutagenesis studies involved the use of UV-C which, as mentioned,
should not contribute significantly to skin cancer development in humans since it is
blocked by the ozone layer. Some studies have addressed whether the mutation spectrum
produced by treatment with UV-B or simulated sunlight is the same as that with UV-C.
Treatment of human cells with simulated sunlight causes the conversion of the majority of
(6-4) photoproducts to their Dewar isomers, as opposed to treatment with UV-C, which
cannot induce this conversion (75), implying that the mutation spectrum also may differ
between the two treatments as a result of different damage induction. In mammalian cells,
the mutation types were found to be similar in the supF containing shuttle vector
following UV-B or -C treatment, but the UV-B-induced spectrum contained more
insertions, deletions, and multiple mutational events (76). In yeast, UV-B mutagenesis
gave a virtually identical mutation spectrum as that of UV-C, but tandem base changes
occurred more frequently (77). In contrast, sunlight induced mutagenesis in yeast reduced
the frequency of GC to AT transitions (40% vs. 66%) and increased that of GC to TA
transversions (27% vs. 2%) compared to UV-C modification (70). These studies indicate
that while UV-C is a suitable model mutagen to study the mutagenic effects of CPDs and
(6-4) photoproducts, it may not exactly reproduce the mutation spectrum induced by
sunlight because of differences in the nature of DNA lesions.
Yeast vs. Mammalian Cells
Since the mutation types generated in yeast systems following UV irradiation are
broadly similar to those induced in mammalian cells, this implies that the processes
leading to mutagenesis (including DNA repair and polymerase misincorporation of bases
on damaged templates) are similar in the two systems, and that the study of mutagenesis
in yeast accurately reflects the same process in humans. Indeed, the excision repair
pathways in the two cell types exhibit remarkable functional conservation (78),
suggesting that this process may be similar. However, a direct investigation into the
question of whether polymerase base misincorporation is the same in these two cell types
has revealed slight differences. This was done by using site specific mutagenesis, wherein
a single photoproduct is placed at a defined site within a DNA sequence, and the
mutations that result from replication in either yeast or mammalian cells is determined.
Single stranded DNA was used as a template to avoid the complication of DNA repair,
and the mutagenicity of a CPD and a (6-4) photoproduct at a TpT site were examined
(79). TT CPDs were not found to be highly mutagenic in either cell type, but the TT (64) photoproduct induced mutations 60% of the time in mammalian cells and 29% in
yeast. The types of mutations recovered were not identical; in the mammalian cells, G to
T transversions occurred at the G 5' to the TT (6-4) photoproduct in 80% of the cases,
while T to C transitions were observed at the 3'T of the lesion in yeast in 70% of the
mutants examined. Although these experiments were not performed with adducts that are
believed to be responsible for the majority of UV-induced base changes (TC and CC
CPDs; discussed above), they do reveal important differences in polymerase base
misincorporation and may partly explain the subtle differences in the types of mutations
recovered using cells of these types.
Sequence Context Effects
Early studies in E. coli indicated that mutation hotspots correlate with UVinduced DNA damage hotspots (47). In mammalian systems, however, the situation
seems to be more complex. In human cells, this correlation of damage and mutation
hotspots does not exist (80). Sites of frequent mutations are likely more dependent on
surrounding sequences than on adduct load. This important concept is nicely illustrated
by a series of experiments that investigated the effects of sequence context on UVinduced hotspot mutagenesis in the supF containing shuttle vector passaged in repair
deficient human cells (81-83). These experiments involved the alteration of the supF
sequence by either one or two nucleotides or by copying an 8 base palindrome into a
different region of the gene. Comparison of the mutation patterns of the variants
following UV irradiation to that obtained with the native supF gene revealed that changing
a single base in the DNA sequence resulted in either increased or decreased mutability at
hotspot sites close to the base alteration (8 bp in one instance) or far away from the site
(48 and 80 bp in two other variants; ref. 81, 83). Copying the 8 base palindrome that
contains two hotspot sites in the native supF gene and moving it to a different region
retained the mutability of the sites (although with different mutation frequencies), but this
resulted in the creation of a new hotspot site =70 bp away (82). Furthermore,
examination of the CPD and (6-4) photoproduct damage spectrum of the supF gene and
the variants revealed that in most instances, the increased or decreased mutation
frequencies at hotspot sites could not be explained by differences in photoproduct
formation frequencies (81-83). These results clearly indicate that much remains to be
learned about the processes that govern mutational hotspot formation and reinforce the
idea that mutation patterns in different genes cannot be easily compared.
As alluded to above, the p53 mutation pattern in skin tumors has been compared
to the patterns generated in model systems using UV light as a mutagen in an attempt to
establish that UV causes mutations in this gene, thus leading to the development of
cancer. Since the data generated in model systems consists of mutation patterns on supF
or endogenous mammalian genes with no relation to cancer, this comparison is less than
ideal. This thesis deals with the characterization and use of a yeast model system to
determine mutation patterns directly on p53 in an attempt to circumvent the problem of
sequence context effects in the comparison of mutation spectra.
The p53 Tumor Suppressor Gene
The p53 protein was first discovered by several groups independently in 1979
when it was immunoprecipitated from Simian Virus 40 (SV40) transformed cells using
SV40 or large T antigen antiserum (84-87) and from various transformed cells using antitumor serum (87, 88). Early clues to the involvement of this protein in the control of
non-transformed cell growth came with the finding that the stimulation of DNA
replication and mitosis in T-lymphocytes treated with concanavalin A is correlated with
expression of p53 (89) and that microinjection of antibodies directed against this protein
inhibited entry of Swiss 3T3 mouse cells into S phase following serum stimulation (90).
Subsequently, p53 was classified as an oncogene when three groups demonstrated that the
gene product could cooperate with an activated ras gene to transform primary rat cells
(91-93). Shortly thereafter, however, investigators began to discover that cell
transformation was associated with mutated forms of the protein (94), and that the clones
used in the initial ras cooperation experiments encoded mutant p53 (95, 96). Finally, it
became clear that p53 is indeed a tumor suppressor gene when the Levine group showed
that the wild type form can inhibit transformation of cells transfected with either E 1A
plus ras or mutant p53 plus ras (97).
Since that time, several other lines of evidence have come together to illustrate the
importance of wild type p53 in the suppression of transformation. First of all, p53 is the
most frequently mutated gene found to date in human tumors (over 50% of tumors
contain mutations in this gene), and it has been found to be mutated in a wide variety of
tumor types (98-100; reviewed in refs. 63, 101). Secondly, introduction of wild type p53
into cells that have only mutated forms of the protein or lack it altogether results in
growth arrest or cell death (102-105). Additionally, a familial cancer syndrome in which
patients are predisposed to a diversity of mesenchymal and epithelial cancers (LiFraumeni syndrome) is associated with inherited mutations in p53 (106, 107). Similarly,
knockout mice with deleted p53 are predisposed to multiple types of sarcomas,
lymphomas, and other tumor types (108). Finally, cells from Li-Fraumeni patients and
from p53 knockout mice can spontaneously immortalize in culture at a higher frequency
than normal cells (109, 110).
The central importance of p53 in halting neoplastic transformation combined with
the advances in elucidating its biochemical functions earned this protein the distinction of
election as molecule of the year in 1993 by Science (111). In fact, so much effort has gone
into determining the precise cellular roles of p53 that a recent review admits that
"literature on p53 during the past few years has been massive, making it impossible for us
to refer to every recent publication" (22). Thus, the known and proposed cellular
functions of p53 will be only briefly described here in order to illustrate what is known at
the present time about how p53 achieves its goal of suppressing transformation and how
it is inactivated in tumors.
Structure and Functional Domains
The p53 protein is comprised of 393 amino acids and has been divided into 3
distinct functional domains (reviewed in refs. 22, 112-114, and presented in Figure 1-4).
The first domain consists of residues 1-43 and is responsible for the transcription
activation ability of the protein. This domain can interact with a variety of proteins:
those involved in general transcription - TATA box binding protein (TBP) and TBPassociated factors (TAFs); a subunit of the transcription coupled repair factor, TFIIH;
the single stranded DNA binding protein RP-A; and the cellular oncogene mdm2. The
adenovirus E1B 55 kD protein can also bind to this region of p53 to inactivate its
function (22). The crystal structures of this domain bound to mdm2 (115) and bound to
p53BP2, another p53 binding protein of unknown function (116), were recently solved in
order to provide insight into the cellular regulation of the transactivation function of the
protein.
The second domain of p53 is the sequence specific DNA-binding region that
encompasses residues 100-300. This domain contains four of the five most highly
evolutionarily conserved regions of the protein and includes the most frequently mutated
sites in p53 in human cancers. The crystal structure of this region bound to DNA (117)
indicates that the residues most frequently mutated in cancers are important contributors
to this sequence specific DNA binding function. The mutations are divided into two
classes - those that involve amino acids that contact the DNA directly (contact mutants)
and those that result in changes in the supporting 'scaffold' that holds the contact amino
acids in place (conformational mutants). In fact, the evolutionarily conserved regions
form the binding contacts with DNA while the less conserved regions of this domain
comprise the 3 sandwich scaffold important for the conformation of the protein. The
sequence specific DNA binding domain is also responsible for the binding to SV40 large T
antigen (22).
The third domain is located in the carboxyl-terminal region of the protein and
consists of residues 300-393. This domain is responsible for the ability of the protein to
catalyze the reannealing of complementary single strands of RNA or DNA and for the
nonspecific binding of p53 to DNA (22). The C-terminal domain can be further
subdivided into the flexible linker (residues 300-320), tetramerization (residues 320-360),
and basic (residues 363-393) regions. Structures of the tetramerization domain have been
determined by both NMR (118-121) and x-ray crystallography (122, 123). Much
interest in this oligomerization domain exists mainly because it has been shown to be the
minimal region required for transformation and because mutants can act dominantly over
wild type sequences through this domain by oligomerizing with wild type monomers and
forming inactive tetramers (123).
The highly basic C-terminal 30 amino acid region of the protein is thought to play
a role in the regulation of DNA binding by p53. When this region is deleted,
phosphorylated by casein kinase II (124) or protein kinase C (125), or bound by proteins
or short peptides (124, 126, 127), p53 is strongly activated for sequence specific DNA
binding. The proposed model to explain these results is that p53 exists in a conformation
that is inactive for DNA binding and can be activated by a regulatory molecule acting
upon the C-terminus of the protein (22).
Biochemical Functions
Sequence Specific DNA Binding and Transcription Activation
The amino terminus of p53 was first demonstrated to have transcription
activation capabilities when it was fused to a GAL-4 DNA binding protein and shown to
strongly activate transcription of a reporter gene downstream of the GAL-4 DNA
recognition sequence (128-130). Subsequently, a human DNA sequence that binds wildtype but not mutant p53 was identified (131), and experiments involving the
cotransfection ofp53 with a vector containing this DNA sequence adjacent to a reporter
gene showed that full length p53 can activate transcription in cells from a human DNA
element. Furthermore, mutated forms of p53 had lost this ability and could interfere with
the activity of wild-type protein (132). Additional studies identified numerous human
genomic DNA fragments (133) and synthetic oligonucleotides (134) that bind p53. This
led to the definition of a genomic DNA consensus binding sequence as two copies of 5'PuPuPuC(A/T)(T/A)GPyPyPy-3' separated by 0-13 base pairs (133). The site perfectly
matches the more specific consensus sequence that was discovered in the study using
random oligonucleotides and shown to promote transcription activation by p53 in
mammalian cells (134). Similar studies using purified mouse and human p53
demonstrated that the protein can activate transcription in vitro, arguing against the
possibility that this activity in cells could be an artifact of overexpression of the protein
(135).
Many genes have subsequently been shown to be transactivated by p53 (reviewed
in ref. 22). Those that are likely to be relevant cellular targets are presented along with
their cellular functions in Table 1-1. These were shown to be activated by p53 from its
recognition sequences in the endogenous promoter of the gene and to be induced following
DNA damage in cells with wild type and not mutant p53.
Table 1-1. Genes transactivatedby p53.
Gene Product
Cellular Function
Reference
p21, WAF1, Cipl
Arrests cells in G1 by inhibiting cyclin
(136-138)
dependent kinases.
mdm2
GADD45
Inhibits p53 function.
(139-141)
Inhibits entry into S phase following
(142-144)
DNA damage; involved in DNA repair.
cyclin G
Possible role in G2/M cell cycle
(145-148)
transition.
bax
IGF-BP3
Promotes apoptosis.
(149)
Inhibits signaling by insulin-like growth
(150)
factor.
PCNA
DNA replication protein; required for
(151)
DNA repair
Several other genes are thought to be up-regulated by p53 but have not yet been
shown to meet all of the criteria defined above for relevant cellular targets (22). More
recently, HIC-1 (hypermethylated in colon cancer-1; ref. 152), FAC, the gene for the
cancer predisposition syndrome Fanconi Anemia, complementation group C (153), and
several novel genes involved in the control of cellular growth along with previously
characterized genes (namely SM20, microsomal epoxide hydrolase, and EGR-1) have been
proposed to be activated by p53 (154, 155). Additionally, many genes involved in
apoptosis have recently been shown to be up-regulated in the same manner. These
include angiotensinogen, angiotensin II (156), and the novel genes p85 (157), PAG608
(158), KILLER/DR5 (159), and the human homologue of the Drosophila seven in absentia
gene (160, 161). Two studies have also used a global approach to simultaneously identify
many p53 dependent up-regulated genes in cells induced to undergo apoptosis and
discovered novel as well as previously described genes (160, 162).
Transcription Repression
In addition to its ability to activate the transcription of certain genes, p53 can also
repress transcription. Specific genes such as bcl-2 (163), insulin-like growth factor I
receptor (IGF-I-R; ref. 164), and the gene for a microtubule associated protein MAP4
(165), each of which is implicated in the inhibition of apoptosis, have been shown to be
down-regulated by p53 along with several oncogenes and other various genes (166-171
and references therein). It was initially thought that p53 inhibits transcription by
associating with TBP, thus preventing efficient transcription initiation (172, 173), but
more recent results indicate that binding to TAFs may be essential for this activity (22).
Biological Roles
Growth Arrest
Following treatment of certain cell types with DNA damaging agents, p53
accumulates and leads to growth arrest (reviewed in refs. 22, 114, 174). This is thought
to occur mainly by up-regulation of the p21 gene, the product of which is an inhibitor of
cyclin dependent kinases (CDKs) and proliferating cell nuclear antigen (PCNA). Cells
treated with radiation exhibit p53 specific inhibition of cyclin A / CDK2 and cyclin E /
CDK2 in this manner (175). The inhibition of CDKs prevents the phosphorylation of
Rb (176), which causes it to remain complexed to the E2F transcription factor, thus
leading to growth arrest in the GI phase of the cell cycle. PCNA is an auxiliary factor for
DNA polymerases 8 and e, and its suppression by p21 causes inhibition of DNA
synthesis (177-179) but not DNA repair (179). This also results in GI arrest following
DNA damage and allows time for repair to occur before entry into S phase. Notably,
cells from mice that lack the p21 gene also have a partially deficient cell cycle arrest in G1
following radiation treatment (180, 181). This reinforces the fact that p21 is important
for the GI induced cell cycle arrest, but indicates that some other factor(s) may be
involved as well. Perhaps the transactivation of some of the genes listed in Table 1-1
plays a part in the arrest, or possibly another function of p53 is involved in this process.
In addition to its role in arresting cells in Gi, p53 has also recently been
implicated in a G2 arrest checkpoint (147, 182-186 and references therein) and also as a
mitotic checkpoint (187) suggesting a means by which cells lacking p53 undergo gene
amplification (188, 189) and eventually become aneuploid (110). Participation in the
control of the GO/G1/S cell cycle transition by p53 has also been proposed (190).
Control of the Gi/S cell cycle checkpoint, however, remains the most well characterized
growth arrest function of p53 to date.
Apoptosis
p53 was first demonstrated to cause programmed cell death (apoptosis) following
introduction into a mouse myeloid leukemic cell line that normally lacks the protein (191)
and a human colon cancer cell line (192). Studies from p53 knockout mice confirmed that
some forms of apoptosis are dependent on functional p53, as thymocytes lacking the
protein were shown to be resistant to radiation-induced apoptosis (193, 194).
Subsequently, many instances of p53-dependent stress-, DNA damage-, or oncogene
expression-induced apoptosis have been confirmed (reviewed in refs. 22, 195), including
cell death resulting from UV treatment of mouse skin (23) and that from lack of oxygen in
solid tumors (196). However, not all forms of apoptosis are dependent on p53, since the
mouse thymocytes lacking this protein remain sensitive to apoptosis induced by other
agents such as glucocorticoids (193, 194). Notably, p53 has been demonstrated to be
required for the induction of apoptosis following treatment of cells with cancer
chemotherapeutic agents, suggesting a means by which certain tumors are resistant to the
killing effects of this therapy (197, 198).
Whereas the growth arrest function of p53 is thought to depend mainly on the
ability of the protein to transactivate target genes (discussed above), the contribution of
this function to apoptosis is less clear. Different studies using a transcription activation
deficient mutant
(p 5 3 gln22ser23)
have reported differences in apoptotic response. Two
studies using either baby rat kidney (BRK) (199) or human hepatocarcinoma Hep3B cells
(200) concluded that transactivation was necessary for the induction of apoptosis, while
another experiment in HeLa cells demonstrated that this activity was dispensable for p53
induced cell death (201). In apparent contrast to the latter study, however, the
transactivation domain was demonstrated to be required for apoptosis induction in HeLa
cells (202). Another recent study using human cells expressing a p53 mutant (R273H)
that is unable to transactivate (at least the p21 gene) suggested that transcription
activation is not essential for programmed cell death (203). Additionally, the finding that
p53 can effectively induce apoptosis in the absence of new RNA or protein synthesis
supports the idea that transactivation is not involved (204). These examples illustrate a
controversy that is ongoing in this field and suggest that cell type along with experimental
system differences may affect whether transactivation of target genes is required for p53
mediated apoptotic cell death. Consistent with this, Oren and colleagues have reported
that the necessity for transactivation in the process varies with cell type (205).
Importantly, it has also been reported that a mutant that retains the ability to
transactivate from several p53-responsive promoters had actually lost the ability to do so
from the promoter of the bax gene (the product of which induces apoptosis) along with
the ability to mediate programmed cell death (206). This implies that mutants may have
differential abilities to activate transcription between different p53-responsive promoters
in the genome and further complicates study of the involvement of transactivation in
programmed cell death.
Much new evidence supports a role for the transactivation function of p53 in
apoptosis. As discussed above, many genes involved in this process have been shown to
be up-regulated by p53 (149, 156-162). Recent experiments also have established that
bax, a p53 transactivated gene, is involved in apoptosis in vivo in a transgenic mouse
brain tumor model (207). Additionally, neurons from bax knockout mice were shown to
be resistant to cell death induced by DNA damage (208), further extending the idea that
this gene product is important in the apoptotic process.
Some evidence suggests that the transcription repression function of p53 may also
regulate its ability to induce apoptosis. For instance, the bcl-2 and E1B 19K gene
products, which effectively block p53-induced apoptosis, inhibit the ability of p53 to
repress transcription without affecting its transactivation ability (209, 210).
Additionally, the down-regulation of genes implicated in protecting cells from apoptosis
(bcl-2; ref. 163, IGF-I-R; ref. 164), and the gene for a microtubule associated protein
MAP4; ref. 165) has been demonstrated and could conceivably result in the induction of
apoptosis.
Other cellular roles
p53 was demonstrated to have a role in the general maintenance of genomic
stability when human fibroblasts from Li-Fraumeni Syndrome patients (with one wild
type p53 allele) were found to have a lower frequency of gene amplification than cells in
which this allele ofp53 had mutated (188, 189). Loss of cell cycle control or apoptosis is
generally thought to be responsible for increasing genomic instability, as either would
allow genetic alterations to accumulate. More recent results indicate that p53 may also
have a role in the regulation of centrosome duplication, thus ensuring that chromosomes
are segregated equally during mitosis (211). This would also explain why cells without
p53 display gene amplification and often are aneuploid (110).
The p53 protein has been suggested to be involved in other unrelated cellular
processes as well. For example, the protein has been demonstrated to assist in the
reannealing of complementary single strands of DNA, suggesting a direct role in the repair
process (212, 213). Also, p53 was shown to interact with a cellular replication factor,
RP-A, and inhibit its function, indicating that it may be a regulator of DNA replication
(214). Many follow-up studies concerning these issues have been done, and arguments
can be made for or against the involvement of p53 in replication and/or repair (see 22).
Additionally, p53 has been proposed to be involved in translational control (reviewed in
ref. 215), embryonic development (reviewed in ref. 216), and cellular senescence (114,
217 and references therein), but the significance of these functions remains unclear.
Suppression of Transformation
The overall function of p53 in tumor suppression has generally been assumed to
be mediated by its ability to induce cell cycle arrest and/or apoptosis. Much research has
focused on whether the ability of p53 to activate transcription (its most well
characterized biochemical function) correlates with its ability to induce growth arrest and
apoptosis, and thus suppress transformation. Early studies found a strong correlation
between the capability of the protein to transactivate and its ability to suppress cell
growth (218-220). However, it was found that some mutants that can activate
transcription are unable to suppress transformation of primary rodent cells (220),
suggesting that other functions of p53 may be involved in this process. Subsequent
studies have also cast some doubt on the idea that growth suppression activity
completely correlates with transcription activation ability by identifying mutant forms of
the protein that either cannot activate transcription but can suppress cell growth (199,
221, 222) or can activate transcription but cannot suppress cell growth (222).
A similar controversy exists in the apoptosis field about whether transactivation
by p53 is required for p53 dependent cell death (discussed above). Studies that
specifically examined the ability of the protein to suppress transformation by either E1A
alone or E1A plus activated ras concluded that this activity correlates with its apoptosis
capability (222, 223) and not growth arrest ability (222). A recent study that examined
whether transactivation is involved in this mediation of apoptosis (with a focus on
transformation) compared the number of transformed foci that resulted from introducing
E1A and ras into cells that lack bax (a p53 transactivated gene) with that of normal
controls. Since the number of foci was greater in cells lacking bax, it was concluded that
this gene product, and therefore p53 transcription activation, is important in suppressing
transformation (224). Also, because evidence for the transactivation of genes involved in
apoptosis is accumulating (discussed above), it is likely that this function is critical, if not
exclusive, in mediating programmed cell death. However the fact that a mutant that lacks
the oligomerization domain, nuclear localization signal, and a portion of the DNA binding
domain was found to induce apoptosis, although at a reduced rate compared to wild-type
protein (201, 225), clearly demonstrates that another function of p53 mediated by its Nterminus contributes to its apoptotic potential.
It is likely that the ultimate pathway used by p53 to suppress transformation in a
given cell depends upon the cell type, the nature of the DNA damage, and the particular
mutations and/or viral proteins present. Whether transactivation dependent or
independent growth arrest or apoptosis, or a combination of these, occurs may therefore
be governed by a complex set of rules that are not presently well understood. This may
account for much of the discrepancy in the results obtained in the described studies, and it
illustrates that much remains unknown about the exact mechanism of tumor suppression
by p53.
Molecular Archaeology of p53 Mutations
Mutation Spectra Analysis
The study of tumor mutation spectra has been termed 'molecular archaeology' and
has yielded significant clues as to the importance of certain exogenous and endogenous
agents in the development of cancer (226). It is generally believed that carcinogens induce
a particular pattern of mutations along a DNA sequence unique to each mutagen. Thus,
the study of the positions and types of mutations (mutation spectrum) in a cancer related
gene from tumor cells could be informative as to the mutagen that caused the tumor.
Analysis of this nature can also shed light on important questions such as the importance
of the gene in question to tumorigenesis, tissue specificity of tumors, selective processes
involved in the development of tumors, carcinogen-DNA interactions, and the replication
and repair of damaged DNA (63).
The p53 gene is often used for the study of mutation spectra in tumors. One
reason is that mutations in the gene are very common in tumors, and therefore a large
database ofp53 mutations exists allowing for the comparison of spectra from cells of
different origins and from a variety of people with differing exposure histories. Also,
nearly 80% of the mutations in the gene are missense (226), many mutations inactivate
the function of the protein, and these mutations are distributed widely throughout the
coding region. This allows inferences about the mechanisms of DNA adduction and
mutation to be made, and also permits patterns of point mutations to be detected if a
mutagen causes such alterations. Finally, because p53 is highly conserved among
vertebrates, mutation spectra studies from animal models can be compared to the human
data (63).
UV and Skin Tumors
The utility of using p53 mutation spectra in providing insight into the cause of
skin tumors first became apparent with the initial finding that of 24 human SCCs
examined, nearly 60% contained mutations in the gene. Additionally, three of these
mutations were CC to TT transitions and 5 were C to T transitions, suggesting a UV
specific pattern of mutations (227). Since that time, numerous studies have examined the
p53 gene in sun-exposure related skin cancers and precancerous lesions (including SCC,
BCC, and AK), and comparison of the data with UV specific mutations in model systems
has been used to conclude that UV mutagenesis of p53 is an important step in the
development of skin cancer. This matter has been the subject of several recent reviews
(20, 63, 101, 228, 229), and a compilation of the p53 mutations found to date in skin and
all other tumor types (>7500 total mutations), along with references, can be obtained
through the Internet (98-100).
A comparison of the types and positions of mutation found in skin cancers and
precancerous lesions with those of internal tumors reveals that the spectra differ
considerably (99). Approximately 90% of skin tumor mutations are at dipyrimidine
sequences, compared to =55% in internal malignancies. GC to AT transitions
predominate in both data sets (68% in skin and 49% in the others); however, in internal
tumors, these are largely targeted to CpG sites (60% compared to 34%) implying that
spontaneous deamination of 5-methylcytosine may be the causative event. Also, tandem
CC to TT mutations are highly over-represented in the skin database, as 15% of the
mutations are of this type compared to only -1% in the internal tumors. Since this
mutational pattern is also very similar to that induced by UV light as a mutagen in model
systems, and because UV is known to induce tumors (discussed above), it seems
reasonable to conclude that UV directly induced the mutations in p53 that lead to the
development of skin tumors in humans. Notably, the distribution of mutation hotspots
also differ between skin tumors and other tumor types. Figure 1-5 shows the distribution
of mutations in p53 from tumors derived from colon, liver, and skin cancer as examples.
Studies in mouse models that have examined mutations in p53 in skin tumors
induced by UV have also been informative in establishing the role of UV in human tumors
of this type. A recent representative study of UV-B-induced mouse squamous cell
carcinomas that generated a large number of tumors found that the types of mutations in
p53 were very similar to those of human skin tumors (230). Of 160 tumors analyzed,
nearly 70% contained mutations in the gene, and a vast majority (96%) of the base
alterations occurred at dipyrimidine sequences. GC to AT transitions predominated (over
80% of the total mutations), and tandem CC to TT mutations were observed (5% of the
total mutations). Although the distribution of mutations in the mouse model system was
not identical to that of human skin tumors, one hotspot mutation (defined by the authors
as an amino acid change at a particular codon) in murine codon 272 that occurred in 19%
of all the tumors matched a hotspot for mutation in human skin tumors (the
corresponding human codon is 278; ref. 230). Both CCT to TCT and CCT to CTT
mutations at this codon occurred with high frequency (=7% each), which is also the case
in human skin (=2% each).
