Modeling Hematologic Malignancies and Their Treatment in Humanized Mice
by
MASSACHUSETTS INSTITUTE
OF TECHNCOLOY
Ilya Leskov
SEP 1 23O0
B.A. Biology, with High Honors
Swarthmore College, 2001
LIBPARI ES
Submitted to the Department of Biology in
Partial Fulfillment of the Requirements for the Degree of
ARCHIVES
Doctor of Philosophy
at the
Massachusetts Institute of Technology
July 2010
© Massachusetts Institute of Technology
All rights reserved
Signature of Author:
//
lj:::
~
Ilya Leskov
Department of Biology
July 23, 2010
Certified by:
Jianzhu Chen
Cottrell Professor of Immunology
July 23, 2010
/
Accepted by:_
_
_
_
_
Tania A. Baker
Co-Chair of the Graduate Program in Biology
E. C. Whitehead Professor of Biology
July 23, 2010
Modeling Hematologic Malignancies and Their Treatment in Humanized Mice
by
Ilya Leskov
Submitted to the Department of Biology on July 23, 2010
in Partial Fulfillment of the Requirements for the Degree of Doctor of Philosophy
ABSTRACT
Approximately 10% of all cancer deaths in the United States are due to neoplasms of the
hematopoietic system, such as leukemias and lymphomas. Genetically engineered mouse
models of these diseases have yielded invaluable insights into the ways normal processes
become corrupted, leading to cancer development, progression, and spreading. Yet, as our
understanding of cancer in mice grows more sophisticated, it is important to be aware of vital
differences between murine models and human patients, differences in basic physiology,
immunology, and in susceptibility to cancer itself. Furthermore, as anti-neoplastic therapy
becomes increasingly focused on human-specific therapies, mouse models become less useful in
screening and evaluating potential new therapies.
Humanized mice - immunodeficient animals engrafted with human hematopoietic stem
cells (HSCs) that subsequently give rise to various mature blood lineage cells - are an elegant
solution to these problems, as they offer an ethical and practical way to study human cell biology
in vivo. Recent advances in human HSC culture and expansion make it possible not only to
generate large cohorts of humanized mice, but also to modify HSCs genetically prior to their
engraftment. Such transgenesis of adult human stem cells permits modeling of hematologic
malignancies in human cells. To that end, a lentiviral vector capable of stoichiometric
expression of up to three transgenes in a B cell-specific manner was constructed; in this case,
these transgenes included the GFP reporter and the clinically-important oncogenes Bcl-2 and
Myc. Enforced overexpression of Bcl-2 resulted in a benign B cell hyperplasia, but
overexpression of Bcl-2 in combination with Myc led to a rapid development of an aggressive
disease that recapitulated the histopathological and clinical aspects of human progenitor B cell
acute lymphoblastic leukemia (pro-B ALL). Leukemic cells that arise in these mice expressed
CD52 and were transplantable into secondary recipients; these were subsequently used to test the
efficacy of a human specific monoclonal antibody to CD52, alemtuzumab, which is currently
approved for treatment of chronic lymphocytic leukemia, but not ALL. Alemtuzumab treatment
of secondary mice resulted in an almost complete clearance of leukemic blasts from the
periphery and a significant improvement in life expectancy, and antibody-dependent tumor cell
killing was shown to be mediated by macrophages. The lack of alemtuzumab activity in the
brain and bone marrow of the mice was investigated, and overcome by combining alemtuzumab
with the commonly used chemotherapeutic agent cyclophosphamide. Great synergy between
alemtuzumab and cyclophosphamide seen in this model suggests that a further investigation into
this clinically relevant drug combination is well warranted.
Thesis Supervisor: Jianzhu Chen
Title: Cottrell Professor of Immunology, Professor of Biology
Acknowledgements
Completion of this work would not have been possible without significant input and
contributions from numerous mentors, colleagues, friends, and members of my family.
First and formost, my thanks go out to Dr. Jianzhu Chen, my lab mentor and PI, who was
kind enough to take me into his laboratory and allow me significant intellectual freedom to
develop as a scientist. I addition, I'd like to thank members of my thesis committee, including
Drs. Michael Hemann, Jacqueline Lees, and Harvey Lodish, as well as Benjamin Ebert of
Harvard Medical School, for providing much-needed guidance throughout this process. Special
thanks go out to Hidde Ploegh, one of the best lecturers I have ever had the pleasure of hearing,
who has taught me so much about immunology. Dr. Herman Eisen has been a source of great
knowledge and inspiration from the start of my graduate career. And of course, I am greatly
indebted to my very first PI and mentor, Vadim Arshavsky, for preparing me so well for this line
of work.
My fellow lab mates have been vital to my education. Thank you Adam Drake, Bettina
Iliopoulou, Vinay Mahajan, Christian Pallasch, Ching-Hung Shen, and Patrick Stem, for serving
as my role models in so many respects. And of course, thank you Lily Trajman for bearing the
tough burden of being my baymate for many years with such grace and good humor.
This project required a great deal of technical support. For that reason, I'd like to express
my gratitude to the wonderful technical staff at the Chen laboratory, especially the two people
most closely involved with the humanized mouse project, Mimi Fragoso and Amanda Souza.
Equally instrumental were members of the several Koch Institute core facilities, including flow
cytometry and cell sorting, histology and pathology, bioinformatics, imaging, and sequencing.
In not synthesizing any peptides I suppose I missed out on "collecting them all"; so be it.
When I started at MIT, I also moved into an undergraduate dormitory of Harvard College
named Lowell House; living there over these past five years has provided me with significant
emotional and intellectual stability. For that, I want to thank all members of the Lowell House
community, including the dear House Masters, Drs. Diana Eck and Dorothy Austin, who made it
a warm home-away-from-home; my fellow tutors, who as graduate students understood what I
have been going through and could commiserate with me; and the large number of
undergraduates whom I befriended over the years and who inspired me with the sheer variety of
their academic and non-academic interests and their unyielding enthusiasm for, well, everything.
Of course, I want to thank all my friends, who have lent me a sympathetic ear and life
advice throughout this arduous process. You know who you are.
And my parents... what can I say, really? Thank you, mom and Steve, for everything;
this dissertation is for you, as I could never have done any of it without your endless love,
patience, and support...
Table of Contents
A bstract...........................................................................................................................................2
A cknow ledgem ents ........................................................................................................................
3
Tab le of Contents ...........................................................................................................................
4
7
Chapter 1: Introduction ........................................................................................................
1.1 Normal hematopoiesis and cellular origins of B cell malignancies............................11
1.1.1 Hematopoietic stem and progenitor cells and the origins of precursor
B cell acute lymphoblastic leukemia/lymphoma (B-ALL)....................
11
1.1.2 Mature B lymphocytes and the origins of mature B cell neoplasms .....
15
1.2 Differences between murine and human immune systems.....................................
18
1.3 Humanized mouse models.......................................................................................22
1.4 Expansion of human hematopoietic stem cells in vitro ....................
25
1.5 Further characterization of in vitro-expanded HSCs using the novel
NOD/scid, ycnun immunodeficient mouse model..............................................
28
1.6 Overall project objectives .......................................................................................
34
1.7 References...................................................................................................................35
Chapter 2: Modeling Hematologic Malignancies in Humanized Mice ...............................
2 .1 S umm ary .....................................................................................................................
2.2 Introduction .................................................................................................................
2.2.1 Lentivirus as a transgene delivery system ...............................................
41
42
43
45
2.2.2 B cells-specific promoters.......................................................................
46
2.2.3 Choice of oncogenes ................................................................................
48
2 .3 Resu lts.........................................................................................................................52
2.3.1 Lentiviral vector design ...........................................................................
52
2.3.2 Lentivirus production and titration .........................................................
53
2.3.3 Lentiviral spin-infection lowers the engraftment efficiency of human
CD 133* cells .........................................................................................
55
2.3.4 Transgene expression from the CD19 promoter is highly
restricted to B cells................................................................................
2.3.5 Bcl-2 overexpression by CD19+ cells leads to non-malignant
B cell accumulation................................................................................60
2.3.6 The effect of GFP and Bcl-2 overexpresion on B cell development .....
57
62
2.3.7 Adoptively transferred GB cells are short lived in secondary hosts..... 66
2.3.8 In vivo stimulation of B cells in GB mice does not lead to increased
68
cell proliferation or antibody production..............................................
70
2.3.9 Myc overexpression leads to a lack of GFP* cells in the periphery .....
2.3.10 Overexpression of both Myc and Bcl-2 by CD19+ cells leads to
rapidly-progressing pro-B cell lymphocytosis.......................................72
2.3.11 GMB cells are monoclonal or oligoclonal.............................................75
2.3.12 GMB mice are short lived.....................................................................
77
2.3.13 Rapidly-expanding GFP* cells can be transplanted into
secondary NSG mice..............................................................................80
2 .4 D iscussion ...................................................................................................................
81
2.5 Materials and Methods............................................................................................90
2.5.1 Lentiviral design and preparation ...........................................................
90
2.5.2 C ell lines ..................................................................................................
93
2.5.3 Lentivirus production and titration .........................................................
2.5.4 Isolation and expansion of human CD133* cells....................................
94
95
2.5.5 Lentiviral infection of human CD133+cells.............................................96
2.5.6 M ice ........................................................................................................
. 97
2.5.7 Engraftment of mice with human CD133* cells......................................97
2.5.8 Human cell chimerism in mice engrafted with human CD133+ cells..........98
2.5.9 Tissue preparation, antibodies, and flow cytometry ................................
98
2.5.10 H istology ................................................................................................
99
2.5.11 Protein expression analysis....................................................................99
2.5.12 In vivo stimulation of B cells ................................................................
99
2.5.13 C lonal analysis.........................................................................................101
2 .6 References.................................................................................................................102
Chapter 3: Modeling Immune Therapy of proB-ALL in a Humanized Mouse Model.......108
109
3.1 Sum mary ...................................................................................................................
3.2 Introduction ...............................................................................................................
110
3.3 Resu lts.......................................................................................................................115
5
3.3.1 Treatment of secondary GMB mice with alemtuzumab results in
partial tumor clearance.............................................................................115
3.3.2 The Fc region of alemtuzumab is essential to its anti-tumor function.......119
3.3.3 Complement does not mediate alemtuzumab's anti-tumor activity
in G MB mice............................................................................................119
3.3.4 Alemtuzumab's anti-tumor activity in GMB mice is mediated by
macrophages ............................................................................................
12 1
3.3.5 Alemtuzumab is able to penetrate the bone marrow, but not the brain ..... 126
3.3.6 Bone marrow is not an immune-privileged site for GMB cells.................126
3.3.7 Combining alemtuzumab with cyclophosphamide leads to a
synergistic anti-neoplastic effect in the bone marrow ............................. 130
136
3.4 D iscussion .................................................................................................................
3.5 Materials and Methods..............................................................................................142
3.5.1 Generation of the pro-B ALL model .........................................................
142
3.5.2 Alemtuzumab and its variants....................................................................143
3.5.3 Chemotherapeutics.....................................................................................144
3.5.4 Tissue preparation, antibodies and flow cytometry ..................................
144
3.5.5 Complement-dependent cytotoxicity (CDC) assay ...................................
145
3.5.6 In vitro tumor cell killing assay .................................................................
146
3.5.7 In vivo macrophage depletion ....................................................................
146
3.5.8 H istology ....................................................................................................
147
3.6 References.................................................................................................................149
Chapter 4: Summary and Future Directions ..........................................................................
153
4 .1 Summ ary ...................................................................................................................
154
4.2 Future directions .......................................................................................................
157
4.3 References.................................................................................................................163
A pp en d ices..................................................................................................................................164
A.1 Optimization of lentivirus production......................................................................165
A.2 Annotated sequence of the modified pEGFP-2A shuttle vector ..............................
168
A.3 Annotated sequence of the pLB2-Ep./CD19-GFP lentiviral vector ......................... 170
A.4 Annotated sequence of the pLB2-Ep/CD19-GFP/Myc/Bcl-2 lentiviral vector.......175
Chapter 1
Introduction
Cancer is the second-leading cause of death in the United States, after heart
disease; in 2004, for example, over 20% of all deaths in America were due to cancer,
with over half a million Americans succumbing to the disease (Heron 2007). Of all
cancer deaths, approximately 10% were due to neoplasms of the hematopoietic system,
including leukemias and lymphomas (U.S. Cancer Statistics Working Group 2007). The
terms "leukemia" and "lymphoma" are. descriptions of the usual tissue distribution of the
neoplasm at the time of clinical presentation: leukemias involve the bone marrow and
peripheral blood, while lymphomas arise as discrete tissue masses. In practice, however,
the distinction between the two types of diseases can blur, with leukemias sometimes
arising without bone marrow involvement, and lymphoma cells spreading to the
bloodstream during the course of the disease (Aster 2005).
The World Health Organization (WHO) has therefore chosen to classify
hematologic malignancies based not on the morphology of the disease, but rather on the
lineage of cancerous cells. The three general types of leukocyte tumors are therefore
myeloid neoplasms, derived from bone marrow progenitors of the various myeloid cells;
lymphoid neoplasms, derived from B or T cell progenitors or from mature B or T cells;
and the relatively rare histiocytic/dendritic neoplasms, derived from cells that would
otherwise
develop
into
tissue
macrophages
(histiocytes)
or
dendritic
cells
(Swerdlow et al. 2008).
Myeloid neoplasms include myelodysplastic syndromes (MDS) that exhibit
dysplastic and ineffective blood cell production; acute myeloid leukemias (AML), where
proliferating myeloid blast cells dominate the bone marrow, but do not differentiate,
resulting in severely decreased levels of red blood cells, platelets, and neutrophils; and
myeloproliferative neoplasms (MPN), characterized by hyperproliferation of more
mature cells from one or more myeloid lineages.
MPNs tend to be more chronic
diseases: an example is chronic myeloid leukemia (CML), where the differentiation of
neoplastic cells is relatively unaffected, and which causes elevated blood cell counts;
eventually, however, these chronic disorders can progress to the acute form described
above (Aster 2005).
Lymphoid neoplasms, on the other hand, originate from lymphoid cells in various
stages of differentiation. These tumors are further sub-classified by the WHO based on
the particular cell type from which they arise and which they subsequently resemble:
precursor or immature B cells and T cells, as well as mature (or peripheral) B cells, T
cells, and natural killer (NK) cells (Swerdlow et al. 2008).
An additional category
comprises Hodgkin lymphoma, which has a different clinical progression, a distinctive
neoplastic cell phenotype, and a likely infectious etiology; it will not be discussed here
further. Transformed B and T cells often behave similarly to their healthy counterparts,
homing to the appropriate sites in the lymph nodes and spleen; as their numbers rise,
however, normal lymph node and spleen architecture is disrupted, leading to decreased
immune vigilance and increased likelihood of autoimmunity (Aster 2005).
The majority (80-85%) of human lymphocyte malignancies is of B cell origin
(Aster 2005); the focus of this work was therefore the study and modeling of B-cell
leukemia and lymphoma. Thus, in order to gain a better understanding of the origins of
these malignancies, it is important to become familiar with normal hematopoiesis and
lymphocyte development, and how these processes can become corrupted and lead to the
development of cancer.
Our understanding of normal hematopoiesis, as well as of the diseases that arise
when it becomes disrupted or dysregulated, has been greatly helped by mouse models.
As our understanding of these models becomes ever more sophisticated, however, it
becomes increasingly important to appreciate the differences between mice and human
patients. These differences become particularly pertinent when modeling the effects of
cancer therapy, especially as anti-neoplastic regimens move away from general
antimetabolites and genotoxic drugs and towards more target-specific treatments.
Humanized mice, immunodeficient animals engrafted with human cells or tissues,
offer an elegant way to address these differences. When human hematopoietic stem cells
(HSCs) are used to reconstitute sublethally irradiated immunodeficient mice, mature
human B, T, and myeloid cells arise in the resulting chimeras within weeks.
Until
recently, availability the number of humanized mice that one could generate using cells
from an individual donor was strictly limited by the availability of human HSCs. The last
several years, however, saw important advances in ex vivo culture of these cells, and a
recent report from our laboratory showed that a culture protocol developed by Lodish and
colleagues results in an expansion of long-term HSCs (Drake et al., submitted).
These advances make it possible to generate large cohorts of humanized mice, all
bearing human leukocytes derived from a single cord blood sample. Furthermore, in
vitro expansion of human HSCs makes it possible to introduce specific genetic alterations
in these cells by lentiviral transduction. Using vectors bearing oncogenes or inhibitors of
tumor suppressors, it becomes possible to model human leukocyte malignancies with
human cells, as well as their treatment using human-specific, targeted immunotherapy.
Such modeling, of both human disease and its treatment, was the goal of this project.
1.1
Normal hematopoiesis and cellular origins of B cell malignancies
1.1.1
Hematopoietic stem and progenitor cells and the origins of precursor B cell
acute lymphoblastic leukemia/lymphoma (B-ALL)
Pluripotent hematopoietic stem cells are defined as cells that can divide
asymmetrically, in order to self-renew as well as to give rise to all other lymphoid,
myeloid, megakaryocyte and erythroid progenitors (Orkin and Zon 2008). There are no
surface markers that are uniquely expressed by HSCs (Kirouac and Zandstra 2006), but it
is possible to significantly enrich for HSCs, by isolating populations of cells that lack
lineage-specific markers (e.g. the B cell marker CD19 (in humans) or B220 (in mice), the
T cell marker CD3, etc.), but do possess a certain combination of other surface antigens.
Notably, these antigens are different in mice and humans (Chao, Seita, and Weissman
2008). In mice, HSC activity lies in populations of cells that express c-Kit and Scal
(Uchida and Weissman 1992), and either lack expression of CD34 altogether (Osawa et
al. 1996) or show variations in CD34 expression based on their activation state (Sato,
Laver, and Ogawa 1999) or on the age of the mouse (Ito, Tajima, and Ogawa 2000). In
contrast, human HSC activity is exclusively found in CD34* cells (Civin et al., 1984;
DiGiusto et al., 1994). Human HSCs are further enriched in populations of cells that
express CD133 (Yin et al. 1997) and CD90 (Baum et al. 1992), but lack expression of
CD38 (Huang and Terstappen 1994).
Surface marker expression patterns as well as repopulation assays have been used
to define the stages of HSC development and to explore progenitor commitment to the
various hematopoietic lineages. Thus, mouse long-term (LT-) HSCs can self-renew
throughout a mouse's lifetime, while cells of a later, more mature stage, called the shortterm (ST-) HSCs, can only self-renew for 6-8 weeks before advancing to the multipotent
progenitor (MPP) stage (Shizuru, Negrin, and Weissman 2005). These, in turn, have very
little self-renewing potential (Morrison and Weissman 1994), and soon commit to either
the lymphoid lineage, becoming common lymphoid progenitors (CLPs) (Kondo,
Weissman, and Akashi 1997), or to the myeloid lineage, becoming common myeloid
progenitors (CMPs) (Akashi et al. 2000). Finally, the progenitors develop into the mature
cells of the blood: CLPs differentiate into B cells, T cells, and NK cells, while CMPs
differentiate into granulocytes, monocytes, dendritic cells, erythrocytes, and platelets
(Blom and Spits 2006).
The pool of CLPs contains precursors of both B cells and T cells, the two classes
of cells that comprise the adaptive immune system. When normal development of these
precursors (also called lymphoblasts) becomes dysregulated, immature lymphoblasts
accumulate in the bone marrow, peripheral blood, and (when T-cell precursors are
involved) in the thymus.
This is the clinical presentation of acute lymphoblastic
leukemia/lymphoma (ALL), a disease primarily affecting infants and children (Aster
2005). Although the root causes of the majority of ALL cases are not known, several
genetic defects have been found to recur; these include chromosomal copy number
changes (including both hypo- and hyperploidy), chromosomal translocations that result
in novel fusion genes, and mutations in specific genes (Teitell and Pandolfi 2009).
The majority (80-85%) of ALL cases are aggressive malignancies of precursor B
cells. Stages in B cell development are defined by the markers expressed on the surface
of B cells (see Table 1).
B-ALL cells show intracellular expression of terminal
deoxynucleotidyl transferase (TdT), and express surface markers CD 19 and CD 10, but
not immunoglobulin or (usually) CD20; they therefore match the marker phenotype of
pro-B cells (Blom and Spits 2006). T-ALL cells also usually express TdT, but they have
a more variable expression of surface and intracellular markers, which may reflect
transformation at different stages of T cell development (Swerdlow et al. 2008).
Table 1: Stages of human B cell development
CD19
TdT IL-7Ra CD20
IgM CD10
CLP
-
-
+
-
-
+
Pro-B
+
+
+
-
-
+
t CD19, t TdT
Pre-B
+
-
-
+
-
+
4'IL-7Ra, t CD20
ImmatureB
+
-
-
+
+
+
TIgM
Mature B
+
-
-
+
+
-
4 CD10
(Adapted from Blom and Spits, 2006)
ALL is often subtyped based on the underlying genetic lesion, and the nature of
these lesions is often predictive of treatment outcome (Pui, Relling, and Downing 2004).
The most common translocation in pediatric ALL patients is t(12;2 1), which results in the
creation of a fusion between transcription factors TEL and AML 1; the fusion protein is
thought to inhibit the transcription cascade normally initiated by AML 1, thereby altering
the differentiation and renewal of the affected cells (Speck and Gilliland 2002). The
prognosis of TEL-AMLl+ patients after aggressive treatment with combination
chemotherapy is generally quite good, with significantly lower rates of relapse and higher
rates of event-free survival observed in these patients than in those without this
translocation (Rubnitz et al. 1997).
In contrast, the most common translocation in adult ALL patients is t(9;22), where
the fusion occurs between the breakpoint cluster region (BCR) gene and the tyrosine
kinase ABL.
The constitutive activity of the resulting BCR-ABL tyrosine kinase
subsequently activates the RAS-MAPK and the PI3K-AKT pathways in an aberrant
manner, resulting in dysregulation of cell proliferation and survival (Kharas and Fruman
2005; McCubrey et al. 2008).
The prognosis for patients with this translocation, also
called the Philadelphia chromosome, is quite poor, even with aggressive treatment
(Thomas et al. 2004; Pullarkat et al. 2008); this is thought to be due to the high mutation
rate that results in a rapid rise of drug-resistant clones (Teitell and Pandolfi 2009).
Other translocations are also associated with precursor B-ALL. These include a
variety of translocations involving the mixed lineage leukemia (MLL) gene, which
normally modulates gene expression via its function as a histone methylase, as well as the
E2A transcription factor that regulates B cell transition from the pro-B to the pre-B
development stage (Teitell and Pandolfi 2009). Dysregulation of still other transcription
factors and enzymes are more commonly associated with T-ALL; although outcome of
aggressive treatment of T-ALL is often favorable (Larson et al. 1995), karyotypic
abnormalities seem to not affect patient prognosis (Heerema et al. 1998).
1.1.2
Mature B lymphocytes and the origins of mature B cell neoplasms
More mature B cells are distinguished by their surface expression of CD20 as
well as proteins of the immunoglobulin (Ig) family that can bind soluble antigens. In the
membrane-bound form, these are called the B cell receptors (BCRs); upon activation,
mature B cells gain the ability to secrete the BCR, which in its soluble forms is called an
antibody. The BCR (as well as a typical antibody) consists of four polypeptide chains: a
dimer of two identical heavy chains that weigh -50 kDa each, and two identical light
chains, each attached to a heavy chain and weighing -25 kDa. Each heavy and light
chain is comprised of a constant region and a variable region. The constant region of the
heavy chain will determine the effector function of an antibody that may eventually be
secreted; meanwhile, the combination of variable regions of heavy and light chains
attached to one another form the binding site of the BCR. This site is able to bind a very
small number of epitopes or antigens, possibly only one; every BCR contains two
identical antigen binding sites. Furthermore, each B cell is able to express a unique BCR,
so that this receptor becomes a clonal marker of that cell and of all its progeny
(Janeway, Jr. et al. 2001).
BCR specificity is attained early in B cell development, as B cell precursors in the
bone marrow assemble the BCR variable regions from numerous germline-encoded
segments, in a process called V(D)J recombination. The imprecision of joining of these
segments, partly accomplished through the activity of the TdT enzyme mentioned above,
along with the combinatorial association of different segments, contributes to the
immense diversity of B cells and antibodies (Janeway, Jr. et al. 2001).
After mature B cells leave the bone marrow, where they had been developing,
they are still naive - that is, they still have not encountered their cognate antigen.
Consequently, naive B cells circulate through the primary lymphoid organs (such as
lymph nodes and spleen), where many antigens are either carried in soluble form by the
blood or lymph flow, or are brought in by specialized antigen presenting cells, such as
dendritic cells (DCs).
After encountering antigen, a B cell becomes activated and
proliferates, and its progeny undergoes further maturation in the lymph node follicle.
Specifically, these clonal B cells congregate around a specialized antigen-presenting cell
called a follicular DC, forming the so-called germinal center. Here, B cells are subjected
to somatic hypermutation, a process whereby mutations are introduced at a high rate into
genes encoding BCR variable regions. As a result, mutated B cells have a range of
affinities for the antigen; because the antigen is in limited supply, only B cells with the
highest affinity for the antigen can bind the follicular DC and receive survival and
proliferation stimuli, while the vast majority of B cells undergoes apoptosis. Several
rounds of somatic hypermutation produce B cells with markedly increased antigen
affinity.
Some of these cells also perform isotype switching, where the antibody's
constant region, which determines its interactions with the rest of the immune system, is
switched to optimize the protective effect of the antibody; in this way, B cells that start
out expressing IgM may switch to express IgA, IgE, or IgG antibody isotypes. In the
end, two general types of B cells arise: the long-lived but quiescent memory cells as well
as plasma cells that can rapidly secret large amounts of their unique antibody in order to
neutralize an infection (Janeway, Jr. et al. 2001).
As noted above, the majority of lymphomas are of B cell origin; these can arise
from any stage of B cell development, including naYve B cells, germinal center B cells,
and plasma cells. For example, cases of chronic lymphocytic leukemia (CLL), the most
common mature B cell neoplasm that accounts for ~ 30% of all leukemias diagnosed in
the US, may arise from either naYve or antigen-experienced B cells (Stevenson and
Caligaris-Cappio 2004). In most B cell lymphomas, however, neoplastic cells show signs
of somatic hypermutation, suggesting that the cancer originated in germinal center or
post-germinal center cells (Carbone et al. 2009). The importance of the germinal center
in lymphomagenesis is underscored in follicular lymphoma (FL), the second most
common mature B cell neoplasm; FL cells accumulate in lymph node follicles and may
undergo somatic hypermutation throughout the course of the disease (Kuppers et al.
1999). The initial disease is indolent, but in up to 70% of the cases the cancer undergoes
histological transformation into a more aggressive form; this transformation is thought to
be due to progressive accumulation of further genetic changes, inside as well as outside
of the Ig locus (Viardot et al. 2003).
In other, more aggressive lymphomas, neoplastic B cells do not undergo continual
somatic hypermutation, but germinal center-specific events are nonetheless thought to be
crucial for disease emergence. A common feature of many of these lymphomas is the
presence of chromosomal translocations that fuse an Ig constant region with an oncogene.
Examples include Ig/bcl-6 fusions in diffuse large B-cell lymphoma and Ig/c-myc fusions
in some cases of Burkitt lymphoma; the expression of fused oncogenes becomes
dysregulated, leading to the emergence and progression of a neoplastic phenotype
(Kuppers et al. 1999). The fusion sites lie within Ig isotype switch regions, implicating
defective isotype switching in the germinal center as the source of the malignant
transformation. Multiple myeloma, a plasma cell neoplasm, appears to be a variation on
this theme: chromosomal abnormalities sustained in the germinal center do not prevent
pre-myeloma cells from differentiating into antibody-secreting plasma cells, but once
these plasma cells reach the bone marrow, the local microenvironment promotes their
proliferation, expansion, and consequent pathology (Tricot 2002).
1.2
Differences between murine and human immune systems
Much immunological insight has been gleaned from careful examination of
samples from healthy volunteers as well as from patients suffering from the leukemias
and lymphomas described above. Yet, it is also difficult to overstate the importance of
mouse models in advancing our understanding of both basic immunology and of the
processes underlying the development of hematologic malignancies. Indeed, the overall
structure of the immune systems in mice and in humans is broadly similar: innate
immune cells and B cells develop in the bone marrow, T cells develop in the thymus, and
cells of both the innate and adaptive systems circulating through secondary lymphoid
organs that includes structurally-similar lymph nodes, spleen, and mucosal associated
lymphoid tissues (Haley 2003). These similarities have led to the tendency to ignore or
downplay any differences, as well as to assume that mice are essentially immunologically
identical to humans.
Yet there are obvious differences between the two species, the immunological and
oncological implications of which cannot be overlooked. For example, gestation in mice
is almost 15 times shorter than that of humans; after birth, mice grow 100 times faster
than humans, and after reaching maturity they age 30 times faster. Mice are also 3000
times smaller than humans; this difference in stature, as well as other differences in diet
and habitat, results in mice likely experiencing a range of antigens that is very different
from humans (Gordon et al. 2001).
As Rangarajan and Weinberg (2003) point out, these large-scale differences have
grave implications for the relative susceptibility of the two species to cancer. The basal
metabolic rate is 7-fold higher in mice than in humans, which causes mice to produce
correspondingly higher amounts of potentially mutagenic metabolic by-products;
meanwhile, murine and human livers also differ in the way they process these
compounds. Even more striking is the observation that the lifetime risk of developing
cancer is the same in both species, -30%; given that humans live -30 times longer, our
markedly lower susceptibility to age-dependent tumors must be due to powerful antineoplastic mechanisms that had developed since our evolutionary divergence from
rodents.
Indeed, the perturbation of only two signaling pathways is sufficient to
transform murine fibroblasts in vitro, while a similar transformation of human fibroblasts
requires the perturbation of six or more pathways (Rangarajan and Weinberg 2003).
In terms of immunological differences between the two species, perhaps the most
evident one is in the composition of their circulating leukocyte populations: in mice these
are predominantly lymphocytes (-60%), while in humans these are mainly neutrophils
(also -60%).
The functional significance of this difference, however, is not well
understood (Haley 2003).
Less apparent discrepancies also abound, though their functional implications, in
most cases, also remain unclear. Differences in marker expression of HSCs have already
been discussed (see above); in addition, B cell developmental requirements also appear to
be different, most notably with interleukin 7 appearing to be dispensable for normal B
cell development in humans (Kovanen and Leonard 2004), but not in mice (Busslinger
2004). In contrast, defects in the BLNK adapter protein, in the BCR-associated tyrosine
kinase Btk, or in the pre-BCR component k5 results in an almost complete absence of
mature B cells in humans, but only a modest reduction in B cell numbers in mice
(Gordon et al. 2001). In T cell development, defects in ZAP70, a kinase involved in T
cell receptor signaling, block the differentiation of both CD4* and CD8* T cells in mice,
but only CD8* T cells in humans (Mestas and Hughes 2004).
There are also significant differences between murine and human mature
lymphocytes. Among B cells, these include the expression of CD77 (expression of which
defined germinal center B cells in humans, but is only sparsely present on murine
splenocytes), CD38 (indicative of terminally differentiated plasma cells in humans, but
downregulated and lost on murine plasma cells), and CD5 and CD23 (present
concurrently on activated NB cells in humans, but not in mice) (Gordon et al. 2001).
Differentially expressed T cell markers include Thy-1 (expressed on murine thymocytes
and mature T cells, but absent from human T cells), the co-stimulatory molecule CD28
(present on virtually all mouse T cells, but only on 80% of CD4* and 50% of CD8* cells
in humans), and the MHC class II molecule (expressed on human but not murine T cells).
Finally, functional differences between human and murine lymphocytes have also been
documented; the most notable of these is the differential effect of cytokines on B cell
class switching, as well as helper T cell polarization (Mestas and Hughes 2004).
As research of murine and human hematopoiesis continues, the list of differences
between the two species is likely to grow. These differences, especially ones related to
cancer susceptibility, are certainly important when mice are used to model abnormalities
in lymphocyte development and/or function, abnormalities that lead to leukemias,
lymphomas, or other diseases of the immune system. But perhaps even more problematic
is that, as Mark Davis remarks, "mice are lousy models for clinical studies" (Davis 2008).
Numerous protocols that appeared promising in mice have failed in human patients, in
part because models fail to approximate accurately the anatomical localization of disease,
its onset, progression, or development, or the way the disease interacts with the host
(Ostrand-Rosenberg 2004).
In the case of human-specific treatments, potential targets of chemo- and
immunotherapy are most likely not well conserved between mice and humans, so that
purely murine models simply cannot be used for treatment screening, development, or
validation. This is certainly the case for therapeutic antibodies that target specific surface
antigens; human-specific by definition, these require human targets to be injected into the
hosts (Ostrand-Rosenberg 2004). These targets could consist of patient-derived leukemia
or lymphoma samples, though the patient-to-patient variability of the samples, as well as
the unclear genetic history of the lesions present in these samples, limit the usefulness of
this approach.
Target cells could also be cell lines engineered to express the target
human antigen, but engraftment of such cells is again likely to not correspond with the
natural course of disease progression in human patients; furthermore, artificial expression
of human antigen in these cells may result in their immune rejection by the host itself.
Clearly, better models of human immune disorders and hematologic malignancies are
urgently needed, so that pre-clinical studies of human specific anti-neoplastic treatments
become possible.
1.3
Humanized mouse models
To satisfy the growing need for in vivo studies of human cells and tissues,
researchers have developed immunodeficient mice that accept xenotransplants of human
tissues.
In the late 1980's, it was discovered that mice that had a severe combined
immunodeficiency (scid) due to a mutation in a DNA-activated protein kinase could
support the engraftment of human hematopoietic cells (McCune et al. 1988). This scid
mouse model was successfully used to study in vivo properties of human HSCs, human T
cell differentiation and infection with HIV, as well as homing properties of human
leukemia (Greiner, Hesselton, and Shultz 1998).
The model, however, also had
significant limitations, which included its high sensitivity to radiation preconditioning,
due to the severe defect in its DNA repair mechanisms, as well as the leakiness of the
mutation itself, which caused a gradual appearance of endogenous immune cells and thus
resulted in extremely low (0.5% - 5%) levels of human cell engraftment (Shultz,
Ishikawa, and Greiner 2007).
In 1995, it was shown that non-obese diabetic (NOD) mice carrying the above
scid mutation support much better engraftment of human tissues (Greiner et al., 1995;
Hesselton et al., 1995). This was thought to be due to additional defects in the innate
immune system that are present in these mice; however, a recent report showed that NOD
mice carry a polymorphism that allows human hematopoietic cells to bind and inhibit
macrophages in recipient mice, thereby preventing them from interfering with the human
graft (Takenaka et al. 2007). Over the last several years, NOD/scid mice have become
widely used as xenotransplant recipients, in a variety of studies aimed at elucidating the
function of various human tissues, healthy and malignant. The usefulness of this model,
however, is limited by its high predisposition to thymic lymphomas and therefore a
relatively short life span (~37 weeks) (Shultz et al. 2005). In addition, high levels of
human tissue engraftment are still not seen, likely due to residual presence of innate
immunity and low but present NK cell activity (Greiner, Hesselton, and Shultz 1998).
In
2005,
Shultz
and
colleagues
reported
successfully
back-crossing
immunodeficient mice lacking the gene for the common cytokine-receptor y chain onto
the NOD/scid background, thereby producing NOD/scid, ycu" (NSG) mice (Shultz et al.
2005). The common y chain is a vital component of the receptors for interleukins (IL-) 2,
4, 7, 9, 15, and 21; the myriad roles of these cytokines include the differentiation and
development of T cells (IL-2, IL-7), B cells (IL-7), and NK cells (IL-2, IL- 15), as well as
downstream effects on lymphocyte homeostasis (IL-7, IL- 15), as well as on helper T cell
polarization and B cell class switching (IL-4, IL-21) (Janeway, Jr., Travers, Walport, &
Shlomchik, 2001; Kovanen & Leonard, 2004).
Thus, mice deficient in this multi-
receptor subunit lacked not only mature B and T cells, but also NK cells (Cao et al.
1995). Furthermore, NOD/scid, ycn" (NSG) mice were free of thymic lymphomas, even
after sub-lethal irradiation, which was attributed to a lack of residual thymocytes as
compared to the NOD/scid mice; as a result, NSG mice had a much longer life span, -90
weeks, as compared to -37 weeks seen in NOD/scid mice (Shultz et al. 2005).
Most importantly, adult NSG mice were shown to support much higher
engraftment levels of human cells after injection of human CD34* cells than the
NOD/scid mice. NSG mice were sublethally irradiated, injected via their tail vein with
7x 105 human CD34* cells, and examined 10 weeks later. The bone marrow of NSG mice
reconstituted with human HSCs showed 5- to 6-fold higher engraftment levels of human
cells than their NOD/scid counterparts (-35% vs. -6%, respectively).
Of human
leukocytes in the bone marrow, defined as cells expressing the human leukocyte common
antigen CD45, approximately 80% were CD19+ B-lineage cells, with approximately a
third of these showing the IgM* staining indicative of mature B cells; in addition, human
NK cells, myeloid cells, plasmacytoid dendritic cells, and stem cells were all detected.
The spleen showed -60% human chimerism (i.e. -60% of all splenocytes were human
CD45*), with the majority of human cells being CD20* B cells arranged in follicular
structures. Human IgM and IgG were detected in the peripheral blood, indicating the
occurrence of class switching. The thymus showed -37% chimerism, with the majority
of cells being CD4*CD8*; the majority of peripheral blood leukocytes were CD3* T cells,
with 34% of these being CD4* and 55% CD8*. Finally, T cells from the thymus were
able to proliferate in response to T cell mitogens phytohemagglutinin (PHA) and
streptococcal pyrogenic exotoxin (Shultz et al. 2005).
1.4
Expansion of human hematopoietic stem cells in vitro
As described above, approximately 7x 105 CD34* cells are required for successful
reconstitution of an adult NOD/scid, ycnun mouse.
This requirement presents two
significant problems. The first is expense: a vial containing 7-10x 105 CD34* human
umbilical cord blood cells, enough to reconstitute only one or two adult NSG mice, costs
several hundred dollars, making routine generation of humanized mice prohibitively
expensive. The second problem is that of reproducibility. Human cord blood can be
obtained from individual donors or as batches of pooled cord blood cells; however,
individual cords yield fewer than 106 CD34* cells, while batches of pooled cells can vary
in their ability to reconstitute mice (Adam Drake, personal communication).
A subsequent report showed that engraftment of newborn NSG mice was in some
ways preferable to that of adults: injection of only 105 human CD34* cells was sufficient
to attain high engraftment levels in both the bone marrow (~70%) and the spleen (~55%),
and indeed resulted in higher levels of circulating human antibodies (Ishikawa et al.
2005). This alleviates the problem of expense somewhat; the difficulty of obtaining large
groups of newborn pups at any given time, however, make the generation of large cohorts
of humanized mice from reconstituted pups quite impractical.
Thus, it would be desirable to be able to expand a population of human long-term
reconstituting HSCs in vitro, so that cells originating from either one donor or one batch
of pooled donors are sufficient to reconstitute enough adult NSG mice for an entire study
or set of experiments. Because there are no surface markers that that uniquely define
HSCs, the efficacy of in vitro HSC expansion protocols is best quantified in vivo, by
assaying the ability of a given number of cultured cells to reconstitute a syngeneic mouse
(for murine HSCs) or an immunodeficient (e.g. scid) mouse (for human HSCs)
(Coulombel 2004; Kirouac and Zandstra 2006). Numerous different culture conditions
have been described over the years; the most successful of these use serum-free media
supplemented with several growth factors to expand the so-called scid-repopulating cells
(SRCs). These growth factors include stem cell factor (SCF, also known as steel factor),
which has been shown to prevent HSC apoptosis and to anchor HSCs in the bone marrow
niche, as well as thrombopoietin (TPO), Notch ligands, and Wnts, all of which have been
shown to be important in the generation and expansion of HSCs (Zhang and Lodish
2008). Other growth factors commonly used in HSC culture include IL-3 and IL-6, Flt3
ligand (Flt3-L), and fibroblast growth factors (FGFs) (Sauvageau, Iscove, and Humphries
2004). In a recent development, pleiotrophin, a heparin-binding growth factor secreted
by brain endothelial cells, has been described as promoting HSC regeneration; its ability
to promote in vitro expansion of human HSCs, however, was quite modest, with only -3fold SRC expansion achieved in culture along with TPO, SCF, and Flt3-L (Himburg et al.
2010).
This expansion was on par with numerous other reports: until recently, the
maximum reported SRC expansion was only ~6-fold (Gammaitoni et al. 2003;
Sauvageau, Iscove, and Humphries 2004). Nevertheless, even these modest expansions
are being shown to be useful in the clinic: infusion of SRC that had been expanded -6fold in vitro in patients undergoing bone marrow transplantation was recently shown to
lead to much faster neutrophil recovery, effectively reducing the time during which these
patients are extremely susceptible to infections (Delaney et al. 2010).
These developments underscore the need to gain a better understanding of the
mechanisms that support human HSC survival and to identify other factors that promote
symmetrical, self-renewing division of HSCs in vivo and their expansion in vitro. To that
end, Lodish and colleagues recently identified two new growth factors that support
expansion of human HSCs: insulin growth factor binding protein 2 (IGFBP2) and
Angiopoietin-like protein 5 (Angptl5) (Zhang et al. 2008). Neither had previously been
known to have a role in hematopoiesis: IGFBP2 binds IGF-1 and IGF-2 with high
affinity, thereby modulating IGF distribution and biological activity (Ranke and
Elmlinger 1997), while Angptl's have been described as regulators of angiogenesis
(Oike, Yasunaga, and Suda 2004). These two proteins were used to supplement serumfree medium containing SCF, TPO, and FGF-1 (STF medium). In this study human cord
blood-derived human CD133* cells were used; as described above, CD133 is a marker
expressed by populations of primitive human cord blood cells that are enriched with
HSCs. When CD133* cells were cultured for 11 days in the STF medium supplemented
with IGFBP2 and Angptl5, the total number of cells increased ~250-fold.
Notably,
NOD/scid mice that had been reconstituted with cells cultured in the presence of IGFBP2
and Angptl5 showed much greater chimerism (39.5±7.5% human cells) than mice
reconstituted either with cells cultured in STF medium alone (0.8±0.3%), or with cells
that had not been cultured at all (0.2±0.2%). Engraftment with the progeny of just -8000
human CD133+ cells was sufficient to result in high human chimerism.
Subsequent
limiting dilution assays showed that SRCs expanded by -20-fold in culture, a significant
improvement over the previous benchmark of -6-fold expansion. Finally, the long-term
self-renewal potential of the in vitro expanded cells was confirmed when bone marrow
from primary mouse recipients of the expanded HSCs successfully reconstituted
secondary recipients, while the bone marrow from mice that had received unexpanded
cells failed to do so (Zhang et al. 2008).
1.5
Further characterization of in vitro-expanded HSCs using the novel
NOD/scid, yc"" immunodeficient mouse model
Human cell expansion in the above study was quantified by assaying the
reconstitution of NOD/scid mice; yet, this assessment was limited to a time period of
approximately two months post-engraftment, since NOD/scid mice rapidly develop
thymic lymphoma after irradiation. Thus, it has been difficult to determine whether the
population of expanded human cells indeed contained long-term HSCs, or the more
differentiated short-term HSCs and multipotent progenitors.
However, the extended lifespan of the NOD/scid, ycnun mice recently developed
by Shultz and colleagues permits a more thorough assessment of human cell engraftment
over a much longer period of time (Shultz et al. 2005). Furthermore, because NOD/scid,
ye""" mice lack NK cells, higher levels of human cell chimerism are likely to be attained,
even when fewer starting human cells are used.
To evaluate these possibilities, we set out to combine these two novel
technologies. Consequently, HSC culture conditions optimized by Zhang et al. (2008)
were used to expand human cord blood-derived CD133* cells, which were then engrafted
into sub-lethally irradiated NOD/scid, ycnul mice. The ability of expanded human cells to
reconstitute these hosts was the same as their ability to reconstitute NOD/scid mice; in
effect, culture conditions had increased the cells' scid-repopulating ability by -20-fold.
Notably, a similar -20-fold increase during culture was observed in the number of cells
expressing both CD34 and CD133 (Figure 1.1A). Scid-repopulating activity of expanded
cells resided exclusively in these CD34* CD 133* cells (Figure 1.1 B), and this activity per
CD34* CD133* cell remained the same before and after culture (Figure 1.1C).