The fact that certain mutations are found with a high frequency in tumors could
either mean that the mutation is induced by the carcinogen with a high frequency or that
the mutation is highly selected for in the tumor. Experimental models that examine tumor
mutations as an endpoint cannot distinguish between these possibilities. Mutation
spectra analyses in model systems detect mutations directly following mutagen treatment
and replication of the DNA and can thus answer whether particular mutations are directly
induced by an agent. Many such studies have been performed using UV as a mutagen
(discussed above), but these systems cannot answer the question of whether mutations at
particular sites inp53 are induced by an agent, as genes other thanp53 are used as targets.
Two techniques have been used to attempt to address this concern. One, termed ligation
mediated PCR (LMPCR), was used to specifically answer whether the hotspot mutations
seen in human skin cancer can be induced by UV irradiation of cells in culture by mapping
the sites of DNA adduction along p53 (231) and measuring their rates of repair. This
study found that of eight frequently mutated bases in p53 in human skin cancers, seven
were at sites where UV adducts formed and were repaired significantly more slowly than
adducts at surrounding sites in human skin fibroblasts irradiated in culture. Other sites of
slow repair were also found, but the authors argued that mutations at those sites may not
be selected for in tumors (232). Although these results demonstrate a correlation between
sites of slow repair and those of mutation, they cannot completely establish a causal
relationship between these events, as the assay used is unable to determine whether the
slowly repaired adducts actually resulted in mutations.
Another method that attempted to establish whether the mutations in skin tumors
are caused by UV-induced DNA adducts is termed restriction fragment length
polymorphism/PCR (RFLP/PCR) analysis, and involves the selective enrichment and
amplification of sequences that have mutations in a particular restriction enzyme site
(reviewed in refs. 233, 234). This method was used to examine 9 bases in p53 (extending
from codons 247-250) for mutations in human skin fibroblasts irradiated with UV-B. The
most prominent base changes found were C to A and G to T transversions at positions
that are not frequently mutated in human skin tumors, leading the authors to conclude
that selection of certain mutant cells is more important than the induction of mutations by
UV in the development of skin tumors (235). However, this method is only capable of
examining a small region of the gene; information about mutations at other bases cannot be
determined. The experiment did examine one site of hotspot mutation in tumors (a codon
248 CGG to TGG; ref. 235), but the fact that mutations were not induced in their system
at a high frequency at this site is not enough information to conclude that the mutation
pattern in this system is significantly different from that of skin tumors. Perhaps other
hotspots in skin tumors also occurred with high frequency in the experimental system
(and remained undetected), and possibly the codon 248 mutation seen in skin tumors is
not directly caused by UV adducts. This would be consistent with the fact that the same
mutation in codon 248 is also a hotspot for many internal tumors (98), implying that the
selection pressure for this mutation in tumors may be high.
Other Environmental Agents and Cancer
Comparison of the spectrum of mutations in p53 in tumors to those induced in
experimental systems has also been used to attempt to establish correlations between
mutations by several other environmental agents and specific cancers (reviewed in refs.
63, 236). Two representative examples of this are discussed in detail below, namely the
associations between aflatoxin B 1 (AFB 1) and liver cancer, and between components of
cigarette smoke and lung cancer.
AFB 1 was first suggested to induce G to T transversions in the third base of
codon 249 in liver tumors when two studies reported that in tumors of this type from
people in Qidong, China (237) and southern Africa (238), where exposure to AFB1 is
high, a large proportion (>50%) contained this mutation. Further studies have confirmed
this and have established that liver tumors from areas of low exposure to AFB 1 rarely
contain this mutation (ref. 98; reviewed in refs. 239, 240). Mutation spectra studies in
model systems have established that G to T transitions are the primary mutation type
induced by this agent (241, 242), lending evidence to the hypothesis that AFB 1 causes
mutations at this site. An early study that used an in vitro method for mapping the sites
of adducts along a DNA sequence (DNA polymerase fingerprint analysis) found that
AFB 1 preferentially bound to the tumor mutation hotspot site in a p53 containing vector
(243). Additionally, RFLP/PCR has been used to examine the question of whether AFB 1
induces mutations at that site in treated human hepatocellular cells (as in the study with
UV mutagenesis), and concluded that G to T mutations in the third base of codon 249 are
induced at high frequency (244). However, mutations at adjacent sites were also seen,
albeit at lower frequencies, suggesting that either codon 249 arginine to serine mutations
are selected for in AFB 1 induced liver tumors or that the treatment scheme of the cells did
not accurately reflect the human situation. Further studies using this method examined
the frequency of mutations at the same bases in normal human liver samples from areas of
high, medium, or low exposure to AFB 1 and found that the levels of mutations coincided
with putative exposure level, providing stronger evidence for a causative role of this agent
in mutation induction, and suggesting that mutation at codon 249 in p53 is an early event
in AFB 1-induced liver cancer (245).
Mutation spectrum analysis ofp53 in lung tumors from smokers has also
suggested that the carcinogens present in cigarette smoke (for example polycyclic
aromatic hydrocarbons such as benzo(a)pyrene (BaP) and/or N-nitrosamines) are
probable causes of the mutations, as a predominance of G to T transversions is seen in
the tumor spectrum as well as in spectra generated by these agents in model systems.
Furthermore, the spectrum differs significantly from those of other tumor types,
implying that the agents in cigarette smoke are inducing the mutations in the gene
(reviewed in refs. 63, 236). A study using DNA polymerase fingerprint analysis found
that p53 treated in vitro with BaP was modified at 13 out of 14 sites that are mutated in
lung cancers (243) implying a causal relationship between adduct formation and tumor
mutations. More recently, RFLP/PCR was used on 9 bases spanning codons 247-250 in
hepatocellular cells treated with the same agent and determined that the most
preferentially induced mutation that caused an amino acid change in the protein was a G
to T transversion at the middle position of codon 248. The fact that this is also a hotspot
for mutation in human lung tumors suggests that BaP directly causes the mutations seen
in the lung tumors of smokers (246). LMPCR analysis of BaP treated HeLa and
bronchial epithelial cells also established that adducts preferentially formed at three
hotspots in lung tumors (247). However, these studies have the limitations discussed
above, namely that no single study is able to determine the occurrence of mutations at all
of the sites along the gene.
The Utility of Yeast Functional Assays
Soon after the discovery that p53 can act as a transcription activator in
mammalian cells, it was found to be capable of acting as a sequence dependent
transactivator in Saccharomyces cerevisiae (248). This led directly to the development of
yeast assays to determine whether a given p53 sequence is wild type or mutant (248250). In these 'yeast functional assays' (presented in Figure 1-6), genomic DNA from a
given tissue or blood sample is isolated, p53 is amplified by PCR, and the PCR product is
co-transfected with a 'gapped' yeast expression vector that has homology to the termini
ofp53 on its ends. The yeast cell then repairs the gap in the expression vector with the
p53 PCR product by homologous recombination to form an intact expression vector.
Present in the yeast strain is also a p53 binding site from which wild type but not mutant
p53 can enhance the transcription of a gene that causes a phenotypic change. In this way,
p53 PCR products that are mutant in their transcription activation ability can be
distinguished from wild type PCR products by either a colony color change or a life/death
selection in yeast. The expression vector also contains sequences necessary to ensure
that only a single vector is present in each cell (centromeric and autonomous replicating
sequences), so that theoretically, the percentage of cells with the selectable phenotype is
the same as that of mutant PCR products.
This thesis initially describes the adaptation of one of the yeast functional assays
to determine the mutation spectrum of p53 directly following mutagen modification and
replication in yeast. The method involves mutagen treatment of an intact p53 yeast
expression vector that contains human p53 cDNA, transformation into a yeast strain with
red/white color selection for mutants, determination of the mutation frequency, and
characterization of the mutants by sequencing to obtain the mutation spectrum. This
method, like RFLP/PCR analysis, attempts to determine whether certain mutagens
actually induce mutations in p53 as opposed to selecting for cells that already contain
these mutations. However, the assay used here is able to detect mutations in more sites
than a few select codons - every mutant that loses the ability to activate transcription
from the ribosomal gene cluster (RGC) p53 binding site can be detected. As discussed
above, this activity of p53 is likely instrumental in its ability to suppress transformation.
The assay used in these studies also has benefits over techniques such as LMPCR,
mainly because mutations are studied as an endpoint, leaving no doubt that the adducts
formed by the DNA damaging agent in use led to a mutation in the DNA. Finally, this
method has the benefit over other previous bacterial and yeast systems for mutagenesis
studies that the p53 gene itself is the target for mutagenesis, thus avoiding problems with
sequence context effects when comparing mutation spectra from model systems with p53
in tumors.
UV light was used as a mutagen to characterize the system (Chapter 2), and the
obtained spectrum of mutations was compared to that of human skin tumors in an
attempt to validate the system. Then, a more extensive analysis of the hotspot sites of
mutation was done to further analyze whether the two spectra are similar (Chapter 3).
Next, an improvement to the selection system that facilitates more efficient mutant
screening and cellular mutagen modification was introduced and characterized (Chapter 4).
Unrelated work on screening for inhibitors of the CDK2 serine/threonine kinase for
potential use as therapeutic agents that was done at a summer internship at SUGEN, Inc.
is then presented (Chapter 5). Finally, future avenues of research that build upon this
work are detailed (Chapter 6).
hv
"Z
Oxidative Stress / Antioxidant Defense
Immunological Response
I
I
Cell
Dipnth
DNA
Photoadduction/
Oxidative Products
Transformation
Repair/
Mutation
Conversion
Papilloma
Malignancy
Mutated Repair Genes
Oncogene Activation (eg. ras)
Tumor Suppressor Gene Inactivation (eg. p53)
INITIATION
PROMOTION / PROGRESSION
Carcinogenic Process
Figure 1-1. Multistage process of skin cancer. UV light can cause DNA
photoadduction to presumably act as an initiator and/or promoter of carcinogenesis and
cause oxidative stress, which then leads to oxidative DNA damage and an immunological
response. The DNA damage can lead to cell death, or mutations can occur in repair genes,
oncogenes, and tumor suppressor genes to transform the cells and eventually lead to
malignancy. Modified from (19).
Wavelength
(nm)
A
Chromophore
Process
Damage
Photosensitizer (P)
visible
02-- --
P.- +0 2
400
hv
P ---
02
O
UV-A
w
DNA strand breaks
Fenton
reaction
oxidized bases
Electron
abstraction
oxidized bases
(8-oxoGua)
102
8-oxoGua
-
(singlet oxygen)
320
UV-B
electron transfer
photohydration
280
DNA bases
hv
photoaddition
dimerization
UV-C
Do 8-oxoGua
-
cytosine hydrates
Pyr (6-4) Pyo
Dewar
CPDs
250
Figure 1-2. UV-induced DNA damage. UV-A induced DNA damage is mediated by
endogenous photosensitizers and occurs either by generating superoxide (02--) or singlet
oxygen, or by electron abstraction to form the indicated products. UV-B and UV-C act
directly on the DNA to form mainly CPDs and (6-4) photoproducts (Pyr (6-4) Pyo), the
latter of which can rearrange to the Dewar isomers with exposure to UV-B. The other
indicated products following UV-B or -C treatment are formed in low yield. Modified
from (36).
O
CH 3
O
CH 3
HN
NH
H
IN
H
O
k N1
Cyclobutane Pyrimidine
Dimer (CPD)
Pyrimidine (6-4) Pyrimidone
Photoproduct
HN.
,H3
'OH
0
Dewar isomer
Figure 1-3. UV-C and UV-B-induced DNA adducts. The chemical structures are
shown for a TpT CPD, (6-4) photoproduct, and Dewar isomer.
Functional
Domains
Activation
domain
Sequence-specific
DNA binding domain
Non-specific DNA
interaction domain
tetramerization
N
/IV/
basic C
NLSI NLSII NLSIII
dsDNA-PK
and CKI
I
Protein
Interactions
CDK PKC CKII
I
TFIID
I
II
SV40 TAg
TBP
TBP
p53BP1
TFIIH
TAF40, TAF60
p53BP2
TFIIH
p62
XPB
XPD
CSB
mdm-2
RP-A
AdE1B 55kD
Figure 1-4. Schematic diagram of the p53 protein. Hatched boxes represent
evolutionarily conserved regions of the protein. Areas of differential shading depict the
functional domains, which are identified above or on the diagram. Circled Ps are
phosphorylation sites, and the corresponding kinases are indicated below. Proteins that
interact with particular domains of p53 are shown below the drawing. NLS stands for
nuclear localization sequence. Modified from (22).
SKIN
10,
248
278
I
,1ct
21
41
I
6)
d
ffiLaJ
I
I 121 141 I 11
101
$
201
is$1 11
I ......
I 286
...-
21
-A
241
1 1 11286
261
21J
I- -
301 321 341i 361 381
Codon Number
COLON
Codon 248
36 Mutations
Codon 175
34 Mutations
273
245
f
,2
i~
1
''
21
41
61
81
1 .J11i
101
121
141 161
LI
181
201
221
TIF'[
:=: - r . . . : Ta
241 261
281
301
31
...
31
361
311
341
361
381
Codon Number
LIVER
Codon 249
48 Mutations
273
i
rl--u-r-----r---l--41
.,.61
I
II.,Jil
,i
I
-- n,-.,...
~,-,,.---.,-,-~.~---.1
101
121
141
161 111
201
221
l
l.1.
1
I ilMIIl~llm
. ~.._______
241
261 - 281
301
321
Codon Number
Figure 1-5. Distribution of p53 mutations in selected human cancers. The number
of mutations included is 51 for skin, 290 for colon, and 157 for liver. Modified from
(101).
FIBROBLASTS
BLOOD
TUMOR
RNA
cDNA
p53 PCR PRODUCT
p53 eDNA
(wt)
cDNA (wt)
p53
ADE2
white colonies
000
O
+
gapped p53 expression vector (pSS16)
p53 eDNA (mut)
p53 cDNA (mut)
-IE
0
•
0
0
00
red colonies
e
/
Figure 1-6. Yeast functional assays. RNA is extracted from cells and reverse
transcribed to make cDNA. This DNA is used to amplify p53, and the PCR product is
transfected into yeast with a 'gapped expression vector' with homology to p53 on its
ends. In the cells, the gap in the vector is filled with the PCR product, resulting in an
intact p53 expression vector. Wild type and mutant p53 are then identified by their
differential abilities to transactivate a gene causing a phenotypic change (here a red white
color change). Modified from (249, 250).
References
1.
2.
3.
4.
5.
6.
7.
8.
9.
10.
11.
12.
13.
14.
15.
16.
17.
18.
19.
20.
Nordling, C.O., A new theory on the cancer-inducing mechanism. Br. J Cancer,
1953. 7, 68-72.
Stocks, P., A study of the age curve for cancer of the stomach in connection with a
theory of the cancer producing mechanism. Br. J Cancer, 1953. 7, 407-417.
Muller, H.J., Radiation damage to the genetic material. Sci. Prog., 1951. 7, 93-165.
Nowell, P.C., The clonal evolution of tumor cell populations. Science, 1976. 194,
23-28.
Bishop, J.M., The molecular genetics of cancer. Science, 1987. 235, 305-311.
Weinberg, R.A., Oncogenes, antioncogenes, and the molecular basis of multistep
carcinogenesis. Cancer Res., 1989. 49, 3713-3721.
Fearon, E.R. and Vogelstein, B., A genetic model for colorectal tumorigenesis. Cell,
1990. 61, 759-767.
Kinzler, K.W. and Vogelstein, B., Lessons from hereditary colorectal cancer. Cell,
1996. 87, 159-170.
Harris, C.C., Chemical and physical carcinogenesis: advances and perspectives for
the 1990s. Cancer Res., 1991. 51 (suppl.), 5023s-5044s.
Strauss, B.S., The origin of point mutations in human tumor cells. Cancer Res.,
1992. 52, 249-253.
Barrett, J.C., Mechanisms of multistep carcinogenesis and carcinogen risk
assessment. Environ. Health Perspect., 1993. 100, 9-20.
Clayson, D.B., ICPEMC publication number 17: Can a mechanistic rationale be
provided for non-genotoxic carcinogens identified in rodent bioassays? Mutat. Res.,
1989. 221, 53-67.
Krawczak, M., Smith-Sorensen, B., Schmidtke, J., Kakkar, V.V., Cooper, D.N., and
Hovig, E., Somatic spectrum of cancer-associated single basepair substitutions in
the TP53 gene is determined mainly by endogenous mechanisms of mutation and by
selection. Hum. Mutat., 1995. 5, 48-57.
Unna, P.G., Die histopathologieder hautkrankheiten. 1894, Berlin: Hirschwald.
Ananthaswamy, H.N. and Pierceall, W.E., Molecular mechanisms of ultraviolet
radiation carcinogenesis. Photochem. Photobiol., 1990. 52(6), 1119-1136.
Glass, A.G. and Hoover, R.N., The emerging epidemic of melanoma and squamous
cell skin cancer. J. Amer. Med. Assoc., 1989. 262(15), 2097-2100.
Weinstock, M.A., Controversies in the role of sunlight in the pathogenesis of
cutaneous melanoma. Photochem. Photobiol., 1996. 63(4), 406-410.
Ananthaswamy, H.N. and Kanjilal, S., Oncogenes and tumor suppressor genes in
photocarcinogenesis. Photochem. Photobiol., 1996. 63(4), 428-432.
Black, H.S., deGruijl, F.R., Forbes, P.D., Cleaver, J.E., Ananthaswamy, H.N.,
deFabo, E.C., Ullrich, S.E., and Tyrell, R.M., Photocarcinogenesis: an overview. J.
Photochem.Photobiol.B., 1997. 40, 29-47.
Nataraj, A.J., Trent, J.C.I., and Ananthaswamy, H.N., p53 gene mutations and
photocarcinogenesis. Photochem. Photobiol., 1995. 62(2), 218-230.
21.
22.
23.
24.
25.
26.
27.
28.
29.
30.
31.
32.
33.
Brash, D.E., Sunlight and the onset of skin cancer. Trends Genet., 1997. 13(10),
410-414.
Ko, L.J. and Prives, C., p53: puzzle and paradigm. Genes Dev., 1996. 10, 10541072.
Ziegler, A., Jonason, A.S., Leffell, D.J., Simon, J.A., Sharma, H.W., Kimmelman, J.,
Remington, L., Jacks, R., and Brash, D.E., Sunburn and p53 in the onset of skin
cancer. Nature, 1994. 372, 773-776.
Campbell, C., Quinn, A.G., Ro, Y.S., Angus, B., and Rees, J.L., p53 mutations are
common and early events that precede tumor invasion in squamous cell neoplasia of
the skin. J Invest. Dermatol., 1993. 100(6), 746-748.
Nakazawa, H., English, D., Randell, P.L., Nakazawa, K., Martel, N., Armstrong,
B.K., and Yamasaki, H., UV and skin cancer: specific p53 gene mutation in normal
skin as a biologically relevant exposure measurement Proc. Natl. Acad. Sci. USA,
1994. 91, 360-364.
Nelson, M.A., Einspahr, J.G., Alberts, D.S., Balfour, C.A., Wymer, J.A., Welch,
K.L., Salasche, S.J., Bangert, J.L., Grogan, T.M., and Bozzo, P.O., Analysis of the
p53 gene in human precancerous actinic keratosis lesions and squamous cell cancers.
CancerLett., 1994. 85(1), 23-29.
Kanjilal, S., Strom, S.S., Clayman, G.L., Weber, R.S., el-Naggar, A.K., Kapur, V.,
Cummings, K.K., Hill, L.A., Spitz, M.R., Kripke, M.L., et al., p53 mutations in
nonmelanoma skin cancer of the head and neck: molecular evidence for field
cancerization. Cancer Res., 1995. 55, 3604-3609.
Ren, Z.P., Hedrum, A., Ponten, F., Nister, M., Ahmadian, A., Lundeberg, J., Uhlen,
M., and Ponten, J., Human epidermal cancer and accompanying precursors have
identical p53 mutations different from p53 mutations in adjacent areas of clonally
expanded non-neoplastic keratinocytes. Oncogene, 1996. 12, 765-773.
Jonason, A.S., Kunala, S., Price, G.J., Restifo, R.J., Spinelli, H.M., Persing, J.A.,
Leffell, D.J., Tarone, R.E., and Brash, D.E., Frequent clones of p53-mutated
keratinocytes in normal human skin. Proc.Natl. Acad. Sci. USA, 1996. 93, 1402514029.
Ren, Z.P., Ahmadian, A., Ponten, F., Nister, M., Berg, C., Lundeberg, J., Uhlen,
M., and Ponten, J., Benign clonal keratinocyte patches with p53 mutations show
no genetic link to synchronous squamous cell precancer or cancer in human skin.
Amer. J Pathol., 1997. 150(5), 1791-1803.
Ponten, F., Berg, C., Ahmadian, A., Ren, Z.P., Nister, M., Lundeberg, J., Uhlen,
M., and Ponten, J., Molecular pathology in basal cell cancer with p53 as a genetic
marker. Oncogene, 1997. 15, 1059-1067.
Rehman, I., Quinn, A.G., Healy, E., and Rees, J.L., High frequency of loss of
hererozygosity in actinic keratosis, a usually benign disease. Lancet, 1994. 344,
788-789.
Gailani, M.R., Leffell, D.J., Ziegler, A., Gross, E.G., Brash, D.E., and Bale, A.E.,
Relationship between sunlight exposure and a key genetic alteration in basal cell
carcinoma. J Natl. CancerInst., 1996. 88(6), 349-354.
34.
35.
36.
37.
38.
39.
40.
41.
42.
43.
44.
45.
46.
47.
48.
49.
Oro, A.E., Higgins, K.M., Hu, Z., Bonifas, J.M., Epstein, E.H., and Scott, M.P.,
Basal cell carcinomas in mice overexpressing sonic hedgehog. Science, 1997. 276,
817-821.
Sage, E., Distribution and repair of photolesions in DNA: genetic consequences and
the role of sequence context Photochem. Photobiol., 1993. 57(1), 163-174.
Cadet, J., Berger, M., Douki, T., Morin, B., Raoul, S., Ravanat, J.L., and Spinelli,
S., Effects of UV and visible radiation on DNA - final base damage. Biol. Chem.,
1997. 378, 1275-1286.
Bose, S.N., Davies, R.J., Sethi, S.K., and McCloskey, J.A., Formation of adeninethymine photoadduct in the deoxynucleoside monophosphate d(TpA) and in DNA.
Science, 1983. 220, 723-725.
Gasparro, F.P. and Fresco, J.R., Ultraviolet-induced 8,8-adenine dehydrodimers in
oligo- and polynucleotides. Nucl. Acids Res., 1986. 14, 4239-4251.
Gallagher, P.E. and Duker, N.J., Formation ofpurine photoproducts in a defined
human sequence. Photochem. Photobiol., 1989. 49, 599-605.
Barna, T., Malinowski, J., Holton, P., Ruchirawat, M., Becker, F.F., and Lapeyre,
J.N., UV-induced photoproducts of 5-methylcytosine in a DNA sequence context
Nucl. Acids Res., 1988. 16, 3327-3340.
Mitchell, D.L., Jen, J., and Cleaver, J.E., Relative induction of cyclobutane dimers
and cytosine photohydrates in DNA irradiated in vitro and in vivo with ultravioletC and ultraviolet-B light Photochem. Photobiol., 1991. 54, 741-746.
Setlow, R.B. and Carrier, W.L., Pyrimidine dimers in ultraviolet-irradiated DNA's.
J. Mol. Biol., 1966. 17, 237-254.
Gordon, L.K. and Haseltine, W.A., Quantitation of cyclobutane pyrimidine dimer
formation in double- and single-stranded DNA fragments of defined sequence.
Radiat. Res., 1982. 89, 99-112.
Bourre, F., Renault, G., Seawell, P.C., and Sarasin, A., Location and quantification
of ultraviolet-induced lesions in simian virus 40 DNA. Biochimie, 1985. 67, 233239.
Lippke, J.A., Gordon, L.K., Brash, D.E., and Haseltine, W.A., Distribution of UV
light-induced damage in a defined sequence of human DNA: detection of alkalisensitive lesions at pyrimidine nucleoside-cytidine sequences. Proc.Natl. Acad. Sci.
USA, 1981. 78, 3388-3392.
Bourre, F., Renault, G., and Sarasin, A., Sequence effect on alkali-sensitive sites in
UV-irradiated SV40 DNA. Nucl. Acids Res., 1987. 15, 8861-8875.
Brash, D.E. and Haseltine, W.A., UV-induced mutation hotspots occur at DNA
damage hotspots. Nature, 1982. 298(8), 189-192.
Tornaletti, S. and Pfeifer, G.P., UV damage and repair mechanisms in mammalian
cells. BioEssays, 1996. 18(3), 221-228.
Seidman, M., The development of transient SV40 based shuttle vectors for
mutagenesis studies: problems and solutions. Mutat. Res., 1989. 220, 55-60.
50.
51.
52.
53.
54.
55.
56.
57.
58.
59.
60.
61.
62.
Sikorski, R.S. and Hieter, P., A system of shuttle vectors and yeast host strains
designed for efficient manipulation of DNA in Saccharomyces cerevisiae. Genet.,
1989. 122(1), 19-27.
Ishizaki, K., Nishizawa, K., Mimaki, S., and Aizawa, S.I., UV-induced mutations of
supF gene on a shuttle vector plasmid in p53-deficient mouse cells are qualitatively
different from those in wild type cells. Mutat. Res., 1996. 364, 43-49.
Armstrong, J.D. and Kunz, B.A., Excision repair and gene orientation modulate the
strand specificity of UV mutagenesis in a plasmid-borne yeast tRNA gene.
Environ. Mol. Mutagen, 1995. 25, 12-22.
Carty, M.P., el-Saleh, S., Zernik-Kobak, M., and Dixon, K., Analysis of mutations
induced by replication of UV-damaged plasmid DNA in HeLa cell extracts.
Environ. Mol. Mutagen, 1995. 26(2), 139-146.
Yagi, T., Sato, M., Nishigori, C., and Takebe, H., Similarity in the molecular profile
of mutations induced by UV light in shuttle vector plasmids propagated in mouse
and human cells. Mutagen., 1994. 9(1), 73-77.
Armstrong, J.D., Chadee, D.N., and Kunz, B.A., Roles for the yeast RAD18 and
RAD52 DNA repair genes in UV mutagenesis. Mutat. Res., 1994. 315, 281-293.