The
number of CD34* CD133* cells is thus predictive of scid-repopulating activity of human
cells expanded using the above protocol.
Human cell reconstitution of NSG hosts was the same at 3 and 6 months postengraftment, both in the extent of human cell chimerism in the peripheral blood
(Figure 1.2A) and the number and lineage of various human leukocytes in the bone
marrow, spleen, and thymus (see below).
Robust reconstitution was achieved after
injecting only 2.5xl05 CD34* CD133* cells (Figure 1.2B). In addition, it was possible to
isolate human CD34* cells from the bone marrows of reconstituted mice 3 or 6 months
after the initial engraftment, and to use these cells to reconstitute secondary NSG hosts
(Figure 1.2C).
These results indicate that the expanded CD34* CD133* cells indeed
contain long-term human HSCs.
Finally, human leukocytes that arose from the engrafted CD34* CD133* cells
were thoroughly characterized. Human cells in reconstituted mice included relatively few
platelets, erythrocytes, myelomonocytes, granulocytes, DCs, and NK cells.
Poor
reconstitution of these lineages is likely due to the incompatibility of cytokines required
for their development, (produced by the murine host) and the receptors for these
cytokines present on human cells (Chen, Khoury, and Chen 2009).
..............
- -- - .,:::_::
::yr.
I.
-
- --
-- -- '...
--
-
-
;
..........
.......
...
. ........
1,
20-
Culture day 1 Culture day 11
E 15102E 5
0
CD34
0
V
V
C)
*AA
.
vv*8
5
A
Cultured
Uncultured
Injected Cells
(Figure adapted from Drake et al., submitted)
Figure 1.1: Expanded CD34* CD133* cells are SCID repopulating cells.
(A) Expression of primitive surface markers CD34 and CD133 in a representative
sample of CD133* cells isolated from human cord blood, on day 1 and day 11 of in vitro
expansion. The number indicates percentage of CD34* CD133* cells in the gated region.
The number of total cells increased approximately 60-fold in this particular expansion.
(B) Comparison of reconstitution in neonate NSG mice engrafted with ~10 CD34*
CD133* cells that were expanded and re-purified after culture or with a sample of
cultured cells that contained ~105 CD34* CD133* cells. Human cell chimerism was
determined 12 weeks after initial engraftment by determining the expression of human
and murine CD45 in peripheral blood mononuclear cells (PBMCs) of engrafted mice.
Mean ± SD is shown, n = 7 mice per group. (C) Comparison of bone marrow
chimerism (human vs. murine CD45) in sublethally irradiated neonate NSG recipients
that had been engrafted with 400, 1000, or 5000 cultured or uncultured CD34* CD133*
cells. Horizontal bars show the mean; each symbol represents an individual mouse. No
significant differences among data sets was found (p=0.23).
.. .
A
........
B
6o
E40
8o
E
00
0
3
6
0
Months post
reconstitution
C
Primary
9
Secondary
24,51.86
CD34
Bone Marrow
0.69
Human CD45
Bone Marrow
Spleen
(Figure adapted from Drake et al., submitted)
Figure 1.2: Expanded CD34* CD133* cells contain long-term HSCs.
(A) Comparison of chimerism in peripheral blood of sublethally irradiated adult NSG
mice reconstituted with 2.5-5xl05 CD34* CD133* cells per mouse at 3 and 6 months
after initial engraftment. PBMCs were stained for expression of human and murine
CD45. Mean ± SD is shown, n= 6 mice per group. (B) Comparison of reconstitution
levels in mice injected with different numbers of expanded CD34* CD133* cells.
Sublethally irradiated adult NSG recipients were injected with cultured cells containing
0.5xl05, 2.5xl05 or 5x105 CD34* CD133* cells. Eight weeks later, PBMCs of engrafted
mice were analyzed for expression of human and murine CD45. Mean ± SD is shown, n
= 6-8 per group. (C) CD34* cells from the bone marrow of a primary reconstituted
humanized mouse can be used to engraft other, secondary mice with human cells. Human
CD34* cells were isolated from the femoral bone marrow of primary humanized mice via
magnetic sorting; numbers indicate percentage of gated cells - note the presence of
CD34* CD133* cells. The equivalent of one femur's CD34* cells was transferred into
one sublethally irradiated secondary recipient. Twelve weeks later, cells from the bone
marrow and the spleen of secondary recipient mice were analyzed for expression of
human and murine CD45.
Consistent with previous reports, the majority of human cells were lymphocytes
(Figure 1.3).
CD19+ B cells accounted for -2/3 of human cells in the bone marrow;
approximately 65% of the CD 19+ cells were IgM IgD- CD 10 pro-B or pre-B cells, and
only -4% were IgM* IgD* naive B cells (Figure 1.3B). In the spleen, -3/4 of the human
leukocytes were CD19* B cells, and -75%
of these were IgM* IgD* naive B cells
(Figure 1.3A). In comparison, the level of T cell reconstitution in these mice was fairly
low, possibly also due to a cytokine-receptor incompatibility (Manz and Di Santo 2009).
The majority of thymocytes were of human origin, and the normal patterns of CD4 and
CD8 expression were observed (Figure 1.3C). And although human T cells that arise in
these mice accounted for only -5% of human leukocytes in the spleen and peripheral
blood, the ratio of CD4* and CD8* T cells in the periphery was 2:1, similar to that found
in humans (Figure 1.3D, E).
Taken together, these results demonstrate that in vitro expanded human CD34*
CD133* HSCs can give rise to a variety of human blood cell lineages.
Human
reconstitution achieved using this protocol compares favorably with previously reported
human cell reconstitutions in NSG mice (cf. Shultz et al. 2005; Giassi et al. 2008).
Because relatively few starting human cells are needed to achieve robust human cell
engraftment, this protocol presents the possibility to generate numerous wellreconstituted adult humanized mice using cells derived from a single donor.
These
findings were described in a manuscript that was recently submitted for publication
(Drake et al.).
...........
Bone Marrow
Spleen
IgM
CD10
C
I- - T4C
I 4.9
CD10
7~
I
I
T.I
IgM
CDIO
CD45
CD4
_
1
Thymus
17.0_
83
CD45
CD4
(Figure adapted from Drake et al., submitted)
Figure 1.3: Lymphoid cell reconstitution in adult NSG recipients.
Sub-lethally irradiated adult NSG mice were engrafted with 2.5-5x105 expanded CD34+
CD133* cells. Mice were euthanized approximately 12 weeks after initial engraftment,
and cells from the spleen (A and D), bone marrow (B), thymus (C), and peripheral
blood (E) were analyzed by flow cytometry for the expression of indicated surface
markers. All samples were gated on human CD45* cells except those showing IgM vs.
IgD staining, which were gated on CD45* CD19+ cells, and those showing CD4 vs. CD8
staining, which were gated on CD45* CD3* cells. The numbers indicate percent cells in
the gated region. Representative data from one of at least 5 mice are shown.
1.6
Overall project objectives
Using the methods described above to culture and engraft human HSCs, it is
possible to generate a large number of humanized mice that are genetically identical in
both the murine host and human graft. This presents an excellent opportunity to model
not only the healthy human hematopoietic and immune systems, but also various
disorders of these systems. Furthermore, in vitro expansion of human HSCs offers the
opportunity to transduce these cells with exogenous genes delivered via a retroviral
vector. Specifically, inducing these cells, or their more mature progeny, to over-express
oncogenes thus allows modeling of human hematologic malignancies, as well as their
treatment using chemo- and immunotherapy.
Therefore, the first objective of this project is to create a suitable viral vector that
could infect human HSCs and stably integrate into their genome, as well as to optimize
the conditions of such infection.
The next objective is to demonstrate that mice
reconstituted with HSCs that had been virally transduced with oncogenes go on to
develop tumors. The final objective will be to use a humanized mouse model of a human
lymphoma or leukemia to examine the effects of human-specific anti-neoplastic therapy.
1.7
References
Akashi, K, D Traver, T Miyamoto, and I L Weissman. 2000. A clonogenic
common myeloid progenitor that gives rise to all myeloid lineages. Nature 404, no. 6774:
193-7.
Aster, J.C. 2005. Diseases of the White Blood Cells, Lymph Nodes, Spleen, and
Thymus. In: Robbins and Cotran PathologicBasis of Disease. AK Abbas, N Fausto, and
V Kumar. 7th ed. Philadelphia, PA: Elsevier, Inc.
Baum, C.M., I.L. Weissman, A.S. Tsukamoto, A.M. Buckle, and B. Peault. 1992.
Isolation of a candidate human hematopoietic stem-cell population. Proceedingsof the
NationalAcademy of Sciences of the United States ofAmerica 89, no. 7: 2804-8.
Blom, B., and H. Spits. 2006. Development of human lymphoid cells. Annual
Review of Immunology 24: 287-320.
Busslinger, M. 2004. Transcriptional control of early B cell development. Annual
Review of Immunology 22: 55-79.
Cao, X, E W Shores, J Hu-Li, M R Anver, B L Kelsall, S M Russell, J Drago, M
Noguchi, A Grinberg, and E T Bloom. 1995. Defective lymphoid development in mice
lacking expression of the common cytokine receptor gamma chain. Immunity 2, no. 3:
223-38.
Carbone, A., A. Gloghini, A. Cabras, and G. Elia. 2009. The germinal centrederived lymphomas seen through their cellular microenvironment. British Journalof
Haematology 145, no. 4: 468-80.
Chao, M P, J Seita, and I L Weissman. 2008. Establishment of a normal
hematopoietic and leukemia stem cell hierarchy. Cold Spring HarborSymposia on
Quantitative Biology 73: 439-49.
Chen, Q., M. Khoury, and J. Chen. 2009. Expression of human cytokines
dramatically improves reconstitution of specific human-blood lineage cells in humanized
mice. Proceedingsof the NationalAcademy of Sciences of the United States ofAmerica
106, no. 51: 21783-8.
Civin, C.I., L.C. Strauss, C. Brovall, M.J. Fackler, J.F. Schwatz, and J.H. Shaper.
1984. Antigenic Analusis of Hematopoiesis III. A Hematopoietic Progenitor Cell Surface
Antigen Defined by a Monoclonal Antibody Raised Against KG-la Cells. Journalof
Immunology 133: 157-65.
Coulombel, L. 2004. Identification of hematopoietic stem/progenitor cells:
strength and drawbacks of functional assays. Oncogene 23, no. 43: 7210-22.
Davis, M.M. 2008. A prescription for human immunology. Immunity 29, no. 6:
835-8.
Delaney, C., S. Heimfeld, C. Brashem-Stein, H. Voorhies, R.L. Manger, and I.D.
Bernstein. 2010. Notch-mediated expansion of human cord blood progenitor cells capable
of rapid myeloid reconstitution. Nature Medicine 16, no. 2: 232-6.
DiGiusto, D, S Chen, J Combs, S Webb, R Namikawa, A Tsukamoto, B P Chen,
and A H Galy. 1994. Human fetal bone marrow early progenitors for T, B, and myeloid
cells are found exclusively in the population expressing high levels of CD34. Blood 84,
no. 2: 421-32.
Drake, A.C., M. Khoury, I. Leskov, B.P. Iliopoulou, M. Fragoso, H. Lodish, and
J. Chen. Robust Reconstitution of Adult NOD-scid Il2rg-/- (NSG) Mice with In Vitro
Expanded Human CD34+ CD 133+ Hematopoietic Stem Cells. Manuscript submitted.
Gammaitoni, L., S. Bruno, F. Sanavio, M. Gunetti, 0. Kollet, G. Cavalloni, M.
Falda, et al. 2003. Ex vivo expansion of human adult stem cells capable of primary and
secondary hemopoietic reconstitution. ExperimentalHematology 31, no. 3: 261-70.
Giassi, L.J., T. Pearson, L.D. Shultz, J. Laning, K. Biber, M. Kraus, B.A. Woda,
et al. 2008. Expanded CD34+ human umbilical cord blood cells generate multiple
lymphohematopoietic lineages in NOD-scid IL2rgamma(null) mice. Experimental
Biology and Medicine 233, no. 8: 997-1012.
Gordon, J., G. Grafton, P.M. Wood, M. Larch6, and R.J. Armitage. 2001.
Modelling the human immune response: can mice be trusted?. Current Opinion in
Pharmacology 1: 431-5.
Greiner, D L, L D Shultz, J Yates, M C Appel, G Perdrizet, R M Hesselton, I
Schweitzer, W G Beamer, K L Shultz, and S C Pelsue. 1995. Improved engraftment of
human spleen cells in NOD/LtSz-scid/scid mice as compared with C.B-17-scid/scid mice.
The American Journalof Pathology 146, no. 4: 888-902.
Greiner, D L, R A Hesselton, and L D Shultz. 1998. SCID mouse models of
human stem cell engraftment. Stem Cells 16, no. 3: 166-77.
Haley, P. 2003. Species differences in the structure and function of the immune
system. Toxicology 188, no. 1: 49-71.
Heerema, NA, HN Sather, MG Sensel, and P. 1998. Frequency and clinical
significance of cytogenetic abnormalities in pediatric T-lineage acute lymphoblastic
leukemia: a report from the Children's Cancer Group. Journalof Clinical Oncology 16,
no. 4: 1270-8.
Heron, M.P. 2007. Deaths : Leading Causes for 2004. National Vital Statistics
Reports 56, no. 5: 1-96.
Hesselton, R M, D L Greiner, J P Mordes, T V Rajan, J L Sullivan, and L D
Shultz. 1995. High levels of human peripheral blood mononuclear cell engraftment and
enhanced susceptibility to human immunodeficiency virus type 1 infection in NOD/LtSzscid/scid mice. JournalofInfectious Diseases 172, no. 4: 974-82.
Himburg, H.A., G.G. Muramoto, P. Daher, S.K. Meadows, J.L. Russell, P. Doan,
J.-T. Chi, et al. 2010. Pleiotrophin regulates the expansion and regeneration of
hematopoietic stem cells. Nature Medicine 16, no. 4: 475-82.
Huang, S, and LW Terstappen. 1994. Lymphoid and myeloid differentiation of
single human CD34+, HLA-DR+, CD38-hematopoietic stem cells. Blood 83, no. 6:
1515-26.
Ishikawa, F., M. Yasukawa, B. Lyons, S. Yoshida, T. Miyamoto, G. Yoshimoto,
T. Watanabe, K. Akashi, L.D. Shultz, and M. Harada. 2005. Development of functional
human blood and immune systems in NOD/SCID/IL2 receptor gamma chain-null mice.
Blood 106, no. 5: 1565-73.
Ito, T, F Tajima, and M Ogawa. 2000. Developmental changes of CD34
expression by murine hematopoietic stem cells. Experimental Hematology 28, no. 11:
1269-73.
Janeway, Jr., C.A., P. Travers, M. Walport, and M.J. Shlomchik. 2001.
Immunobiology. 5th ed. New York, NY: Garland Publishing.
Kharas, M.G., and D.A. Fruman. 2005. ABL Oncogenes and Phosphoinositide 3Kinase: Mechanism of Activation and Downstream Effectors. CancerResearch 65, no. 6:
2047-53.
Kirouac, D.C., and P.W. Zandstra. 2006. Understanding cellular networks to
improve hematopoietic stem cell expansion cultures. Current Opinion in Biotechnology
17, no. 5: 538-47.
Kondo, M, I.L. Weissman, and K Akashi. 1997. Identification of clonogenic
common lymphoid progenitors in mouse bone marrow. Cell 91, no. 5: 661-672.
Kovanen, P.E., and W.J. Leonard. 2004. Cytokines and immunodeficiency
diseases : critical roles of the g c -dependent cytokines interleukins signaling pathways.
Immunological Reviews 202: 67-83.
Kuppers, R., U. Klein, M.-L. Hansmann, and K. Rajewsky. 1999. Cellular origin
of human B-cell lymphomas. New EnglandJournalof Medicine 341, no. 20: 1520-9.
Larson, R A, R K Dodge, C P Bums, E J Lee, R M Stone, P Schulman, D
Duggan, F R Davey, R E Sobol, and S R Frankel. 1995. A five-drug remission induction
regimen with intensive consolidation for adults with acute lymphoblastic leukemia:
cancer and leukemia group B study 8811. Blood 85, no. 8: 2025-37.
Manz, M.G., and J.P. Di Santo. 2009. Renaissance for mouse models of human
hematopoiesis and immunobiology. Nature Immunology 10, no. 10: 1039-42.
McCubrey, J.A., L.S. Steelman, S.L. Abrams, F.E. Bertrand, D.E. Ludwig, J.
Basecke, M. Libra, et al. 2008. Targeting survival cascades induced by activation of
Ras/Raf/MEK/ERK, PI3K/PTEN/Akt/mTOR and Jak/STAT pathways for effective
leukemia therapy. Leukemia 22, no. 4: 708-22.
McCune, JM, R. Namikawa, H. Kaneshima, LD Shultz, M. Lieberman, and IL
Weissman. 1988. The SCID-hu mouse: murine model for the analysis of human
hematolymphoid differentiation and function. Science 241, no. 4873: 1632-9.
Mestas, J., and C.C.W. Hughes. 2004. Of mice and not men: differences between
mouse and human immunology. JournalofImmunology 172, no. 5: 2731-8.
Morrison, S J, and I L Weissman. 1994. The long-term repopulating subset of
hematopoietic stem cells is deterministic and isolatable by phenotype. Immunity 1, no. 8:
661-73.
Oike, Y., K. Yasunaga, and T. Suda. 2004. Angiopoietin-Related/AngiopoietinLike Proteins Regulate Angiogenesis. InternationalJournalof Hematology 80, no. 1: 218.
Orkin, S.H., and L.I. Zon. 2008. Hematopoiesis: an evolving paradigm for stem
cell biology. Cell 132, no. 4: 631-44.
Osawa, M, K Hanada, H Hamada, and H Nakauchi. 1996. Long-term
lymphohematopoietic reconstitution by a single CD34-low/negative hematopoietic stem
cell. Science 273, no. 5272: 242-5.
Ostrand-Rosenberg, S. 2004. Animal models of tumor immunity, immunotherapy
and cancer vaccines. Current Opinion in Immunology 16, no. 2: 143-50.
Pui, C.-H., M.V. Relling, and J.R. Downing. 2004. Acute lymphoblastic
leukaemia. New EnglandJournalofMedicine 3350, no. 15: 1535-48.
Pullarkat, V., M.L. Slovak, K.J. Kopecky, S.J. Forman, and F.R. Appelbaum.
2008. Impact of cytogenetics on the outcome of adult acute lymphoblastic leukemia:
results of Southwest Oncology Group 9400 study. Blood 111, no. 5: 2563-72.
Rangarajan, A., and R.A. Weinberg. 2003. Comparative biology of mouse versus
human cells: modelling human cancer in mice. Nature Reviews Cancer 3, no. 12: 952-9.
Ranke, M.B., and M. Elmlinger. 1997. Functional role of insulin-like growth
factor binding proteins. Hormone Research 48, no. Suppl. 4: 9-15.
Rubnitz, J E, J R Downing, C H Pui, S A Shurtleff, S C Raimondi, W E Evans, D
R Head, et al. 1997. TEL gene rearrangement in acute lymphoblastic leukemia: a new
genetic marker with prognostic significance. Journal of clinical oncology : official
journal of the American Society of Clinical Oncology 15, no. 3: 1150-7.
Sato, T, J.H. Laver, and M Ogawa. 1999. Reversible expression of CD34 by
murine hematopoietic stem cells. Blood 94, no. 8: 2548-54.
Sauvageau, Guy, Norman N Iscove, and R Keith Humphries. 2004. In vitro and in
vivo expansion of hematopoietic stem cells. Oncogene 23, no. 43: 7223-32.
Shizuru, J.A., R.S. Negrin, and I.L. Weissman. 2005. Hematopoietic stem and
progenitor cells: clinical and preclinical regeneration of the hematolymphoid system.
Annual Review of Medicine 56: 509-38.
Shultz, L.D., B.L. Lyons, L.M. Burzenski, B. Gott, X. Chen, S. Chaleff, M. Kotb,
et al. 2005. Human Lymphoid and Myeloid Cell Development in NOD/LtSz-scid
IL2R{gamma}null Mice Engrafted with Mobilized Human Hemopoietic Stem Cells.
Journalof Immunology 174: 6477-89.
Shultz, L.D., F. Ishikawa, and D.L. Greiner. 2007. Humanized mice in
translational biomedical research. Nature Reviews Immunology 7, no. 2: 118-30.
Speck, N.A., and D.G. Gilliland. 2002. Core-binding factors in haematopoiesis
and leukaemia. Nature Reviews Cancer 2, no. 7: 502-13.
Stevenson, F.K., and F. Caligaris-Cappio. 2004. Chronic lymphocytic leukemia:
revelations from the B-cell receptor. Blood 103, no. 12: 4389-95.
Swerdlow, S.H., E. Campo, N.L. Harris, E.S. Jaffe, S.A. Pileri, H. Stein, J. Thiele,
and J.W. Vardiman (eds). 2008. World Health OrganizationClassificationof Tumours of
Haematopoieticand Lymphoid Tissues. 4th ed. Lyon: IARC Press.
Takenaka, K., T.K. Prasolava, J.C.Y. Wang, S.M. Mortin-Toth, S. Khalouei, 0.1.
Gan, J.E. Dick, and J.S. Danska. 2007. Polymorphism in Sirpa modulates engraftment of
human hematopoietic stem cells. Nature Immunology 8, no. 12: 1313-23.
Teitell, M.A., and P.P. Pandolfi. 2009. Molecular genetics of acute lymphoblastic
leukemia. Annual Review of Pathology 4: 175-98.
Thomas, D.A., Stefan Faderl, Jorge Cortes, S. O'Brien, F.J. Giles, S.M. Kornblau,
G. Garcia-Manero, et al. 2004. Treatment of Philadelphia chromosome-positive acute
lymphocytic leukemia with hyper-CVAD and imatinib mesylate. Blood 103, no. 12:
4396-407.
Tricot, GJ. 2002. New insights into role of microenvironment in multiple
myeloma. InternationalJournalof Hematology 76 Suppl 1: 334-6.
U.S. Cancer Statistics Working Group. 2007. United States Cancer Statistics:
2004 Incidence and Mortality. Atlanta: US. Departmentof Health and Human Services,
Centersfor Disease Control andPrevention and NationalCancer Institute.