Madzak, C., Armier, J., Stary, A., Daya-Grosjean, L., and Sarasin, A., UV-induced
mutations in a shuttle vector replicated in repair deficient trichothiodistrpohy cells
differ with those in genetically-related cancer prone xeroderma pigmentosum.
Carcinogen., 1993. 14(7), 1255-1260.
Carty, M.P., Hauser, J., Levine, A.S., and Dixon, K., Replication and mutagenesis
of UV-damaged DNA templates in human and monkey cell extracts. Mol. Cell.
Biol., 1993. 13(1), 533-542.
Bredberg, A., Kraemer, K.H., and Seidman, M.M., Restricted ultraviolet mutational
spectrum in a shuttle vector propagated in xeroderma pigmentosum cells. Proc.
Natl. Acad. Sci. USA, 1986. 83, 8273-8277.
Lichtenauer-Kaligis, E.G.R., Thijssen, J., den Dulk, H., van de Putte, P., GiphartGassler, M., and Tasseron-de Jong, J.G., UV-induced mutagenesis in the
endogenous hprt gene and in hprt cDNA genes integrated at different positions in
the genome. Mutat. Res., 1995. 326, 131-146.
Wang, Y.C., Maher, V.M., Mitchell, D.L., and McCormick, J.J., Evidence from
mutation spectra that the UV hypermutability of xeroderma pigmentosum variant
cells reflects abnormal, error-prone replication on a template containing
photoproducts. Mol. Cell. Biol., 1993. 13(7), 4276-4283.
McGregor, W.G., Chen, R.H., Lukash, L., Maher, V.M., and McCormick, J.J., Cell
cycle-dependent strand bias for UV-induced mutations in the transcribed strand of
excision repair-proficient human fibroblasts but not in repair-deficient cells. Mol.
Cell. Biol., 1991. 11(4), 1927-1934.
Drobetsky, E.A., Grosovsky, A.J., Skandalis, A., and Glickman, B.W.,
Perspectives on UV light mutagenesis: investigation of the CHO aprt gene carried
on a retroviral shuttle vector. Somat. Cell Mol. Genet., 1989. 15(5), 401-409.
63.
64.
65.
66.
67.
68.
69.
70.
71.
72.
73.
74.
75.
76.
Greenblatt, M.S., Bennett, W.P., Hollstein, M., and Harris, C.C., Mutations in the
p53 tumor suppressor gene: clues to cancer etiology and molecular pathogenesis.
CancerRes., 1994. 54, 4855-4878.
Kunz, B.A., Pierce, M.K., Mis, J.R.A., and Giroux, C.N., DNA sequence analysis
of the mutational specificity of u.v. light in the sup4-o gene of yeast Mutagen.,
1987. 2(6), 445-453.
Ivanov, E.L., Kovaltzova, S.V., Kassinova, G.V., Gracheva, L.M., Korolev, V.G.,
and Zakharov, I.A., The rad2 mutation affects the molecular nature of UV and
acridine-mustard-induced mutations in the ADE2 gene of Saccharomyces cerevisiae.
Mutat. Res., 1986. 160, 207-214.
Lee, G.S.F., Savage, E.A., Ritzel, R.G., and vonBorstel, R.C., The base-alteration
spectrum of spontaneous and ultraviolet radiation-induced forward mutations in the
URA3 locus of Saccharomyces cerevisiae. Mol. Gen. Genet., 1988. 214, 396-404.
Kraemer, K.H., Lee, M.M., and Scotto, J., DNA repair protects against cutaneous
and internal neoplasia: evidence from xeroderma pigmentosum. Carcinogen., 1984.
5(4), 511-514.
Yagi, T., Tatsumi-Miyajima, J., Sato, M., Kraemer, K.H., and Takebe, H., Analysis
of point mutations in an ultraviolet-irradiated shuttle vector plasmid propagated in
cells from Japanese Xeroderma Pigmentosum patients in complementation groups
A and F. CancerRes., 1991. 51, 3177-3182.
Seetharam, S., Kraemer, K.H., Waters, H.L., and Seidman, M.M., Ultraviolet
mutational spectrum in a shuttle vector propagated in xeroderma pigmentosum
lymphoblastoid cells and fibroblasts. Mutat. Res., 1991. 254, 97-105.
Armstrong, J.D. and Kunz, B., Excision repair influences the site and strand
specificity of sunlight mutagenesis in yeast. Mutat. Res., 1992. 274, 123-133.
Sancar, A., Structure and function of DNA photolyase. Biochem., 1994. 33, 2-9.
Protic-Sabljic, M., Tuteja, N., Munson, P.J., Hauser, J., Kraemer, K.H., and Dixon,
K., UV light-induced cyclobutane pyrimidine dimers are mutagenic in mammalian
cells. Mol. Cell. Biol., 1986. 6(10), 3349-3356.
Bourre, F., Benoit, A., and Sarasin, A., Respective roles of pyrimidine dimer and
pyrimidine (6-4) pyrimidone photoproducts in UV mutagenesis of Simian Virus 40
DNA in mammalian cells. J. Virol., 1989. 63(11), 4520-4524.
Armstrong, J.D. and Kunz, B.A., Photoreactivation implicates cyclobutane dimers
as the major promutagenic UV-B lesion in yeast. Mutat. Res., 1992. 268, 83-94.
Clingen, P.H., Arlett, C.F., Roza, L., Mori, T., Nikaido, 0., and Green, M.H.L.,
Induction of cyclobutane pyrimidine dimers, pyrimidine (6-4) pyrimidone
photoproducts, and Dewar valence isomers by natural sunlight in normal human
mononuclear cells. CancerRes., 1995. 55, 2245-2248.
Keyse, S.M., Amaudruz, F., and Tyrell, R.M., Determination of the spectrum of
mutations induced by defined-wavelength solar UV-B (313-nm) radiation in
mammalian cells by use of a shuttle vector. Mol. Cell. Biol., 1988. 8(12), 54255431.
77.
78.
79.
80.
81.
82.
83.
84.
85.
86.
87.
88.
89.
90.
91.
Armstrong, J.D. and Kunz, B., Site and strand specificity of UV-B mutagenesis in
the SUP4-o gene of yeast. Proc. Natl. Acad. Sci. USA, 1990. 87, 9005-9009.
Ramotar, D. and Masson, J.Y., Saccharomyces cerevisiae DNA repair processes: an
update. Mol. Cell. Biochem., 1996. 158, 65-75.
Gentil, A., LePage, F., and Sarasin, A., The consequence of translesional replication
of unique UV-induced photoproducts. Biol. Chem., 1997. 378, 1287-1292.
Brash, D.E., Seetharam, S., Kraemer, K.H., Seidman, M.M., and Bredberg, A.,
Photoproduct frequency is not the major determinant of UV base substitution hot
spots or cold spots in human cells. Proc.Natl. Acad. Sci. USA, 1987. 84, 37823786.
Parris, C.N., Levy, D.D., Jessee, J., and Seidman, M.M., Proximal and distal effects
of sequence context on ultraviolet mutational hotspots in a shuttle vector replicated
in xeroderma cells. J Mol. Biol., 1994. 236, 491-502.
Levy, D.D., Magee, A.D., Namiki, C., and Seidman, M.M., The influence of single
base changes on UV mutational activity at two translocated hotspots. J. Mol. Biol.,
1996. 255, 435-445.
Levy, D.D., Magee, A.D., and Seidman, M.M., Single nucleotide positions have
proximal and distal influence on UV mutation hotspots and coldspots. J. Mol. Biol.,
1996. 258, 251-260.
Lane, D.P. and Crawford, L.V., T antigen is bound to a host protein in SV40transformed cells. Nature, 1979. 278, 261-263.
Linzer, D.I.H. and Levine, A.J., Characterization of a 54K dalton cellular SV40
tumor antigen present in SV40-transformed cells and uninfected embryonal
carcinoma cells. Cell, 1979. 17, 43-52.
Kress, M., May, E., Cassingena, R., and May, P., Simian virus 40-transformed cells
express new species of proteins precipitable by anti-simian virus 40 tumor serum.
J Virol., 1979. 31(2), 472-483.
Melero, J.A., Stitt, D.T., Mangel, W.F., and Carroll, R.B., Identification of new
polypeptide species (48-55K) immunoprecipitable by antiserum to purified large T
antigen and present in SV40-infected and -transformed cells. Virol., 1979. 93, 466480.
DeLeo, A.B., Jay, G., Appella, E., Dubois, G.C., Law, L.W., and Old, L.J.,
Detection of a transformation-related antigen in chemically induced sarcomas and
other transformed cells of the mouse. Proc.Natl. Acad. Sci. USA, 1979. 76(5),
2420-2424.
Milner, J. and McCormick, F., Lymphocyte stimulation: concanavalin A induces
the expression of a 53K protein Cell Biol. Int. Rep., 1980. 4(7), 663-667.
Mercer, W.E., Nelson, D., DeLeo, A.B., Old, L.J., and Baserga, R., Microinjection
of monoclonal antibody to protein p53 inhibits serum-induced DNA synthesis in
3T3 cells. Proc.Natl. Acad. Sci. USA, 1982. 79, 6309-6312.
Eliyahu, D., Raz, A., Gruss, P., Givol, D., and Oren, M., Participation of p53
cellular tumour antigen in transformation of normal embryonic cells. Nature, 1984.
312, 646-649.
92.
93.
94.
95.
96.
97.
98.
99.
100.
101.
102.
103.
104.
105.
Parada, L., Land, H., Weinberg, R.A., Wolf, D., and Rotter, V., Cooperation
between gene encoding p53 tumour antigen and ras in cellular transformation
Nature, 1984. 312, 649-651.
Jenkins, J.R., Rudge, K., and Currie, G.A., Cellular immortalization by a cDNA
clone encoding the transformation-associated phosphoprotein p53. Nature, 1984.
312, 651-654.
Jenkins, J.R., Rudge, K., Chumakov, P., and Currie, G.A., The cellular oncogene
p53 can be activated by mutagenesis. Nature, 1985. 317, 816-818.
Finlay, C.A., Hinds, P.W., Tan, T.H., Eliyahu, D., Oren, M., and Levine, A.J.,
Activating mutations for transformation by p53 produce a gene product that forms
an hsc70-p53 complex with an altered half-life. Mol. Cell. Biol., 1988. 8(2), 531539.
Hinds, P., Finlay, C., and Levine, A.J., Mutation is required to activate the p53
gene for cooperation with the ras oncogene and transformation. J Virol., 1989.
63(2), 739-746.
Finlay, C.A., Hinds, P.W., and Levine, A.J., The p53 proto-oncogene can act as a
suppressor of transformation. Cell, 1989. 57, 1083-1093.
Hainaut, P., Hernandez, T., Robinson, A., Rodriguez-Tome, P., Flores, T.,
Hollstein, M., Harris, C.C., and Montesano, R., IARC database of p53 gene
mutations in human tumors and cell lines: updated compilation, revised formats and
new visualization tools. Nucl. Acids Res., 1998. 26(1), 205-213.
Beroud, C. and Soussi, T., p53 gene mutation: software and database. Nucl. Acids
Res., 1998. 26(1), 200-204.
Cariello, N.F., Douglas, G.R., Gorelick, N.J., Hart, D.W., Wilson, J.D., and Soussi,
T., Databases and software for the analysis of mutations in the human p53 gene,
human hprt gene and both the lacI and lacZ gene in transgenic animals. Nucl. Acids
Res., 1998. 26(1), 198-199.
Levine, A.J., Wu, M.C., Chang, A., Silver, A., Attiyeh, E.F., Lin, J., and Epstein,
C.B., The spectrum of mutations at the p53 locus. Evidence for tissue specific
mutagenesis, selection of mutant alleles, and a "gain of function" phenotype. Ann.
N.Y. Acad. Sci., 1995. 768, 111-128.
Baker, S.J., Markowitz, S., Fearon, E.R., Willson, J.K.V., and Vogelstein, B.,
Suppression of human colorectal carcinoma cell growth by wild-type p53. Science,
1990. 249, 912-915.
Mercer, W.E., Shields, M.T., Amin, M., Sauve, G.J., Appella, E., Romano, J.W.,
and Ullrich, S.J., Negative growth regulation in a glioblastoma tumor cell line that
conditionally expresses human wild-type p53. Proc.Natl. Acad. Sci. USA, 1990.
87, 6166-6170.
Chen, P.L., Chen, Y., Bookstein, R., and Lee, W.H., Genetic mechanisms of tumor
suppression by the human p53 gene. Science, 1990. 250, 1576-1580.
Johnson, P., Gray, D., Mowat, M., and Benchimol, S., Expression of wild-type
p53 is not compatible with continued growth of p53-negative tumor cells. Mol.
Cell. Biol., 1991. 11(1), 1-11.
106. Malkin, D., Li, F.P., Strong, L.C., Fraumeni, J.F., Nelson, C.E., Kim, D.H., Kassel,
J., Gryka, M.A., Bischoff, F.Z., Tainsky, M.A., et al., Germ line p53 mutations in
a familial syndrome of breast cancer, sarcomas, and other neoplasms. Science, 1990.
250, 1233-1238.
107. Srivastava, S., Zou, Z., Pirollo, K., Blattner, W., and Chang, E.H., Germ-line
transmission of a mutated p53 gene in a cancer-prone family with Li-Fraumeni
syndrome. Nature, 1990. 348, 747-749.
108. Donehower, L.A., Harvey, M., Slagle, B.L., McArthur, M.J., Montgomery, C.A.,
Butel, J.S., and Bradley, A., Mice deficient for p53 are developmentally normal but
susceptible to spontaneous tumors. Nature, 1992. 356, 215-221.
109. Bischoff, F.Z., Yim, S.O., Pathak, S., Grant, G., Siciliano, M.J., B.C., G., Strong,
L.C., and Tainsky, M.A., Spontaneous abnormalities in normal fibroblasts from
patients with Li-Fraumeni cancer syndrome: aneuploidy and immortalization.
CancerRes., 1990. 50, 7979-7984.
110. Harvey, M., Sands, A.T., Weiss, R.S., Hegi, M.E., Wiseman, R.W., Pantazis, P.,
Giovanella, B.C., Tainsky, M.A., Bradley, A., and Donehower, L.A., In vitro
growth characteristics of embryo fibroblasts isolated from p53-deficient mice.
Oncogene, 1993. 8, 2457-2467.
111. Koshland, D.E., Editorial: molecule of the year. Science, 1993. 262, 1953.
112. Prives, C., How loops, P sheets, and oc helices help us to understand p53. Cell,
1994. 78, 543-546.
113. Burley, S.K., p53: a cellular Achilles' heel revealed. Structure, 1994. 2, 789-792.
114. Levine, A.J., p53, the cellular gatekeeper for growth and division. Cell, 1997. 88,
323-331.
115. Kussie, P.H., Gorina, S., Marechal, V., Elenbaas, B., Moreau, J., Levine, A.J., and
Pavletich, N.P., Structure of the MDM2 oncoprotein bound to the p53 tumor
suppressor transactivation domain. Science, 1996. 274, 948-953.
116. Gorina, S. and Pavletich, N.P., Structure of the p53 tumor suppressor bound to the
ankyrin and SH3 domains of 53BP2. Science, 1996. 274, 1001-1005.
117. Cho, Y., Gorina, S., Jeffrey, P.D., and Pavletich, N.P., Crystal structure of a p53
tumor suppressor-DNA complex: understanding tumorigenic mutations. Science,
1994. 265, 346-355.
118. Clore, G.M., Omichinski, J.G., Sakaguchi, K., Zambrano, N., Sakamoto, H.,
Appella, E., and Gronenborn, A.M., High-resolution structure of the
oligomerization domain of p53 by multidimensional NMR Science, 1994. 265, 386391.
119. Lee, W., Harvey, T.S., Yin, Y., Yau, P., Litchfield, D., and Arrowsmith, C.H.,
Solution structure of the tetrameric minimum transforming domain of p53. Nat.
Struct. Biol., 1994. 1, 877-890.
120. Clore, G.M., Omichinski, J.G., Sakaguchi, K., Zambrano, N., Sakamoto, H.,
Appella, E., and Gronenborn, A.M., Interhelical angles in the solution structure of
the oligomerization domain of p53: correction. Science, 1995. 267, 1515-1516.
121. Clore, M.G., Ernst, J., Clubb, R., Omichinski, J.G., Poindexter Kennedy, W.M.,
Sakaguchi, K., Appella, E., and Gronenborn, A.M., Refined solution structure of
the oligomerization domain of the tumour suppressor p53. Nat. Struct. Biol., 1995.
2(4), 321-333.
122. Jeffrey, P.D., Gorina, S., and Pavletich, N., Crystal structure of the tetramerization
domain of the p53 tumor suppressor gene at 1.7 angstroms. Science, 1995. 267,
1498-1502.
123. Miller, M., Lubkowski, J., Mohana Rao, J.K., Danishefsky, A.T., Omichinski,
J.G., Sakaguchi, K., Sakamoto, H., Appella, E., Gronenborn, A.M., and Clore,
G.M., The oligomerization domain of p53: crystal structure of the trigonal form.
FEBS Lett., 1996. 399, 166-170.
124. Hupp, T.R., Meek, D.W., Midgley, C.A., and Lane, D.P., Regulation of the
specific DNA binding function of p53. Cell, 1992. 71, 875-886.
125. Takenaka, I., Morin, F., Seizinger, B.R., and Kley, N., Regulation of the sequencespecific DNA binding function of p53 by protein kinase C and protein
phosphatases. J. Biol. Chem., 1995. 270, 5405-5411.
126. Halazonetis, T.D., Davis, L.J., and Kandil, A.N., Wild-type adopts a "mutant"-like
conformation when bound to DNA. EMBO J., 1993. 12, 1021-1028.
127. Hupp, T.R., Sparks, A., and Lane, D.P., Small peptides activated the latent
sequence-specific DNA binding function of p53. Cell, 1995. 83, 237-245.
128. Fields, S. and Jang, S.K., Presence of a potent transcription activating sequence in
the p53 protein. Science, 1990. 249, 1046-1049.
129. Raycroft, L., Wu, H., and Lozano, G., Transcriptional activation by wild-type but
not transforming mutants of the p53 anti-oncogene. Science, 1990. 249, 1049-1051.
130. O'Rourke, R.W., Miller, C.W., Kato, G.J., Simon, K.J., Chen, D.L., Dang, C.V., and
Koeffler, H.P., A potential transcriptional activation element in the p53 protein.
Oncogene, 1990. 5, 1829-1832.
131. Kern, S.E., Kinzler, K.W., Bruskin, A., Jarosz, D., Friedman, P., Prives, C., and
Vogelstein, B., Identification of p53 as a sequence-specific DNA-binding protein.
Science, 1991. 252, 1708-1711.
132. Kern, S.E., Pietenpol, J.A., Thiagalingam, S., Seymour, A., Kinzler, K.W., and
Vogelstein, B., Oncogenic forms of p53 inhibit p53-regulated gene expression
Science, 1992. 256, 827-830.
133. El-Deiry, W.S., Kern, S.E., Pietenpol, J.A., Kinzler, K.W., and Vogelstein, B.,
Definition of a consensus binding site for p53. Nat. Genet., 1992. 1, 45-49.
134. Funk, W.D., Pak, D.T., Karas, R.H., Wright, W.E., and Shay, J.W., A
transcriptionally active DNA-binding site for human p53 protein complexes. Mol.
Cell. Biol., 1992. 12(6), 2866-2871.
135. Farmer, G., Bargonetti, J., Zhu, H., Friedman, P., Prywes, R., and Prives, C., Wildtype p53 activates transcription in vitro. Nature, 1992. 358, 83-86.
136. El-Deiry, W.S., Tokino, T., Velculescu, V.E., Levy, D.B., Parsons, R., Trent, J.M.,
Lin, D., Mercer, W.E., Kinzler, K.W., and Vogelstein, B., WAF1, a potential
mediator of p53 tumor suppression. Cell, 1993. 75, 817-825.
137. Harper, J.W., Adami, G.R., Wei, N., Keyomarsi, K., and Elledge, S.J., The p21
Cdk-interacting protein Cip 1 is a potent inhibitor of G 1 cyclin-dependent kinases.
Cell, 1993. 75, 805-816.
138. Xiong, Y., Hannon, G.J., Zhang, H., Casso, D., Kobayashi, R., and Beach, D., p21
is a universal inhibitor of cyclin kinases. Nature, 1993. 366, 701-704.
139. Barak, Y., Juven, T., Haffner, R., and Oren, M., mdm2 expression is induced by
wild type p53 activity. EMBO J., 1993. 12, 461-468.
140. Wu, X., Bayle, J.H., Olson, D., and Levine, A.J., The p53-mdm-2 autoregulatory
feedback loop. Genes Dev., 1993. 7, 1126-1132.
141. Perry, M.E., Piette, J., Zawadzki, J.A., Harvey, D., and Levine, A.J., The mdm-2
gene is induced in response to UV light in a p53-dependent manner. Proc. Natl.
Acad. Sci. USA, 1993. 90, 11623-11627.
142. Kastan, M.B., Zhan, Q., El-Deiry, W.S., Carrier, F., Jacks, T., Walsh, W.V.,
Plunkett, B.S., Vogelstein, B., and Fornace, A.J., A mammalian cell cycle
checkpoint pathway utilizing p53 and GADD45 is defective in ataxia-telangiectasia.
Cell, 1992. 71, 587-597.
143. Lu, X. and Lane, D.P., Differential induction of transcriptionally active p53
following UV or ionizing radiation: defects in chromosome instability syndromes?
Cell, 1993. 75, 765-778.
144. Smith, M.L., Chen, I.T., Zhan, Q., Bae, I., Chen, C.Y., Gilmer, T.M., Kastan,
M.B., O'Connor, P.M., and Fornace, A.J., Interaction of the p53-regulated protein
gadd45 with proliferating cell nuclear antigen. Science, 1994. 266, 1376-1379.
145. Okamoto, K. and Beach, D., Cyclin G is a transcriptional target of the p53 tumor
suppressor protein. EMBO J., 1994. 13, 4816-4822.
146. Zauberman, A., Lupo, A., and Oren, M., Identification of p53 target genes through
immune selection of genomic DNA: the cyclin G gene contains two distinct p53
binding sites. Oncogene, 1995. 10, 2361-2366.
147. Shimizu, A., Nishida, J., Ueoka, Y., Kato, K., Hachiya, T., Kuriaki, Y., and Wake,
N., Cyclin G contributes to G2/M arrest of cells in response to DNA damage.
Biochem. Biophys. Res. Com., 1998. 242, 529-533.
148. Smith, M.L., Kontny, H.U., Bortnick, R., and Fornace, A.J., The p53-regulated
cyclin G gene promotes cell growth: p53 downstream effectors cyclin G and
Gadd45 exert different effects on cisplatin chemosensitivity. Exp. Cell Res., 1997.
230(1), 61-68.
149. Miyashita, T. and Reed, J.C., Tumor suppressor p53 is a direct transcriptional
activator of the human bax gene. Cell, 1995. 80, 293-299.
150. Buckbinder, L., Talbott, R., Velasco-Miguel, S., Takenaka, I., Faha, B., Seizinger,
B.R., and Kley, N., Induction of the growth inhibitor IGF-binding protein 3 by
p53. Nature, 1995. 377, 646-649.
151. Morris, G.F., Bischoff, J.R., and Mathews, M.B., Transcriptional activation of the
human proliferating-cell nuclear antigen promoter by p53. Proc. Natl. Acad. Sci.
USA, 1996. 93, 895-899.
152. Makos Wales, M., Biel, M.A., El-Deiry, W., Nelkin, B.D., Issa, J.P., Cavenee,
W.K., Kuerbitz, S.J., and Baylin, S.B., p53 activates expression of HIC-1, a new
candidate tumour suppressor gene on 17p13.3. Nat. Med., 1995. 1(6), 570-577.
153. Liebetrau, W., Budde, A., Savoia, A., Grummt, F., and Hoehn, H., p53 activates
Fanconi anemia group C gene expression Hum. Mol. Genet., 1997. 6(2), 277-283.
154. Madden, S.L., Galella, E.A., Riley, D., Bertelsen, A.H., and Beaudry, G.A.,
Induction of cell growth regulatory genes by p53. Cancer Res., 1996. 56, 53845390.
155. Madden, S.L., Galella, E.A., Zhu, J., Bertelsen, A.H., and Beaudry, G.A., SAGE
transcript profiles for p53-dependent growth regulation Oncogene, 1997. 15, 10791085.
156. Pierzchalski, P., Reiss, K., Cheng, W., Cirielli, C., Kajstura, J., J.A., N., Rizk, M.,
Capogrossi, M.C., and Anversa, P., p53 induces myocyte apoptosis via the
activation of the renin-angiotensin system. Exp. Cell Res., 1997. 234, 57-65.
157. Yin, Y., Terauchi, Y., Solomon, G.G., Aizawa, S., Rangarajan, P.N., Yazaki, Y.,
Kadowaki, T., and Barrett, J.C., Involvement of p85 in p53-dependent apoptotic
response to oxidative stress. Nature, 1998. 391, 707-710.
158. Israeli, D., Tessler, E., Haupt, Y., Elkeles, A., Wilder, S., Amson, R., Telerman, A.,
and Oren, M., A novel p53-inducible gene, PAG608, encodes a nuclear zinc finger
protein whose overexpression promotes apoptosis. EMBO J., 1997. 16(14), 43844392.
159. Wu, G.S., Burns, T.F., McDonald, E.R., Jiang, W., Meng, R., Krantz, I.D., Kao,
G., Gan, D.D., Zhou, J.Y., Muschel, R., et al., KILLERDR5 is a DNA damageinducible p53-regulated death receptor gene. Nat. Genet., 1997. 17, 141-143.
160. Amson, R.B., Nemani, M., Roperch, J.P., Israeli, D., Bougueleret, L., Le Gall, I.,
Medhioub, M., Linares-Cruz, G., Lethrosne, F., Pasturaud, P., et al., Isolation of 10
differentially expressed cDNAs in p53-induced apoptosis: activation of the
vertebrate homologue of the Drosophila seven in absentia gene. Proc. Natl. Acad.
Sci. USA, 1996. 93, 3953-3957.
161. Nemani, M., Linares-Cruz, G., Bruzzoni-Giovanelli, H., Roperch, J.P., Tuynder,
M., Bougueleret, L., Cherif, D., Medhioub, M., Pasturaud, P., Alvaro, V., et al.,
Activation of the human homolgue of the Drosophila sina gene in apoptosis and
tumor suppression. Proc. Natl. Acad. Sci. USA, 1996. 93, 9039-9042.
162. Polyak, K., Xia, Y., Zweier, J.L., Kinzler, K.W., and Vogelstein, B., A model for
p53-induced apoptosis. Nature, 1997. 389, 300-305.
163. Miyashita, T.M., Harigai, M., Hanaka, M., and Reed, J.C., Identification of a p53dependent negative response element in the bcl-2 gene. Cancer Res., 1994. 54,
3131-3135.
164. Werner, H., Karnieli, E., Rauscher, F.J., and LeRoith, D., Wild-type and mutant
p53 differentially regulate transcription of the insulin-like growth factor I receptor
gene. Proc.Natl. Acad. Sci. USA, 1996. 93, 8318-8323.
165. Murphy, M., Hinman, A., and Levine, A.J., Wild-type p53 negatively regulates the
expression of a microtubule-associated protein. Genes Dev., 1996. 10, 2971-2980.
166. Mori, N., Kashanchi, F., and Prager, D., Repression of transcription from the
human T-cell leukemia virus type I long terminal repeat and cellular gene promoters
by wild-type p53. Blood, 1997. 90(12), 4924-4932.
167. Pesch, J., Brehm, U., Staib, C., and Grummt, F., Repression of interleukin-2 and
interleukin-4 promoters by tumor suppressor protein p53. J. Interferon Cytokine
Res., 1996. 16(8), 595-600.
168. Webster, N.J., Resnik, J.L., Reichart, D.B., Strauss, B., Haas, M., and Seely, B.L.,
Repression of the insulin receptor promoter by the tumor suppressor gene product
p53: a possible mechanism for receptor overexpression in breast cancer. Cancer
Res., 1996. 56, 2781-2788.
169. Desdouets, C., Ory, C., Matesic, G., Soussi, T., Brechot, C., and Sobczak-Thepot,
J., ATF/CREB site mediated transcriptional activation and p53 dependent
repression of the cyclin A promoter. FEBS Lett., 1996. 385, 34-38.
170. Iotsova, V., Crepieux, P., Montpellier, C., Laudet, V., and Stehelin, D., TATA-less
promoters of some Ets-family genes are efficiently repressed by wild-type p53.
Oncogene, 1996. 13, 2331-2337.
171. Farmer, G., Friedlander, P., Colgan, J., Manley, H.L., and Prives, C.,
Transcriptional repression by p53 involves molecular interactions distinct from
those with the TATA box binding protein. Nucl. Acids Res., 1996. 24(21), 42814288.
172. Seto, E., Usheva, A., Zambetti, G.P., Momand, J., Horikoshi, N., Weinmann, R.,
Levine, A.J., and Shenk, T., Wild-type p53 binds to the TATA-binding protein and
represses transcription. Proc. Natl. Acad. Sci. USA, 1992. 89, 12028-12032.
173. Mack, D.H., Vartikar, J., Pipas, J.M., and Laimins, L.A., Specific repression of
TATA-mediated but not initiator-mediated transcription by wild-type p53. Nature,
1993. 363, 281-283.
174. Gottlieb, T.M. and Oren, M., p53 in growth control and neoplasia. Biochim.
Biophys. Acta, 1996. 1287, 77-102.
175. Dulic, V., Kaufmann, W.K., Wilson, S.J., Tlsty, T.D., Lees, E., Harper, J.W.,
Elledge, S.J., and Reed, S.I., p53-dependent inhibition of cyclin-dependent kinase
activities in human fibroblasts during radiation-induced GI arrest. Cell, 1994. 76,
1013-1023.
176. Slebos, R.J.C., Lee, M.H., Plunkett, B.S., Kessis, T.D., Williams, B.O., Jacks, T.,
Hedrick, L., Kastan, M.B., and Cho, K.R., p53-dependent GI arrest involves pRBrelated proteins and is disrupted by the human papillomavirus 16 E7 oncoprotein.
Proc.Natl. Acad. Sci. USA, 1994. 91, 5320-5324.
177. Waga, S., Hannon, G.J., Beach, D., and Stillman, B., The p21 inhibitor of cyclindependent kinases controls DNA replication by interaction with PCNA. Nature,
1994. 369, 574-578.
178. Flores-Rozas, H., Kelman, Z., Dean, F.B., Pan, Z.Q., Harper, J.W., Elledge, S.J.,
O'Donnell, M., and Hurwitz, J., Cdk-interacting protein 1 directly binds with
proliferating cell nuclear antigen and inhibits DNA replication catalyzed by the
179.
180.
181.
182.
183.
184.
185.
186.
187.
188.
189.
190.
191.
DNA polymerase delta holoenzyme. Proc.Natl. Acad. Sci. USA, 1994. 91, 86558659.
Li, R., Waga, S., Hannon, G.H., Beach, D., and Stillman, B., Differential effects by
the p21 CDK inhibitor on PCNA-dependent DNA replication and repair. Nature,
1994. 371, 534-537.
Deng, C., Zhang, P., Harper, J.W., Elledge, S.J., and Leder, P., Mice lacking
p21WAFl/CIP1 undergo normal development, but are defective in GI checkpoint
control. Cell, 1995. 82, 675-684.
Brugarolas, J., Chandrasekaran, C., Gordon, J.I., Beach, D., Jacks, T., and Hannon,
G.J., Radiation-induced cell cycle arrest compromised by p21 deficiency. Nature,
1995. 377, 552-557.
Schwartz, D., Almog, N., Peled, A., Goldfinger, N., and Rotter, V., Role of wildtype p53 in the G2 phase: regulation of the y-irradiation-induced delay and DNA
repair. Oncogene, 1997. 15, 2597-2607.
Medema, R.H., Klompmaker, R., Smits, V.A.J., and Rijksen, G., p21WAF1 can block
cells at two points in the cell cycle, but does not interfere with processive DNAreplication or stress-activated kinases. Oncogene, 1998. 16, 431-441.
Cayrol, C., Knibiehler, M., and Ducommun, B., p21 binding to PCNA causes GI
and G2 cell cycle arrest in p53-deficient cells. Oncogene, 1998. 16, 311-320.
Dulic, V., Stein, G.H., Far, D.F., and Reed, S.I., Nuclear accumulation ofp21Cipl at
the onset of mitosis: a role at the G2/M-phase transition. Mol. Cell. Biol., 1998.
18(1), 546-557.
Niculescu, A.B., Chen, X., Smeets, M., Hengst, L., Prives, C., and Reed, S.I.,
Effects of p 2 1Cipl/WAFI at both the G1/S and the G2/M cell cycle transitions: pRb is
a critical determinant in blocking DNA replication and in preventing
endoreduplication. Mol. Cell. Biol., 1998. 18(1), 629-643.
Cross, S.M., Sanchez, C.A., Morgan, C.A., Schimke, M.K., Ramel, S., Idzerda,
R.L., Raskind, W.H., and Reid, B.J., A p53-dependent mouse spindle checkpoint.
Science, 1995. 267, 1353-1356.
Yin, Y., Tainsky, M.A., Bischoff, F.Z., Srong, L.C., and Wahl, G.M., Wild-type
p53 restores cell cycle control and inhibits gene amplification in cells with mutant
p53 alleles. Cell, 1992. 70, 937-948.
Livingstone, L.R., White, A., Sprouse, J., Livanos, E., Jacks, T., and Tlsty, T.D.,
Altered cell cycle arrest and gene amplification potential accompany loss of wildtype p53. Cell, 1992. 70, 923-935.
Del Sal, G.D., Ruaro, E.M., Utrera, R., Cole, C.N., Levine, A.J., and Schneider, C.,
Gas l-induced growth suppression requires a transactivation-independent p53
function. Mol. Cell. Biol., 1995. 15, 7152-7160.
Yonish-Rouach, E., Resnitzky, D., Lotem, J., Sachs, L., Kimchi, A., and Oren, M.,
Wild-type p53 induces apoptosis of myeloid leukaemic cells that is inhibited by
interleukin-6. Nature, 1991. 352, 345-347.
192. Shaw, P., Bovey, R., Tardy, S., Sahli, R., Sordat, B., and Costa, J., Induction of
apoptosis by wild-type p53 in a human colon tumor-derived cell line. Proc. Natl.
Acad. Sci. USA, 1992. 89, 4495-4499.
193. Lowe, S.W., Schmitt, E.M., Smith, S.W., Osborne, B.A., and Jacks, T., p53 is
required for radiation-induced apoptosis in mouse thymocytes. Nature, 1993. 362,
847-849.
194. Clarke, A.R., Purdie, C.A., Harrison, D.J., Morris, R.G., Bird, C.C., Hooper, M.L.,
and Wyllie, A.H., Thymocyte apoptosis induced by p53-dependent and
independent pathways. Nature, 1993. 362, 849-852.
195. White, E., Life, death, and the pursuit of apoptosis. Genes Dev., 1996. 10, 1-15.
196. Graeber, T.G., Osmanian, C., Jacks, T., Housman, D.E., Koch, C.J., Lowe, S.W.,
and Giaccia, A.J., Hypoxia-mediated selection of cells with diminished apoptotic
potential in solid tumors. Nature, 1996. 379, 88-91.
197. Lowe, S., Ruley, H.E., Jacks, T., and Housman, D.E., p53-dependent apoptosis
modulates the cytotoxicity of anticancer agents. Cell, 1993. 74, 957-967.
198. Lowe, S.W., Bodis, S., McClatchey, A., Remington, L., Ruley, H.E., Fisher, D.E.,
Housman, D.E., and Jacks, T., p53 status and the efficacy of cancer therapy in
vivo. Science, 1994. 266, 807-810.
199. Sabbatini, P., Lin, J., Levine, A.J., and White, E., Essential role for p53-mediated
transcription in E1A-induced apoptosis. Genes Dev., 1995. 9, 2184-2192.
200. Roemer, K. and Mueller-Lantzsch, N., p53 transactivation domain mutant Q22,
S23 is impaired for repression of promoters and mediation of apoptosis. Oncogene,
1996. 12, 2069-2079.
201. Haupt, Y., Rowan, S., Shaulian, E., Vousden, K., and Oren, M., Induction of
apoptosis in HeLa cells by transactivation-deficient p53. Genes Dev., 1995. 9,
2170-2183.
202. Yonish-Rouach, E., Deguin, V., Zaitchouk, T., Breugnot, C., Mishal, Z., Jenkins,
J.R., and May, E., Transcriptional activation plays a role in the induction of
apoptosis by transiently transfected wild-type p53. Oncogene, 1996. 12, 21972205.
203. Bissonnette, N., Wasylyk, B., and Hunting, D.J., The apoptotic and transcriptional
transactivation activities of p53 can be dissociated. Biochem. Cell Biol., 1997. 75(4),
351-358.
204. Caelles, C., Helmberg, A., and Karin, M., p53-dependent apoptosis in the absence
of transcriptional activation of p53-target genes. Nature, 1994. 370, 220-223.
205. Haupt, Y., Barak, Y., and Oren, M., Cell-type specific inhibition of p53-mediated
apoptosis by mdm2. EMBO J., 1996. 15(7), 1596-1606.
206. Friedlander, P., Haupt, Y., Prives, C., and Oren, M., A mutant that discriminates
between p53-responsive genes cannot induce apoptosis. Mol. Cell. Biol., 1996.
16(9), 4961-4971.
207. Yin, C., Knudson, C.M., Korsmeyer, S.J., and Van Dyke, T., Bax suppresses
tumorigenesis and stimulates apoptosis in vivo. Nature, 1997. 385, 637-640.
208. Xiang, H., Kinoshita, Y., Knudson, C.M., Korsmeyer, S.J., Schwartzkroin, P.A.,
and Morrison, R.S., Bax involvement in p53-mediated neuronal cell death J.
Neurosci., 1998. 18(4), 1363-1373.
209. Shen, Y. and Shenk, T., Relief of p53-mediated transcriptional repression by the
adenovirus E1B 19-kDa protein or the cellular Bcl-2 protein. Proc.Natl. Acad. Sci.
USA, 1994. 91, 8940-8944.
210. Sabbatini, P., Chiou, S.K., Rao, L., and White, E., Modulation of p53-mediated
transcriptional repression and apoptosis by the adenovirus E1B 19K protein. Mol.
Cell. Biol., 1995. 15(2), 1060-1070.
211. Fukasawa, K., Choi, T., Kuriyama, R., Rulong, S., and Vande Woude, G.F.,
Abnormal centrosome amplification in the absence of p53. Science, 1996. 271,
1744-1747.
212. Bakalkin, G., Yakovleva, T., Selivanova, G., Magnusson, K.P., Szekely, L.,
Kiseleva, E., Klein, G., Terenius, L., and Wiman, K.G., p53 binds single-stranded
DNA ends and catalyzes DNA renaturation and strand transfer. Proc.Natl. Acad.
Sci. USA, 1994. 91, 413-417.
213. Brain, R. and Jenkins, J.R., Human p53 directs DNA strand reassociation and is
photolabelled by 8-Azido ATP. Oncogene, 1994. 9, 1775-1780.
214. Dutta, A., Ruppert, J.M., Aster, J.C., and Winchester, E., Inhibition of DNA
replication factor RP-A by p53. Nature, 1993. 365, 79-82.
215. Ewen, M.E. and Miller, S.J., p53 and translational control. Biochim. Biophys. Acta,
1996. 1242, 181-184.
216. Hall, P.A. and Lane, D.P., Tumour suppressors: a developing role for p53? Curr.
Biol., 1997. 7, R144-R147.
217. Bond, J., Haughton, M., Blaydes, J., Gire, V., Wynford-Thomas, D., and Wyllie,
F., Evidence that transcriptional activation by p53 plays a direct role in the
induction of cellular senescence. Oncogene, 1996. 13, 2097-2104.
218. Pietenpol, J.A., Tokino, T., Thiagalingam, S., El-Deiry, W.S., Kinzler, K.W., and
Vogelstein, B., Sequence-specific transcriptional activation is essential for growth
suppression by p53. Proc. Natl. Acad. Sci. USA, 1994. 91, 1998-2002.
219. Ory, K., Legros, Y., Auguin, C., and Soussi, T., Analysis of the most representative
tumour-derived p53 mutants reveals that changes in protein conformation are not
correlated with loss of transactivation or inhibition of cell proliferation EMBO J.,
1994. 13(15), 3496-3504.
220. Crook, T., Marston, N.J., Sara, E.A., and Vousden, K.H., Transcriptional activation
by p53 correlates with suppression of growth but not transformation Cell, 1994.
79, 817-827.
221. Hirano, Y., Yamato, K., and Tsuchida, N., A temperature sensitive mutant of the
human p53, Val138, arrests rat cell growth without induced expression of
cipl/wafl/sdil after temperature shift-down. Oncogene, 1995. 10, 1879-1885.
222. Hansen, R.S. and Braithwaite, A.W., The growth-inhibitory function of p53 is
separable from transactivation, apoptosis and suppression of transformation by
E1A and Ras. Oncogene, 1996. 13, 995-1007.
223. Lowe, S.W., Jacks, T., Housman, D.E., and Ruley, H.E., Abrogation of oncogeneassociated apoptosis allows transformation of p53-deficient cells. Proc.Natl. Acad.
Sci. USA, 1994. 91, 2026-2030.
224. McCurrach, M.E., Connor, T.M.F., Knudson, C.M., Korsmeyer, S.J., and Lowe,
S.W., Bax-deficiency promotes drug resistance and oncogenic transformation by
attenuating p53-dependent apoptosis. Proc.Natl. Acad. Sci. USA, 1997. 94, 23452349.
225. Haupt, Y., Rowan, S., Shaulain, E., Kazaz, A., Vousden, K., and Oren, M., p53
mediated apoptosis in HeLa cells: transcription dependent and independent
mechanisms. Leukem., 1997. 11(suppl 3), 337-339.
226. Harris, C.C., The 1995 Walter Hubert lecture - molecular epidemiology of human
cancer: insights from the mutational analysis of the p53 tumor suppressor gene. Br.
J. Cancer, 1996. 73(3), 261-269.
227. Brash, D.E., Rudolph, J.A., Simon, J.A., Lin, A., McKenna, G.J., Baden, H.P.,
Halperin, A.J., and Ponten, J., A role for sunlight in skin cancer: UV-induced p53
mutations in squamous cell carcinoma Proc. Natl. Acad. Sci. USA, 1991. 88, 1012410128.
228. Ziegler, A., Jonason, A., Simon, J., Leffell, D., and Brash, D.E., Tumor suppressor
gene mutations and photocarcinogenesis. Photochem. Photobiol., 1996. 63(4), 432435.
229. Daya-Grosjean, L., Dumaz, N., and Sarasin, A., The specificity of p53 mutation
spectra in sunlight induced human cancers. J. Photochem. Photobiol.B., 1995. 28,
115-124.
230. Dumaz, N., van Kranen, H.J., de Vries, A., Berg, R.J.W., Wester, P.W., van Kreijl,
C.F., Sarasin, A., Daya-Grosjean, L., and de Gruijl, F.R., The role of UV-B light in
skin carcinogenesis through the analysis of p53 mutations in squamous cell
carcinomas of hairless mice. Carcinogen., 1997. 18(5), 897-904.
231. Tomaletti, S., Rozek, D., and Pfeifer, G.P., The distribution of UV photoproducts
along the human p53 gene and its relation to mutations in skin cancer. Oncogene,
1993. 8, 2051-2057.
232. Tornaletti, S. and Pfeifer, G.P., Slow repair of pyrimidine dimers at p53 mutation
hotspots in skin cancer. Science, 1996. 263, 1436-1438.
233. Pourzand, C. and Cerutti, P., Genotypic mutation analysis by RFLP/PCR Mutat.
Res., 1993. 288, 113-121.
234. Cerutti, P., Hussain, P., Pourzand, C., and Aguilar, F., Mutagenesis of the H-ras
protooncogene and the p53 tumor suppressor gene. Cancer Res., 1994. 54 suppl.,
1934s-1938s.
235. Amstad, P., Hussain, P., and Cerutti, P., Ultraviolet B light-induced mutagenesis of
p53 hotspot codons 248 and 249 in human skin fibroblasts. Mol. Carcinogen.,
1994. 10, 181-188.
236. Semenza, J.C. and Weasel, L.H., Molecular epidemiology in environmental health:
the potential of tumor suppressor gene p53 as a biomarker. Environ. Health
Perspect., 1997. 105(suppl. 1), 155-163.
237. Hsu, I.C., Metcalf, R.A., Sun, T., Welsh, J.A., Wang, N.J., and Harris, C.C.,
Mutational hotspot in the p53 gene in human hepatocellular carcinomas. Science,
1991. 350, 427-428.
238. Bressac, B., Kew, M., Wands, J., and Ozturk, M., Selective G to T mutations of
the p53 gene in hepatocellular carcinoma from southern Africa. Science, 1991. 350,
429-431.
239. Lasky, T. and Magder, L., Hepatocellular carcinoma p53 G to T transversions at
codon 249: the fingerprint of aflatoxin exposure? Environ. Health Perspect., 1997.
105(4), 392-397.
240. Shen, H.M. and Ong, C.N., Mutations of the p53 tumor suppressor gene and ras
oncogenes in aflatoxin hepatocarcinogenesis. Mutat. Res., 1996. 366, 23-44.
241. Levy, D.D., Groopman, J.D., Lim, S.E., Seidman, M.M., and Kraemer, K.H.,
Sequence specificity of aflatoxin B 1-induced mutations in a plasmid replicated in
xeroderma pigmentosum and DNA repair proficient human cells. CancerRes.,
1992. 52, 5668-5673.
242. Trottier, Y., Waithe, W.I., and Anderson, A., Kinds of mutations induced by
aflatoxin B 1 in a shuttle vector replicating in human cells transiently expressing
cytochrome P4501A2 cDNA. Mol. Carcinogen., 1992. 6, 140-147.
243. Puisieux, A., Lim, S., Groopman, J., and Ozturk, M., Selective targeting of p53 gene
mutational hotspots in human cancers by etiologically defined carcinogens. Cancer
Res., 1991. 51, 6185-6189.
244. Aguilar, F., Hussain, S.P., and Cerutti, P., Aflatoxin B induces the transversion of
G to T in codon 249 of the p53 tumor suppressor gene in human hepatocytes.
Proc. Natl. Acad. Sci. USA, 1993. 90, 8586-8590.
245. Aguilar, F., Harris, C.C., Sun, T., Hollstein, M., and Cerutti, P., Geographic
variation of p53 mutational profile in nonmalignant human liver. Science, 1994. 264,
1317-1319.
246. Cherpillod, P. and Amstad, P.A., Benzo(a)pyrene-induced mutagenesis of p53 hotspot codons 248 and 249 in human hepatocytes. Mol. Carcinogen., 1995. 13(1),
15-20.
247. Denissenko, M.F., Pao, A., Tang, M., and Pfeifer, G.P., Preferential formation of
benzo(a)pyrene adducts at lung cancer mutational hotspots in p53. Science, 1996.
274, 430-432.
248. Schirer, E. and Iggo, R., Mammalian p53 can function as a transcription factor in
yeast. Nucl. Acids Res., 1992. 20(7), 1539-1545.
249. Ishioka, C., Frebourg, T., Yan, Y.X., Vidal, M., Friend, S.H., Schmidt, S., and Iggo,
R., Screening patients for heterozygous p53 mutations using a functional assay in
yeast. Nat. Genet., 1993. 5, 124-129.
250. Flaman, J.M., Frebourg, T., Moreau, V., Charbonnier, F., Martin, C., Chappuis, P.,
Sappino, A.P., Limacher, J.M., Bron, L., Benhattar, J., et al., A simple p53
functional assay for screening cell lines, blood, and tumors. Proc.Natl. Acad. Sci.
USA, 1995. 92, 3963-3967.
2. UV-Induced Mutagenesis of
Human p53 in a Vector
Replicated in Saccharomyces cerevisiae
A portion of this chapter was published in the Proceedings of the National Academy of
Sciences of the United States of America (1997) 94, 2266-2271.
Introduction
Epidemiologic evidence has demonstrated associations between exposure to
certain environmental agents and the elevated risk of specific cancers. Well-documented
examples include exposure to ultraviolet light as a major risk factor for skin cancers,
cigarette smoke for lung cancers, and aflatoxin and hepatitis B virus for hepatocellular
carcinoma. More recent investigations have identified specific genetic changes in tumors
from exposed individuals that suggest, on a molecular level, mechanisms through which
these agents may contribute to the carcinogenic process. A notable finding is that
alterations in the p53 tumor suppressor gene are common in a variety of human tumors
believed to be caused by exposure to exogenous carcinogens (reviewed in ref. 1). The
significance of this association lies in the fact that mutation ofp53 is thought to play a
central role in the development of cancer by inactivating one or more of the growth
suppression / genome maintenance functions of its protein, including growth arrest and
apoptosis following DNA damage (reviewed in refs. 2, 3).
The p53 mutation spectra present in various tumor types have been compared
with specific carcinogen-induced spectra of selectable genes such as supF and hprt in
experimental systems, and similarities have been interpreted as indicating that mutations
detected in tumors could have been induced as a result of carcinogen-DNA adduction. For
example, the consensus pattern of mutations induced by UV in various model systems,
namely the predominance of GC to AT transitions at dipyrimidines and the existence of
tandem CC to TT mutations, has led many to conclude that UV induces mutations in p53
as an important step in the development of skin cancer (reviewed in ref. 4). However,
since DNA sequence context is known to play a substantial role in the mutation spectrum
generated in target genes ( ref. 5 and references therein), the validity of the extrapolation
of mutation data produced in selectable genes of experimental systems to those found in
endogenous p53 of human tumors may be compromised, especially in cases where an
agent does not create a well-defined mutational pattern. We therefore sought to develop
and validate an experimental system in which mutations induced by agents thought to be
important as cancer risk factors could be characterized directly in the p53 gene, thus
circumventing concerns about sequence context.
With that objective, we adapted a previously described yeast functional assay,
which distinguishes wild type and mutant p53 (6-8), to generate a UV-induced mutation
spectrum of the gene. UV light was used in these initial experiments to validate the
experimental system because this agent has been extensively studied in numerous other
models and the types of mutations induced correlate well with those found in skin
tumors. The data are compared with those of previous studies and with mutations
identified in human skin cancers to provide additional evidence concerning the possible
role of UV in the induction of p53 mutations of this tumor type.
Materials and Methods
Plasmids and UV Treatment. The p53 expression vectors are 9.2 kb plasmids
containing human p53 cDNA under the yeast ADH1 constitutive promoter, the LEU2
gene for selection in yeast, centromeric and autonomously replicating sequences for stable
low copy replication in yeast, and sequences necessary for propagation in bacteria. The
vectors, pLS76 wt (wild type p53), and pLS76 273H (mutant p53; arginine to histidine
substitution at codon 273), were gifts from S. Friend (7). They were amplified in E. coli
strain DH5ix, and large scale preparations were isolated using Qiagen plasmid purification
columns as recommended (Chatsworth, CA).
For UV treatment, pLS76 wt (20 jtg dissolved in water at a concentration of 8
ng/gl) was spread in thin layers in 60-mm petri dishes and exposed to 254 nm UV light
generated from a germicidal lamp. Radiant flux was measured using a UVX Radiometer
(UVP, San Gabriel, CA). Following exposure, the DNA was concentrated by Centricon
30 (Amicon), ethanol precipitated, and dissolved at a concentration of 100-200 ng/gl in
TE buffer (10 mM Tris-Cl / 1 mM EDTA) (pH 7.5).
Yeast Culture and Transformation. yIG397, the Saccharomyces cerevisiae strain
suitable for p53 mutant selection, genotype MATa ade2-1 leu2-3,112 trpl-1 his3-11,15
canl-100 ura3-1 URA3 3XRGC::pCYCI::ADE2, was kindly provided by R. Iggo (8).
Standard techniques for yeast culture were used as described (9). Cultures were routinely
grown in yeast extract / peptone / dextrose (YPD) liquid or solid medium supplemented
with 200 gg/ml adenine (YPD +Ade) to avoid selection for ADE2+ revertants. Selection
of pLS76 transformants and p53 mutants was performed on solid complete minimal
medium (CM) containing 0.67% yeast nitrogen base, 2% dextrose, 2% agar, 4 lg/ml
adenine, and all relevant amino acids except leucine (CM -Leu +low Ade). Media
components were from Difco or Sigma.
Transformations were performed by the lithium acetate procedure as described (9)
with minor revisions. Briefly, 1 colony ofyIG397 was inoculated into 100 ml YPD
+Ade liquid medium and shaken at 300 C until an OD 600 of between 0.52 and 0.54 was
attained (12-18 hours). Cells were washed with 10 ml of water and resuspended in 0.5 ml
LiOac solution (IX TE, pH 7.5 / 0.1 M LiOac). Treated or untreated pLS76 transforming
DNA (a total of 1.5 gg for the reconstruction experiment or 0.5 Rlg for the mutagenesis
studies) was added to 200 gl of yeast cell suspension along with 200 Rg of denatured
salmon sperm carrier DNA. LiOac solution containing 40% polyethylene glycol 3350
(1.2 ml) was added and mixtures were shaken at 300 C for =30 minutes. Heat shock was
performed at 420 C for 15 minutes. Cells were pelleted, resuspended in 1 ml TE, pH 7.5,
and plated on selective medium. Mutants were scored after incubation at 350 C for at
least 50 hours. Transformation of UV-irradiated DNA was performed in dark conditions
and plating was done under yellow lights to avoid photoreactivation repair of the plasmid.