Uchida, N., and I.L. Weissman. 1992. Searching for hematopoietic stem cells:
evidence that Thy-1. lo Lin- Sca-1+ cells are the only stem cells in C57BL/Ka-Thy-1.1
bone marrow. Journalof ExperimentalMedicine 175, no. 1: 175.
Viardot, A., T.F.E. Barth, P. M611er, H. Dshner, and M. Bentz. 2003. Cytogenetic
evolution of follicular lymphoma. Seminars in CancerBiology 13, no. 3: 183-90.
Yin, A.H., S. Miraglia, E.D. Zanjani, G. Almeida-Porada, M. Ogawa, A.G. Leary,
J. Olweus, J. Kearney, and D.W. Buck. 1997. AC 133, a novel marker for human
hematopoietic stem and progenitor cells. Blood 90, no. 12: 5002-12.
Zhang, C.C., M. Kaba, S. lizuka, H. Huynh, and H.F. Lodish. 2008. Angiopoietinlike 5 and IGFBP2 stimulate ex vivo expansion of human cord blood hematopoietic stem
cells as assayed by NOD / SCID transplantation. Blood 111, no. 7: 3415-23.
Zhang, C.C., and H.F. Lodish. 2008. Cytokines regulating hematopoietic stem cell
function. Current Opinion in Hematology 15, no. 4: 307-11.
Chapter 2
Modeling Hematologic Malignancies in Humanized Mice
2.1
Summary
Humanized mice - immunodeficient animals engrafted with human hematopoietic stem
cells (HSCs) that subsequently give rise to mature human blood lineage cells - offer an ethical
and practical way to study human cell biology in vivo. Recent advances in human HSC culture
and expansion make it possible not only to generate large cohorts of humanized mice, but also to
modify HSCs genetically prior to their engraftment. Such transgenesis of adult human stem cells
permits modeling of hematologic malignancies in human cells. To that end, a lentiviral vector
capable of stoichiometric expression of up to three transgenes in a B cell-specific manner was
constructed; in this case, these transgenes included the GFP reporter and the clinically-important
oncogenes Myc and Bcl-2. Enforced expression of Bcl-2 resulted in a benign B cell hyperplasia,
but overexpression of Bcl-2 in combination with Myc led to a rapid development of an
aggressive disease that recapitulated the histopathological and clinical aspects of human
progenitor B cell acute lymphoblastic leukemia (pro-B ALL).
Specific acknowledgements: Dr. Adam Drake's advice proved invaluable throughout this
project. Dr. Ching-Hung Shen helped perform the Southern blot analysis of GMB tumor
clonality. Dr. Bettina Iliopoulou performed the ELISA analysis of serum immunoglobulin
changes in GB mice stimulated with TNP-LPS. Dr. Patrick Stem helped design the vector and
troubleshoot lentiviral production. Maria Fragoso provided excellent technical support.
2.2
Introduction
The ultimate goal of this project was to model human hematologic malignancies and their
treatments in humanized mice. Many leukemias and lymphomas are characterized by aberrant
oncogene expression in mature leukocytes or in their precursors; the most direct way to model
these diseases is therefore to replicate the perceived requirements for their development, by
inducing similarly aberrant oncogene expression in appropriate cellular targets.
Yet, while
engraftment of patient tumor samples in immunodeficient mice is relatively commonplace, there
are few studies where human cells with defined genetic lesions are followed in an in vivo setting.
Nevertheless, the ability of several oncogenes to induce leukemia in human cells has been
assayed; these include transcription factors such as STAT5 (Schuringa et al. 2004), cytokine
receptors such as Flt3 (Chung et al. 2005; Moore et al. 2007), homeobox genes HOXA9 (Chung
et al. 2006) and HOXAlO (Buske et al. 2001), as well as several leukemia-associated fusion
proteins, such as AMLI-ETO (Basecke et al. 2005), CBFp-SMMHC (Wunderlich et al. 2006),
and BCR-ABL (Chalandon et al. 2005). The effects of enforced oncogene expression in these
studies, however, were generally limited to perturbations in the distribution of human cell
lineages that arise following HSC engraftment. This apparently modest effect may have been at
least partially due to fact that engrafted animals were followed for only a few months, before
succumbing to endogenous thymomas to which NOD/scid mice are prone.
The exceptions to this were two studies by Dick and colleagues. In one, engraftment of
human cells that had been transduced with the fusion protein combining the TEL transcription
factor with the JAK2 tyrosine kinase resulted in the rapid development of a disease resembling
acute myelofibrosis (Kennedy et al. 2006). The other study examined the effect of two fusion
proteins: MLL-ENL, the product of the t(1 1; 19) translocation found in both AML and ALL, and
MLL-AF9, a fusion associated primarily with AML (Barab6 et al. 2007). Within 3-4 months of
engraftment, NOD/scid mice reconstituted with human cells that had been transduced with MLLENL developed a B-ALL-like disease, while those engrafted with MLL-AF9-expressing cells
developed either B-lymphoid or myeloid leukemias. These results illustrated that the identity of
fusion partners is vital in determining leukemia lineage (Barab6 et al. 2007). Furthermore, they
showed that enforced expression of a single oncogene may be sufficient for leukemia
development, despite the overall resistance of human cells to transformation described by
Rangarajan and Weinberg (2003).
These findings were particularly encouraging for further modeling of hematologic
malignancies in humanized mice, especially since the extended lifespan of the novel NOD-scid
Il2rj'- (NSG) immunodeficient mice provides the opportunity to follow cancer development
over longer periods of time.
Since humanized mice are generated by reconstituting
immunodeficient animals with human HSCs, transducing these HSCs prior to their engraftment,
as was done in previous studies, seems to be the most suitable method of introducing exogenous
genes into the more mature human cells that will eventually arise.
Thus, there are two initial technical hurdles that must be overcome: the first is to
efficiently transduce human HSCs that are undergoing in vitro expansion, while the second is to
ensure that the newly-introduced genes are expressed in a cell- and stage-specific manner.
Finally, in light the failure of most transgenes examined to date to transform human cells, the
nature of the oncogenes to be used in this study also had to be carefully considered.
2.2.1
Lentivirus as a transgene delivery system
Retroviral vectors have been used for gene delivery into hematopoietic cells for over 25
years (Williams et al. 1984; Dick et al. 1985).
Murine cells were the first targets, but the
possibility of using this technology to correct specific gene defects in human subjects was clear
from the outset (Williams et al. 1984).
Initial vectors were based on the Moloney murine
leukemia virus (MLV), a representative member of the gammaretrovirus genus of the
Retroviridae family (Baum et al. 2006). A retroviral particle consists of a plus-stranded viral
RNA genome, packaged inside a protein capsid and surrounded by a cell-membrane-derived
envelope. Glycoproteins embedded in the envelope are bound by receptors on the target cell,
following which the virion enters the cell, either by direct fusion of the viral and cell membranes
or by receptor-mediated endocytosis and subsequent fusion of the viral membrane with that of
the endosome (reviewed in Anderson and Hope 2005). In the cytoplasm, the protein capsid is
shed and the viral genome is reverse-transcribed into cDNA, which then latch onto dynein
motors and translocate towards the nucleus along microtubules (McDonald et al. 2002). It has
been found, however, that the cDNA of retroviruses like MLV cannot enter the host nucleus, by
traversing the nuclear pore complex for example, but must wait for the mitosis-associated
breakdown of the nuclear envelope in order to gain access to the host genome (Roe et al. 1993).
Consequently, MLV-based vectors do not efficiently transduce quiescent cells such as HSCs
(Baum et al. 2006).
In contrast, the lentivirus genus of the Retroviridaefamily does not share this dependence
on mitosis for nuclear entry (Lewis and Emerman 1994). This is due in part to the presence of
nuclear localization signals on lentiviral proteins, such as integrase, that co-localize with the viral
cDNA (Gallay et al. 1997), as well as to active disruption of the nuclear envelope by lentiviral
proteins (De Noronha et al. 2001). Lentiviral ability to infect non-dividing cells makes these
vectors optimal for transducing HSCs. Another important advantage of lentiviral vectors as
transgene delivery systems is that lentivirally-delivered transgenes have been shown to be
significantly less susceptible to CpG methylation-mediated silencing by the host cell than those
delivered via a gammaretrovirus (Pfeifer et al. 2002).
Because such silencing tends to be
especially prominent in cells undergoing a long differentiation process (Brenner and Malech
2003), this aspect of lentiviral vectors is particularly relevant for transducing HSCs when the
eventual goal is expression of transgenes in their more differentiated descendants.
Finally,
lentiviruses are much better able to incorporate exogenous regulatory elements, such as
enhancers and promoters, into their genome. Since these sequences normally do not exist in the
form of RNA (as they would in the viral vector), they often contain cryptic splice sites, but
lentiviral Rev proteins and Rev-responsive elements have been shown to suppress host-cellmediated splicing and to promote packaging of unspliced viral genomes (May et al. 2000;
reviewed in Logan, Lutzko, and Kohn 2002).
Their numerous advantages over comparable
gammaretroviral vectors thus made lentiviruses the optimal choice of vector with which to
transduce human HSCs.
2.2.2
B cell specific promoters
Lentiviral ability to carry enhancers and promoters is especially important in light of the
need to accurately and precisely target the expression of vector-delivered transgenes. Because
most human lymphoid malignancies are of B cell origin, it was critical to restrict transgene
expression to cells of the B lymphocyte lineage. To date, only three B cell-specific promoters
have been described in the context of a lentiviral vector. The first is the immunoglobulin (Ig)
heavy chain enhancer Eji, discovered simultaneously by two groups in 1983 (Banerji, Olson, and
Schaffner 1983; Gillies et al. 1983). When incorporated into expression cassettes, this enhancer
led to B cell specific transgene expression (Adams et al. 1985). Although the extent of B cellspecific enhancement was found to vary with the site of transgene integration, this positiondependent variegation was significantly reduced by combining the Ei enhancer with its flanking
matrix attachment regions (MARs) (Forrester et al. 1994).
These elements function by
maintaining neighboring chromatin in an open conformation (Jenuwein et al. 1997), and the EptMARs combination was recently shown to induce B cell specific expression of lentivirallydelivered genes (Lutzko et al. 2003).
A similar way to induce B cell-specific transgene expression was described by
Gustafsson and colleagues (Laurie et al. 2007); this consisted of placing transgenes (in this case,
a GFP reporter) under the control of the Ig kappa light chain minimal promoter along with two Ig
enhancers. Unfortunately, the leakiness of this system was not very encouraging: although most
of the GFP* cells were of B cell origin, some 13% were CD3* T cells (Laurie et al. 2007).
Finally, a more robust promoter system was described by the Tonnelle group, who
characterized the genomic region located directly upstream of the human CD19 gene (Moreau et
al. 2004). This gene is expressed by B cells from the pro-B cell stage onwards; and indeed,
when human CD34* cells were transduced with a lentivirus in which GFP was under the control
of a this putative promoter region, and transduced cells were used to reconstitute NOD/scid mice,
GFP expression was tightly restricted to B cells that arose. Combining this CD19 promoter with
the previously described Ep-MARs construct resulted in a 12-fold increase of GFP expression
without any loss in B cell specificity (Moreau et al. 2008). Of the currently available promoters,
this combination of the Ep-MARs enhancer construct and the human CD19 promoter thus
appears to be the best option for achieving B cell specific transgene expression.
2.2.3
Choice of oncogenes
Since the goal of this project was to model hematologic malignancies, it was clear that
the transgenes to be lentivirally delivered to HSCs, and to be later expressed in their B cell
descendants, should be ones that promote cancer development. In order to avoid latency in
disease emergence, it was preferable to choose oncogenes that had previously been shown to
promote rapid lymphomagenesis.
Two such oncogenes that are particularly important in human lymphomas are Myc and
Bcl-2; translocations that aberrantly place the expression of these genes under the control of the
immunoglobulin regulatory regions are found in most cases of Burkitt lymphoma and follicular
lymphoma, respectively (Aster 2005). Both Myc and Bcl-2 have been extensively studied since
they were first discovered (Sheiness, Fanshier, and Bishop 1978; Tsujimoto et al. 1984). The
Myc gene encodes for a transcription factor that can act as an activator, inducing many genes
directed toward cell growth and proliferation, including ones involved in protein synthesis (e.g.
ribosomal components and other translation machinery) and energy metabolism (e.g. genes
involved in glycolysis and other mitochondrial functions).
Thus it is not surprising that
transgenic mice harboring an exogenous copy of Myc under the control of the Ep enhancer
developed
aggressive
(Adams et al. 1985).
monoclonal
B
cell
lymphomas
within
3-5
months
of birth
It is notable, however, that no lymphoid hyperplasia is seen before the onset of malignant
lymphoma in these Ept-Myc mice; this is thought to be due to Myc-enhanced B cell proliferation
being accompanied by a Myc-induced apoptosis (Marin et al. 1995).
In light of Myc's
proliferative functions, its concurrent pro-apoptotic function was surprising; nevertheless, it has
been shown to promote apoptosis by a variety of mechanisms, including (among others) indirect
activation of p53, up-regulation of cell surface death receptors, repression of the anti-apoptotic
members of the Bcl-2 family members (e.g. Bcl-XL), and the concurrent induction of its proapoptotic members (reviewed in Meyer, Kim, and Penn 2006). Indeed, in a recent elegant study,
Evan and colleagues showed that the role of Myc in apoptosis depends on its expression level:
continuous presence of Myc in low amounts promoted proliferation, while abundant Myc
overexpression resulted in apoptosis (Murphy et al. 2008).
Myc's pro-apoptotic role suggests that tumor development in the context of Myc
overexpression requires additional genetic lesions; the latency period in the Ep-Myc model, as
well as the monoclonal nature of the disease that emerges, further support this notion. Indeed,
one such potent secondary lesion involves overexpression of the Bcl-2 oncogene.
Unlike
previously identified oncogenes that stimulate proliferation directly, Bcl-2 has been found
instead to inhibit programmed cell death, by protecting the integrity of the mitochondrial outer
membrane; this precludes the release of cytochrome c from the mitochondria into the cytoplasm,
which would otherwise result in the activation of effector caspases and the initiation of apoptosis
(reviewed in Youle and Strasser 2008; Chipuk et al. 2010). Consistent with this exclusively antiapoptotic function was the observation that when Bcl-2 was overexpressed in murine B cells
(again via the use of the Ept enhancer), transgenic mice exhibited polyclonal B cell hyperplasia
instead of monoclonal malignant lymphoma (McDonnell et al. 1989).
Unexpectedly, the Ept-Bcl-2 transgenic mice did go on to develop aggressive lymphomas,
but only after an average latency period of 15 months; about half of the affected animals
exhibited a secondary rearrangement of their endogenous Myc gene with the endogenous
immunoglobulin locus (McDonnell and Korsmeyer 1991). At about the same time, two studies
by the Cory group had demonstrated that Bcl-2 cooperates with Myc in tumor development, in
vitro (Vaux, Cory, and Adams 1988) and in vivo (Strasser et al. 1990). In the latter study,
transgenic mice in which B cells overexpress both Myc and Bcl-2 from the outset develop
lymphoid tumors within -3 weeks of birth, and die from an illness resembling a disseminated
lymphoma/leukemia within 2 months of birth. Unlike the lymphomas developed by the Eg-Myc
single-transgenic mice, these Ep-Myc/Bcl-2 tumors were leukemias of progenitor cells: widely
disseminated, with no evidence of immunoglobulin rearrangement, and bearing markers
suggestive of lymphoid progenitors (Strasser et al. 1990). Subsequently, this cooperation was
shown to be due to Bcl-2 blocking Myc-associated apoptosis without inhibiting Myc-induced
proliferation (Fanidi, Harrington, and Evan 1992; Marin et al. 1995); more recently, Korsmeyer
and colleagues demonstrated that sustained expression of Bcl-2 was required for leukemia
maintenance in Ep-Myc/Bcl-2 mice (Letai et al. 2004).
The rapid development of lymphoid tumors in the Ep.-Myc/Bcl-2 double-transgenic mice
strongly suggests that humanized mice would also quickly develop leukemia if the reconstituting
human HSCs give rise to lymphocytes that overexpress both of these oncogenes. The relatively
small size of the two oncogenes (-0.7kb for Bcl-2 and -1.4kb for Myc) means that both can be
placed within a single lentiviral vector, along with a fluorescent reporter marker such as GFP.
Given the importance of the Myc and Bcl-2 oncogenes in two common human lymphomas, and
because their effects have been extensively studied both in vitro and in vivo, using numerous
murine models, these two oncogenes were finally chosen as the transgenes to be lentivirally
introduced into human HSCs.
The considerations summarized above determined the choice of vector with which to
transduce human HSCs, as well as the oncogenes and the regulatory elements that would control
their expression. Subsequent challenges included assembling the promoter and transgenes within
the vector, transducing human HSCs undergoing in vitro expansion with the resulting oncogenic
lentivirus, reconstituting immunodeficient mice using these cells, and, finally, characterizing the
human malignancies that arise. The results of this work are described below.
2.3
Results
2.3.1
Lentiviral vector design
In an effort to attain stable transgene expression that would be minimally affected by the
site of lentivirus integration, we based the design of our lentiviral vector on the pLB2 backbone,
originally developed by Stem and colleagues (Stem et al. 2008). This backbone was modified to
include a multiple cloning sequence (MCS) that contains several unique restriction sites,
designed to accommodate the insertion of a promoter sequence, as well as that of one or several
transgenes.
The transgenes chosen in this study were the Green Fluorescent Protein (GFP) reporter
and two human oncogenes, Myc and Bcl-2.
As described above, Myc can promote cell
proliferation as well as apoptosis; one of the mechanisms for this latter function is the induction
of the pro-apoptotic protein Bim, which binds and inhibits Bcl-2. However, the Myc allele
chosen here contains the T58A mutation, which was previously shown to impair Myc's ability to
induce Bim and thereby to inhibit Bcl-2 (Hemann et al. 2005).
The use of this allele was
expected to further increase the potential of this oncogene combination to transform human cells.
In order to express several proteins from a single mRNA, transgene sequences were
separated from one another by the sequence of a foot-and-mouth disease virus-derived 2A
peptide; this sequence induces a ribosomal skip during translation and results in a stoichiometric
production of several proteins from a single mRNA (Donnelly, Luke, et al. 2001; Donnelly,
Hughes, et al. 2001; (Szymczak et al. 2004). As a result, 28 of the 29 amino acids encoded by
the 2A sequence are left on the C-terminus of the already-translated protein, while a single
proline
remains on the N-terminus of the nascent protein. This method permitted the generation of four
constructs, which contained the sequences of either GFP alone, GFP in combination with either
Myc or Bcl-2, or all three transgenes (Figure 2.1).
The rationale for choosing the B cell specific combination of the Et-MARs enhancer
construct and the human proximal CD19 promoter is described above. As a control, the strong
and ubiquitously-expressed promoter of human elongation factor 1la (EFl1a) was also chosen;
this has been previously shown to induce strong transgene expression in human hematopoietic
progenitors and all of their more mature descendants (Salmon et al. 2000).
Both of these
promoters were cloned immediately upstream of the transgene constructs within the pLB2
backbone (Figure 2.2).
2.3.2
Lentivirus production and titration
High-titer virus (~108 viral particles/ml, after concentration) was made when lentivirus-
producing 293FT cells were transfected with a vector where the EFla promoter controlled the
expression of GFP alone. However, when these cells were transfected instead with vectors
bearing one or both oncogenes, the normally adherent and spindle-shaped 293FT cells separated
from the flask and became spherical; no virus was recovered from the supernatant media.
These changes in the 293FT cells' morphology and function were hypothesized to be due
to their recognition of the EFl1a promoter sequence in the vectors with which they had been
transduced, and the subsequent production of the Myc and/or Bcl-2 oncogenes within these cells.
Therefore, the EFla promoter in the lentiviral vector construct was replaced with the Ep
enhancer/CD 19 promoter combination. Transgenes under its control were not expected to be
.. ..........
......
BsrG
Agel
Not|
Apal
B
*Not|
Apal
O Not|l
Apal
Age|
BsrG|
~Apal
(Apal)
Figure 2.1
Construction of expression cassettes containing up to three transgenes
Four expression cassettes (in red boxes) were assembled in the pEGFP-Nl shuttle vector. The
initial cassette (A) contained the sequences of eGFP and the 2A peptide; sequences encoding the
Myc (B) and Bcl-2 (C) were inserted 3' of the 2A sequence using the ApaI and NotI restriction
sites. The triple transgene cassette (D) was constructed by first replacing eGFP in the initial
cassette with a Myc sequence that contained an upstream ApaI site, using the AgeI and BsrGI
restriction sites; the resulting Myc-2A sequence was then excised using its flanking ApaI
restriction sites, and inserted into the ApaI site located in the 2A peptide sequence between eGFP
and Bcl-2. Arrows indicate the approximate locations of restriction sites relative to one another.
transcribed by 293FT cells, which are derived from human embryonic kidney tissue and do not
express the CD19 surface marker.
Indeed, when 293FT cells were transfected with vectors
where the expression of GFP and oncogenes was under the control of the combination of the Ep
enhancer and the CD19 promoter, no significant changes in 293FT cell morphology were
observed, and lentiviral particles were produced.
The resulting titers of oncogene-bearing
viruses were similar to those of viruses bearing GFP alone.
Thus, four pLB2-based lentiviral vectors were generated, where the combination of the
Ep enhancer and the human CD 19 promoter controlled the expression of either GFP alone, GFP
and Bcl-2, GFP and Myc, or GFP as well as both Myc and Bcl-2 (Figure 2.2). For ease of
nomenclature, these vectors were subsequently referred to as G, GB, GM, or GMB virus,
respectively.
2.3.3
Lentiviral spin-infection lowers the engraftment efficiency of human CD133* cells
Once high-titer virus was obtained, it was important to assess the impact of lentiviral
spin-infection on the ability of human CD133+ cells to engraft in NSG mice and differentiate into
more mature leukocytes. Human cord blood-derived CD133* cells, a population that is greatly
enriched for hematopoietic stem cells (HSCs), were isolated and expanded in vitro as previously
described (Zhang et al. 2008; also see Materials and Methods). Expansion of CD133* cells was
monitored during culture by flow cytometry; after approximately 7-10-fold expansion of these
cells had occurred, CD133* cells were re-isolated from expansion culture and spin-infected with
the G lentiviral vector (i.e. one carrying the GFP reporter alone, as described above). After being
cultured in the presence of the virus for another 36-48 hours, the cells were washed and injected
Not|
Agel
Ii
Nhel
Not|
Agel
E 1a
GM
Not
Agel
Agel
=|
GB
Ep/CD19
Not|
N~eI
GMB
A gel
N
-
I
\
-
5'LT
1\
|
.0- .00,
t t t
.-* .01
(pLB2 lentiviral backbone)I
3'LR
Nhel Agel Not|
Lentiviral vector assembly
Figure 2.2
The EFlax promoter sequence or the sequence of the Ep/CD19 enhancer/promoter combination
was inserted in the pLB2 lentiviral vector backbone using the NheI and AgeI restriction sites.