Plasmid Survival and Mutation Frequency. Survival was expressed as the ratio of the
total number of colonies attained with UV treated DNA to the number from untreated
DNA in parallel transformations. Survival evaluations from distinct transformations were
averaged for the final values. Cell densities were typically 1-2 thousand colonies per 150mm plate.
Mutation frequency was expressed as the ratio of the number of red and pink
colonies to the total number of colonies. For the reconstruction experiment, frequency
calculations are based on at least 14 mutants (generally more than 20), and each value was
obtained from a single transformation. For the spontaneous and induced mutation
frequencies, multiple transformations (3 to 6) were carried out on the same batches of
control or UV-treated plasmid to accumulate at least 50 spontaneous and 100 induced
mutants to provide valid estimates of mutation frequencies. The same lot of DNA was
used for each treatment to avoid variations in spontaneous mutation frequencies. Mean
induced mutation frequency values were calculated from three independent treatments.
Statistical Analysis. Analysis of the differences in reconstruction experiment values
and in spontaneous and UV-induced mutation frequency values was performed by first
using the F-test to determine the variances of the standard deviations, then the
appropriate 2 tailed t-test (for equal or unequal variances). Chi square analysis was used
to determine whether numbers of mutants varied significantly between transformations.
Isolation and Characterization of Mutants.
Mutant Prescreening. As an initial screening method to identify yeast spontaneous
mutants that were red due to loss of the p53-responsive ADE2 gene as opposed to having
mutant pLS76, total yeast DNA was isolated by the glass bead lysis method as described
(9), digested with BamHI, and subjected to Southern blot analysis with a 29-mer probe
identical in sequence to the p53 binding sites found in yIG397 (8, 10).
PlasmidRecovery. The vector pLS76 was extracted from yIG397 by a modification of a
previously described procedure for isolation of total yeast DNA (11). Red and pink
colonies were grown in 5 ml of CM -Leu medium supplemented with adenine at 200
gg/ml (to promote optimal growth), harvested, and washed successively with 10 ml of TE
and 10 ml of 1 M sorbitol. Cells were resuspended in 0.5 ml of buffer containing 1 M
sorbitol, 0.1 M EDTA, 14 mM 2-mercaptoethanol, and 10 mM Tris (pH 8.0).
Incubation with 1 mg of Zymolyase 20T (ICN) was then performed at 370 C for 45
minutes. After centrifugation, Wizard mini-prep plasmid purification columns (Promega)
were used to isolate the plasmid from pelleted spheroplasts. To amplify recovered DNA,
transformation into E. Coli strain DH5a was performed with a BTX electroporator under
recommended conditions, combined with the method for salt-free preparation of electrocompetent bacteria described by Sharma and Schimke (12). The Perfect Prep DNA
isolation system (5 prime -> 3 prime) was used to isolate plasmid DNA from the bacteria
for sequence analysis.
Sequencing. Sequencing was performed by the University of Georgia Molecular Genetics
Instrumentation Facility with the primer 5'-GGCTTCTTGCATTCTGGGAC-3' that
flanks exon 5 ofp53. Mutations were identified with the aid of Sequencher DNA
sequence analysis software (Gene Codes Co, Ann Arbor, MI).
Hotspot Determination. Mutation hotspots are defined as sites that contain more
mutations than would be expected to occur by random. The number of mutations
required at a certain site to be considered a hotspot at 99% confidence was determined by
Poisson Distribution analysis, and calculated as follows:
P(n)=- ne- / n!
where X is the total number of samples sequenced (N) divided by 5 times the number of
base pairs (B) in the target sequence (for p53 exons 5-8, B is =540), and P(n) is the
probability that n mutations would occur at any given site by chance. The number 5 is
used because any point mutation at a particular site can have 5 possible changes (for
example, a C can mutate to T, G, or A, or be inserted or deleted). Then, the Bonferroni
inequality (13) was applied as a means to ensure that all of the possible mutation events
fall within the 99% confidence interval:
in [1
- Z P(n)] <: 0.01 / 5B
Values for n that fulfill this criteria were considered to be the number of mutations at any
one site that are unlikely to have occurred by chance, at 99% confidence. The hotspots
were taken as sites that had at least 1 more mutation than the minimum needed to be
within the 99% confidence limit.
Results
Reconstruction Experiment. The yeast strain yIG397 was previously shown to
accurately distinguish wild type from mutant p53 following transformation with pLS76
expression vectors; colonies harboring p53 mutants defective in DNA binding and
transcription activation were red or pink due to lack of expression of a p53-responsive
ADE2 gene (8). However, it had not been experimentally established that the mutant
frequency (i.e., ratio of red and pink colonies to total colonies) determined by this
procedure accurately quantified the proportion of mutant pLS76 p53 expression vectors
present in the transfected DNA. A reconstruction experiment was therefore carried out
to validate estimation of mutation frequencies in the system, and to estimate the lower
limit for detection of mutants. Known quantities of a vector expressing wild type p53
(pLS76 wt) were mixed in varying proportions with that expressing a mutant shown to be
inactive in this and similar yeast assays (pLS76 273H) (6-8). After transformation into
yIG397, ratios of red and pink colonies to the total number of colonies formed were
determined in three separate experiments and compared with expected values. Observed
mutant frequencies did not differ significantly from the expected values when ratios of
mutant to total plasmid were 1:500 or 1:3,000 (P = 0.21 and 0.31, respectively; data not
shown). This indicates that the system can accurately detect a mutant frequency as low
as 1/3,000 (3.3 x 10-4). However, the average mutant frequencies obtained in these two
cases were slightly lower than expected, and at a mutant to total plasmid ratio of 1:1,000,
the observed mutant frequency was significantly lower than that expected [(0.9 ± 0.2) x
10-3 versus (1.3 ± 0.1) x 10-3; P<0.05)]. This suggests that mutant frequencies determined
by the procedure may slightly underestimate the actual number of mutant plasmids
present. This experiment addresses two issues of importance in eliminating potential bias
from data produced by the system. First, transformed yeast did not harbor more than
one viable plasmid per cell; if they had, mutants would not have been detectable at the
low frequency observed. Second, transformation efficiency of preparations containing
wild type p53 is approximately the same as those containing mutant p53.
UV-Induced Mutations. Having established that this system is capable of providing
valid estimates of mutation frequency, pLS76 wt was treated with UV light at doses of
50, 150, and 300 J/m 2 and transformed into yIG397 to determine the frequency of
inactivating p53 mutations and the spectrum of mutations induced.
PlasmidSurvival and Mutation Frequency. Agarose gel electrophoresis indicated that the
amount of strand breaks was not increased by UV treatment (data not shown). However,
a dose dependent decrease in transformation efficiency was seen with plasmid DNA
treated with increasing exposure to UV. The average transformation efficiency of
untreated pLS76 wt was 7 x 104 colonies per ug of DNA; treatment with 50, 150, and 300
J/m2 of UV light reduced this efficiency to approximately 95%, 50%, and 15% of value
obtained with control plasmid, respectively.
Mutation frequency increased in a dose dependent manner with increasing UV
dose (Table 2-1). At the three treatment levels tested, the mutation frequencies were 2.5-,
6.9-, and 18-fold higher than that of untreated vector (3.2 x 10-4). Each of the values
obtained was significantly higher than the spontaneous frequency (P<0.01 for 50 and 150
J/m 2 , and P<0.05 for 300 J/m 2).
Mutation Spectrum. To characterize p53 mutations, plasmids that had been exposed to
UV at a dose of 300 J/m 2 were recovered from red and pink yIG397 colonies. Plasmids
were first subjected to agarose gel electrophoresis to identify those containing gross
insertions or deletions in the p53 region. One mutant containing a large deletion was
detected in the total of 112 induced by UV treatment. Further analysis by SacI/Bsp]201
digestion, which excises a 3.2 kb fragment containing p53 (plus promoter and terminator)
in the wild type plasmid, confirmed that the deletion occurred in the region of interest.
Analyses of four additional preparations of this mutant plasmid from distinct bacterial
colonies confirmed that the deletion had occurred in plasmid replicated in yeast, not as a
result of bacterial transformation.
A total of 111 mutants not containing deletions were analyzed by sequencing
exons 5-8 of the p53 cDNA. Of these, 64% (71) contained detectable noncryptic
mutations; the remainder presumably harbored mutations regions ofp53 not analyzed, in
the promoter region, or in the p53 responsive element of yIG397. Ten induced mutants
contained mutations identical to those of other plasmids from the same transformation
and were thus presumed to have been siblings; sequence data from such plasmids was not
included in the analysis.
A summary of the types of mutations identified is shown in Table 2-2. GC to
AT transitions predominated in the induced spectrum, representing 61% of the total
mutations; an additional 11% were GC to TA transversions, and 5% were GC to CG
base changes. Only 5% of the induced mutations occurred at AT sites; all of these were
AT to GC transitions. Four CC to TT (GG to AA) mutations, characteristic base
changes induced by UV, were found, representing 6% of total mutations. Additional
minor contributions to the overall mutation spectrum included AC to TT (TG to AA),
CCC to ACT (GGG to TGA) base changes, small insertions, and single GC base pair
deletions in runs of GCs. The types ofp53 mutations that have been identified in human
skin tumors are also summarized in Table 2-2 for comparative purposes.
The distribution of mutations within the p53 coding regions sequenced is
summarized in Figure 2-1. A hotspot, representing 13% of the total induced mutations,
occurred at the first base of codon 213. Seven of eight mutations at this site were C to T
transitions, resulting in a nonsense mutation in the gene product, and one was a C to G
transversion, resulting in an arginine to glycine substitution. The second most prevalent
modified site (8% of total mutations) was at the second base of the same codon. Three of
five mutations at this site were G to A transitions, resulting in an arginine to glutamine
substitution, and the remaining two mutants had G to T transversions, which caused an
arginine to leucine substitution.
Spontaneous Mutations.
Mutation Frequency. The spontaneous mutation frequency of pLS76, obtained by
determining the number of red and pink colonies resulting from transformation of
untreated plasmid, was 3.2 x 10-4. However, in this experimental system red colonies
could also have resulted from loss of the p53-responsive element in yIG397, as opposed
to mutation of p53 in the pLS76 plasmid. A previous study reported the rate of loss of
yeast vectors integrated by standard homologous recombination techniques (analogous to
the manner in which the p53-responsive ADE2 gene was integrated into yIG397) to be
relatively high (=1% after 15 generations) during growth in nonselective conditions
similar to those used in this study (14). Therefore, to identify and screen out such
mutants before sequencing of the vectors, genomic DNA from red and pink colonies was
subjected to Southern blot analysis with a probe for the p53 binding sites. Of 118
spontaneous mutants analyzed in this manner, 71 (60%) had lost the p53 binding sites
and were thus not subjected to sequence analysis of pLS76. Agarose gel analysis of the
47 spontaneous mutants retaining the p53 binding sites detected 4 insertions and 5
deletions. As was the case for the large deletion in the UV-induced mutant, these size
changes occurred in the p53-containingregion of pLS76 and were induced in yeast, not as
a result of bacterial transformation.
Mutation Spectrum. The 38 spontaneous mutants that were of normal size and from
colonies that retained p53 binding sites were analyzed by sequencing exons 5-8 of p53. A
total of 12 base-substitution mutations and 3 small deletions were found, whereas 23
mutants contained no sequence changes in this region. As shown in Table 2-2, one-half of
all spontaneous mutants contained small or large deletions (33%) or insertions (17%), the
remainder being base substitutions. The majority (75%) of the base substitutions
occurred at GC base pairs, with GC to AT and GC to TA changes nearly equally
represented. Base changes also occurred at AT sites, but these represented only 12% of
total mutations. As is seen in the spectrum of spontaneous mutations presented in Figure
2-1, base changes were distributed randomly throughout the sequenced region, and none
occurred more than once.
Site and Strand Specificity of Mutations. Many previous UV mutagenesis studies
have examined the bases flanking mutation sites in attempting to identify premutagenic
DNA lesions and the basis for localization of mutation hotspots (reviewed in ref. 15).
Table 2-3 summarizes the site and strand specificity of spontaneous and induced
mutations identified in our experiments. Of the induced single base mutations, 90%
(46/51) occurred at dipyrimidine sites, whereas only 58% (7/12) of the spontaneous point
mutations occurred at these sequences. Additionally, there was a slight bias (67%)
toward mutations caused by lesions in the transcribed (antisense) strand. Spontaneous
mutations occurred with approximately equal frequency when the dipyrimidine was
located on the sense or antisense strand. However, caution must be used in drawing site
and strand specificity conclusions from these results because all of the inactivating p53
mutations for this system have yet to be characterized (see discussion).
In the induced spectrum, within sites where only 1 possible pyrimidine dimer
could form (i.e., where the mutated pyrimidine was flanked by a purine and a
pyrimidine), the majority (83%) of mutations occurred at the 3' C of TC sequences
(Table 2-3). Additionally, 2 mutations were at the 3' T of CT, and one each occurred at
the 5' C of CC and the 3' T of TT. In cases where the mutated pyrimidine was flanked
by two pyrimidines, it was not possible to attribute the mutation to one putative dimer
or the other; however, if it is assumed that the 3' base is the mutated site, as was the case
in 96% of the mutations where only one dimer could form, then 19 of 22 would have
occurred at TC sites and the remainder at CC. Also of note is the fact that the frequencies
of transitions (80%) and transversions (20%) were the same whether pyrimidine dimers
could form at the mutated site or not.
Mutation Comparison with Human Skin. Figure 2-1 indicates by arrows where
mutations found in this study are identical to those that occurred at least once in human
skin tumors (16). Eleven such mutations were found out of a total of 28 distinct sites
with single base changes. A more rigorous comparison between the two spectra was done
by first narrowing the data set to include only human skin p53 mutations that are likely to
have been caused by UV, i.e. those from BCCs, SCCs, fibroxanthoma, keratoses, and
precancerous lesions. Also, p53 mutations in samples from studies of sun-exposed
normal skin (17-20) were added to the human skin data. Then, the comparison was
limited to those sites that are hotspots in either of the two data sets. This is appropriate,
as mutations at sites that are not hotspots could occur by random. Also, data from UVinduced mutants generated in an analogous manner in the same yeast system and recently
reported (seven mutants; ref. 21) were added to the mutant pool generated here. In the
yeast UV-induced mutants, a hotspot was calculated to be three or more (identical)
mutations at a site. For the human UV exposed skin, a hotspot was four or more identical
mutations. Table 2-4 lists the sites that are hotspots for the two data sets and how many
times the particular hotspot mutation occurred in the other data set. As is seen, there is a
single site that is a hotspot in both systems (codon 286 GAA to AAA).
Discussion
In this study, we used an experimental system in which a p53 yeast expression
vector was exposed to UV light in vitro and then introduced into S. cerevisiaefor
replication, repair, and mutant selection. A reconstruction experiment showed the lower
limit of detection of the system to be at least 3.3 x 10-4, and demonstrated that it provided
accurate estimates of mutation frequencies. When the vector was treated with increasing
amounts of UV light, a dose dependent decrease in survival and increase in mutation
frequency were seen, with the highest dose tested (300 J/m 2) resulting in 15% survival
and an 18-fold induction of mutants over the spontaneous frequency of 3.2 x 10-4 .
Sequence analysis ofp53 in spontaneous mutants and in those induced by UV
light at 300 J/m 2 revealed that the two spectra vary considerably. One-half of the
spontaneous events were insertions or deletions, whereas fewer than 10% of the induced
mutants contained these alterations. Additionally, transitions and transversions were
present in equal proportions in the spontaneous spectrum, but transitions clearly
predominated in the induced. It is also noteworthy that tandem CC to TT base changes,
hallmark mutations of UV mutagenesis, were detected only in the induced spectrum.
The most prevalent induced mutation was the GC to AT transition, which
occurred in 61% of the UV-induced mutants. The predominance of this mutation is in
agreement with previous yeast studies of UV mutagenesis in the endogenous ADE2 gene
(22) or the SUP4-o gene carried on a centromeric plasmid (23) after treatment of whole
cells, but differs from the results obtained in a similar study on an integrated URA3 gene
(24). The latter investigators found that the most common base alterations in their
system were AT to GC transitions and that the frequency of transitions was equal to that
of transversions. Indeed, more than 10% of mutations in both the ADE2 (22) and SUP4-o
(23) systems were AT to GC transitions. Interestingly, the paucity of transitions at AT
sites in the system used here and the predominance of GC to AT base changes correlates
more closely with the effects of UV irradiated: 1) shuttle vector passaged though human
(25, 26) or monkey (27) cells, 2) Lad gene in E. coli (28) or human (29) cells, 3) gpt gene
in E. coli (30) or Chinese Hamster Ovary (CHO; ref. 31) cells, 4) endogenous or
retrovirally inserted aprt gene in CHO cells (32), and 5) hprt in human cells (33) than it
does with the data generated in yeast (22-24). However, in all of the above studies,
transversions at AT sites were detected, whereas none were seen in our study. The
reasons for these discrepancies are not known, but the small sample size examined here
makes it difficult to assess the significance of the differences.
In accord with many previous UV studies in both prokaryotic and eukaryotic
systems (reviewed in ref. 15), the majority of mutations (90%) occurred at dipyrimidine
sites, most notably the 3'C of TC. Recent studies involving the kinetics of C deamination
in TC dimers, delayed photoreactivation of UV-irradiated phage (34 and references
therein) and mutagenesis of a site-specifically placed T-U dimer (35) in a vector in SOS
induced E. coli have led to the proposal that C to T mutations can result from the
incorporation of A opposite either U (the deamination product of C) or the (E)-imino
tautomer of cytosine in the context of a cyclobutane pyrimidine dimer. Since these
dimers have been shown to be the primary lesions responsible for UV mutagenesis in
yeast (36), this mechanism of mutation may have been operative in the present study.
The induction of nearly 70% of detected mutations by lesions in the transcribed strand is
surprising in light of the fact that the opposite strand bias has been observed in E. coli and
mammalian cells. This has been attributed to the preferential removal of lesions on the
strand of genes transcribed by RNA polymerase II, a phenomenon seen in these cell
types and yeast (reviewed in ref. 37). However, our results were similar to those of a
study of mutagenesis in an integrated URA3 gene of yeast, in which 64% (16/25) of the
mutations resulted from lesions on the transcribed strand (24).
The two most highly mutated bases were in codon 213, within the sequence 5'ACTTTTCGAC-3' (mutated bases underlined), with a hotspot at the C. This result is
consistent with the observation that some mutation hotspots occur at sites 3' to a run of
pyrimidines in E. Coli (38). Interestingly, in numerous UV studies involving the bacterial
supF gene replicated in mammalian cells (see 15), a hotspot was consistently found
within a similar sequence: 5'-CTTCGAAG-3', where the C adjacent to the mutated G
was a hotspot in some systems but less frequently mutated in others. The existence of a
similar hotspot in these two very different settings suggests that local sequence context
may play a large role in determining the mutability of certain sites. These findings are
supported by the fact that when the above noted 8 bp supF region was copied and
transferred to a different region of the gene, it remained a hotspot following replication in
repair deficient human cells (39). However, in that system, a new hotspot was created
approximately 70 bp away from the 8 base insertion, suggesting that local sequence
contexts also have long range effects on mutability.
When the mutation spectrum obtained in this study is compared to that of p53 in
human skin tumors, precancerous lesions, and cell lines from normal and repair deficient
individuals, it can be seen that eleven of the single base changes detected in pLS76 at 28
distinct sites are identical to those observed in human skin (arrows in Figure 2-1).
Additionally, the types of mutations in the p53 cDNA of UV treated pLS76 are similar to
those observed in vivo (Table 2-2). The fact that 92% of the mutations found in human
skin cancers are located within dipyrimidine sites further reinforces the similarities of the
results of the two systems, as 90% of the mutations occurred at these sites in the present
study.
Of the two most frequently reported mutations in skin cancer (occurring in codons
248 and 278), one was detected in this study in a single mutant (a codon 278 CCT to
TCT mutation), but the other was not detected. The fact that the codon 248 arginine to
tryptophan mutation can be detected in this and similar yeast assays (6-8) raises the
possibility that the codon 248 mutations in tumors (also a hotspot for internal tumors)
may not have been induced by UV. This would be in agreement with a study that
examined codons 247-250 ofp53 for mutations following UV treatment of human skin
fibroblasts and concluded that the results obtained did not correlate with what is found in
skin tumors (40). However, caution must be used in drawing firm conclusions about the
in vivo situation from the data generated here. Reasons why discrepancies may exist
between the results of the two systems include: differences in repair in yeast and human
cells, differential mutability of DNA sites in vitro compared to in vivo, transcription
activation inconsistencies between the two cell types, and the selective growth advantage
of p53 mutants in vivo.
This work has clear advantages over previous studies using model systems for
mutation analysis. Because the vector employed contains the intact human p53 cDNA,
the spectra of mutations induced by in vitro exposure to mutagens can be directly
compared with the spectra of the same gene in tumors without concerns about sequencedependent mutation effects. Additionally, repair of the damaged gene takes place in a
eukaryotic setting (yeast) in this system, which should more closely mimic the situation
in human cells than does bacterial repair. Finally, this method can be used with any
mutagen and can thus contribute to the ongoing effort to determine the p53 mutation
pattern of agents important in the development of cancer.
The described system also has limitations. Most notably, the p53 mutations
detected here are those which inactivate the DNA binding and transcription activation
function of the protein, specifically for the RGC (ribosomal gene cluster) binding site (10)
present in the p53-responsive element in the yeast strain used (8). Previous studies have
indicated that transactivation by p53 correlates well with its growth suppression of cells
(41-43), but not tumor suppression (42, 43), which may require transcription activation
dependent and independent activities of the protein (reviewed in refs. 2, 3, 44). Thus, it
is likely that not all of the p53 mutants found in human cancer can be detected using this
system. To further complicate the matter, recent studies have also indicated that the loss
of DNA binding and transcription activation of certain p53 mutants may be dependent on
the particular binding site in use (45-47 and references therein), suggesting that different
mutants may be detected with different p53-responsive elements.
Another current limitation of this system is that not all of the inactivating
mutations in p53 have been characterized. Thus, conclusions cannot yet be drawn about
mutagen site and strand specificity. The fact that the mutations seem to be targeted to
certain kinds of sites could simply mean that more of these sites are available for
mutation. Arguing against this is that nearly half of the spontaneous point mutations
occurred at sequences lacking dipyrimidines, and that those that did occur at these sites
showed no strand specificity combined with the findings that in human internal
malignancies 61% of the mutations occur at sites without dipyrimidines; however,
presently the possibility cannot be ruled out. Of the 13 point mutants that were
previously determined to be detected using this or a similar yeast system (6-8), 9 (69%)
could be induced by mutations at sites with dipyrimidines (5 on the transcribed strand, 4
on the untranscribed strand), and 4 at sites without dipyrimidines. Additional analysis of
all possible mutations that could result in stop codons in the region sequenced, which
would presumably result in a detectable mutation in this assay, reveals that 38/54 (70%)
of the possible nonsense mutations (in addition to the ones detected in this study) occur
at sites with dipyrimidines - 60% on the transcribed strand, 40% on the untranscribed
strand. Of these mutable sites flanked by a pyrimidine and a purine, 9/31 (29%) are C's
in the sequence TCA/G. Thus, it is possible that dipyrimidines and mutable TC sites
may be over-represented in this system, along with the number of dipyrimidine mutable
sites in the transcribed strand. However, the small number of events prevents any certain
conclusions from being made. The future characterization of more spontaneous mutations
and those induced by other mutagens should resolve this issue.
Although the types of mutations found in this study correlate with what is seen in
human skin tumors and some of the mutations are identical, differences were revealed
with a comparison of the mutational hotspots between the UV-induced yeast mutants
and human skin p53 mutations that are likely to have been caused by UV. The
importance of limiting the mutation spectra comparison to hotspots is illustrated by the
fact that although eleven of the mutations found in this study are identical to those in skin
tumors, other tumor types unrelated to UV exposure (e.g. bladder, brain, colon, liver,
lung, and others) also have approximately the same number of sites with identical
mutations (16). Some of the identical mutations occurred only once or twice in either data
set and are therefore infrequent events that have a reasonable probability of having
occurred by chance. By definition, hotspots are sites that have more mutations than
would be expected to occur by chance, and therefore the analysis of only these sites
focuses on the comparison of mutations that are targeted by UV.
Table 2-4 lists the hotspot sites of mutation for UV-induced p53 mutants in yeast
and in UV-exposed human skin. As is seen, one (codon 286 GAA to AAA) is identical in
both systems. This hotspot is specific to UV-exposed skin, as it does not occur with any
other tumor type in the database. However, there are four other tumor types present in
the database that also share a single hotspot site with the UV yeast data. In lung, colon,
and breast cancer, the codon 213 CGA to TGA mutation is a hotspot; in bladder cancer,
the codon 271 GAG to AAG mutation is also one (16).
Some of the mutations that are hotspots in the human data occurred in the yeast
system, but were not frequent enough to be called hotspots (namely the codon 278 CCT
to TCT and 279 GGG to GAG mutations). Because of the limited number of samples
analyzed in this study, the estimation of the frequency of occurrence of these mutations
could have high variance, and thus may not accurately reflect the actual value. A solution
to this problem would be to analyze a larger number of mutants to determine whether the
mutations in question actually occur at a high enough frequency to be called hotspots.
This issue is addressed in the following chapter.
A
T
AT
AA
TT
C
C
T
TACTCCCCT..//. .AACAAGATGTTTTGCCAACTGGCC. .//..TGCCCTGTGCAGCTGTGGGTTGATTCCACACCCCCGCCCGGCA
C
CC..//. .ATCTACAAGCAG. .//..ACGGAGGTT. .//.
165
T
A
A
TATCCGAGTGGAAGGAAAT.. /
195
AA
.TGCCCCCACCATGAG. .//.
T
.AGCGATGGTCTGGCC. .//..CATCT
AAAAA
T
I
I
155
150
145
135
126
G
170
180
185
T
T
TT
TT
TA
TA
A
CA
A
G
+A
TA
. .AGAAACACTTTTCGACATAGTGTGGTG.. / /..TACATGTGTAACAGTTCCTGCATGGGCGGC
I
I
200
210
A
A
245
240
215
A
A
A
A
A
A
A AA
AT
A
AA
TT
A
ATGAACCGGAGGCCCATCCTCACCATCATCACACTGGAA. .//..GGTAATCTACTGGGACGGAACAGCTTTGAGGTGCGTGTTTGTG
G C
A I
C
T
T
250
A
SA
A A
AA
A A
T
A A
CCTGTCCTGGGAGAGACCGGCGCACAGAGGAAGAG. . /.
SI
280
275
270
265
255
A
T
T
. AAGGGGAGCCTCACCACGAGCTGCCCCCAGGG. . / /..AAGCGAG
I
295
285
300
I1
305
Figure 2-1. Distribution of spontaneous and UV-induced (300 J/m2) mutations in
exons 5-8 ofp53 in pLS76. Spontaneous mutations are listed below the sequence and
induced mutations above. Underlined bases are multiple mutations from the same
plasmid, and A signifies a 1 bp deletion. Arrows point to identical mutations seen in
human skin tumors, precancerous lesions, and cell lines (16). Numbers correspond to
codons.
100
Table 2-1. Mutation frequency of pLS76 wt following treatment with UV light and
replication in yIG397
UV dose
(J/m 2 )
Trial
0
Red/total
Mutation
coloniesa
frequency b
67/230,660
80/206,125
62/226,435
50
(3.2 ± 0.6) x 10-4
141/170,325
105/128,400
120/157,715
150
(8.0 ± 0.4) x 10-4
130/60,835
136/59,520
166/76,670
300
(2.2 ± 0.1) x 10-3
120/22,480
127/16,545
158/37,730
(5.7 ± 1.8) x 10-3
aEach value represents the sum of multiple transformations. In 8 of the 9 sets of
transformations of treated DNA, the number of mutants did not vary significantly between
distinct transformations.
bNumber of red colonies divided by the number of total colonies: average of the three trials
± standard deviation.
101
Table 2-2. Types of mutations in spontaneous and UV-induced (300 J/m 2 ) pLS76 and in
human cells
Number of mutations (% of total)
Human
Sequence
Un-treateda
UV-induceda
skin p53b
5
38
(61)
105
(45)
1
(21)
(4)
3
(5)
18
(8)
GC to TA
4
(17)
7
(11)
22
(9)
GC to CG
0
(0)
(5)
14
(6)
AT to TA
AT to CG
0
(0)
2
(0)
(8)
3
0
0
(0)
9
10
(4)
(4)
(or GG to AA)
Other double
0
(0)
4
(6)
32
(14)
mutants
0
2
(3)
5
(2)
Deletion (< 10bp)
Deletion (> 10bp)
3
(0)
(12)
(5)
(21)
(5)
(2)
12
5
3
1
2
(1)
Insertion (< 10bp)
Insertion (> 10bp)
Total mutations
0
4
(0)
(17)
1
0
(2)
4
(2)
(0)
0
(0)
233
alteration
Transitions
GC to AT
AT to GC
Transversions
CC to TT
aMutations in exons 5-8 of p53 in pLS76 (this study).
bNon-cryptic mutations in the coding region of p53 in human
skin tumors, precancerous lesions, and cell lines (16).
102
Table 2-3. Site and strand specificity of spontaneous and UV-induced mutations
No. of spontaneous
Spontaneous
No. of induced
events (sense or
antisense strand)b
base
changec
events (sense or
antisense strand) b,c
Mutation sitea
TCA/G
20 (8s,12a)
0
Induced
base changec
C to :T(16) :
A(3) :G(1)
CTA/G
1 (s)
T to G
2 (1s,la)
T to :C(2)
GCC
2 (1s,la)
C to :T(1) :A(1)
1 (a)
C to A
TTG
0
1 (s)
T to C
CCG
1 (a)
Total at dipyrimidines
C to A
0
24
4
TCC
1 (a)
C to A
12 (2s,10a)
C to :T(10) :A(2)
TCT
0
-
7 (2s,5a)
C to :T(6) :G(1)
CCC
TTC
1 (s)
1 (a)
C to T
T to G
3 (Is,2a)
0
C to :T(2) :A(1)
Total at overlapping
22
dipyrimidines
3
ACA/G
4
C to :T(3) :A(1)
4
C to :T(3) :G(1)
0
-
1
C to T
1
5
T to C
0
5
GCA
ATG
Total at non-dipyrimidines
aMutated bases are underlined.
bMutations resulting from UV photoproducts on the (s)ense or (a)ntisense strand.
cNumber of events is in parentheses.
103
Table 2-4. Comparison ofp53 hotspot mutations generated in yeast and in human
sun-exposed skin
number of mutations
codon
in yeast
in human
TGA
CAA
ATA
AAG
AAA
8
3
3
3
4
2
1
1
0
6
T/TAT
TAT
T/TGA
TGA
AGC
T/TGG
TGG
CTT
TCT
GAG
TGG
AAA
0
0
0
0
0
0
0
0
2
1
0
4
4
5
4
7
4
5
8
6
6
4
5
6
base change
to
to
to
to
to
yeast
system
hotspot
213
213
246
271
286
CGA
CGA
ATG
GAG
GAA
human
hotspot
178
179
195
196
245
247
248
278
278
279
282
286
C/CAT to
CAT to
C/CGA to
CGA to
GGC to
C/CGG to
CGG to
CCT to
CCT to
GGG to
CGG to
GAA to
104
References
1.
2.
3.
4.
5.
6.
7.
8.
9.
10.
11.
12.
13.
14.
15.
Greenblatt, M.S., Bennett, W.P., Hollstein, M., and Harris, C.C., Mutations in the
p53 tumor suppressor gene: clues to cancer etiology and molecular pathogenesis.
Cancer Res., 1994. 54, 4855-4878.
Gottlieb, T.M. and Oren, M., p53 in growth control and neoplasia. Biochim.
Biophys. Acta, 1996. 1287, 77-102.
Ko, L.J. and Prives, C., p53: puzzle and paradigm. Genes Dev., 1996. 10, 10541072.
Ziegler, A., Jonason, A., Simon, J., Leffell, D., and Brash, D.E., Tumor suppressor
gene mutations and photocarcinogenesis. Photochem. Photobiol., 1996. 63(4), 432435.
Levy, D.D., Magee, A.D., and Seidman, M.M., Single nucleotide positions have
proximal and distal influence on UV mutation hotspots and coldspots. J. Mol. Biol.,
1996. 258, 251-260.
Schirer, E. and Iggo, R., Mammalian p53 can function as a transcription factor in
yeast. Nucl. Acids Res., 1992. 20(7), 1539-1545.
Ishioka, C., Frebourg, T., Yan, Y.X., Vidal, M., Friend, S.H., Schmidt, S., and Iggo,
R., Screening patients for heterozygous p53 mutations using a functional assay in
yeast. Nat. Genet., 1993. 5, 124-129.
Flaman, J.M., Frebourg, T., Moreau, V., Charbonnier, F., Martin, C., Chappuis, P.,
Sappino, A.P., Limacher, J.M., Bron, L., Benhattar, J., et al., A simple p53
functional assay for screening cell lines, blood, and tumors. Proc.Natl. Acad. Sci.
USA, 1995. 92, 3963-3967.
Ausubel, F.M., Brent, R., Kingston, R.E., Moore, D.D., Seidman, J.G., Smith, J.A.,
and Struhl, K., eds. CurrentProtocols in MolecularBiology. Vol. 2. 1995, John
Wiley & Sons, Inc.: New York.
Kern, S.E., Kinzler, K.W., Bruskin, A., Jarosz, D., Friedman, P., Prives, C., and
Vogelstein, B., Identification of p53 as a sequence-specific DNA-binding protein.
Science, 1991. 252, 1708-1711.
Strathern, J.N. and Higgins, D.R., Recovery of plasmids from yeast into Escherichia
coli: shuttle vectors. Methods Enzymol., 1991. 194, 319-329.
Sharma, R.C. and Schimke, R.T., Preparation of electrocompetent E. Coli using saltfree growth medium. Biotechniques, 1996. 20(1), 42-44.
Mendenhall, W., Wackerly, D.D., and Scheaffer, R.L., Mathematicalstatistics with
applications.4 ed. 1990, Boston: PWS-KENT Publishing.
Struhl, K., Stinchcomb, D.T., Scherer, S., and Davis, R.W., High-frequency
transformation of yeast: autonomous replication of hybrid DNA molecules. Proc.
Natl. Acad. Sci. USA, 1979. 76(3), 1035-1039.
Sage, E., Distribution and repair of photolesions in DNA: genetic consequences and
the role of sequence context Photochem. Photobiol., 1993. 57(1), 163-174.
105
16.
17.
18.
19.
20.
21.
22.
23.
24.
25.
26.
27.
28.
Hollstein, M., Shomer, B., Greenblatt, M., Soussi, T., Hovig, E., Montesano, R.,
and Harris, C.C., Somatic point mutations in the p53 gene of human tumors and cell
lines: updated compilation. Nucl. Acids Res., 1996. 24(1), 141-146.
Jonason, A.S., Kunala, S., Price, G.J., Restifo, R.J., Spinelli, H.M., Persing, J.A.,
Leffell, D.J., Tarone, R.E., and Brash, D.E., Frequent clones of p53-mutated
keratinocytes in normal human skin. Proc.Natl. Acad. Sci. USA, 1996. 93, 1402514029.
Ren, Z.P., Hedrum, A., Ponten, F., Nister, M., Ahmadian, A., Lundeberg, J., Uhlen,
M., and Ponten, J., Human epidermal cancer and accompanying precursors have
identical p53 mutations different from p53 mutations in adjacent areas of clonally
expanded non-neoplastic keratinocytes. Oncogene, 1996. 12, 765-773.
Ren, Z.P., Ahmadian, A., Ponten, F., Nister, M., Berg, C., Lundeberg, J., Uhlen,
M., and Ponten, J., Benign clonal keratinocyte patches with p53 mutations show
no genetic link to synchronous squamous cell precancer or cancer in human skin.
Amer. J. Pathol., 1997. 150(5), 1791-1803.
Ponten, F., Berg, C., Ahmadian, A., Ren, Z.P., Nister, M., Lundeberg, J., Uhlen,
M., and Ponten, J., Molecular pathology in basal cell cancer with p53 as a genetic
marker. Oncogene, 1997. 15, 1059-1067.
Inga, A., Cresta, S., Monti, P., Aprile, A., Scott, G., Abbondandolo, A., Iggo, R.,
and Fronza, G., Simple identification of dominant p53 mutants by a yeast
functional assay. Carcinogen., 1997. 18(10), 2019-2021.
Ivanov, E.L., Kovaltzova, S.V., Kassinova, G.V., Gracheva, L.M., Korolev, V.G.,
and Zakharov, I.A., The rad2 mutation affects the molecular nature of UV and
acridine-mustard-induced mutations in the ADE2 gene of Saccharomyces cerevisiae.
Mutat. Res., 1986. 160, 207-214.
Kunz, B.A., Pierce, M.K., Mis, J.R.A., and Giroux, C.N., DNA sequence analysis
of the mutational specificity of u.v. light in the sup4-o gene of yeast. Mutagen.,
1987. 2(6), 445-453.
Lee, G.S.F., Savage, E.A., Ritzel, R.G., and vonBorstel, R.C., The base-alteration
spectrum of spontaneous and ultraviolet radiation-induced forward mutations in the
URA3 locus of Saccharomyces cerevisiae. Mol. Gen. Genet., 1988. 214, 396-404.
Bredberg, A., Kraemer, K.H., and Seidman, M.M., Restricted ultraviolet mutational
spectrum in a shuttle vector propagated in xeroderma pigmentosum cells. Proc.
Natl. Acad. Sci. USA, 1986. 83, 8273-8277.
Seetharam, S., Kraemer, K.H., Waters, H.L., and Seidman, M.M., Ultraviolet
mutational spectrum in a shuttle vector propagated in xeroderma pigmentosum
lymphoblastoid cells and fibroblasts. Mutat. Res., 1991. 254, 97-105.
Hauser, J., Seidman, M.M., Sidur, K., and Dixon, K., Sequence specificity of point
mutations induced during passage of a UV-irradiated shuttle vector plasmid in
monkey cells. Mol. Cell. Biol., 1986. 6(1), 277-285.
Miller, J.H., Mutagenic specificity of ultraviolet light. J Mol. Biol., 1985. 182, 4568.
106
29.
30.
31.
32.
33.
34.
35.
36.
37.
38.
39.
40.
41.
42.
43.
Hsia, H.C., Lebkowski, J.S., Leong, P.M., Calos, M.P., and Miller, J.H.,
Comparison of ultraviolet irradiation-induced mutagenesis of the lacI gene in
Escherichia coli and in human 293 cells. J Mol. Biol., 1989. 205, 103-113.
Sockett, H., Romac, S., and Hutchinson, F., DNA sequence changes in mutations
induced by ultraviolet light in the gpt gene on the chromosome of Escherichia coli
uvr+ and uvrA cells. Mol. Gen. Genet., 1991. 230, 295-301.
Romac, S., Leong, P., Sockett, H., and Hutchinson, F., DNA base sequence changes
induced by ultraviolet light mutagenesis of a gene on a chromosome in Chinese
Hamster Ovary cells. J. Mol. Biol., 1989. 209, 195-204.
Drobetsky, E.A., Grosovsky, A.J., Skandalis, A., and Glickman, B.W.,
Perspectives on UV light mutagenesis: investigation of the CHO aprt gene carried
on a retroviral shuttle vector. Somat. Cell Mol. Genet., 1989. 15(5), 401-409.
Lichtenauer-Kaligis, E.G.R., Thijssen, J., den Dulk, H., van de Putte, P., GiphartGassler, M., and Tasseron-de Jong, J.G., UV-induced mutagenesis in the
endogenous hprt gene and in hprt cDNA genes integrated at different positions in
the genome. Mutat. Res., 1995. 326, 131-146.
Tessman, I., Kennedy, M.A., and Liu, S.K., Unusual kinetics of uracil formation in
single and double-stranded DNA by deamination of cytosine in cyclobutane
pyrimidine dimers. J. Mol. Biol., 1994. 235, 807-812.
Jiang, N. and Taylor, J.S., In vivo evidence that the UV-induced C to T mutations
at dipyrimidine sites could result from the replicative bypass of cis-syn
cyclobutane dimers or their deamination products. Biochem., 1993. 32, 472-481.
Armstrong, J.D. and Kunz, B.A., Photoreactivation implicates cyclobutane dimers
as the major promutagenic UVB lesion in yeast Mutat. Res., 1992. 268, 83-94.
Sweder, K.S., Nucleotide excision repair in yeast. Curr. Genet., 1994. 27, 1-16.
Brash, D.E. and Haseltine, W.A., UV-induced mutation hotspots occur at DNA
damage hotspots. Nature, 1982. 298(8), 189-192.
Levy, D.D., Magee, A.D., Namiki, C., and Seidman, M.M., The influence of single
base changes on UV mutational activity at two translocated hotspots. J. Mol. Biol.,
1996. 255, 435-445.
Amstad, P., Hussain, P., and Cerutti, P., Ultraviolet B light-induced mutagenesis of
p53 hotspot codons 248 and 249 in human skin fibroblasts. Mol. Carcinogen.,
1994. 10, 181-188.
Pietenpol, J.A., Tokino, T., Thiagalingam, S., El-Deiry, W.S., Kinzler, K.W., and
Vogelstein, B., Sequence-specific transcriptional activation is essential for growth
suppression by p53. Proc. Natl. Acad. Sci. USA, 1994. 91, 1998-2002.
Crook, T., Marston, N.J., Sara, E.A., and Vousden, K.H., Transcriptional activation
by p53 correlates with suppression of growth but not transformation. Cell, 1994.
79, 817-827.
Rowan, S., Ludwig, R.L., Haupt, Y., Bates, S., Lu, X., Oren, M., and Vousden,
K.H., Specific loss of apoptotic but not cell-cycle arrest function in a human tumor
derived p53 mutant. EMBO J., 1996. 15(4), 827-838.
107
44.
45.
46.
47.
Bates, S. and Vousden, K.H., p53 in signaling checkpoint arrest or apoptosis. Curr.
Opin. Genet. Dev., 1996. 6, 12-19.
Zhang, W., Guo, X.-Y.D., and Deisseroth, A.B., The requirement of the carboxy
terminus of p53 for DNA binding and transcriptional activation depends on the
specific p53 binding DNA element. Oncogene, 1994. 9, 2513-2521.
Friedlander, P., Haupt, Y., Prives, C., and Oren, M., A mutant that discriminates
between p53-responsive genes cannot induce apoptosis. Mol. Cell. Biol., 1996.
16(9), 4961-4971.
Park, D.J., Chumakov, A.M., Miller, C.W., Pham, E.Y., and Koeffler, H.P., p53
transactivation through various p53-responsive elements. Mol. Carcinogen., 1996.
16, 101-108.
108
3. Analysis of Hotspot Mutations Induced
in Human p53 Following In Vitro UV
Treatment and Replication in Yeast
This work was performed in collaboration with Per O. Ekstrom and William G. Thilly at
the Massachusetts Institute of Technology
109
Introduction
The previous chapter details the use of a yeast model system for the generation of
UV-induced p53 mutations and comparison of the spectrum to that of human UVexposed skin. Some similarities were found between the two spectra, but comparison of
the hotspot sites of mutation revealed significant differences. However, because the
generated mutant sample size was small in the study, some doubt about the sites of
hotspot mutations remains. Therefore, a larger scale UV-induced mutant generation and
analysis was begun in an attempt to more clearly define the hotspots in p53 resulting
from UV treatment and replication in yeast.
Constant denaturant capillary electrophoresis (CDCE) is a recently described
technique that can efficiently separate DNA fragments of approximately 100 bp differing
by as little as a single base pair (1). This method is a modification of the earlier
techniques of denaturing gradient gel electrophoresis (DGGE; ref. 2) and constant
denaturant gel electrophoresis (CDGE; ref. 3). Each process is based on the facts that 1)
the electrophoretic mobility of DNA molecules through a gel is greatly reduced when the
fragments are partially denatured (melted), and 2) the melting properties of different
mutants are not identical. Sequences containing a high and a low melting domain are ideal
for analysis with this technique because at certain denaturant conditions, they form
partially melted structures. Base alterations in the low melting domain alter the
equilibrium between the partially melted and unmelted states, thus leading to different
mobilities through the gel (reviewed in ref. 4). Additionally, boiling and reannealing of the
strands creates heteroduplexes of wild type and mutant DNA that are less stable than
110
homoduplexes and migrate more slowly through the gel, thus improving the ability to
separate out mutant fragments using this procedure. The fragments are detected by laserinduced fluorescence of Fluorescein labeled DNA (contained on one of the PCR primers;
ref. 1). For sequences that do not contain a high melting and a low melting domain, a GC
rich 'clamp' can be added to the PCR primer for the sequence in question to create an
artificial high melting domain (5).
CDCE has been successfully used to analyze mutations in a human mitochondrial
DNA fragment (1), in N-ras (6), and more recently in exon 8 ofp53 (7). Here, the
technique is used to analyze a large pool of UV-induced p53 mutants generated in yeast in
an attempt to determine hotspot sites of mutation and mutation frequencies for
comparison with the mutation spectrum of human UV-exposed skin.
111
Materials and Methods
Yeast Cells and Plasmids. yIG397, the yeast strain suitable for red/white color
selection for p53 mutants, genotype MATa ade2-1 leu2-3,112 trpl-1 his3-11,15 can]-100
ura3-1 URA3 3XRGC::pCYCI::ADE2 was provided by R. Iggo (8). The cells were
cultured using standard techniques (9) in yeast extract / peptone / dextrose (YPD) liquid
or solid (+2% agar) medium supplemented with 200 jgg/ml adenine (YPD +Ade).
Selection for pLS76 transformants and cells with mutant p53 was performed on solid
medium limited in adenine (4 gg/ml; CM -Leu +low Ade) as described (10). pLS76 wt,
the p53 yeast expression vector, was provided by S. Friend (11). pLS76 mutants
containing a codon 271 GAG to AAG or codon 286 GAA to AAA base substitution in
p53 were generated previously (10).
UV Treatment and Mutant Generation. pLS76 was exposed to 300 J/m 2 UV light as
described (10) except that a Stratalinker (Stratagene) was used for the 254 nm light source.
yIG397 was transformed with the damaged plasmid and untreated control using a LiOac
procedure (10) until =1200 induced mutants were obtained (approximately 20
transformations of treated and 2 of control DNA). Mutants were then isolated and restreaked to single colonies on selective plates.
112
Mutant DNA Isolation. 1200 UV-induced mutants were pooled by inoculating one
colony of approximately identical size from each of the re-streaked mutants into 10 ml ice
cold (to prevent excessive cell growth) selective medium. DNA was then isolated from
the cell mixture by the glass bead lysis method as described (9). Two separate mutant
DNA mixtures were prepared by inoculating the colonies in opposite order to determine
whether the DNA isolated in this manner results in a reproducible quantitation of the
number of certain mutant plasmids present.
CDCE Analysis. PCR was performed on the samples with the following primers: 5' TGGTAATCTACTGGGACGG - 3' and GC clamp containing 5' Fluorescein labeled 5'
- CGCCCGCCGCGCCCCGCGCCCGTCCCGCCGCCCCCGCCCGTACCTCGCT
TAGTGCTCCCT - 3' (exon 8) or GC clamp containing 5' Fluorescein labeled 5' CGCCCGCCGCGCCCCGCGCCCGTCCCGCCGCCCCCGCCCGATTTGCGTGTG
GAGTATTTG - 3' and 5' - CTCCGGTTCATGCCGCCCATG - 3' (exons 6 - 7)
using Pfu polymerase (Stratagene) and an Air-Thermo Cycler (Idaho Technology). The
program used was 1 min. at 95 0 C, then 35 cycles of 8s at 95 0 C, 15s at 500 C, and 20s at
72°C. Total reaction volumes were either 5 or 10 l. Heteroduplexes were formed by
heating the samples at 94 0 C for 3 minutes and reannealing at 65 0 C for one hour. PCR
products were analyzed by CDCE as described (7).
113
Results and Discussion
Mutant Generation. To perform a large scale analysis of UV-induced mutations in
human p53 cDNA following replication in yeast, the pLS76 wt p53 expression vector
was first treated in vitro with 300 J/m 2 UV-C and introduced into yIG397 for replication
and selection of mutants. Mutation frequencies were found to be =6 x 10-4 for untreated
control plasmid (54 mutants out of 94,230 colonies) and =6 x 10-3 for the UV-treated
plasmid (1242 mutants out of 201,040 colonies). Then, 1200 UV-induced mutants were
pooled and DNA was extracted for subsequent analysis for hotspot mutation sites in
exon 8 and a region encompassing parts of exons 6 and 7.
CDCE Analysis. As an initial trial of the PCR and mutant separation procedures, pLS76
vector standards containing either wild type or mutant p53 (a codon 271 GAG to AAG
or codon 286 GAA to AAA mutation) were amplified with primers specific for exon 8 of
p53 (cDNA) and analyzed by CDCE after boiling and reannealing to form heteroduplexes.
Figure 3-1 shows the profiles of the wild type standard and 50/50 mixtures of wild type
and each mutant. The four prominent peaks in the wild type / codon 271 mutant sample
represent the wild type homoduplex, mutant homoduplex, and heteroduplexes of the two
mutant and wild type strands (in the order of increasing elution time). The wild type /
codon 286 mutant mixture profile has only three peaks. This is presumably due to the
inability to separate the wild type and mutant homoduplexes under the conditions used.
114
Alteration of conditions such as the length of the capillary and the temperature at which
the samples are run should be able to improve subsequent separation of these peaks (1).
Since the mutant standard amplification and separation from wild type (in at least
the case of heteroduplexes) was successful, the DNA derived from the pooled 1200
mutant sample was amplified and analyzed by CDCE. The products were run at
different temperatures in an attempt to distinguish peaks that are likely due to mutants as
opposed to single stranded DNA or other artifacts from the PCR process. The elution
time of actual mutant and wild type homoduplexes and heteroduplexes should be
dependent upon the temperature at which the samples are run; single stranded
"contaminating" DNA should be unaffected by temperature. Figure 3-2 presents the
results of the analysis of the mutant sample run at 76, 77, and 78 0 C. As can be seen, the
large wild type peak at 600 seconds and some of the peaks eluting later are affected by
the temperature of the run, indicating that they are double stranded DNA fragments and
represent possible mutants. The elution of the peaks present before 550 seconds are
unaffected by temperature, implying that they are single stranded. The large peak at 500
seconds is the primer peak; the others between 500 and 550 seconds may represent
'primer dimers'.
Analysis of a positive control sample of yeast DNA that contains pLS76 with
only wild type p53 was also performed, and the CDCE profile is shown in Figure 3-3. A
few peaks that elute just before the wild type homoduplex are present, suggesting that the
PCR products was not as 'clean' as desired. However, the region after the wild type
115
peak (> =14 minutes) is free from peaks, indicating that mutants should be detectable in
this region.
This work is ongoing as a collaborative effort with Dr. Per Ekstrom in the Thilly
Laboratory. The next step in the analysis will be to optimize PCR conditions as to
eliminate extra 'unknown' peaks in the CDCE profile and to optimize the separation of
mutant and wild type peaks. Then, the 1200 mutant sample will be amplified and run
again to identify peaks representing hotspot sites of mutation. The peaks will be
collected and analyzed by sequencing to determine what the hotspot base changes are and
where they occur. Of particular interest are the codon 278 CCT to TCT, codon 286
GAA to AAA, and codon 279 GGG to GAG mutations, which are hotspots in human
UV-exposed skin and occur in the yeast system following UV treatment (10). The same
type of analysis will be performed using primers specific for a region encompassing exons
6-7 to see if the most prominent hotspots observed in the former small scale UV
mutagenesis study (codon 213 CGA to TGA and CGA to CAA) are also present at a
high frequency in the large mutant pool. In all, the results obtained using CDCE should
prove to be superior over those using the 'clone by clone' approach described in the
previous chapter for comparing the UV-induced mutation spectrum ofp53 generated in
yeast with that of human skin.
116
A
-- ......
......................
......-I.....
......-.
~....
...........
.....
-:.'..........
.
-- -...-............
...........
.................
...............
..............
......
..............
.~~~~~~~...
-.
..............
.. . . ..............
............---
B
. . ...
C
.
...... ..
..
...
...
. .....
..
.. ...
...
..
.. ....
.
..
.
.
...
. . * ... ...
.......
..
....
.. ...
-........
- ...
- -....
...
..
....
-i .
;-.....--; ...
-
...
....
......
8.0
10.0
12.0
Elution time (min)
Figure 3-1. CDCE profile of wild type and mutant p53 standards. (A) wild type
p53, (B) wild type and codon 271 GAG to AAG mutant 50/50 mixture, (C) wild type
and codon 286 GAA to AAA mutant 50/50 mixture.
117
A
118 ................................
~~-~~
..........
.......
.....
.............
..*..........
..
..............
B
...
...
....
...
..
...
...
......
....
...
..
....
.....
......
...
...
..~~...
....
r . ........ ...
.
..
..
...
..
..
..
..
...
..
..
...
..
..
...
. . ......
.. ... ...
..
..
..
..
.....
..
...
....... ...
....
..
..
....
.....
. ...
.. . ..
...
...
......
C
:...
B
..
...
...
...
.. ....
.....
..
...
...