Subsequently, each of the four constructs previously assembled within the pEGFP-N1 shuttle
vector was transferred into the lentiviral backbone using the AgeI and NotI restriction sites.
Arrows indicate the approximate locations of restriction sites relative to one another.
into sub-lethally irradiated adult (2-3 month-old) NOD-scid Il2r-
(NSG) mice, with each
mouse receiving ~2.5x 106 CD133* cells; 8-10 weeks later, human chimerism was measured in
their peripheral blood.
Human leukocytes express the human variant of the common leukocyte antigen CD45
(hCD45), while leukocytes in NSG mice express the murine variant of this antigen (mCD45.1).
Therefore, human chimerism in reconstituted mice was defined as follows:
% hCD454 cells
(% hCD4g+ cells) + (% mCD45.1 cells)
The extent of human chimerism varied with each engraftment (four examples are shown
in Figure 2.3), but the average chimerism always ranged between -2% and ~20%. In all cases,
however, it was significantly lower than the 38%±15% human chimerism seen in mice
reconstituted with ostensibly the same number of CD133* cells that had not been subjected to
spin infection (Drake et al., submitted; Figure 1.2B).
2.3.4
Transgene expression from the CD19 promoter is tightly restricted to CD19+ B cells
Although lentiviral spin infection appears to lower the engraftment efficiency of CD133*
cells, it did not affect their differentiation into mature leukocytes.
When NSG mice were
engrafted with CD133* cells that had been spin-infected with lentivirus bearing the GFP reporter
and the peripheral blood of these G mice was examined 8 weeks post-engraftment, the majority
of human cells were CD20*IgM* naYve B cells, with a small percentage of CD3* T cells and
CD33* myeloid cells (Figure 2.4). These findings are very similar to those in mice reconstituted
with CD133* cells that had not undergone spin infection (Drake et al., submitted; Figure 1.3).
E
25
x
x
-
20 -
A Aug. 16, 2009
X
E
X
Dec. 14, 2009
oJan. 15, 2010
C
E
Sep. 26, 2009
-
10
-
-C
0,0
A
Z
C
0-
Figure 2.3
Human cell chimerism following engraftment with CD133* cells that had
undergone lentiviral spin-infection. Human CD133* cells were purified from in vitro
expansion culture and spin-infected with lentivirus carrying the GFP reporter only. Two days
later, cells were washed of the virus and engrafted into sublethally irradiated adult NOD-scid
Il2ry~ mice. Eight weeks later, peripheral blood mononuclear cells (PBMCs) were analyzed for
expression of human and murine CD45. Each symbol represents an individual mouse; %human
chimerism was determined as indicated in the text.
A
LB
0
Human CD45
CD1 9- GFP+
GFP
CD19+ GFP+
CD3+
1""111
CD33+
CD19+GFP-
CD19- GFP""""j~r
r 1TJ ' ''""'u
CD19
i
'''
i
'I"""
I '
'' 11'
I '
' ""I
'
CD33
Human leukocytes reconstitution in NSG mice. Sublethally irradiated adult
Figure 2.4
NSG mice were engrafted with human CD133+ cells that had been spin-infected with lentivirus
in which the combination of the Ep enhancer and the CD19 promoter controlled the expression
of the GFP reporter gene. Peripheral blood leukocytes that arise in the reconstituted mice were
assessed 8 weeks later for the expression of the indicated markers. (A) Human leukocytes are
differentiated from murine ones by their expression of the species-specific variants of the
leukocyte common antigen, CD45. (B) Expression of GFP was confined to human CD45* cells
(bottom) and was entirely absent from mouse leukocytes (top). (C) Within the human cell
population, GFP expression was further restricted to CD19* B cells, which comprise the majority
of human cells that arise in humanized mice. (D) Among the CD19- human cells in the
periphery are CD3* T cells and CD33* myeloid cells. Representative data from at least 5 mice
are shown.
Approximately 1-15% of human cells in G mice were found to be GFP*; the exact
percentage differed with different infections (Figure 2.4).
As expected, the overwhelming
majority of cells expressing GFP were CD 19+ B cells; the lack of GFP* CD 19~ cells confirms the
previously-reported observation that the activity of the CD19 promoter is tightly restricted to
cells of the B lineage (Moreau et al. 2004; Moreau et al. 2008). The percentage of GFP* B cells
remained stable over the course of several months (Figure 2.5A), suggesting that these cells
differentiated from lentivirally-infected long-term HSCs, and not the more differentiated and
shorter-lived progenitor cells.
2.3.5
Bcl-2 overexpression by CD19+ cells leads to non-malignant B cell accumulation
Strong GFP expression confined to the B cell progeny of transduced human HSCs
suggested that a similarly B cell-specific enforced expression of the Bcl-2 oncogene would result
in a humanized mouse model of follicular lymphoma. Aberrant overproduction of Bcl-2 by
mature B cells that accumulate and proliferate in lymph nodes is the hallmark of this common
lymphoma. Therefore, sublethally irradiated NSG mice were engrafted with human CD133*
cells that had been spin-infected with lentivirus in which the B cell-specific human CD19
promoter controls the expression of either GFP alone or GFP in combination with Bcl-2.
Notably, the percentage of human cells that were GFP* was significantly higher in mice
that were engrafted with CD133k cells spin-infected with lentivirus that bears both GFP and the
Bcl-2 oncogene (GB mice; Figure 2.5B).
Moreover, this percentage steadily increased with
time, such that approximately 4 months after initial engraftment, GFP* cells constituted the
majority of human cells in the mice. Indeed, 5 months after engraftment, the total cell number
was 1.8-fold higher in the bone marrows and 2.7-fold higher in the spleens of GB mice, as
GFP
GFP
GFP
56.6
33.2
19.5
GFP
GFP
GFP
6 weeks
9 weeks
18 weeks
Percentage of GFP* cells is stable in G mice, but grows over time in GB mice.
Figure 2.5
Sublethally irradiated adult NSG mice were engrafted with human CD133* cells that had been
spin-infected with lentivirus carrying either GFP alone (A) or the combination of GFP and the
Bcl-2 oncogene (B). At the indicated times following engraftment, PBMCs from these mice
were analyzed for GFP expression. All cells were gated on human CD45* cells; murine cells did
not express GFP. Numbers indicate percent cells in the indicated region. Representative data
from at least 5 mice are shown.
compared to cell numbers in the same organs of G mice. This increased cellularity in both
organs was due exclusively to large increases in GFP* cells: a 13.5-fold increase in the bone
marrow and a 16.9-fold increase in the spleen (Figure 2.6); the numbers of GFP~ cells in both
organs remained approximately the same in G and GB mice. As in the G mice, GFP expression
in GB mice was confined to CD19+ cells of the B cell lineage; interestingly, increases in B cell
numbers did not affect the size and composition of other cell populations, such as human T cells
or murine or human myeloid cells (data not shown). As expected, GFP* cells in GB mice also
showed greatly increased levels of Bcl-2 expression, compared to CD19* cells isolated from
human buffy coat (data not shown).
Increased numbers of GFP+ cells in GB mice did not appear to affect their overall health:
over the course of 6 months after the initial engraftment, no significant difference in morbidity or
mortality was observed between G and GB mice. In addition, no overt differences in internal
anatomy were observed between G and GB mice when several of these mice were euthanized
approximately as late as 5 months post-engraftment. Histologic examination of H&E-stained
sections of various organs from G and GB mice showed that although the number of
lymphocytes in the spleens and lymph nodes was greater in GB mice than in G mice, the overall
organ architecture was the same in both cases.
2.3.6
The effect of GFP and Bcl-2 overexpression on B cell development
Four months after G and GB mice were engrafted with human CD133* cells, human
leukocytes from their bone marrows and spleens were analyzed for expression of GFP, as well as
the B cell development markers CD 19, CD 10, CD20, and IgM, and the B cell activation markers
CD21 and CD23. B cells were defined as those cells that express CD 19, and in the G mice
80
C0
x
70 -
GFP
60 +
GFP/Bcl-2
C
50
CU
40
+
0E 30
-
E
-
-
-c
4-
20 -
10 -
Bone Marrow
(1 femur)
Spleen
Figure 2.6
Human GFP* cells accumulate in the bone marrow and spleen of GB mice.
The number of human CD45* cells in the bone of one femur and in the spleen from a
representative G mouse (blue) and GB mouse (red) is shown; the contribution of GFP* cells to
the total number of human leukocytes is indicated in green. Determination of cell number was
made 5 months after initial engraftment with human CD133* cells, which had been spin-infected
with lentivirus carrying either GFP alone or the combination of GFP and the Bcl-2 oncogene.
Bone marrow Bcells
G mice
GB mice
GFP-
GFP+
Cell Type
Markers
GFP-
GFP+
Total B cells
CD19+
93.3% (3.5)
6.7% (3.5)
44.9% (10.6) 55.1% (10.6)
Pro B cell
cD1O+ cD20- IgM-
60.3% (7.2)
56.7% (4.7)
62.7%(5.7)
Pre B cell
cD10+ cD20+ IgM-
26.7% (5.7)
28.3% (5.5)
24.3% (4.7) 25.0% (11.5)
Immature B cell
cD10+ CD20+ IgM+
7.0%(1.1)
7.5%(1.1)
6.6% (0.4)
6.8% (1.4)
Mature B cell
CD10- CD20+ IgM+
1.1%(0.5)
1.4% (0.4)
1.1% (0.4)
2.0% (1.2)
58.3(9.3)
Table 2.1: Composition of the bone marrow B cell compartment in reconstituted G and GB
mice. Bone marrow of 3 G mice and 3 GB mice was examined 4 months after their initial
engraftment with human CD133* cells which had been spin-infected with lentivirus bearing GFP
alone or in combination with Bcl-2, respectively. All percentage calculations are based on cells
gated on the live (DAPI) human B cell gate; values are given as Mean % (Standard Deviation).
Note: B cells staining CD20~ IgM* did not fit the classification scheme and were therefore
discounted.
Splenic Bcells
G mice
GB mice
Cell Type
Markers
GFP-
GFP+
GFP-
GFP+
Total B cells
CD19+
84.4% (5.8)
15.6% (5.8)
22.3% (9.9)
77.7% (9.9)
Pro B cell
cD10+cD20- IgM-
22.0% (2.6)
21.0% (4.6)
22.7% (3.1)
40.3% (3.2)
Pre B cell
CD10+ cD20+ IgM-
7.8% (1.4)
9.4% (3.0)
6.5% (1.2)
7.9% (1.1)
Immature B cell
cD10+ CD20+ IgM+
33.7% (5.0)
32.7% (2.5)
29.0% (2.6)
15.7% (2.3)
Mature B cell
CD10- cD20+ IgM+
30.3% (5.7)
32.0% (6.1)
38.3% (4.7)
26.3% (3.8)
Table 2.2: Composition of the splenic B cell compartment in reconstituted G and GB mice.
Spleens of 3 G mice and 3 GB mice was examined 4 months after their initial engraftment with
human CD133* cells which had been spin-infected with lentivirus bearing GFP alone or in
combination with Bcl-2, respectively. All percentage calculations are based on cells gated on the
live (DAPF) human B cell gate; values are given as Mean % (Standard Deviation). Note: B cells
staining CD20~ IgM* did not fit the classification scheme and were therefore discounted.
~10% of these cells were GFP*. The relative proportions of bone marrow B cells in the various
developmental stages were essentially the same for GFP~ and GFP* B cell populations (Table
2.1): ~ 50-60% of B cells expressed CD10 but not CD20 or IgM and were therefore in the pro-B
cell stage, while -20-30% of B cells were CDl0* CD20* IgM~ pre-B cells. An additional -5-8%
were CD20* IgM* naYve B cells, of which the vast majority (over 85%) were CDlO and thus
immature (Table 2.1). Consistent with this nearly complete lack of mature naYve B cells, <1% of
the B cells expressed the activation markers CD21 and CD23 (data not shown).
The relative proportions of B cells in the different developmental stages were different in
the spleens of the G mice, which, as expected, contained many fewer pro- and pre-B cells (a little
over 20% and -8%, respectively) and many more naYve B cells (-65%, of which about half were
CD10~ mature cells) than the bone marrow (Table 2.2). Again, no significant differences in the
relative proportions of these cells were observed between GFP~ and GFP* B cell populations.
Likewise, roughly the same percentage of GFP~ and GFP* B cells expressed CD21 and CD23
(-20-25%; data not shown). These results indicate that GFP expression alone did not affect B
cell differentiation.
In the bone marrows of GB mice, GFP* cells accounted for >50% of all B cells;
nevertheless, the relative proportions of pro-B, pre-B, and naive B cells were very similar, not
only between GFP~ and GFP* B cell populations (Table 2.1), but also to the relative proportions
found in the bone marrows of G mice. Again, -60% of the B cells (GFP~ or GFP*) were in the
CD20- IgM~ pro-B cell stage, another -25% were CD20* IgM~ pre-B cells, and
-
7% were
CD20* IgM* naYve B cells, of which most were CDl0* and thus immature. Similar to the G
mice, <1% of bone marrow B cells in GB mice were CD21* CD23* (Table 2.1).
The spleens of GB mice, however, differed from those of G mice. While the relative
proportions of GFP~ pro-B, pre-B, and naive B cells were similar to those found in G mice, a
significantly higher percentage of GFP* (Bcl-2*) splenocytes was in the pro-B cell stage (40.3 ±
3.2% vs. 21.0 ± 4.6% in G mice; p < 0.05) (Table 2.2). Consequently, there were significantly
fewer GFP* cells that were CD20* IgM* naive B cells (Table 2.2). Consistent with this decrease
in the percentage of GFP+ naive cells, the percentage of activated (CD21* CD23*) GFP* B cells
was about half that of GFP~ cells (data not shown). These data suggested that overproduction of
Bcl-2 in these cells resulted in a delay in the development of pro-B cell splenocytes developing
into naive B cells.
2.3.7
Adoptively transferred GB cells do not expand in secondary hosts
In order to determine whether GFP* cells from GB mice are able to persist, and possibly
proliferate, after adoptive transfer, total spleen cell preparations from these mice were injected
into secondary NSG recipients. Each secondary mouse received approximately 107 GFP* cells;
4 weeks after transfer, however, GFP+ cells were undetectable in their peripheral blood (Figure
2.8A), spleens, or bone marrows (not shown).
This disappearance of GFP* cells after their
adoptive transfer suggested that the expanded population of GFP* cells in GB mice is likely to be
continually replenished by stem cells or progenitor cells that reside outside of the spleen.
To test this hypothesis, NSG mice were sublethally irradiated and engrafted with whole
bone marrow cell preparations from GB mice. Each secondary recipient received ~3-5x 107 total
bone marrow cells from GB mice, which included ~2x 107 GFP+ cells as well as ~3.5x105
CD133* cells (all of which were GFP~, as expected). Notably, human cell chimerism was ~40%
in the peripheral blood of these mice 6 months after engraftment, with GFP* cells comprising
......................................................
.
.
.......
. .
A
_
__B
95.3
_
0
45.7
____
0.2
o
4.7
Human CD45
0
19.7
Human CD45
036.6
32.4
GFP
Adoptive transfer of whole bone marrow, but not of splenocytes, gives rise to
Figure 2.8
in secondary GB mice. Cell suspensions were prepared from GB mouse
population
GFP* cell
bone marrow and spleen, and injected into sublethally irradiated NSG mice, such that each
secondary host received either ~1.5x 107 splenocytes (which included ~107 GFP+ cells) or -35x10 7 total bone cells (which included -2x107 GFP* cells as well as -3.5x1O' GFP~ CD133*
cells). Peripheral blood leukocytes were assessed 8 weeks later for the expression of the
indicated markers. (A) Human leukocytes are absent from mice that had been engrafted with
splenocytes. (B) Human cells do arise in mice that had received bone marrow grafts; a large
fraction of these cells expressed GFP. The size of the GFP+ fraction in these mice stayed stable
for at least 6 months after engraftment. Splenocyte recipients: representative data from at least 5
mice are shown. Bone marrow recipients: data from one of two engrafted mice are shown.
30-45% of all human cells (Figure 2.8B). These results confirmed that the replenishment of
GFP* cells in GB mice is likely due to bone marrow resident hematopoietic stem cells that had
been infected by lentivirus carrying GFP and Bcl-2.
2.3.8
In vivo stimulation of B cells in GB mice using TNP-LPS does not lead to increased
cell proliferation or antibody production
Because Bcl-2 is an inhibitor of apoptosis and does not normally induce proliferation, it
is perhaps not surprising that the overexpression of this factor alone is insufficient to cause the
kind of malignant B cell disease observed in follicular lymphoma. To determine whether an
additional proliferation signal would result in the transformation of these cells, GB mice were
immunized with trinitrophenyl conjugated to lipopolysaccharide (TNP-LPS) -4 months after
their initial engraftment with human cells. TNP-LPS is a B cell mitogen that induces polyclonal
B cell proliferation and T cell independent production of antibodies in wild-type mice (Jacobs
1975). Here, GB mice received intraperitoneal injections of either 100 tg TNP-LPS or PBS, and
boosted with an additional injection of TNP-LPS (or PBS) 3 weeks later. Each of the groups was
comprised of 5 mice. At the start of the experiment and 3 weeks after the booster injection,
peripheral blood from the GB mice was assessed for the percentage of human cells that were
CD 19+ B cells, the ratio of GFP* to GFP~ B cells, and the levels of activation markers CD21 and
CD23 expressed on B cells. In addition, levels of human IgM in the sera of GB mice were
determined via ELISA.
Contrary to expectation, however, TNP-LPS injections did not appear to have a
significant effect on B cells, as monitored by their numbers and activation phenotype in the
peripheral blood. In other words, though the B cell fraction in the blood changed in each of the
mice over the course of the experiment, no significant differences were found between the PBS-
treated and the TNP-LPS-treated group. Similarly, though some of the mice exhibited shifts in
the ratio of GFP* B cells to GFP~ ones, overall no statistically-significant trends were detected.
Likewise, no changes in B cell activation status (e.g. the levels of CD21 and CD23 expression)
were noted, in either the mice injected with PBS or those injected with TNP-LPS.
The concentrations of human IgM in GB mice, as determined after receiving 2 injections
of either PBS or TNP-LPS, remained low: <85 pg/ml in 4 of 5 mice that received PBS and <115
pg/ml in 4 of 5 mice that received TNP-LPS. Injections of TNP-LPS did not result in significant
changes in the concentration of human IgM in GB sera (data not shown). Finally, TNP-LPS
injections did not appear to affect the overall health of the mice, as indicated by their healthy
general appearance and by the fact that their post-injection survival was not significantly
different from that of mice that had received injections of PBS.
In summary, these results indicate that Bcl-2 overexpression in CD19+ cells leads to a
non-malignant hypertrophy of the overall B cell compartment. This was especially evident in the
spleen, where the accumulation of GFP* pro-B cells and a simultaneous decrease in % GFP*
naive B cells suggested a partial block in B cell development. Thus, since follicular lymphoma
arises from mature germinal center cells that bear surface immunoglobulin, GB mice are not an
accurate model of this disease.
2.3.9
Myc overexpression leads to a lack of GFP+ cells in the periphery
Unlike the anti-apoptotic factor Bcl-2, the Myc oncogene has a well-characterized role in
stimulating cell proliferation. Moreover, enforcing a B cell-specific expression of Myc offers an
opportunity to model Burkitt lymphoma, a B cell malignancy characterized by a dysregulation of
Myc expression.
Therefore, sublethally-irradiated NSG mice were engrafted with human
CD133+ cells that had been spin-infected with the GM lentivirus, which bears both GFP and Myc
under the control of the CD19 promoter.
Surprisingly, although human cells developed as usual in these mice, no GFP* cells were
detected, either in peripheral blood or in the bone marrow or the spleen. The same observations
were made when this experiment was repeated. Yet, in both cases, GFP* cells were detected in
mice engrafted with human cells derived from the same cord, but which had been spin-infected
with the G or the GB virus instead (Figure 2.9). The titer of the GM virus used here (3.9x 108
virions/ml) was higher than that of the GB virus (3.1 x 108 virions/ml), which argues against the
possibility that the GM virus had failed to infect human HSCs. This suggested that the GM virus
was integrating in the genomes of some human progenitor and/or stem cells, and that the
activation of the CD19 promoter in pro-B cells, and the consequent overproduction of Myc,
resulted in the death of these cells.
Nevertheless, a PCR assay failed to detect any GFP
sequences in whole bone marrow preparations from three GM mice (data not shown), leaving
open the possibility that GM virus was somehow unable to infect human cells.
GFP
GFP/Bcl-2
GFP/Myc
Figure 2.9
GFP* cells do not arise from HSCs that were spin infected with Myc-bearing
lentivirus. Sublethally irradiated adult NSG mice were engrafted with human CD133* cells that
had been spin-infected with a lentivirus in which the Ep/CD 19 promoter/enhancer combination
controlled the expression of GFP alone, GFP and Bcl-2, or GFP and Myc. Three months after
engraftment, peripheral blood leukocytes from G, GB, and GM mice were assessed for their
expression of GFP. All samples were gated on human CD45* cells; numbers indicate percent
cells in the gated region. Representative data from at least 5 mice are shown.
2.3.10 Overexpression of both Myc and Bcl-2 in CD19+ cells leads to rapidly-progressing
pro-B cell lymphocytosis
Coordinated overexpression of both Myc and Bcl-2 results in a rapid development of
aggressive leukemia in transgenic mice.