...
...
.I........
:...
....
....
..... ...
..
................ ... .......... .... ........
.....
...... .......... ..... ...............................
.........
............
.......
......
.....
...
.........
.......
............*.
........................................................
...........
......
.......
.......
........
.........
.....
...
...
........
..
..
...
...
...
4.0
5.0
...
....
........
..
...
6.0
7.0
..
.
..
I..
.
..
8.0
Elution time (sec x 10-2)
Figure 3-2. CDCE profile of pooled p53 mutant sample at various temperatures.
Samples were run at 76 0 C (A), 77 0 C (B), and 78 0 C (C).
10.0
12.0
14.0
16.0
Elution time (min)
Figure 3-3. CDCE profile of wild type p53 control sample.
119
18.0
References
1.
2.
3.
4.
5.
6.
7.
8.
9.
10.
11.
Khrapko, K., Hanekamp, J.S., Thilly, W.G., Belenkii, A., Foret, F., and Karger,
B.L., Constant denaturant capillary electrophoresis (CDCE): a high resolution
approach to mutational analysis. Nucl. Acids Res., 1994. 22(3), 364-369.
Fischer, S.G. and Lerman, L.S., Length-independent separation of DNA restriction
fragments in two-dimensional gel electrophoresis. Cell, 1979. 16, 191-200.
Hovig, E., Smith-Sorensen, B., Brogger, A., and Borresen, A.L., Constant
denaturant gel electrophoresis, a modification of denaturing gradient gel
electrophoresis, in mutation detection. Mutat. Res., 1991. 262, 63-71.
Khrapko, K., Andre, P., Cha, R., Hu, G., and Thilly, W.G., Mutational
spectrometry: means and ends. Prog.Nucl. Acid Res. Mol. Biol., 1994. 49, 285-312.
Myers, R.M., Fischer, S.G., Lerman, L.S., and Maniatis, T., Nearly all single base
substitutions in DNA fragments joined to a GC-clamp can be detected by
denaturing gradient gel electrophoresis. Nucl. Acids Res., 1985. 13(9), 3131-3145.
Kumar, R., Hanekamp, J.S., Louhelainen, J., Burvall, K., Onfelt, A., Hemminki, K.,
and Thilly, W.G., Separation of transforming amino acid-substituting mutations in
codons 12, 13, and 61 of the N-ras gene by constant denaturant capillary
electrophoresis (CDCE). Carcinogen., 1995. 16(11), 2667-2673.
Ekstrom, P.O., Borresen-Dale, A.L., Qvist, H., Giercksky, K.E., and Thilly, W.G.,
Detection of low frequency mutations in exon 8 of the TP53 gene by constant
denaturant capillary electrophoresis (CDCE). submittedfor publication, 1998,.
Flaman, J.M., Frebourg, T., Moreau, V., Charbonnier, F., Martin, C., Chappuis, P.,
Sappino, A.P., Limacher, J.M., Bron, L., Benhattar, J., et al., A simple p53
functional assay for screening cell lines, blood, and tumors. Proc.Natl. Acad. Sci.
USA, 1995. 92, 3963-3967.
Ausubel, F.M., Brent, R., Kingston, R.E., Moore, D.D., Seidman, J.G., Smith, J.A.,
and Struhl, K., eds. CurrentProtocolsin MolecularBiology. Vol. 2. 1995, John
Wiley & Sons, Inc.: New York.
Moshinsky, D.J. and Wogan, G.N., UV-induced mutagenesis of human p53 in a
vector replicated in Saccharomyces cerevisiae. Proc.Natl. Acad. Sci. USA, 1997. 94,
2266-2271.
Ishioka, C., Frebourg, T., Yan, Y.X., Vidal, M., Friend, S.H., Schmidt, S., and Iggo,
R., Screening patients for heterozygous p53 mutations using a functional assay in
yeast. Nat. Genet., 1993. 5, 124-129.
120
4. UV-Induced Mutagenesis of Human
p53 : Analysis Using a
Double Selection Method in Yeast
121
The previous chapters detailed the use of a yeast model system to generate and
study UV-induced mutations in human p53 following in vitro DNA modification. This
chapter extends the use of the same model, but introduces modifications of the mutant
selection scheme to allow for more efficient screening for mutants and for mutagen
treatment of whole cells. The characterization of the system and preliminary analysis of
UV-induced mutations in p53 are presented.
122
Introduction
Mutation of the p53 tumor suppressor gene is the most common genetic alteration
known to occur in human cancers. Wild type p53 is a key factor in the induction of cell
cycle arrest or apoptosis following DNA damage and in the maintenance of genomic
stability (reviewed in ref. 1). The ability of p53 to activate transcription is of central
importance in inducing these cellular effects. Many genes whose products are involved in
growth arrest or apoptosis have been shown to be transactivated by p53, including the
cyclin dependent kinase inhibitor p21WAF' (2-4), the DNA damage inducible growth arrest
gene GADD45 (5, 6), the apoptosis inducer bax (7), and several other newly discovered
genes involved in the promotion of apoptosis (8-13).
The mutation spectra ofp53 in human tumors have been extensively analyzed
with the objective of determining which environmental agents are responsible for the
induction of certain tumor types (reviewed in refs. 14, 15). Commonly, the pattern of
mutations inp53 is compared to those generated in various selectable genes in
experimental systems to attempt to establish a causal relationship between carcinogens
and tumor mutations. More recently, however, a yeast model system has been used to
determine mutation patterns directly on the p53 gene, thus avoiding difficulties inherent in
the comparison of genes with different sequence contexts (16-18). In these analyses, the
p53 gene was treated with a mutagen in vitro, replicated in yeast (16, 17) or amplified by
PCR (18), and mutants were selected for by a red/white color selection based on loss of
transactivation ability of the protein in yeast.
123
Here we present a modification of the p53 mutagenesis yeast model system where
a life/death selectable phenotype is used in addition to the red/white color selection to
identify cells with transactivation deficient p53, and mutagen treatment of the gene is
performed in the yeast cells as opposed to in vitro. The initial characterization of this
mutant selection scheme is described, and it is shown to accurately measure the mutant
fraction of mixtures of cells with wild type and those with mutant p53. Additionally, UV
light was used as a mutagen to establish that the majority of cells with the appropriate
phenotypic change actually contain mutations in p53 and to perform a preliminary
investigation of the nature of UV-induced mutations generated by cellular mutagen
treatment. This system greatly facilitates the screening of the large number of colonies
examined in mutagenesis experiments and allows for the mutagen modification of whole
cells, a more biologically relevant treatment scheme than that of DNA in vitro.
124
Materials and Methods
Yeast Strains, Media, and Plasmids. yIG397, the yeast strain suitable for red/white
color selection for p53 mutants, genotype MATa ade2-1 leu2-3,112 trpl-1 his3-11,15
canl-100 ura3-1 URA3 3XRGC::pCYCI::ADE2 was provided by R. Iggo (19). To
incorporate the life/death selection for mutants, this strain was transformed with
pSS1CANla using a LiOac method as described (16) to form yDM56. pSS1CANla was
constructed as follows: the yeast CAN1 (arginine permease) coding region was PCR
amplified from the vector pYeCAN 1-2 (ref. 20; provided by G. Fink) for 30 cycles using
the primers 5'-GGACGGAGCTCAAAGGCATAGCAATGACA-3'
and 5'-
GCTGGCGGCCGACGTCATATCTATGCTAC-3' and Pfu polymerase (Stratagene).
The PCR product was then digested with SacI and EagIand ligated into SacI/EagI
digested pSS1 (a stable episomal vector containing a p53-responsive HIS3 gene that was
provided by S. Friend; ref. 21) after gel purification to remove the HIS3 gene, forming
pSS1CAN1. A bi-directional transcription terminator contained in the region between the
GCY1 and PFY1 genes of S. cerevisiae (22) was then PCR amplified from yIG397
genomic DNA with the primers 5'-GCTGGCGGCCGTGGCTGACTACTTGATTGG
TG-3' and 5'-GCTGGCGGCCGGTCTACTGAGGACTTTGAAGC-3'
for 30 cycles
using Pfu polymerase. The terminator was digested with Eagl and inserted into Eagl
digested pSS1CAN1 to form pSS1CAN1a. The humanp53 cDNA yeast expression
vectors, pLS76 wt (wild type p53) and pLS76 273H (transactivation deficient mutant
p53 with an arginine to histidine substitution at codon 273; provided by S. Friend, ref.
125
21) were introduced into yDM56 by LiOac transformation to form yDM56p, the strain
suitable for cellular mutagen modification studies, and yDM56p (mt) for the
reconstruction experiment, respectively.
Yeast strains were cultured using standard techniques (23). yIG397 was grown in
yeast extract / peptone / dextrose (YPD) liquid or solid (+2% agar) medium supplemented
with 200 gg/ml adenine (YPD +Ade). Other strains were grown in complete minimal
(CM) media containing 0.67% yeast nitrogen base, 2% dextrose, 200 gg/ml adenine, and
complete additions except for relevant amino acids (CM -Trp -Arg +Ade for yDM56
and CM -Trp -Arg -Leu +Ade for yDM56p). Arginine was not included in the media to
avoid the possible selection of cells with spontaneous reversions in the mutant CAN1
(arginine permease) locus. Selection for pLS76 transformants and cells with mutant p53
was performed on solid medium limited in adenine (4 gg/ml; CM -Leu +low Ade) for
yIG397 or medium containing 200 gg/ml canavanine (CM -Trp -Arg -Leu +low Ade
+Can) for yDM56p. Media components were from Difco or Sigma.
Reconstruction Experiment. yDM56p and yDM56p (mt) were inoculated separately
into 5 ml CM -Trp -Arg -Leu +Ade and grown until an OD 600 of> 1.0 (=3 x 107
cells/ml) was attained. The cells were diluted appropriately in ice cold water and plated
at a density of =1200 cells/150 mm plate on medium without canavanine (CM -Trp -Arg
-Leu +low Ade) for subsequent determination of cell numbers. The cells were then mixed
in approximate ratios of 1:1000 and 1:10,000 yDM56p (mt) to total cells and plated at
126
=60,000 cells/150 mm plate on medium containing 200 gg/ml canavanine. The plates
were incubated at 35 0 C for 3 days, at which time mutant fractions were calculated by
dividing the number of red colonies on plates with drug by the total number of colonies,
as determined by the colony number on plates without drug. Results are the average of
three independent experiments. Expected mutant fractions are based on the proportion of
mutants in the initial cell mixture, as determined by the number of colonies on medium
without drug, plus the spontaneous mutant fraction of the same culture (2.3 x 10-5; 1.9 x
106 colonies examined).
UV Mutagenesis. yDM56p was inoculated into 5 ml medium and grown and diluted as
in the reconstruction experiment. Cells were plated at a density of =4000/150 mm plate
on medium without canavanine and =100,000/plate on medium containing the drug.
Plates were UV-irradiated with 254 nm UV light at 60 J/m 2 in a Stratalinker (Stratagene)
and incubated at 350 C for 3 days in dark conditions to avoid photoreactivation repair of
the UV damage. Cell survival was determined by plating =1200 cells/plate and comparing
the number of colonies resulting on UV-treated vs. untreated plates (typically three for
both conditions). Mutant fractions were determined as in the reconstruction experiment.
Spontaneous mutant fractions were obtained from identical cultures of cells in the same
way except that the UV treatment was omitted and the cell densities were =1200
cells/plate without drug and =60,000 cells/plate with drug.
127
Mutant Characterization.
Yeast FunctionalAssay. To determine the mutation status ofp53, PCR products of the
gene were re-introduced into yIG397 with a 'gapped' expression vector as in the
previously described functional assay (19). Briefly, genomic DNA was isolated from red
colonies of yDM56p by a glass bead lysis method (23) and used for PCR amplification of
the p53 cDNA (of pLS76) using the primers P3 and P4 and Pfu polymerase as described
(19). PCR products were purified using the High Pure PCR Purification system
(Boehringer Mannheim), and =100 ng were cotransfected with =100 ng HindllI/Stul
linearized pSS16 gapped p53 expression vector (a gift from S. Friend; ref. 21) by the
LiOac method. One fifth to one third of the transformed cells were plated on CM -Leu
+low Ade. PCR products that resulted in 295% red colonies were classified as p53
mutants.
Sequencing. Exons 5-8 of the purified PCR products were sequenced with the primer 5'GGCTTCTTGCATTCTGGGAC-3' by the University of Georgia Molecular Genetics
Instrumentation Facility. Mutations were identified using Sequencher DNA analysis
software (Gene Codes, Ann Arbor, MI).
128
Results
Alteration of p53 Mutant Selection System. The yeast strain yIG397, which has
red/white color selection for p53 mutants based on loss of transactivation of a p53responsive ADE2 gene (19), was genetically altered to incorporate life/death selection for
mutants where cells with wild type p53 die on selective medium and those with mutant
p53 live. This was done by introducing an episomal vector containing a p53-responsive
CAN] (arginine permease) gene (pSSICAN1a; Figure 4-1) into the strain. The presence
of the CAN1 gene product sensitizes cells to the toxic arginine analog canavanine by
facilitating cellular uptake of this drug (20). Cells with wild type p53 activate
transcription of the CAN] gene through the interaction of the protein with the ribosomal
gene cluster (RGC) binding site in the vector, and these cells thus cannot grow on medium
containing canavanine. Cells with mutant p53 are unable to activate transcription of
CAN] and are unaffected by the presence of the drug in the medium. yDM56, the strain
bearing pSS1CANla, was also transformed with pLS76 wt, an episomal p53 yeast
expression vector maintained at single copy, to form a strain, yDM56p, suitable for
cellular mutagen treatment and selection of p53 mutants by both red/white and life/death
selection.
Reconstruction Experiment. To test whether p53 mutant fractions can be accurately
determined with yDM56p plated on selective medium, yDM56p and yDM56p (mt)
129
were mixed in ratios of = 1:1000 and 1:10,000 and plated on medium containing
canavanine (for life/death selection) and limited in adenine (for red/white selection). The
number of red colonies was then determined, and mutant fractions were calculated. The
results of this experiment are presented in Table 4-1. The mutant fractions determined in
this way are not significantly different from the expected values, indicating that the values
obtained using this system correctly reflect the fraction of mutants in the initial cell
mixture.
Figure 4-2 shows an identical plate of yDM56p on selective medium pictured on a
dark and a light background. As seen with the black background, the life/death selection
does not completely kill cells with wild type p53 but rather slows their growth, as
indicated by the presence of many small colonies. However, when the plate is transferred
to a white background, the red (larger) colonies are clearly visible.
UV Mutagenesis. As an initial test to determine the proportion of red colonies present
on selective medium following mutagen modification of yDM56p that contain mutations
in p53 as opposed to elsewhere in the genome, a UV mutagenesis experiment was
2
performed. Cells were plated on selective medium, UV irradiated at 60 J/m of 254 nm
UV, and incubated at 350 C until red colonies appeared. Cell survival on non-selective
medium at this dose was =20%. A slight increase in mutant fraction was seen over the
spontaneous following treatment (Table 4-2 A). Since a larger increase in mutant fraction
was expected, the survival of yDM56p (mt) on plates with canavanine was examined. If
130
the survival of cells with mutant p53 after UV irradiation is significantly less on plates
with drug than on those without drug, this would result in a lower measured mutant
fraction, as the combined treatment of cells with UV and canavanine in the medium would
kill more cells than UV treatment alone. This was found to be the case. The survival of
yDM56p (mt) following UV irradiation on plates without drug was comparable to that
seen with yDM56p (-15%), but was less on plates containing canavanine (=5%). Thus,
the mutant fraction resulting from treatment of yDM56p in this manner is likely an
underestimate of the actual value.
Mutant Characterization. To determine the number of red colonies in the UV
mutagenesis experiment that have mutant p53, this gene was PCR amplified from selected
colonies and introduced back into yIG397 with a gapped expression vector as in the
previously described yeast functional assay (see Materials and Methods). PCR products
that resulted in red colonies were considered p53 mutants; those that resulted in white
colonies were presumed to have mutations outside of the p53 region to cause the growth
and red phenotype in yDM56p.
Before functional analysis, the p53 PCR products were analyzed by agarose gel
electrophoresis to detect gross insertions and deletions. Of the 50 spontaneous red
colonies examined, 14 (28%) contained large insertions or deletions in p53. In contrast,
only 3 (7%) of the 41 UV-induced red colonies contained alterations of this kind (data not
shown).
131
The results of the p53 functional assay analysis are presented in Table 4-2 B. Of
the 36 spontaneous red yDM56p colonies (with normal size PCR product) tested in the
functional assay, 31 (86%) contained mutant p53. Sequencing of exons 5-8 ofp53 from
these mutants revealed that 17 (55%) harbored mutations in this region. For the UVinduced red colonies of yDM56p, 27 of 38 (71%) contained mutant p53 as judged by the
functional assay, and 16 (59%) of these had detectable mutations in exons 5-8 in p53.
Three spontaneous mutants were found to contain an identical mutation (18 bp deletion).
Because of the way that these experiments were performed, cells deriving from the same
mutant cannot be distinguished from independent spontaneous mutational events.
Therefore, only 1 of these three mutants were included in further analyses.
A summary of the mutations found in the sequenced region of the gene are listed
in Table 4-3. In total, the majority of spontaneous mutations (69%) were found to be
large or small insertions and deletions, whereas a minority (25%) of the UV-induced
mutants contained these alterations. Of the single base changes in the UV treated
samples, C to T was the most common (7/14) followed by T to C (3/14) and C to A
(3/14), then T to A (1/14). Additionally, the UV-induced mutations showed a strong
preference for mutating bases that are within dipyrimidine sequences (CT, CC, TT, or
TC), as 13 out of 14 (93%) of the single base changes occurred within these sites.
Spontaneous mutations did not display such a preference; mutations within dipyrimidine
sites occurred with nearly the same frequency as those at sites without dipyrimidines (4
of 9 vs. 5 of 9, respectively).
132
Pink colonies were also found using this method for selection of mutants, and 31
(combined from spontaneous and UV-induced) were analyzed by yeast functional assay
to determine whether they harbored mutations in p53. Only 1 (3%) actually contained a
mutation in the gene, implying that a different mutational event in the cells may be
responsible for the pink phenotype. Therefore, only red colonies should be classified as
likely p53 mutants.
Spontaneous Mutation Frequency. As yDM56p is continuously cultured,
spontaneous mutations in p53 accumulate, and the measured spontaneous mutant fraction
increases (data not shown), presumably because cells with mutant p53 may have a slight
growth advantage over cells with wild type protein (21, 24). To address whether the
spontaneous mutant fraction could be lowered by killing pre-existing p53 mutants by
altering the cell growth conditions, yDM56p was cultured in medium lacking adenine, and
the spontaneous mutant fraction was compared to that of cells grown in the presence of
this compound. Since the yeast strain contains a p53-responsive ADE2 gene, only cells
with wild type p53 should be able to grow in medium lacking adenine.
A large culture of yDM56p (100 ml) was grown to saturation from a single
colony, and =4 x 106 cells from this culture were re-grown to saturation in 5 ml medium
containing adenine while the same number of cells were grown in 5 ml medium lacking
adenine. Spontaneous mutant fractions were then determined from the two cultures.
Growing the cells in medium lacking adenine was found to reduce the mutant fraction
133
under these conditions by =2 fold, as the mutant fraction of the cells grown with adenine
5
was (6.0 ± 1.7) x 10-5 and that of the cells grown without it was (2.6 ± 1.0) x 10- (based
on 3 independent experiments and the examination of at least 106 total cells per trial).
134
Discussion
We have introduced an improved system for p53 mutation detection in yeast
where a life/death selection scheme for transactivation deficient mutants was incorporated
into the strain already containing red/white colony color selection. This greatly facilitates
the mutant screening process, since only mutants grow well on selective medium. Also,
this strain allows for the mutagen modification of whole cells as opposed to in vitro DNA
treatment, since the redundancy of selection for mutants ensures that cells with the
appropriate phenotype actually harbor mutations in p53, not in the selection gene. A
reconstruction experiment showed that mutant frequencies can be accurately determined
-4
using this system with mutant to total cell ratio at least as low as 1 x 10 . A small scale
UV mutagenesis experiment confirmed that p53 mutations can be induced with this yeast
strain and, more importantly, that the majority of the cells with growth ability and red
phenotype on selective medium contain mutant p53. 86% of the spontaneous and 71%
UV-induced red colonies contained mutations in the gene as determined by yeast
functional assay analysis. Of those mutants, 55% of the spontaneous and 59% of the
UV-induced harbored mutations within exons 5-8, as determined by sequencing. These
numbers are similar to that of a previously described mutation study following in vitro
DNA treatment where 39% of the spontaneous and 64% of the UV-induced red colonies
contained detectable mutations in this region ofp53 (16).
Sequence analysis of the mutants revealed that the mutational events that occurred
spontaneously differed from those induced by UV. Most of the spontaneous mutations
were insertions or deletions (69%), and the predominant base change was C to A (78% of
135
the single base changes). In contrast, only 25% of the UV-induced mutants contained
insertions or deletions, and the most common base change was C to T (50%). This
predominance of C to T transitions is in accord with a multitude of previous studies on
UV mutagenesis in bacterial, yeast, and human cell systems (reviewed in ref. 25). The
fact that T to C mutations were also found at a relatively high frequency (21% of the
single base pair substitutions) is in agreement with other UV mutagenesis studies in yeast
where whole cells were treated with mutagen (26-28), but differs slightly from the in vitro
UV-treatment scheme with subsequent replication in yeast where T to C transitions
represented only 6% of the single base changes (16). Also in agreement with the majority
of UV studies in many different models was the fact that over 90% of the induced
mutations occurred at dipyrimidine sites (25), consistent with the previous findings that
cyclobutane pyrimidine dimers are the primary mutagenic lesions in UV treated yeast
(29). Spontaneous mutations were nearly equally distributed between sites with and
those without dipyrimidines. The small sample size and the fact that no mutations were
found more than once makes it difficult to compare the mutation spectrum obtained here
with that ofp53 mutations in human cancers, however this has been done with UV as a
mutagen in this system following in vitro DNA treatment and transformation into yeast
(16).
The =2 fold increase in p53 mutant fraction observed after treatment of the cells
with 60 J/m 2 UV was much less than that observed in similar systems for the ADE2 (26),
SUP4-o (27), and URA3 (28) genes with the same dose of UV. p53 mutant cell survival
136
after UV irradiation on plates with canavanine was found to be less than that on plates
without the drug (5% vs. 15%, respectively), indicating that treatment of the cells in the
presence of canavanine kills more cells than treatment alone, and this likely accounts for
the low calculated induced mutant fraction. Treating the cells in nonselective medium and
allowing for cell recovery before plating on medium with drug would circumvent this
problem, and as indicated from the results of the reconstruction experiment, mutant
fractions obtained in this way accurately reflect the proportion of mutants in the initial
cell mixture.
Another way to ensure a greater induced mutant fraction compared to
spontaneous is to reduce the latter, the background mutant fraction of the system.
Culturing the cells in medium without adenine was found to decrease this spontaneous
mutant fraction by approximately 2 fold following a single overnight culture (=8 cell
population doublings). Since the strain contains a p53-responsive ADE2 gene, cells with
transactivation deficient p53 require the presence of adenine in the medium for growth.
Continued culture of the cells in medium lacking adenine should further reduce the
background mutant fraction and also lead the way for analysis of spontaneous p53
mutations generated by culturing the cells, as the number of pre-existing mutants would
be small in comparison.
The model system described here can be used to determine mutation patterns on
p53 directly following mutagen modification and replication in yeast cells for the
comparison with those of p53 mutations in certain tumor types. Studies such as these
137
attempt to answer whether the selected mutagen was likely to have caused the p53
mutations seen in the tumors, and also whether the mode of action of certain carcinogens
involves mutagenic or non-mutagenic mechanisms. However, there are reasons to expect
that mutation patterns generated with this assay will not correlate exactly with what is
seen in tumors. First, the mutants selected for in this system are those that have lost the
ability to activate transcription from the RGC binding site (30) driving the expression of
both selection genes. There is some evidence that different mutants may lose affinity for
certain genomic DNA binding sites over others (31, 32), suggesting that there may be a
bias for selection of mutants that lose activity from this particular binding site.
Furthermore, although the transactivation function of p53 seems to be important in
mediating its cellular functions, one or more additional activities of the protein may be
required for it to have full tumor suppression capability (see ref. 1). Thus, the in vivo
selection of mutants in tumors may be different from the mutant selection used in these
studies. Additionally, differences between yeast and human cell DNA repair and
mutagenesis may cause differences in the mutation patterns in the two systems. These
limitations notwithstanding, this assay should prove useful in the study of whether
certain environmental agents, e.g. aflatoxin Bl and benzo(a)pyrene, mutate p53 in humans
as a step in carcinogenesis.
138
p53
binding site
pSS1CAN1a
RS
CEN
Figure 4-1. pSS1CANla p53 mutant selection vector. This plasmid contains the
open reading frame of the CAN1 (arginine permease) gene controlled by a minimal
promoter and p53 binding site (RGC). It also contains the TRP1 gene for selection in
yeast and ARS and CEN sequences for stable low copy maintenance.
139
Figure 4-2. yDM56p plated on selective medium. An identical plate is pictured on a
black and a white background.
140
Table 4-1. Reconstruction experiment
Approx. ratio of
mut. to total cells
1:1000
1:10,000
Observed
mutant fractiona
Red/total
colonies
1
161/175,440
9.2 x 10-4
9.1 x 10-4
2
217/188,850
11.5 x 10-4
9.1 x 10- 4
3
189/189,370
10.0 x 10-4
9.5 x 10-4
(10.2 ± 1.2) x 10-4
(9.2 ± 0.2) x 10-4
1
61/583,100
1.0 x 10-4
1.1 x 10-4
2
64/629,500
1.0 x 10-4
1.1 x 10-4
3
43/631,250
0.7 x 10-4
1.2 x 10- 4
(0.9 + 0.2) x 10-4
(1.1 + 0.1) x 10-4
aNumber of red colonies divided by the total number of colonies.
bCalculated
Expected
mutant fraction b
Trial
as described in Materials and Methods.
141
Table 4-2. Spontaneous and UV-induced mutant fractions in yDM56p
UV treatment
(J/m 2)
Red/total
colonies
Mutant
fraction
No. mutant in
functional assay (%)
No. mutant
in p5 3 a (%)
0
54/3,058,470
1.8 x 10-5
31/36 (86)
17/31 (55)
60
71/1,722,620
4.1 x 10-5
27/38 (71)
16/27 (59)
aNumber of samples in which p53 mutations were detected in exons 5-8 by sequencing.
142
Table 4-3. Sequence alterations in spontaneous and UV-induced mutants
UV dose
(J/m 2 )
0
60
Sequence
contexta
Amino acid
change
No. of
samples
Mutation
12
2
1
1
1
1
1
1
1
1
1
1
1
1
1
1
1
large del.c
large ins.c
18 bp del.