To determine the combined effect of these two
oncogenes in human B cells, sublethally irradiated NSG mice were engrafted with human
CD133* cells that had been spin-infected with a lentivirus in which the human CD19 promoter
controlled the expression of GFP as well as both the Myc and Bcl-2 oncogenes. Matched G and
GB mice were generated using CD133* cells from the same cord. When the peripheral blood of
these mice was assessed 4-6 weeks after engraftment, the proportion of human cells that were
GFP* was significantly higher in GMB mice than in either G or GB mice. In some of the GMB
mice, GFP+ cells constituted over half of the human cells in the periphery even at this early time
point (Figure 2.10); moreover, GFP* cells expanded rapidly, so that by ~8 weeks postengraftment, they constituted the majority of human cells in almost all GMB mice. As expected,
the levels of both Myc and Bcl-2 were much higher in GFP* cells from these mice, as compared
to human CD19+ B cells isolated from the buffy coat.
Because GFP expression in the GMB lentiviral construct was under the control of the
CD19 promoter, GFP* cells in these mice were expected to be of the B cell lineage. Indeed, that
was the case: GFP expression was not seen in CD19~ cells. The stage of development of the
GFP* B cells was determined using the same set of surface markers as described above. GFP*
cells were found to express CD 10, but not CD20 or IgM, which strongly suggested they were all
pro-B cells (Figure 2.11).
This was not the case with the few remaining GFP~ B cells, a
significant fraction of which expressed both CD20 and IgM (Figure 2.11).
The pro-B cell
staging of GFP+ cells was further confirmed when they were found to express the alpha subunit
......
...
A
6.3
~6.3
Human CD45
GFP
B
16.5
53
Human CD45
GFP
Figure 2.10 The majority of human cells in GMB mice expresses GFP. Sublethally
irradiated NSG mice were engrafted with human CD133* cells that had been spin-infected with
lentivirus carrying either GFP alone (A) or the combination of GFP and the Myc and Bcl-2
oncogenes (B). Five weeks after engraftment, PBMCs from these mice were analyzed for the
expression of murine and human CD45, as well as for GFP expression. GFP expression by
human cells is shown in panels on the right; murine cells did not express GFP. Numbers indicate
percent cells in the gated region. Representative data from at least 5 G and 5 GMB mice are
shown.
99.6
0
0.1
-
0
0.3
0.2
CD19
99.5
IL-7Ra
0.2
0.2
99.6
0.1
CD10
0.1
0,20.M
ID01
CD20
99.7
CD20
1gM
IgM
Figure 2.11 GFP* cells that arise in GMB mice are pro-B cells. Leukocytes were isolated
from the spleens of GMB mice that had been euthanized due to terminal illness and stained for
the indicated markers. All samples were gated on human CD45* cells, except those stained for
TdT and IL-7Ra, which were gated on GFP* cells. The numbers indicate percent cells in the
gated region. Representative data from one of at least 5 mice are shown.
of the interleukin 7 receptor (IL-7Ra), the expression of which rapidly declines as cells transition
from the pro-B cell to the pre-B cell stage (Blom and Spits 2006). Finally, GFP* cells were also
found to express Terminal deoxynucleotidyl Transferase (TdT), a key enzyme in V(D)J
recombination that is only expressed in pro-B cells (Blom and Spits 2006) (Figure 2.11).
Surface marker expression profile of the GFP* cells from GMB mice thus confirmed that they
were in the pro-B cell stage of development.
2.3.11 GMB cells are monoclonal or oligoclonal
To determine the clonality of the proliferating GFP* pro-B cells, their lentiviral insertion
sites were analyzed by Southern blotting (Figure 2.12). Genomic DNA from GFP* cells was
digested with either XbaI or BamHI: while the restriction sites for XbaI within the pLB2 vector
are all 5' of the GFP-encoding sequence, those for BamHI lie on either side of this sequence
(Figure 2.12A). Consequently, hybridization with
32 P-labeled
GFP probe of the XbaI digestion
products will result in the number of bands corresponding to the number of integration sites,
while hybridization of the BamHI digestion products will result in a single band, comprised of
the GFP sequence excised by BamHI from the lentiviral integrant. GFP* cells from 4 primary
GMB mice, derived from 3 independent experiments that utilized CD133+ cells from different
cords, were examined by Southern blotting (Figure 2.12B) In samples from 3 mice, numbered
108, 259, and 261, leukemic grafts appeared to be composed of a single clone, while in sample
from mouse number 530, 4 distinct clones were observed (Figure 2.12B). From these data, it
was concluded that the leukemias that arise in GMB mice are also likely to be monoclonal or
oligoclonal in nature.
...
.....
.....
- .......
. .....
.
.....
:.
--
--
--
Xbal
-I
5' LTR
BamHI
Xbal
BamHI
+
-
9.4 kb-
-9.4
kb
6.6 kb-
-6.6
kb
4.4 kb-
-4.4
kb
2.3 kb-
-2.3
kb
mouse#
108
259
261
530
Figure 2.12 GFP* cells that arise in GMB mice are monoclonal or oligoclonal. GFP* cells
were isolated from the spleens of 4 GMB mice that had been euthanized due to terminal illness;
these mice had been reconstituted in three independent experiments (i.e. using human CD133*
cells deriving from 3 different cord blood samples). Southern blotting was performed by
extracting genomic DNA from these cells and digesting overnight using XbaI and BamHI
restriction enzymes. (A) The locations of the restriction sites for these enzymes in the lentiviral
vector (flanked by the LTR regions) are shown relative to that of GFP and the oncogenes.
(B) Digested genomic DNA (10 ptg) was hybridized with 32 P-labeled cDNA probe specific to
eGFP; HindIl-digested lambda DNA served as molecular weight standards.
2.3.12 GMB mice are short-lived
Approximately 10 weeks after their initial engraftment with human cells, GMB mice
became increasingly frail, showing weight loss, tachypnea, and a decrease in physical activity.
Some of the mice also acquired pronounced hind limb paresis that progressed into paralysis.
Within a month of this time, most were declared moribund and had to be euthanized; in
comparison, G mice generated using CD133+ cells derived from the same cord lived significantly
longer (p < 0.01), surviving for at least an additional 12 weeks. (Figure 2.14).
Post-mortem dissection of GMB mice revealed overt splenomegaly (Figure 2.15:
compare the size of spleen crossections from A and E), as well as brittle bones filled with
marrow that was white instead of the usual red.
Interestingly, both the spleen and bones
exhibited green fluorescence under ultraviolet light.
Histological examination of the spleen revealed massive lymphoblastic infiltration, with
splenic architecture obliterated and numerous mitotic figures present throughout (Figure 2.15:
compare B and F). Lymphoblastic infiltration of organ parenchyma was also detected in the
liver, kidneys, testes, and lungs (Figure 2.15 and data not shown), though in these organs such
infiltration was less extensive. Lymphoblasts also infiltrated the mesenteries, though none were
seen in the small or large bowel (Figure 2.15G).
Bone marrow appeared to consist almost
entirely of lymphoblasts; the femoral cortical thickness appeared diminished as compared to wild
type mice, while the medullary cavity appeared enlarged. Lymphoblasts were also detected in
the meninges, though no invasion of the brain matter itself was seen. Mice suffering from hind
limb paralysis were found to have large fibrotic retroperitoneal masses that consisted of
lymphoblasts invading the underlying psoas and iliacus muscles (Figure 2.15H).
Finally, no lymphoblastic infiltrates were found in the skin or cardiac muscle of the mice.
.
.........
..
...
. ....
...
100
.
80 -
p <
,2
0.01
60 -
40 -
GFP (n =8)
-
a.20
GFP/Myc/BcI-2 (n=10)
-
0
0
20
40
60
80
100
120
Time (days post-engraftment)
Figure 2.14 Kaplan-Meier survival analysis of G and GMB mice. On day 0, sublethally
irradiated NSG mice were engrafted with human CD133* cells that had been spin-infected with
lentivirus carrying GFP alone or GFP with the Myc and Bcl-2 oncogenes; each mouse received
2.5 x106 cells. Mouse health was monitored throughout (first 120 days are shown); animals were
euthanized when declared moribund by veterinary technicians. Representative data from one of
3 independent experiments are shown; n indicates the number of mice in each group.
A
B
E
F
G
H
Figure 2.15 Lymphoblasts infiltrate numerous organs in GMB mice. Tissue sections from
the spleen of a G mouse (A, B) are shown in comparison to those from a GMB mouse (E, F).
Also shown are other tissues from the GMB mouse, showing infiltrations from human
lymphoblasts, including the kidney (C), brain (D), mesentery and gut (G), and the psoas muscle
(H). All samples were stained with hematoxylin and eosin. Samples in B, C, F, and G are
shown at 40x magnification; those in D and H, at lOx magnification. Black arrowheads point to
infiltrating lymphoblasts; white arrows point to mitotic figures present in the GMB spleen.
Representative data from one of at least 3 mice are shown.
2.3.13 Rapidly-expanding GFP* cells can be transplanted into secondary NSG mice
In order to determine whether GFP* cells from GMB mice are able to persist, and
possibly proliferate, after adoptive transfer, ~10 6 GFP* splenocytes or ~106 bone marrow cells
from these mice were injected into secondary, unirradiated NSG recipients. Secondary mice
succumbed to the same disease as the original donor mouse, with infiltration of various organs
with human pro-B cells. The lifespan of a secondary mouse was approximately 4 weeks after
receiving ~10 6 GFP* cells; lifespan was not affected by the organ of origin of the transplanted
GFP* cells.
2.4
Discussion
In this work, lentiviral vectors carrying human oncogenes under the control of a B cell-
specific promoter were used to transduce human hematopoietic stem cells (HSCs) undergoing in
vitro expansion. These cells were then engrafted into immunodeficient NOD-scidI12r< (NSG)
mice, and the enforced oncogene expression in B cells that derived from virally-infected HSCs
resulted in three distinct phenotypes, the nature of which depended on the oncogene
combination. Thus, overexpression of Bcl-2 alone led to an overall expansion of the oncogeneexpressing B cell population; in contrast, the overexpression of Myc alone resulted in a
disappearance of transgenic B cells. Finally, overexpression of both Myc and Bcl-2 led to a
rapid development of a disease that accurately recapitulates the development, progression, and
pathology of progenitor B cell acute lymphoblastic leukemia (pro-B ALL).
Perhaps the most widely used method of achieving the expression of two transgenes from
a single vector uses an internal ribosomal entry site (IRES) sequence to separate the two genes;
the mRNA comprising this sequence has been hypothesized to fold into a structure that mimics
that of ribosomal initiation factors, recruiting the ribosomal 40S subunit to bind and begin
translation in the middle of the mRNA. The gene located upstream of the IRES is translated in
the normal fashion, while the one located downstream of the IRES is translated by the ribosome
that had been recruited by the IRES. One disadvantage of using this method is that IRESmediated initiation is often inefficient, resulting in a greatly reduced expression of the
downstream transgene. Furthermore, IRES inclusion in a vector significantly reduces the titer of
the resulting virus (P. Stern, personal communication), possibly due to problems in packaging
RNA genomes containing the highly structured IRES sequence into viral capsids.
For these reasons, expression of multiple transgenes in this study was achieved by
separating them with the sequence encoding the foot-and-mouth disease virus-derived 2A
peptide.
The 2A sequence induces a ribosomal skip during translation, resulting in a
stoichiometric expression of transgenes separated by it. This permitted the construction of a
vector with the potential to encode for up to 3 transgenes, separated by two 2A sequences
(detailed in Figure 2.1). Such an approach is far superior to using several viruses at once: since
HSC infection efficiency rarely exceeded 10% in this study, the likelihood of transducing a cell
with three separate viruses would be -0.1%.
One of the genes used in this case was the GFP
reporter that facilitated the identification of cells expressing lentivirally-introduced genes;
however, if one of the transgenes is an exogenous surface protein, such as a cytokine receptor, a
surface immunoglobulin, or a T cell receptor, transduced cells can be identified by its surface
expression, obviating the need for another reporter. Finally, in cases where the expression of
three intracellular proteins is desired, a fourth reporter gene can still be included in the vector,
downstream of the multi-transgene sequence and separated from it by an IRES.
To monitor the effect of lentiviral infection per se on HSC engraftment, a virus carrying
only the GFP reporter gene was used. In all cases, the infection procedure appeared to reduce
the engraftment potential of HSCs, as evidenced by the lower rate of human cell reconstitution
achieved by using HSCs that had undergone infection (cf Figure 2.3 vs. Figure 1.2B).
The
infection procedure used in this work involves centrifugation of HSCs in the presence of
concentrated lentivirus (MOI of 10-20) and polybrene, a polymer that has been shown to
improve the efficiency of lentiviral infection (Blesch 2004).
All of these aspects of the
procedure are likely to induce cellular stress in HSCs, potentially impairing their pluripotency
and ability to xenoengraft; further optimizing the infection methodology is thus likely to improve
engraftment of infected cells. In particular, polybrene could be replaced with other compounds
that promote retroviral infection, but are less toxic; Retronectin, a synthetic fragment of human
fibronectin that binds and co-localizes target cells and viral particles, and protamine, a
polycationic agent that brings virus and cells closer together by an electrostatic effect, are
examples of such compounds. The duration and speed of the centrifugation, as well as the viral
concentration used in the infection could also be examined, in an effort to balance infection
efficiency and HSC survival.
In addition, lentiviral targeting to human HSCs could be improved.
The lentiviral
envelope protein used in this work, as in most other lentiviral transduction systems, was the
vesicular stomatitis virus G glycoprotein (VSVG), which allows vector concentration by
ultracentrifugation and enables the vector to target many cell types.
The rate of HSC
transduction possible with VSVG-pseudotyped vectors has not been very high, however, and the
cytotoxicity associated with VSVG limits both vector production and vector concentration that is
safe for target cells. Recent reports indicate that another pseudotype, RD 114, results in enhanced
transduction of human CD34* cells compared to VSVG; this pseudotype can also be
concentrated by ultracentrifugation, and, moreover, it can be produced by stable packaging cell
lines due to its decreased toxicity (Di Nunzio et al. 2007). Another intriguing strategy was
recently proposed by the Cosset group, which attained efficient lentiviral transduction of human
HSCs by engineering the vectors to display so-called early-acting cytokines, such as
thrombopoietin (TPO) and stem cell factor (SCF), on their surface (Verhoeyen et al. 2005).
Similarly, lentiviral targeting via expression of an antibody on the surface of the virus was
recently described (Yang et al. 2006); although in this case an anti-CD20 antibody was used to
target B cells, this method could be adapted to transducing HSCs using an anti-CD133 antibody.
Achieving higher transduction efficiency of human HSCs by any of these methods is likely to
reduce the need for high viral MOI during the infection, thereby improving HSC survival after
engraftment.
Although the infection procedure reduced the engraftment potential of human HSCs in
this study, they nevertheless gave rise to numerous mature leukocytes, including CD19* B cells,
CD3* T cells, and CD33* myeloid cells. Virally-introduced transgenes were expressed in a B
cell-specific manner, as confirmed by the observation that the expression of the GFP reporter
was confined to CD19* cells. This was expected, since transgene expression was under the
control of the combination of the Ep enhancer and the human B-cell specific CD19 promoter; as
previously described, the activity of this Ep.-CD 19 combination was tightly restricted to B cells.
It would be useful to analyze the clonality of GFP* cells that arise in G mice; because we know
the fraction of B cells that express GFP, the number of distinct HSCs contributing to this fraction
would let us calculate the total number of HSCs that give rise to human leukocytes in these mice.
Human B cells express CD 19 at a high level from the earliest stages of their development
(Blom and Spits 2006), leading to a similar pattern of transgene expression. When Myc was the
only oncogenic transgene in the lentiviral vector, no GFP+ (and thus Myc*) cells were observed,
either in the periphery or in the bone marrow. As described above, in addition to its function as
an oncogene, Myc has a well-documented role in the induction of apoptosis; moreover, a recent
study showed that apoptosis was the most likely outcome in cases of major Myc overexpression
(Murphy et al. 2008). Given that high titers of Myc-containing lentivirus were obtained, the
most likely explanation for the phenotype seen in these mice is thus a Myc-induced apoptosis of
CD19-expressing progenitor B cells that arise from virus-infected HSCs. A continuous presence
of Myc at low levels, however, stimulates proliferation instead of apoptosis (Murphy et al. 2008).
Therefore, a potential way to examine the oncogenic effects of Myc in human B cells in vivo
would be to decrease the power of the promoter controlling its expression, by using either the Et
enhancer or the CD 19 promoter, but not both.
Enforced expression of Bcl-2 alone, on the other hand, led to an overall expansion of the
B cell compartment, due to an accumulation of GFP* B cells in all stages of their development.
In the spleen, the relative proportion of GFP* B cell progenitors was larger than that of the
equivalent GFP~ cells, suggesting that Bcl-2 overexpression induced a partial block in B cell
development. Furthermore, GB cells did not appear to be malignant, as they failed to engraft or
expand in secondary hosts.
Notably, the phenotype of these humanized mice - B cell
hyperplasia without malignancy - was very similar to that of transgenic Ep-Bel-2 mice
(McDonnell et al. 1989). In Ep-Bcl-2 mice, lymphomagenesis required at least one additional
mutation in addition to the overexpression of Bcl-2, one that would promote cell proliferation on
top of the anti-apoptotic activity of Bcl-2. In the mice, such a mutation would occur with age,
after an average latency period of about 15 months; it is possible that a similar latency would be
observed in GB mice (in this study they were not observed for such long periods of time), though
human cells are likely to be more resistant to age-related mutagenesis than mouse ones, as
described by Rangarajan and Weinberg (2003).
Indeed, the nature of the additional mutation that occurs in follicular lymphoma, in which
the t(14;18) translocation results in an inappropriate Bcl-2 overexpression by germinal center B
cells, remains unknown. The fact that malignant follicular B cells are clonal, along with the
observation of the t(14;18) translocation in B cells of healthy individuals, suggests that the
lymphoma originates in one such t(14;18)* B cell becoming activated by an encounter with its
cognate antigen. Stimulation of B cell proliferation in the GB mice using TNP-LPS, however,
did not result in a malignant phenotype, though this may well be due to the same factors thought
to underlie the general inability of B cells that arise in humanized mice to proliferate or to secrete
immunoglobulins in response to an antigen challenge.
These factors include a potential
incompatibility of murine follicular dendritic cells (and other antigen presenting cells) and
human B cells, the relative rarity of CD4* helper T cells in humanized mice reconstituted as
adults, and the lack of human cytokines such as BAFF that normally support B cell responses.
Some of these problems are relatively simple to overcome: more T cells arise in mice
reconstituted as newborn pups (Ishikawa et al. 2005), for example, and NSG mice can be
induced to make human cytokines via hydrodynamic injection of plasmids that encode them
(Chen, Khoury, and Chen 2009). Other barriers, such as the incompatibility of some murine and
human cells that must cooperate in order for the immune response to occur, are more intractable
and may require further transgenesis of the NSG hosts.
On the other hand, the inability of Bcl-2 to transform B cells on its own presents an
opportunity to explore other human oncogenes or tumor suppressors that interact with Bcl-2.
This could be accomplished by further infecting GB cells growing in vitro using viruses carrying
other oncogenes; although efforts to culture GB cells have been unsuccessful so far, several
culture methods have not been tried, most notably co-culturing the GB cells with other human
(or murine) cells that might provide cytokine or growth factor support. Of course, the assured
way to induce a second hit is to place the sequence of another oncogene, or of a known inhibitor
of a tumor suppressor, on the same vector as Bcl-2. Conversely, the same strategy for examining
tumorigenic partners of Bcl-2 can also be applied to the case of Myc: other oncogenes or antiapoptotic factors could be cloned into the same vector as Myc, with the emrgence of leukemia
serving as the readout of molecular cooperation.
Indeed, when the two oncogenes were combined on the same vector, GMB, the results
were striking: a rapid development of an aggressive disease that closely resembled human
progenitor B cell ALL.
The strong anti-apoptotic activity of Bcl-2 likely rescued B cells
developing from virally-transduced HSCs from Myc-induced programmed cell death; other
aspects of Myc function then led to the development of the aggressive disease. Perhaps not
surprisingly, the GMB model also resembled the highly aggressive leukemia/lymphoma that
arises in Ep.-Myc/Bcl-2 double transgenic mice, first described by Strasser et al. (1990). In that
model, the animals became ill at 5-6 weeks of age, and died soon thereafter; the cause of death
was revealed to be disseminated malignant lymphoma/leukemia.
However, there are also important differences between the murine and the human models.
Unlike GMB cells described here, leukemic cells in Ep-Myc/Bcl-2 mice did not express TdT,
nor did they show any evidence of V(D)J recombination, such as rearrangements of T cell
receptor or immunoglobulin genes. Thus, tumor clonality could not be established. In contrast,
GMB cells were TdT*, indicating they originated from a somewhat later stage in B cell
development.
Because the model was generated using a lentiviral infection, tumor clonality
could also be determined by analyzing the sites of viral integration into the genome. The tumor
in 3 of the 4 mice examined here was dominated by a single clone. Yet, the fact that as many as
4 clones were visible in one of the samples, as well as the fact that the emergence of overt
leukemia in GMB mice is rapid and reliable, argues against the need for additional mutations for
human B cell transformation.
In addition, the presence of 4 clones suggests that the
monoclonality in the other mice could have been only apparent, perhaps due to an emergence in
vivo of one particularly well-adapted or highly-proliferating clone.
These improvements in
adaptation or increases in the rate of tumor cell proliferation could be the result of additional
mutations; however, such additional mutations are not required for the initial transformation.
Indeed, Dick and colleagues made a similar observation in their humanized mouse models of
leukemias caused by MLL fusion partners: all were monoclonal or oligoclonal. In some cases,
tumor clonality changed after secondary transplantation, indicating the presence of a minor clone
that was below detection level in the transplant, but that emerged, perhaps by acquiring
additional mutations, in the secondary host (Barabe et al. 2007).
It would be informative to
perform a similar study with the GMB cells, examining if any changes to tumor clonality occur
in secondary hosts or as a result of prolonged in vitro culture of the leukemic cells. Ultimate
emergence of a single clone in GMB mice implies that additional potentiating mutations may
have been acquired by the leukemic cells in the course of the disease. The observation that in
some (but not in all) cases GMB mice acquire hind limb paralysis, and develop characteristic
spinal tumors, further supports the notion of such additional mutations and their importance in
cancer development and progression. The nature of these mutations remains to be identified.
Despite the high potential of Myc and Bcl-2 to cooperate and cause aggressive disease,
their concurrent dysregulation in human disease is quite rare. As discussed above, translocations
involving Myc or Bcl-2, individually, are characteristic of Burkitt lymphoma (BL) and follicular
lymphoma (FL), respectively, both of which are rather common; similar translocations are found
in 25-45% of cases of diffuse large B cell lymphoma (DLBCL). However, only about 200 cases
have ever been described where Myc and Bcl-2 are overexpressed at the same time, usually in
small-scale studies or case reports involving a few patients at a time; this literature was recently
reviewed by Snuderl et al. (2010). The authors show that while some of patients suffering from
this so-called "double-hit lymphoma" (DHL) had had a pre-existing case of FL, in most DHL
emerged as a de novo disease. In most cases, DHL cells expressed CD10, CD20, and surface
immunoglobulin concurrently, strongly suggesting that an immature B cell was the source of the
tumor. Notably, DHL patients had a higher incidence of bone marrow or central nervous system
involvement than patients suffering from either BL or DLBCL, similar to the GMB model and its
secondary transplants, in which GFP+ leukemic cells home to the bone marrow initially, and
seed the periphery only later (see below). Finally, DHL is highly aggressive and highly resistant
to therapy, leading to an overall survival of only 4.5 months (Snuderl et al. 2010).
Thus, the disease that arises in GMB mice has significant resemblance to pro-B ALL, and
may also serve as a model of DHL, especially its ability to involve the bone marrow and the
central nervous system.
These resemblances, and the human nature of the GMB leukemia,
suggests that this disease model can be used in ways that its purely murine models cannot,
namely for screening and evaluation of human-specific cancer treatments. One such class of
anti-neoplastics that is increasingly prevalent in the clinic consists of monoclonal antibodies
directed against human tumor cell antigens. These antibodies are human-specific almost by
definition, and their efficacy or mechanism of action cannot be assessed in purely murine
models. Therefore, in the next phase of this project, the suitability of GMB mice for use as a
pre-clinical model of ALL for testing the efficacy of human-specific monoclonal antibodies was
examined.
2.5
Materials and Methods
2.5.1
Lentiviral vector design and preparation
All lentiviral constructs used in this work were based on the self-inactivating pLB2
vector kindly provided by Dr. Patrick Stem (Stem et al. 2008). This vector was subsequently
modified as follows: first, the sequence between Anti-Repressor #40 and the Woodchuck
hepatitis virus Post-transcriptional Regulatory Element (WPRE) was excised using restriction
enzymes XbaI and PmeI, and replaced with a DNA sequence that contained the restriction sites
for several other enzymes, including (in 5' to 3' order) NheI, AgeI, and NotI. Notably, these sites
were absent in the original pLB2 vector; insertion of the DNA strand containing these sites was
verified by restriction digestion.
Four constructs containing various combinations of the enhanced green fluorescent
protein (EGFP) reporter transgene and the c-Myc and Bcl-2 oncogenes were first assembled in
the pEGFP-N1 "shuttle" vector (ClonTech; GenBank accession number U55762).
constructs are eGFP, eGFP-Bcl-2, eGFP-Myc, and eGFP-Myc-Bcl-2.
These
In the case of the
multicistronic constructs, sequences encoding eGFP and either of the oncogenes were separated
from one another by a foot-and-mouth disease virus-derived 2A peptide sequence, which induces
a ribosomal skip during translation and results in a stoichiometric production of several proteins
from a single mRNA (Donnelly, Luke, et al. 2001; Donnelly, Hughes, et al. 2001).
First, most of the shuttle vector's multiple cloning site (MCS) was excised by restriction
digestion with BglII and BamHI; the resulting complementary ends were re-annealed, so that
only a single AgeI site immediately upstream of eGFP was retained. The shuttle vector's eGFP
was then replaced with an eGFP-2A fusion kindly provided by Dr. Patrick Stem; this was
inserted between the retained 5' AgeI site and the 3' NotI site.
Notably, the 3'-most 6
nucleotides of the 2A peptide sequence constitute an ApaI restriction site. The modified eGFP(2A) shuttle vector thus contained three unique restriction sites: an AgeI site immediately
upstream of eGFP, an ApaI site at the very 3' end of the 2A sequence, and a NotI site
downstream of the ApaI site.
The eGFP-(2A)-Myc construct was generated as follows. First, a mutant Myc allele
commonly observed in Burkitt's lymphoma (T58A, a kind gift of Dr. Michael Hemann (Hemann
et al. 2005)) was amplified by PCR methods using the following primers: (Agel-Apal-MYC)
5'CTTCACC-GGTGGGCCCCTCAACGTTAGCTTCACC (ApaI restriction site is underlined)
and
(MYC-NotI)
5'CTTCGCGGCCGCTTACGCACAAGAGTT-CCGTAGCTG
(NotI
restriction site is underlined). The amplified gene was then gel-purified and inserted between the
ApaI and the NotI site of the modified eGFP-(2A) shuttle vector; the sequence of PCR-amplified
Myc was subsequently verified by the Koch Institute core sequencing facility.
The eGFP-(2A)-Bcl-2 construct was generated in a similar fashion. First, human Bcl-2
(Open Biosystems) was amplified by PCR methods using the following primers: (ApaI-BCL-2)
5'CTTCGGGCCCATGGCGCACGCTGGGAGAACAG (ApaI restriction site is underlined) and
(BCL-2-NotI) 5'CTTCGCGGCCGCTCACTTGTGGCCCAGATAG (NotI restriction site is
underlined). The amplified gene was then gel-purified and inserted between the ApaI and the
NotI site of the modified eGFP-(2A) shuttle vector; the sequence of PCR-amplified Bcl-2 was
subsequently verified by the Koch Institute core sequencing facility.
To generate the eGFP-(2A)-Myc-(2A)-Bcl-2 construct, a Myc-2A fusion was inserted
between eGFP-(2A) and Bcl-2 in the eGFP-(2A)-Bcl-2 construct. To generate the Myc-(2A)
fusion, eGFP within the modified eGFP-(2A) shuttle vector was replaced with Myc. This was
done by first excising eGFP using the restriction enzymes AgeI and BsrGI; the BsrGI restriction
site is located only two base pairs upstream of the 2A sequence. The T58A Myc (see above) was
then amplified using the following primers: (Agel-Apal-MYC, as above) 5'CTTCACCGGTGGGCCCCTCAACGTTAGCTTCACC (Agel restriction site in bold italics, ApaI restriction site
is underlined) and (MYC-BsrGI) 5'CTTCTGTACACCGCACAAGAGTTCCGTAGCTG (BsrGI
restriction site is underlined). The amplified gene was gel-purified and inserted into the shuttle
vector from which eGFP had been excised, immediately upstream of the 2A sequence. The
sequence of PCR-amplified Myc was subsequently verified by the Koch Institute core
sequencing facility. Note that the resulting Myc-2A fusion is flanked by two ApaI restriction
sites; therefore, it was subsequently possible to insert this fusion into the unique ApaI site in the
eGFP-(2A)-Bcl-2 construct. Correct orientation of Myc in the resulting eGFP-(2A)-Myc-(2A)Bcl-2 construct was verified by restriction digestion.
The four constructs thus generated, namely eGFP-(2A), eGFP-(2A)-Myc, eGFP-(2A)Bcl-2, and eGFP-(2A)-Myc-(2A)-Bcl-2 (referred to below by the shorthand GFP, GFP/Myc,
GFP/Bcl-2, and GFP/Myc/Bcl-2, respectively), were then transferred from the shuttle vector into
the modified pLB2 vector, using the restriction enzymes AgeI and NotI.
Subsequently, promoter sequences were inserted between the 5' NheI and the 3' AgeI
sites immediately upstream of each of the four GFP-oncogene constructs in the pLB2 vectors.
The ubiquitous EFlc promoter, comprised of nucleotides 125 to 1565 of the human
elongation factor EF 1a (GenBank accession number J04617; kind gift of Dr. Patrick Stem), was
amplified by PCR methods using the following primers: (NheI-BamHI-EFla) 5'CTTCGCTAGCCTTCGGATCCCTTTGGAGCTAAGCCAGC (NheI restriction site is underlined) and
(EFla-Agel) 5'CTTCACCGGTAGTTTTCACGACACCTGAAATG (Agel restriction site is
underlined). The amplified promoter sequence was then gel-purified and inserted between the
NheI and the AgeI site of each of the four pLB2-GFP/oncogene vectors; the sequence of the
PCR-amplified EFla promoter was subsequently verified by the Koch Institute core sequencing
facility.
The B cell-specific enhancer-promoter construct EL19 was a kind gift of Dr. Cecile
Tonnelle; this construct consisted of a fusion of the murine enhancer construct Ept-MARs and the
human CD19 promoter, previously described by the Tonnelle group (Moreau et al. 2008). The
EL19 construct was amplified by PCR methods using the following primers: (EL19 fwd [NheI])
5'CTTCGCTAGC-TAGAGAGGTCTGGTGGAG
(EL19 rev [Agel])
(NheI restriction site is underlined) and
5'CTTTACCGGTGGTGGTCAGACTCTCC (Agel restriction site is
underlined). The amplified promoter sequence was then gel-purified and inserted between the
NheI and the AgeI site of each of the four pLB2-GFP/oncogene vectors; the sequence of PCRamplified Epi-MAR/CD19 promoter was subsequently verified by the Koch Institute core
sequencing facility.
2.5.2
Cell lines
Human embryonic kidney-derived 293FT cells (Invitrogen) were cultured in Dulbecco's
Modified Eagle Medium (Koch Institute core media facility) supplemented with 10% v/v Fetal
Bovine Serum (HyClone), 10mM HEPES, 2mM L-glutamine, 100 U/ml Penicillin and 100
ptg/ml Streptomycin (all from Mediatech). 293FT cells were split 1:4 or 1:8 every 2-3 days,
which maintained them at below ~90% confluence.
Raji cells (a kind gift of Dr. Shiv Pillai) were cultured in RPMI 1640 medium (Koch
Institute core media facility) supplemented with 10% v/v Fetal Bovine Serum, 10mM HEPES
buffer, 1 mM Sodium Pyruvate, 2mM L-glutamine,
100 U/ml Penicillin, 100 pg/ml
Streptomycin (all from Mediatech), and 0.1% v/v 2-mercaptoethanol (Sigma). Cell density was
maintained at < 106 cells/ml.
All cells were maintained in a humidified incubator at 37*C with 5% CO2.
2.5.3
Lentivirus production and titration
Lentiviral particles were produced by transient transfection of 293FT cells with three
plasmids: the pLB2 lentiviral backbone modified with promoters and oncogenes as described
above, the packaging plasmid (pCMVAR8.9, or pA8.9) containing lentivirus structural proteins
(Zufferey et al. 1997), and the pMD.G plasmid containing the vesicular stomatitis virus envelope
protein (VSVG) (Naldini et al. 1996).
Plasmids were transformed into Alpha-Select Gold
Efficiency chemically competent cells (BioLine), which were then grown at 32*C to avoid
lentiviral vector internal recombination. Plasmid DNA was then purified using a Plasmid Maxi
Kit (Qiagen). Near-confluent 293FT cells were transfected in T175 flasks (BD Falcon) using the
TransIT-LT1 transfection reagent (Mirus) according to the manufacturer's instructions. Cell
culture medium containing a mixture of DNA and the transfection reagent was replaced with
fresh medium 18-24 hours post-transfection; lentiviral supernatant was collected approximately
at various points after media change, filtered through 0.45pm filters (Pall), and concentrated by
ultracentrifugation at 25,000xg for 90 minutes (Beckman Coulter Ultracentrifuge). Concentrated
virus was resuspended by overnight incubation in StemSpan medium (StemCell Technologies) at
4*C, then aliquoted and stored at -80*C until immediately prior to use.
The titer of each batch of virus was determined by transducing either 293FT cells or Raji
cells with serial dilutions of concentrated virus in the presence of 4 pg/ml polybrene (American
Bioanalytical) and measuring GFP expression after 3 days by flow cytometry. Viral titer was
calculated by multiplying the number of Raji cells at the time of virus addition, the percentage of
Raji cells expressing GFP, and the corresponding viral dilution. Viral titers usually ranged from
1x10 8/ml to 5x10'/ml.
All work involving oncogene-bearing lentivirus was conducted in the BL2+ facilities of
the Koch Institute, in agreement with the appropriate guidelines of the MIT Environment,
Health, and Safety Office.
2.5.4
Isolation and expansion of human CD133* cells
Purified CD133* human umbilical cord hematopoietic stem cells (HSCs) were purchased
from AllCells or from the National Disease Research Interchange (NDRI).
Alternatively,
CD133* cells were purified from fresh umbilical cord blood purchased from NDRI, as follows.
First, umbilical cord blood was incubated with RosetteSep CD3 and Granulocyte depletion
cocktails (StemCell Technologies) for 20 minutes at room temperature. The blood was then
layered on top of Ficoll-Hypaque (Amersham Biosciences), and centrifuged at 1000xg for 30
minutes at 25*C, so that erythrocytes, now bound to granulocytes and CD3* cells, passed through
the Ficoll-Hypaque, while the rest of the leukocytes remained above it. After this leukocytecontaining layer was collected, the residual erythrocytes were eliminated using the ACK Lysing
buffer (Gibco), and CD133* cells were purified from the remaining leukocytes using a
combination of Phycoerythrin (PE)-conjugated antibody to human CD133 (Miltenyi) and the
EasySep PE Selection Kit (Stem Cell Technologies), according to the manufacturers' protocols.
Isolated human CD133* cells were cultured as reported previously (Zhang et al. 2008),
using StemSpan media (StemCell Technologies) supplemented with human growth factors: 10
ng/ml FGF-1 (Invitrogen), 20 ng/ml SCF, 10 ng/ml TPO, 100 ng/ml IGFBP2 (all from R&D
systems), 10 pig/ml of heparin (Sigma), 500 ng/ml Angiopoietin-like protein 5 (Abnova), 100
U/ml Penicillin, and 100 ptg/ml Streptomycin (Mediatech).
cells were resuspended at 5x1
4 cells/ml
Briefly, freshly-isolated CD133*
in growth factor-supplemented StemSpan and placed in
a 96-well round-bottom plate (Coming) at 104 cells/well. Two days later, cells were transferred
into a 6-well plate (Coming). Higher rate of HSC expansion were observed in Coming multiwell
plates (Adam Drake, personal communication); therefore only Coming multiwall plates were
used here. More media was added to the cells one day after transfer to keep their density below
2x 105 cells/ml, and also 3-4 days after the transfer to keep their density below 7x 105 cells/ml.
2.5.5
Lentiviral infection of human CD133*cells
Approximately 9 days after their initial purification, in vitro-expanded CD133* cells were
re-isolated from the expansion culture using a combination of Allophycocyanin (APC)conjugated anti-human CD133 antibody (Miltenyi) and the EasySep APC Selection Kit (Stem
Cell Technologies), according to the manufacturers' protocols. These cells were then diluted to
1-5 x 105 cells/ml in growth factor-supplemented StemSpan media containing 4 pg/ml polybrene.
Concentrated lentivirus was added to the cells, such that the multiplicity of infection (MOI) was
10-20. The mixture of cells and lentivirus was then plated in 96-well U-bottom plates (Coming)
at 100 pl/well and centrifuged at 1000xg for 2 hours at 25*C. After the spin, the plates were
cultured for 12-18 hours in a humidified incubator at 37*C with 5% C0 2 ; the media was then
replaced with fresh growth factor-supplemented StemSpan media. The plates were then cultured
for an additional 24 hours, after which the cells were pooled, washed 3-4 times in 5ml of
StemSpan media and counted. The percentage of CD133* cells among the cells that had been
exposed to lentivirus was then determined by flow cytometry.
2.5.6
Mice
NOD-scid Il2r< (NSG) mice were obtained from the Jackson Laboratory and bred in the
MIT animal facility. Mice were housed in autoclaved cages, given autoclaved food and water,
with the water being further supplemented with Sulfamethoxazole and Trimethoprim (Hi-Tech
Pharmacal). All animal use was in accordance with the guidelines of the MIT Committee on
Animal Care.
2.5.7
Engraftment of mice with human CD133* cells
Adult NSG mice 8-12 weeks of age were irradiated with 2.7 Gy from a 137Cs source
(Gammacell 40, Atomic Energy of Canada), as described previously (Giassi et al. 2008). Within
1-3 hours of being irradiated, mice were injected via a lateral tail vein with 2.5-5x10 5 CD133*
cells that had been exposed to lentivirus, resuspended in a 100 pil of StemSpan.
Secondary mice - mice engrafted with expanded populations of GFP* cells - were
generated as follows. NSG mice that had been engrafted with human HSCs transduced with
lentivirus bearing either the GFP/Bcl-2 or the GFP/Myc/Bcl-2 construct were euthanized, and
human CD19* cells were purified from their spleens and bone marrows using a combination of
APC-conjugated antibody to human CD19 (BioLegend) and the EasySep APC Selection Kit
(Stem Cell Technologies), according to the manufacturers' protocols. After determining the
proportion of purified cells that was GFP*, the purified cells were resuspended in StemSpan
media and injected into adult NSG mice 8-12 weeks of age via a lateral tail vein.
2.5.8
Human cell chimerism in mice engrafted with human CD133* cells
Human leukocytes express the human variant of the common leukocyte antigen CD45
(hCD45), while leukocytes in NSG mice express the murine variant of this antigen (mCD45.1).
Therefore, human chimerism in reconstituted mice was defined as follows:
Human cell ch~merism =
2.5.9
hCD45+ cells
%
el
%hD5
(% hCD45+ cells) + (% mCD45.1+ cells)
Tissue preparation, antibodies, and flow cytometry
At various time points following injection of NSG recipients with human cells, mice were
euthanized by CO 2 asphyxiation, and their blood, bone marrow, liver, spleen, and brain were
harvested. Marrow was flushed from the bones and cell suspensions were prepared by passing
extracted marrow through a syringe with a 27 gauge needle. Prior to extraction from euthanized
mice, livers were flushed with sterile PBS; after extraction they were ground using a Bellco 85
ml tissue sieve kit (Bellco Glass). Ground liver fragments were then incubated with 2 pg/ml
collagenase A (Roche) for 1 hour at 37*C, and leukocytes were isolated by centrifugation on a
discontinuous 35% Percoll gradient (GE Healthcare). Leukocytes from the spleen were obtained
by grinding it between frosted glass slides and filtering through 70 [tm nylon mesh filters (BD
Falcon). Residual erythrocytes in all samples were lysed, and cells were counted. Antibodies to
human CD3, CD1O, CD19, CD20, CD33, CD34, CD45, CD127 (IL-7Ra), IgM and to murine
98
CD45.1, as well as appropriate isotype controls, were conjugated to FITC, PE, PerCP/Cy5.5,
APC, PE/Cy7 or APC/Cy7 (all from BioLegend). PE- and APC-conjugated antibodies to human
CD133 antibody were from Miltenyi.
PE-conjugated antibodies to human Terminal
deoxynucleotidyl Transferase (TdT) and the appropriate isotype control were from BD
Pharmingen. Cells were stained with indicated antibodies in PBS containing 0.1% w/v bovine
serum albumin (Sigma).
Stained cells were analyzed using the C6 flow cytometer (Accuri
Cytometers), or the FACSCalibur, FACSCanto or LSR II flow cytometers (BD Biosciences) in
the Koch Institute flow cytometry core facility. Dead cells were excluded from analysis by DAPI
or propidium iodide staining. Flow cytometry results were analyzed using the CFlow (Accuri
Cytometers), FACSDiva (BD Biosciences), or FlowJo (Tree Star) software suites.
2.5.10 Histology
Samples of various murine internal organs, including spleen, lymph nodes, liver, kidneys,
lung, gut, brain, testes, skeletal muscle, and tumor masses, were microdissected from mice,
incubated in a 10% formalin solution overnight, and then preserved in a 70% ethanol solution
until processing. Whole bone (femur) samples were microdissected from mice, incubated in a
10% formalin solution overnight, and then transferred into a decalcification solution (10% w/v
disodium ethylenediaminetetraacetate (EDTA), pH ~6.6) for approximately 15 days. Following
decalcification, bone samples were preserved in a 70% ethanol solution until processing.
Finally, smears of peripheral blood and freshly-extracted bone marrow were obtained and air
dried prior to processing.
Processing of these samples, including embedding organ samples in paraffin, obtaining 5
tm-thick sections of the embedded organs, and staining samples with the hematoxylin and eosin
(H&E) stain was performed by the Koch Institute core histology facility. Dr. Roderick Bronson
assisted with the analysis of the stained histological samples.
2.5.11 Protein expression analysis
Levels of Myc and Bcl-2 expression in GFP* cells isolated from G, GB, and GMB mice,
as well as in control CD19* B cells isolated from cord blood, were determined by Western blot.
Myc was detected using the sc-40 antibody (clone 9E 10), while Bcl-2 was detected using the sc509 antibody (clone 100); HRP-conjugated goat anti-mouse polyclonal secondary antibodies
were used (all antibodies for Western blots from Santa Cruz Biotechnology).
2.5.12 In vivo stimulation of B cells
To stimulate human B cells in a T-cell independent manner, GB mice received
intraperitoneal injections of trinitrophenyl conjugated to lipopolysaccharide (TNP-LPS;
Biosearch Laboratories). Each mouse received 100 ptg of TNP-LPS, dissolved in sterile PBS at 1
mg/ml; control mice were injected with PBS alone. Three weeks later, mice received booster
shots of TNP-LPS (or PBS).
Three weeks following booster shot administration, the concentration of human IgM in
the mouse sera was measured using the Human IgM ELISA kit (Bethyl Laboratories). Serum
samples were diluted 125-fold; a standard curve was generated using known concentrations of
human IgM. Culture plates containing the samples were read at 450nm in a VersaMax tunable
microplate spectrophotometer (Molecular Devices).
100
2.5.13 Clonal analysis
Genomic DNA was extracted from GFP* cells using the GenElute Mammalian Genomic
DNA Miniprep kit (Sigma). Purified genomic DNA (10 pg) was digested overnight at 37*C
with XbaI or BamHI (New England BioLabs). Digested DNA was run on 0.8% agarose gel, with
the HindIll digest of lambda DNA (New England BioLabs) serving as molecular weight
standards, and then transferred to a nylon membrane using standard procedures. Clonality at the
level of lentiviral insertion was determined by hybridization with a
32 P-labeled
GFP probe
prepared by random priming using the Amersham Megaprime DNA Labeling System kit (GE
Healthcare).
101
2.6
References
Adams, J.M., A.W. Harris, C.A. Pinkert, L.M. Corcoran, W.S. Alexander, S. Cory, R.D.