13 bp del.
del. C
C to A
C to A
del. CA
T to C
del. TA
ins. GA
C to A
C to T
C to A
C to A
C to A
C to A
CCCGC
GACGC
TGCTI
CACAGC
AATAC
CATAGT
TG--TG
TACAC
TGCAG
TGCAT
TTCAT
CCCAG
GTCTC
s
a
a
s
a
s
s
a
a
s
a
a
a
152
157
164
167
205
214/15
216
238
242
242
246
279
281
frameshift
val to phe
lys to asn
frameshift
tyr to cys
frameshift
frameshift
cys to phe
cys to tyr
cys to stop
met to ile
gly to trp
asp to tyr
2
1
1
1
1
1
1
1
1
1
1
1
large del.c
large ins.c
C to T
C to T
C to T
C to A
C to T
C to T
GT to AA
T to A
del. T
C to T
del. C
C to T
T to C
C to A
T to C
C to A
T to C
CCCCG
GCCCC
CCCCC
CTCAT
CCCTC
TCCGA
GAGTAT
TATIT
TTTGG
TCCAC
AGCTG
TICCT
CCTGC
TGCAG
CTTCC
GACTC
CTTTG
s
s
s
a
s
s
s
s
s
s
a
s
s
a
a
s
s
152
177
177
180
190
196
204/5
205
206
233
269
241
242
242
258
259
270
pro to ser
pro to ser
pro to leu
glu to stop
pro to leu
arg to stop
tyr to asn(205)
tyr to stop
frameshift
his to tyr
frameshift
ser to phe
cys to arg
cys to phe
glu to gly
asp to glu
phe to ser
1
1
1
1
1
1
Strandb
Codon
Sequence is presented 5' to 3' for the strand where the mutated base is a pyrimidine.
Mutated bases are underlined.
a
b The
sequence context for the mutated base is shown for the (s)ense or (a)ntisense strand.
c Determined by agarose gel electrophoresis.
143
References
1.
2.
3.
4.
5.
6.
7.
8.
9.
10.
11.
12.
13.
Ko, L.J. and Prives, C., p53: puzzle and paradigm. Genes Dev., 1996. 10, 10541072.
El-Deiry, W.S., Tokino, T., Velculescu, V.E., Levy, D.B., Parsons, R., Trent, J.M.,
Lin, D., Mercer, W.E., Kinzler, K.W., and Vogelstein, B., WAF 1, a potential
mediator of p53 tumor suppression. Cell, 1993. 75, 817-825.
Harper, J.W., Adami, G.R., Wei, N., Keyomarsi, K., and Elledge, S.J., The p21
Cdk-interacting protein Cipl is a potent inhibitor of GI cyclin-dependent kinases.
Cell, 1993. 75, 805-816.
Xiong, Y., Hannon, G.J., Zhang, H., Casso, D., Kobayashi, R., and Beach, D., p21
is a universal inhibitor of cyclin kinases. Nature, 1993. 366, 701-704.
Kastan, M.B., Zhan, Q., El-Deiry, W.S., Carrier, F., Jacks, T., Walsh, W.V.,
Plunkett, B.S., Vogelstein, B., and Fornace, A.J., A mammalian cell cycle
checkpoint pathway utilizing p53 and GADD45 is defective in ataxia-telangiectasia.
Cell, 1992. 71, 587-597.
Lu, X. and Lane, D.P., Differential induction of transcriptionally active p53
following UV or ionizing radiation: defects in chromosome instability syndromes?
Cell, 1993. 75, 765-778.
Miyashita, T. and Reed, J.C., Tumor suppressor p53 is a direct transcriptional
activator of the human bax gene. Cell, 1995. 80, 293-299.
Yin, Y., Terauchi, Y., Solomon, G.G., Aizawa, S., Rangarajan, P.N., Yazaki, Y.,
Kadowaki, T., and Barrett, J.C., Involvement of p85 in p53-dependent apoptotic
response to oxidative stress. Nature, 1998. 391, 707-710.
Polyak, K., Xia, Y., Zweier, J.L., Kinzler, K.W., and Vogelstein, B., A model for
p53-induced apoptosis. Nature, 1997. 389, 300-305.
Israeli, D., Tessler, E., Haupt, Y., Elkeles, A., Wilder, S., Amson, R., Telerman, A.,
and Oren, M., A novel p53-inducible gene, PAG608, encodes a nuclear zinc finger
protein whose overexpression promotes apoptosis. EMBO J., 1997. 16(14), 43844392.
Wu, G.S., Burns, T.F., McDonald, E.R., Jiang, W., Meng, R., Krantz, I.D., Kao,
G., Gan, D.D., Zhou, J.Y., Muschel, R., et al., KILLER/DR5 is a DNA damageinducible p53-regulated death receptor gene. Nat. Genet., 1997. 17, 141-143.
Amson, R.B., Nemani, M., Roperch, J.P., Israeli, D., Bougueleret , L., Le Gall, I.,
Medhioub, M., Linares-Cruz, G., Lethrosne, F., Pasturaud, P., et al., Isolation of 10
differentially expressed cDNAs in p53-induced apoptosis: activation of the
vertebrate homologue of the Drosophila seven in absentia gene. Proc. Natl. Acad.
Sci. USA, 1996. 93, 3953-3957.
Nemani, M., Linares-Cruz, G., Bruzzoni-Giovanelli, H., Roperch, J.P., Tuynder,
M., Bougueleret, L., Cherif, D., Medhioub, M., Pasturaud, P., Alvaro, V., et al.,
Activation of the human homolgue of the Drosophila sina gene in apoptosis and
tumor suppression. Proc. Natl. Acad. Sci. USA, 1996. 93, 9039-9042.
144
14.
15.
16.
17.
18.
19.
20.
21.
22.
23.
24.
25.
26.
Greenblatt, M.S., Bennett, W.P., Hollstein, M., and Harris, C.C., Mutations in the
p53 tumor suppressor gene: clues to cancer etiology and molecular pathogenesis.
Cancer Res., 1994. 54, 4855-4878.
Semenza, J.C. and Weasel, L.H., Molecular epidemiology in environmental health:
the potential of tumor suppressor gene p53 as a biomarker. Environ. Health
Perspect., 1997. 105(suppl. 1), 155-163.
Moshinsky, D.J. and Wogan, G.N., UV-induced mutagenesis of human p53 in a
vector replicated in Saccharomyces cerevisiae. Proc. Natl. Acad. Sci. USA, 1997. 94,
2266-2271.
Inga, A., lannone, R., Monti, P., Molina, F., Bolognesi, M., Abbondandolo, A.,
Iggo, R., and Fronza, G., Determining mutational fingerprints at the human p53
locus with a yeast functional assay: a new tool for molecular epidemiology.
Oncogene, 1997. 14, 1307-1313.
Murata, J.I., Tada, M., Iggo, R.D., Sawamura, Y., Shinohe, Y., and Abe, H., Nitric
oxide as a carcinogen: analysis by yeast functional assay of inactivating p53
mutations induced by nitric oxide. Mutat. Res., 1997. 379, 211-218.
Flaman, J.M., Frebourg, T., Moreau, V., Charbonnier, F., Martin, C., Chappuis, P.,
Sappino, A.P., Limacher, J.M., Bron, L., Benhattar, J., et al., A simple p53
functional assay for screening cell lines, blood, and tumors. Proc.Natl.Acad. Sci.
USA, 1995. 92, 3963-3967.
Broach, J.R., Strathern, J.N., and Hicks, J.B., Transformation in yeast:
development of a hybrid cloning vector and isolation of the CAN 1 gene. Gene,
1979. 8, 121-133.
Ishioka, C., Frebourg, T., Yan, Y.X., Vidal, M., Friend, S.H., Schmidt, S., and Iggo,
R., Screening patients for heterozygous p53 mutations using a functional assay in
yeast. Nat. Genet., 1993. 5, 124-129.
Hermann, H., Hacker, U., Bandlow, W., and Magdolen, V., pYLZ vectors:
Saccharomyces cerevisiae/Escherichia coli shuttle plasmids to analyze yeast
promoters. Gene, 1992. 119, 137-141.
Ausubel, F.M., Brent, R., Kingston, R.E., Moore, D.D., Seidman, J.G., Smith, J.A.,
and Struhl, K., eds. CurrentProtocols in MolecularBiology. Vol. 2. 1995, John
Wiley & Sons, Inc.: New York.
Nigro, J.M., Sikorski, R., Reed, S.I., and Vogelstein, B., Human p53 and CDC2Hs
genes combine to inhibit the proliferation of Saccharomyces cerevisiae. Mol. Cell.
Biol., 1992. 12(3), 1357-1365.
Sage, E., Distribution and repair of photolesions in DNA: genetic consequences and
the role of sequence context Photochem. Photobiol., 1993. 57(1), 163-174.
Ivanov, E.L., Kovaltzova, S.V., Kassinova, G.V., Gracheva, L.M., Korolev, V.G.,
and Zakharov, I.A., The rad2 mutation affects the molecular nature of UV and
acridine-mustard-induced mutations in the ADE2 gene of Saccharomyces cerevisiae.
Mutat. Res., 1986. 160, 207-214.
145
27.
28.
29.
30.
31.
32.
Kunz, B.A., Pierce, M.K., Mis, J.R.A., and Giroux, C.N., DNA sequence analysis
of the mutational specificity of u.v. light in the sup4-o gene of yeast. Mutagen.,
1987. 2(6), 445-453.
Lee, G.S.F., Savage, E.A., Ritzel, R.G., and vonBorstel, R.C., The base-alteration
spectrum of spontaneous and ultraviolet radiation-induced forward mutations in the
URA3 locus of Saccharomyces cerevisiae. Mol. Gen. Genet., 1988. 214, 396-404.
Armstrong, J.D. and Kunz, B.A., Photoreactivation implicates cyclobutane dimers
as the major promutagenic UVB lesion in yeast. Mutat. Res., 1992. 268, 83-94.
Kern, S.E., Kinzler, K.W., Bruskin, A., Jarosz, D., Friedman, P., Prives, C., and
Vogelstein, B., Identification of p53 as a sequence-specific DNA-binding protein
Science, 1991. 252, 1708-1711.
Park, D.J., Chumakov, A.M., Miller, C.W., Pham, E.Y., and Koeffler, H.P., p53
transactivation through various p53-responsive elements. Mol. Carcinogen., 1996.
16, 101-108.
Friedlander, P., Haupt, Y., Prives, C., and Oren, M., A mutant that discriminates
between p53-responsive genes cannot induce apoptosis. Mol. Cell. Biol., 1996.
16(9), 4961-4971.
146
5. Screening for CDK2 Inhibitors
for Potential Use
as Chemotherapeutic Agents
This work was performed at an internship at SUGEN, Inc., Redwood City, CA
under the advisement of Dr. Harald App
147
Introduction
Mammalian cell cycle progression is regulated by the activity of several cyclin
dependent protein kinases (CDKs; reviewed in refs. 1, 2). The induction of these kinases
is controlled by association with regulatory cyclin subunits and phosphorylation by
CDK-activating kinase (CAK). Inhibition of CDK activity in the cell occurs by
phosphorylation of a specific conserved site or by binding to inhibitor proteins (CKIs;
reviewed in ref. 3). Structural studies of catalytically inactive CDK2 monomer (4, 5),
partially active CDK2 in complex with cyclin A (6) and fully activated CDK2 / cyclin A
phosphorylated by CAK (7) have been instrumental in detailing the mechanism of CDK2
activation. Cyclin binding to the inactive monomer was shown to open and realign
residues in the catalytic cleft of the kinase, and phosphorylation by CAK results in
changes in the putative substrate binding site of the kinase and stabilizes the CDK / cyclin
association (8). Furthermore, the crystal structure of phosphorylated CDK2 / cyclin A
bound to the CKI p2 7 Kipl (9) has revealed how this cellular protein acts to inhibit the
activity of the complex, namely by changing the shape of and inserting into the catalytic
site, mimicking ATP (8).
CDK2, in association with cyclin E, is essential for the GI/S transition of the cell
cycle (10, 11). In association with cyclin A, this CDK is responsible for progression
through S phase (12), acting at a stage after initiation of DNA replication but prior to
elongation (13). The CDK / cyclin complexes are thought to induce these effects by
phosphorylating transcription regulators and/or proteins involved in DNA replication
including p107, E2F, and replication protein A (2).
148
The fact that CDKs are required for cell cycle progression makes them an
attractive target for the development of small molecule inhibitors to treat proliferative
disorders such as cancer. A new class of protein tyrosine kinase (PTK) inhibitors based
on an oxindole core molecule has recently been described (14) and can potentially be used
against CDKs. A study on fibroblast growth factor receptor (FGFR) inhibition identified
two oxindole based compounds - one that is specific to this PTK (SU5402) and one that
is not (SU4984). Figure 5-1 shows the structures of these molecules. X-ray
crystallographic analysis of the kinase domain of the receptor in complex with the
inhibitors showed that the oxindole core of both compounds binds to the kinase at the site
normally occupied by the ATP adenine and suggested that the specificity of inhibition
was modulated by the chemical substituents attached to the oxindole. SU4984 interacted
mainly with residues that are highly conserved in the PTK family, whereas the
carboxyethyl group of SU5402, the more specific inhibitor, formed a hydrogen bond with
a residue that is variable among PTKs (14). Since the ATP binding cleft is somewhat
conserved among protein kinases (4, 15, 16) and can be inhibited by several classes of
molecules with different chemical structures, this suggests that specific oxindole based
inhibitors of other kinases, including CDK2, may be designed (14). To address this, a
screening effort was performed to identify oxindole based molecules that inhibit the
catalytic activity of CDK2 / cyclin A.
149
Materials And Methods
Enzyme, Inhibitors, and Reagents. CDK2 in complex with cyclin A was provided by
N. Gray (17) in 10mM HEPES, pH 7.2, 25mM NaC1, 0.5mM DTT, 10% glycerol. The
oxindole based kinase inhibitor library was constructed by Arqule (Medford, MA).
Inhibitors were typically dissolved as 25mM stock solutions in dimethyl sulfoxide
(DMSO). Histone H1 was obtained from Boehringer Mannheim.
In Vitro CDK2 / Cyclin A Inhibition Assay. CDK2 / cyclin A activity was assayed by
measuring the incorporation of 33 p onto histone H1 substrate. Inhibitors were diluted in
15% DMSO and dispensed into wells of 96-well plates. CDK2 / cyclin A was added and
reactions were allowed to proceed in 25mM Tris, pH 7.2, 10mM MgC12, 0.5mM DTT,
with 10M ATP, 20gg BSA, 5 g histone H1, and 0.15tCi y- 33P ATP in a total volume
of 60gl for 60 minutes. The final concentration of DMSO in the reaction mixture was
5%. 10% TCA was added to a final concentration of =4% to stop the reactions, and an
aliquot of each was spotted onto filter mats. Mats were washed with 1% phosphoric
acid, then dried. Radioactivity was quantitated using a beta plate reader. Initial screens
were carried out at an inhibitor concentration of 10tm, and ICs 0s were measured for all
compounds that resulted in 275% inhibition at this concentration. ICs 0s were determined
by graphical analysis.
150
Results and Discussion
To identify inhibitors of CDK2, a library of =5000 synthetic compounds, each
containing an oxindole core with different chemical substituents, was screened for CDK2 /
cyclin A inhibition using an in vitro kinase assay. Several specific and nonspecific
inhibitors were identified, some of which exhibited ICs5 s in the nanomolar range. The
structures of these molecules and their IC50 data cannot be shown here for proprietary
information reasons. The fact that specific inhibitors of CDK2 could be found in this
library confirms the idea that different protein kinases can be inhibited by oxindoles and
that the substituents on this core molecule govern which kinase is susceptible to
inhibition (14).
Several other classes of CDK inhibitors have been found (reviewed in ref. 18), at
least 3 of which - butyrolactone, flavopyridol, olomoucine and analogs - exhibit
specificity towards these kinases. An additional olomoucine analog, CVT-313, has
recently been discovered and shown to specifically inhibit CDK2 in vitro and inhibit
human cell growth in culture with an IC50 of 1.25 to 20gM (17). The structures of these
compounds are shown in Figure 5-2. Many studies have demonstrated that these
compounds are also active in inhibiting the proliferation of mammalian cells in various cell
systems (see ref. 18), and flavopyridol is currently in clinical trials as a treatment for
breast cancer. The inhibitors identified here using the in vitro assay exhibited ICs 0s
comparable to those of the previously identified compounds and will also be tested in a
151
human cell system to determine whether they inhibit cell proliferation and are thus
potential anticancer drug candidates.
The crystal structures of CDK2 / cyclin A in complex with various specific and
non-specific inhibitors have recently been determined (19-22) in an attempt to reach an
understanding of how these compounds inhibit the kinase. In collaboration with Dr. S.H.
Kim at the University of California, Berkeley, the structures of the inhibitors identified
here bound to CDK2 / cyclin A are being determined. This should add to the structural
information on this kinase and act as a guide for the development of more potent and
specific inhibitors for potential therapeutic use.
152
SU5402
SU4984
HO,
N
N,
/
-H
/
H
H
3-[4-(1 -formylpiperazin-4-yl)benzylidenyl]-2-indolinone
3-[(3-(2-carboxyethyl)-4-methylpyrrol2-yl)methylene]-2-indolinone
Figure 5-1. FGFR inhibitors.
153
COOCH3
HO,
-CH 3
OH
HO
OH
0
Butyrolactone I
R = Cl
R=H
Flavopiridol (L868275)
L868276
NH
HN
MeO
N
N
N
HN
R1
N
CH 20H
N
HO
R2
R1 =H, R2=H
R1 = C2 Hs , R2 = CH 3
NOH
OH
Olomoucine
Roscovitine
Figure 5-2. CDK2 inhibitors.
154
CVT-313
N
-N-
References
1.
2.
3.
4.
5.
6.
7.
8.
9.
10.
11.
12.
13.
14.
15.
16.
Pines, J., Cyclin from sea urchins to HeLas: making the human cell cycle. Biochem.
Soc. Trans., 1996. 24, 15-33.
Nigg, E.A., Cyclin-dependent protein kinases: key regulators of the eukaryotic cell
cycle. BioEssays, 1995. 17(6), 471-480.
Morgan, D.O., Principles of CDK regulation. Nature, 1995. 374, 131-134.
De Bondt, H.L., Rosenblatt, J., Jancarik, J., Jones, H.D., Morgan, D.O., and Kim,
S.H., Crystal structure of cyclin-dependent kinase 2. Nature, 1993. 363, 595-602.
Schulze-Gahmen, U., DeBondt, H.L., and Kim, S.H., High-resolution crystal
structures of human cyclin-dependent kinase 2 with and without ATP: bound
waters and natural ligand as guides for inhibitor design. J. Med. Chem., 1996. 39,
4540-4546.
Jeffrey, P.D., Russo, A.A., Polyak, K., Gibbs, E., Hurwitz, J., Massague, J., and
Pavletich, N.P., Mechanism of CDK activation revealed by the structure of a
cyclinA-CDK2 complex. Nature, 1995. 376, 313-320.
Russo, A.A., Jeffrey, P.D., and Pavletich, N.P., Structural basis of cyclindependent kinase activation by phosphorylation. Nat. Struct. Biol., 1996. 3(8), 696700.
Russo, A.A., Purification and reconstitution of cyclin-dependent kinase 2 in four
states of activity. Methods Enzymol., 1997. 283, 3-12.
Russo, A.A., Jeffrey, P.D., Patten, A.K., Massague, J., and Pavletich, N.P., Crystal
structure of the p2 7 Ki p l cyclin-dependent-kinsae inhibitor bound to the cyclinACDK2 complex. Nature, 1996. 382, 325-331.
Koff, A., Ohtsuki, M., Polyak, K., Roberts, J.M., and Massague, J., Negative
regulation of GI in mammalian cells: inhibition of cyclin E-dependent kinase by
TGF-beta. Science, 1993. 260, 536-539.
Ohtsubo, M., Theodoras, A.M., Schumacher, J., Roberts, J.M., and Pagano, M.,
Human cyclin E, a nuclear protein essential for the G1-to-S phase transition. Mol.
Cell. Biol., 1995. 15(5), 2612-2624.
Pagano, M., Pepperkok, R., Verde, F., Ansorge, W., and Draetta, G., Cyclin A is
required at two points in the human cell cycle. EMBO J., 1992. 11(3), 961-971.
Fotedar, A., Cannella, D., Fitzgerald, P., Rousselle, T., Gupta, S., Doree, M., and
Fotedar, R., Role for cyclin A-dependent kinase in DNA replication in human S
phase cell extracts. J Biol. Chem., 1996. 271(49), 31627-31637.
Mohammadi, M., McMahon, G., Sun, L., Tang, C., Hirth, P., Yeh, B.K., Hubbard,
S.R., and Schlessinger, J., Structures of the tyrosine kinase domain of fibroblast
growth factor receptor in complex with inhibitors. Science, 1997. 276, 955-960.
Mohammadi, M., Schlessinger, J., and Hubbard, S.R., Structure of the FGF
receptor tyrosine kinase domain reveals a novel autoinhibitory mechanism. Cell,
1996. 86(4), 577-587.
Taylor, S.S. and Radzio-Andzelm, E., Three protein kinase structures define a
common motif. Structure, 1994. 2(5), 345-355.
155
17.
18.
19.
20.
21.
22.
Brooks, E.E., Gray, N.S., Joly, A., Kerwar, S.S., Lum, R., Mackman, R.L.,
Norman, T.C., Rosete, J., Rowe, M., Schow, S.R., et al., CVT-313, a specific and
potent inhibitor of CDK2 that prevents neointimal proliferation. J. Biol. Chem.,
1997. 272(46), 29207-29211.
Meijer, L. and Kim, S.H., Chemical inhibitors of cyclin-dependent kinases. Methods
Enzymol., 1997. 283, 113-128.
Schulze-Gahmen, U., Brandsen, J., Jones, H.D., Morgan, D.O., Meijer, L., Vesely,
J., and Kim, S.H., Multiple modes of ligand recognition: crystal structures of
cyclin-dependent protein kinase 2 in complex with ATP and two inhibitors,
olomoucine and isopentenyladenine. Proteins, 1995. 22, 378-391.
de Azevedo, W.F., Mueller-Dieckmann, H.J., Schulze-Gahmen, U., Worland, P.J.,
Sausville, E., and Kim, S.H., Structural basis for specificity and potency of a
flavonoid inhibitor of human CDK2, a cell cycle kinase. Proc.Natl. Acad. Sci. USA,
1996. 93, 2735-2740.
de Azevedo, W.F., LeClerc, S., Meijer, L., Havlicek, L., Strnad, M., and Kim, S.H.,
Inhibition of cyclin-dependent kinases by purine analogues: crystal structure of
human CDK2 complexed with roscovitine. Eur. J. Biochem., 1997. 243, 518-526.
Lawrie, A.M., Noble, M.E.M., Tunnah, P., Brown, N.R., Johnson, L.N., and
Endicott, J.A., Protein kinase inhibition by staurosporine revealed in details of the
molecular interaction with CDK2. Nat. Struct. Biol., 1997. 4(9), 796-801.
156
6. Conclusions and Suggestions
for Future Research
157
This thesis has described the characterization and use of a yeast model system for
the generation and selection of mutations in humanp53 cDNA following in vitro mutagen
modification. The system was shown to accurately measure mutant fractions and was
used to produce a UV-induced mutation spectrum of the gene. Comparisons were then
made between the obtained spectrum and that ofp53 in human UV-exposed skin in an
attempt to validate the use of this model as a representation of what occurs in human
cells. The spectra exhibited some similarities, although examination of the hotspot sites
revealed differences between the two systems. A larger scale mutant analysis was then
begun to more clearly define the hotspots in the mutants generated in yeast, since the
sample size was limited in the initial UV study. Results from this should provide clearer
insight into how many hotspots in the model system are actually the same in human UVexposed skin. Finally, the selection method in the yeast strain used in these studies was
modified to facilitate more efficient screening for mutants and cellular mutagen
modification. UV was used as a mutagen to establish that the improved selection system
is indeed effective in detecting cells with mutant p53.
The utility of the described system and techniques reach beyond the scope of this
thesis. One potential application of the yeast selection system would be to perform site
specific mutagenesis studies on p53. Using this technique, a particular DNA adduct can
be constructed and incorporated into a certain site of the gene, and mutations resulting
from the replication of the sequence in yeast can be analyzed. This attempts to answer
important questions about whether the DNA lesions formed by certain mutagens result in
mutations similar to those seen in human cancers. For example, AFB1 adducts can
158
theoretically be placed at the third base of codon 249 (the site of the G to T hotspot
mutation in liver tumors from areas of high exposure to this agent) to see whether G to T
mutations are induced at high frequency at that site. The same can be done with adducts
formed by other agents to answer similar questions such as the plausibility that BaP
adducts cause the mutations in lung tumors from smokers or that oxidative DNA damage
induces mutations at hotspot sites of p53 in internal tumors. The global DNA
modification technique used in the present studies can also be extended to the study of
these other mutagens to answer the same questions. The analysis of hotspot sites by
CDCE should facilitate the comparison of the obtained spectra with those in human
tumors to determine whether they are similar overall.
CDCE is a separation technique that can also be used for basic research of the
cellular effects ofp53 mutants. One specific application would be to determine whether
certain p53 mutants confer a selective growth advantage to cells (mammalian or yeast)
over cells with wild type or other classes of mutant p53 through a 'gain of function' as
opposed to a simple loss of function mechanism. This could be easily addressed by
mixing cells containing different mutations inp 5 3 , growing them for a number of
generations, and monitoring the proportions of the mutants in the cell mixture by CDCE.
If a particular mutant confers a growth advantage to the cell, the corresponding peak in
the CDCE profile should increase with respect to the other peaks over time. Identifying
mutants that cause cells to proliferate at an increased rate would be an initial step in
determining the mechanism through which p53 gain of function mutants act.
159
The improved mutant selection system introduced in this thesis for more efficient
mutant screening and cellular mutagen modification has another important advantage that
spontaneous mutations in p53 originating from replication in yeast can be studied. This
was not possible with the in vitro system because spontaneous mutants there could
originate from replication in bacterial cells (where the plasmid was amplified), the
transformation process, or in the yeast. With the plasmid already present in the cells,
these first two uncertainties are eliminated. Also, cellular mutagen modification can prove
to be useful for treatment with agents that require metabolic activation to cause DNA
adduction (e.g. AFB1 and BaP). Vectors that express cytochrome P450s can be
introduced into the cells so that they can be directly treated with the agent in question,
thus avoiding the difficulties associated with traditional microsomal or chemical
activation.
In short, this thesis describes the use of a yeast system to study UV-induced
mutations in p53. Future studies stemming from this work have the potential to answer
other questions relating to chemical-induced carcinogenesis along with the basic cellular
functions of the p53 protein.
160