Palmiter, and R.L. Brinster. 1985. The c-myc oncogene driven by immunoglobulin enhancers
induces lymphoid malignancy in transgenic mice. Nature 318: 533-8.
Anderson, J.L., and T.J. Hope. 2005. Intracellular trafficking of retroviral vectors:
obstacles and advances. Gene Therapy 12: 1667-78.
Aster, J.C. 2005. Diseases of the White Blood Cells, Lymph Nodes, Spleen, and Thymus.
In: Robbins and Cotran PathologicBasis ofDisease. AK Abbas, N Fausto, and V Kumar. 7th
ed. Philadelphia, PA: Elsevier, Inc.
Banerji, J., L. Olson, and W. Schaffner. 1983. A Lymphocyte-Specific Cellular Enhancer
Is Located Downstream of the Joining Region in lmmunoglobulin Heavy Chain Genes. Cell 33:
729-40.
Barab6, F., J.A. Kennedy, K.J. Hope, and J.E. Dick. 2007. Modeling the initiation and
progression of human acute leukemia in mice. Science 316, no. 5824: 600-4.
Baum, C., A. Schambach, J. Bohne, and M. Galla. 2006. Retrovirus vectors: toward the
plentivirus?. Molecular therapy 13, no. 6: 1050-63. doi:. .
Blesch, A. 2004. Lentiviral and MLV based retroviral vectors for ex vivo and in vivo
gene transfer. Methods 33, no. 2: 164-72.
Blom, B., and H. Spits. 2006. Development of human lymphoid cells. Annual Review of
Immunology 24: 287-320.
Brenner, S., and H.L. Malech. 2003. Current developments in the design of oncoretrovirus and lentivirus vector systems for hematopoietic cell gene therapy. Biochimica et
Biophysica Acta (BBA) - Molecular Cell Research 1640, no. 1: 1-24.
Buske, C., M. Feuring-Buske, J. Antonchuk, P. Rosten, D.E. Hogge, C.J. Eaves, and R.K.
Humphries. 2001. Overexpression of HOXA10 perturbs human lymphomyelopoiesis in vitro and
in vivo. Blood 97, no. 8: 2286-92.
Basecke, J., M. Schwieger, F. Griesinger, B. Schiedlmeier, G. Wulf, L. TrUmper, and C.
Stocking. 2005. AML1/ETO promotes the maintenance of early hematopoietic progenitors in
NOD/SCID mice but does not abrogate their lineage specific differentiation. Leukemia &
Lymphoma 46, no. 2: 265-72.
Chalandon, Y., X. Jiang, 0. Christ, S. Loutet, E. Thanopoulou, A. Eaves, and C. Eaves.
2005. BCR-ABL-transduced human cord blood cells produce abnormal populations in
immunodeficient mice. Leukemia 19, no. 3: 442-8.
102
Chen, Q., M. Khoury, and J. Chen. 2009. Expression of human cytokines dramatically
improves reconstitution of specific human-blood lineage cells in humanized mice. Proceedings
of the NationalAcademy of Sciences of the United States ofAmerica,106, no. 51: 21783-8.
Chipuk, J.E., T. Moldoveanu, F. Llambi, M.J. Parsons, and D.R. Green. 2010. The BCL2 family reunion. Molecular Cell 37, no. 3: 299-3 10.
Chung, K.Y., G. Morrone, J.J. Schuringa, B. Wong, D.C. Dom, and M.A.S. Moore. 2005.
Enforced expression of an Flt3 internal tandem duplication in human CD34+ cells confers
properties of self-renewal and enhanced erythropoiesis. Blood 105, no. 1: 77-84.
Chung, K.Y., G. Morrone, J.J. Schuringa, M. Plasilova, J.-H. Shieh, Y. Zhang, P. Zhou,
Moore. 2006. Enforced expression of NUP98-HOXA9 in human CD34(+) cells
M.A.S.
and
enhances stem cell proliferation. Cancer Research 66, no. 24: 11781-91.
De Noronha, C., M.P. Sherman, H.W. Lin, M.V. Cavrois, R.D. Moir, R.D. Goldman, and
W.C. Greene. 2001. Dynamic disruptions in nuclear envelope architecture and integrity induced
by HIV-1 Vpr. Science 294, no. 5544: 1105-8.
Di Nunzio, F., B. Piovani, F.-L. Cosset, F. Mavilio, and A. Stornaiuolo. 2007.
Transduction of human hematopoietic stem cells by lentiviral vectors pseudotyped with the
RD1 14-TR chimeric envelope glycoprotein. Human Gene Therapy 18, no. 9: 811-20.
Dick, J.E., M.C. Magli, D. Huszar, R.A. Phillips, and A. Bernstein. 1985. Introduction of
a selectable gene into primitive stem cells capable of long-term reconstitution of the hemopoietic
system of W/Wv mice. Cell 42, no. August: 71-9.
Donnelly, M L, G Luke, A Mehrotra, X Li, L E Hughes, D Gani, and M D Ryan. 2001.
Analysis of the aphthovirus 2A/2B polyprotein 'cleavage' mechanism indicates not a proteolytic
reaction, but a novel translational effect: a putative ribosomal 'skip'. Journalof General Virology
82, no. Pt 5: 1013-25.
Donnelly, M L, L E Hughes, G Luke, H Mendoza, E ten Dam, D Gani, and M D Ryan.
2001. The 'cleavage' activities of foot-and-mouth disease virus 2A site-directed mutants and
naturally occurring '2A-like' sequences. Journalof General Virology 82, no. Pt 5: 1027-41.
Drake, A.C., M. Khoury, I. Leskov, B.P. Iliopoulou, M. Fragoso, H. Lodish, and J. Chen.
Robust Reconstitution of Adult NOD-scid Il2rg-/- (NSG) Mice with In Vitro Expanded Human
CD34+ CD 133+ Hematopoietic Stem Cells. Manuscriptsubmitted.
Fanidi, A., E.A. Harrington, and G.I. Evan. 1992. Cooperative interaction between c-myc
and bcl-2 proto-oncogenes. Nature 359: 554-6.
Forrester, W.C., C. van Genderen, T. Jenuwein, and R. Grosschedl. 1994. Dependence of
enhancer-mediated transcription of the immunoglobulin mu gene on nuclear matrix attachment
regions. Science 265, no. 5176: 1221-5.
103
Gallay, P., T. Hope, D. Chin, and D. Trono. 1997. HIV-1 infection of nondividing cells
through the recognition of integrase by the importin/karyopherin pathway. Proceedings of the
NationalAcademy of Sciences of the United States ofAmerica 94: 9825-30.
Giassi, L.J., T. Pearson, L.D. Shultz, J. Laning, K. Biber, M. Kraus, B.A. Woda, et al.
2008. Expanded CD34+ human umbilical cord blood cells generate multiple
lymphohematopoietic lineages in NOD-scid IL2rgamma(null) mice. ExperimentalBiology and
Medicine 233, no. 8: 997-1012.
Gillies, S.D., S.L. Morrison, V.T. Oi, and S. Tonegawa. 1983. A Tissue-specific
Transcription Enhancer Element Is Located in the Major lntron of a Rearranged lmmunoglobulin
Heavy Chain Gene. Cell 33: 717-28.
Hemann, M.T., A. Bric, J. Teruya-Feldstein, A. Herbst, J.A. Nilsson, C. Cordon-Cardo,
J.L. Cleveland, W.P. Tansey, and S.W. Lowe. 2005. Evasion of the p53 tumour surveillance
network by tumour-derived MYC mutants. Nature 436: 807-11.
Ishikawa, F., M. Yasukawa, B. Lyons, S. Yoshida, T. Miyamoto, G. Yoshimoto, T.
Watanabe, K. Akashi, L.D. Shultz, and M. Harada. 2005. Development of functional human
blood and immune systems in NOD/SCID/IL2 receptor gamma chain-null mice. Blood 106, no.
5: 1565-73.
Jacobs, D M. 1975. Structural and genetic basis of the in vivo immune response to TNPLPS. JournalofImmunology 115, no. 4: 988-92.
Jenuwein, T., W.C. Forrester, L.A. Femndez-Herrero, G. Laible, M. Dull, and R.
Grosschedl. 1997. Extension of chromatin accessibility by nuclear matrix attachment regions.
Nature 385: 269-72.
Kennedy, J.A., F. Barabd, B.J. Patterson, J. Bayani, J.A. Squire, D.L. Barber, and J.E.
Dick. 2006. Expression of TEL-JAK2 in primary human hematopoietic cells drives
erythropoietin-independent erythropoiesis and induces myelofibrosis in vivo. Proceedingsof the
NationalAcademy of Sciences of the United States ofAmerica 103, no. 45: 16930-5.
Laurie, K.L., M.P. Blundell, H.E. Baxendale, S.J. Howe, J. Sinclair, W. Qasim, U.
Brunsberg, A.J. Thrasher, R. Holmdahl, and K. Gustafsson. 2007. Cell-specific and efficient
expression in mouse and human B cells by a novel hybrid immunoglobulin promoter in a
lentiviral vector. Gene Therapy 14, no. 23: 1623-31.
Letai, A., M.D. Sorcinelli, C. Beard, and S.J. Korsmeyer. 2004. Antiapoptotic BCL-2 is
required for maintenance of a model leukemia. Cancer Cell 6, no. 3: 241-9.
Lewis, P.F., and M. Emerman. 1994. Passage through mitosis is required for
oncoretroviruses but not for the human immunodeficiency virus. Journalof Virology 68, no. 1:
510-6.
104
Logan, A.C., C. Lutzko, and D.B. Kohn. 2002. Advances in lentiviral vector design for
gene-modification of hematopoietic stem cells. Current Opinion in Biotechnology 13: 429-36.
Lutzko, C., D. Senadheera, D. Skelton, D. Petersen, and D.B. Kohn. 2003. Lentivirus
vectors incorporating the immunoglobulin heavy chain enhancer and matrix attachment regions
provide position-independent expression in B lymphocytes. Journalof Virology 77, no. 13:
7341-51.
Marin, M.C., B. Hsu, L.C. Stephens, S. Brisbay, and T.J. McDonnell. 1995. The
functional basis of c-myc and bcl-2 complementation during multistep lymphomagenesis in vivo.
Experimental Cell Research 217, no. 2: 240-7.
May, C., S. Rivella, J. Callegari, G. Heller, K.M.L. Gaensler, L. Luzzatto, and M.
Sadelain. 2000. Therapeutic haemoglobin synthesis in beta-thalassaemic mice expressing
lentivirus-encoded human beta-globin. Nature 406, no. 6791: 82-6.
McDonald, D., M.A. Vodicka, G. Lucero, T.M. Svitkina, G.G. Borisy, M. Emerman, and
T.J. Hope. 2002. Visualization of the intracellular behavior of HIV in living cells. Journalof Cell
Biology 159, no. 3: 441-52.
McDonnell, T.J., N. Deane, F.M. Platt, G. Nunez, and U. Jaeger. 1989. bcl-2immunoglobulin transgenic mice demonstrate extended B cell survival and follicular
lymphoproliferation. Cell 57: 79-88.
McDonnell, T.J., and S.J. Korsmeyer. 1991. Progression from lymphoid hyperplasia to
high-grade malignant lymphoma in mice transgenic for the t (14; 18). Nature 349: 254-6.
Meyer, N., S.S. Kim, and L.Z. Penn. 2006. The Oscar-worthy role of Myc in apoptosis.
Seminars in Cancer Biology 16, no. 4: 275-87.
Moore, M.A.S., D.C. Dom, J.J. Schuringa, K.Y. Chung, and G. Morrone. 2007.
Constitutive activation of Flt3 and STAT5A enhances self-renewal and alters differentiation of
hematopoietic stem cells. Experimental Hematology 35, no. 4 Suppl 1: 105-16.
Moreau, T, V Barlogis, F Bardin, J A Nunes, B Calmels, C Chabannon, and C Tonnelle.
2008. Development of an enhanced B-specific lentiviral vector expressing BTK: a tool for gene
therapy of XLA. Gene Therapy 15, no. 12: 942-52.
Moreau, T., F. Bardin, J. Imbert, C. Chabannon, and C. Tonnelle. 2004. Restriction of
transgene expression to the B-lymphoid progeny of human lentivirally transduced CD34+ cells.
Molecular Therapy 10, no. 1: 45-56.
Murphy, D.J., M.R. Junttila, L. Pouyet, A. Karnezis, K. Shchors, D.A. Bui, L. BrownSwigart, L. Johnson, and G.I. Evan. 2008. Distinct thresholds govern Myc's biological output in
vivo. Cancer Cell 14, no. 6: 447-57.
105
Naldini, L, U Bl6mer, P Gallay, D Ory, R Mulligan, F H Gage, I M Verma, and D Trono.
1996. In vivo gene delivery and stable transduction of nondividing cells by a lentiviral vector.
Science 272, no. 5259: 263-7.
Pfeifer, A., M. Ikawa, Y. Dayn, and I.M. Verma. 2002. Transgenesis by lentiviral
vectors: lack of gene silencing in mammalian embryonic stem cells and preimplantation
embryos. Proceedingsof the NationalAcademy of Sciences of the UnitedStates ofAmerica 99,
no. 4: 2140-5.
Rangarajan, A., and R.A. Weinberg. 2003. Comparative biology of mouse versus human
cells: modelling human cancer in mice. Nature Reviews Cancer 3, no. 12: 952-9.
Roe, T., T.C. Reynolds, G. Yu, and P.O. Brown. 1993. Integration of murine leukemia
virus DNA depends on mitosis. The EMBO Journal 12, no. 5: 2099-108.
Salmon, P., V. Kindler, 0. Ducrey, B. Chapuis, R.H. Zubler, and D. Trono. 2000. Highlevel transgene expression in human hematopoietic progenitors and differentiated blood lineages
after transduction with improved lentiviral vectors. Blood 96, no. 10: 3392-8.
Schuringa, J.J., K.Y. Chung, G. Morrone, and M.A.S. Moore. 2004. Constitutive
activation of STAT5A promotes human hematopoietic stem cell self-renewal and erythroid
differentiation. Journalof ExperimentalMedicine 200, no. 5: 623-35.
Sheiness, D., L. Fanshier, and J.M. Bishop. 1978. Identification of nucleotide sequences
which may encode the oncogenic capacity of avian retrovirus MC29. Journalof Virology 28, no.
2: 600-10.
Snuderl, M., O.K. Kolman, Y.-B. Chen, J.J. Hsu, A.M. Ackerman, P. Dal Cin, J.A. Ferry,
et al. 2010. B-cell Lymphomas With Concurrent IGH-BCL2 and MYC Rearrangements Are
Aggressive Neoplasms With Clinical and Pathologic Features Distinct From Burkitt Lymphoma
and Diffuse Large B-cell Lymphoma. American JournalofSurgicalPathology 34, no. 3: 327-40.
Stem, P., S. Astrof, S.J. Erkeland, J. Schustak, P.A. Sharp, and R.O. Hynes. 2008. A
system for Cre-regulated RNA interference in vivo. Proceedingsof the NationalAcademy of
Sciences of the United States ofAmerica 105, no. 37: 13895-900.
Strasser, A., A.W. Harris, M.L. Bath, and S. Cory. 1990. Novel primitive lymphoid
tumours induced in transgenic mice by cooperation between myc and bcl-2. Nature 348: 331-3.
Szymczak, A.L., C.J. Workman, Y. Wang, K.M. Vignali, S. Dilioglou, E.F. Vanin, and
D.A.A. Vignali. 2004. Correction of multi-gene deficiency in vivo using a single 'self-cleaving'
2A peptide-based retroviral vector. Nature Biotechnology 22, no. 5: 589-94.
Tsujimoto, Y, L. Finger, J Yunis, P. Nowell, and C. Croce. 1984. Cloning of the
Chromosome Breakpoint of Neoplastic B Cells with the t ( 14 ; 18 ) Chromosome Translocation.
Science 226, no. 4678: 1097-9.
106
Vaux, D.L., S. Cory, and J.M. Adams. 1988. Bcl-2 gene promotes haemopoietic cell
survival and cooperates with c-myc to immortalize pre-B cells. Nature 335: 440-2.
Verhoeyen, E., M. Wiznerowicz, D. Olivier, B. Izac, D. Trono, A. DubartKupperschmitt, and F.-L. Cosset. 2005. Novel lentiviral vectors displaying "early-acting
cytokines" selectively promote survival and transduction of NOD/SCID repopulating human
hematopoietic stem cells. Blood 106, no. 10: 3386-95.
Williams, DA, IR Lemischka, DG Nathan, and RC Mulligan. 1984. Introduction of new
genetic material into pluripotent haematopoietic stem cells of the mouse. Nature 310: 476-80.
Wunderlich, M., 0. Krejci, J. Wei, and J.C. Mulloy. 2006. Human CD34+ cells
expressing the inv (16) fusion protein exhibit a myelomonocytic phenotype with greatly
enhanced proliferative ability. Blood 108, no. 5: 1690-7.
Yang, L., L. Bailey, D. Baltimore, and P. Wang. 2006. Targeting lentiviral vectors to
specific cell types in vivo. Proceedingsof the NationalAcademy of Sciences of the United States
ofAmerica 103, no. 31: 11479-84.
Youle, R.J., and A. Strasser. 2008. The BCL-2 protein family: opposing activities that
mediate cell death. Nature Reviews Molecular Cell Biology 9, no. 1: 47-59.
Zhang, C.C., M. Kaba, S. Lizuka, H. Huynh, and H.F. Lodish. 2008. Angiopoietin-like 5
and IGFBP2 stimulate ex vivo expansion of human cord blood hematopoietic stem cells as
assayed by NOD / SCID transplantation. Blood 111, no. 7: 3415-23.
Zufferey, R., D Nagy, R.J. Mandel, L. Naldini, and D. Trono. 1997. Multiply attenuated
lentiviral vector achieves efficient gene delivery in vivo. Nature Biotechnology 15: 871-5.
107
Chapter 3
Modeling Immune Therapy of ALL
in a Humanized Mouse Model
108
3.1
Summary
As anti-neoplastic therapy becomes increasingly focused on human-specific therapies,
mouse models become less useful in screening and evaluating potential new therapies.
Humanized mouse models of hematologic malignancies offer the opportunity to evaluate in vivo
the effectiveness and mechanism of action of human-specific anti-neoplastic treatments.
A
humanized mouse mode of pro-B ALL was previously created, where immunodeficient
NOD/scid, yc"ull mice are engrafted with human CD133* cells that had been spin infected with
lentivirus carrying Myc and Bcl-2 oncogenes together. Leukemic cells that arise in this model
expressed CD52 and were transplantable into secondary recipients; these were subsequently used
to test the efficacy of a human specific monoclonal antibody to CD52, alemtuzumab, which is
currently approved for treatment of chronic lymphocytic leukemia, but not ALL. Alemtuzumab
treatment of secondary mice resulted in an almost complete clearance of leukemic blasts from
the periphery and a significant improvement in life expectancy, and antibody-dependent tumor
cell killing was shown to be mediated by macrophages. The lack of alemtuzumab activity in the
brain and bone marrow of the mice was investigated, and overcome by combining alemtuzumab
with the commonly used chemotherapeutic agent cyclophosphamide.
Great synergy between
alemtuzumab and cyclophosphamide seen in this model suggests that a further investigation into
this clinically relevant drug combination is well warranted.
Specific acknowledgements: Dr. Christian Pallasch made essential contributions to this work,
including the acquisition of all chemotherapeutics and alemtuzumab, synthesis and quantification
of alemtuzumab variants, making decisions regarding appropriate drug regimens, tracking
alemtuzumab in vivo binding, and interpretation of histological findings. Dr. Peter Bak imparted
significant insights into conducting macrophage phagocytosis assays. Amanda Souza provided
expert technical help, including continuously monitoring cancer development and progression in
humanized mice. Numerous members of the Chen laboratory helped with large-scale
experiments involving the characterization of responses to anti-neoplastic treatments.
109
3.2
Introduction
Transgenic mouse models have been invaluable in advancing our understanding of the
mechanisms that underlie the development, progression, and spread of malignancies.
The
earliest such models were generated as a means to validate in vivo the hypothesis that neoplasia
arises due to a dysregulation of proto-oncogenes (Adams et al. 1985). Notably, the importance
of elements that control oncogene expression was realized almost immediately, as the use of the
same oncogene (the large T antigen of the simian virus 40) paired with different such elements
resulted in transgenic animals developing tumors in different organs (Brinster et al. 1984;
Hanahan 1985; Palmiter et al. 1985; Messing et al. 1985).
Spatial control of transgene
expression was steadily improved with the characterization of an increasing number of tissuespecific promoters, while the development of chemically-inducible promoters allowed for further
temporal control. Meanwhile, advances in gene targeting via homologous recombination led to
the generation of transgenic animals in which oncogenes or dominant-negative tumor
suppressors were expressed from endogenous promoters; again, more precise spatial and
temporal control of expression was later achieved with the use of conditional knock-in alleles
(reviewed by Frese and Tuveson 2007).
The use of these increasingly sophisticated mouse models of cancer yielded important
insights into basic cancer biology and pointed toward promising molecular targets of therapy
(Felsher 2003). Yet, the value of these models in predicting human response to therapy has been
quite limited (Ostrand-Rosenberg 2004). This discrepancy may be due in part to interspecies
metabolic differences that may result in dissimilar processing of experimental compounds in the
mice; the susceptibility of tumor cells themselves to such compounds may also differ between
mice and humans. Indeed, these differences are likely to become more significant as cancer
110
therapy moves away from general cytotoxic agents and toward treatments that focus more
precisely on human targets. Examples of these include small molecule inhibitors, the targets of
which may not be conserved between mice and humans, and biologicals such as therapeutic
monoclonal antibodies, the efficacy of which depends on their specificity to human epitopes.
An alternative way to model human disease is by engrafting patient tumor samples into
immunodeficient mice (Kelland 2004).
The advantages of this approach include the human
origins of the cancer, as well as the potential for determining an individualized course of
treatment. This potential was evaluated in a recent study where patients' clinical responses to
chemotherapy were retrospectively compared to the responses of their biopsies that had been
previously transplanted into nude mice (Fiebig, Maier, and Burger 2004). Strikingly, xenografts
were found to predict tumor sensitivity in 90% (19 out of 21 cases) and tumor resistance in 97%
of the patients (57 out of 59 cases). On the other hand, freshly isolated tumor samples often fail
to grow in a murine microenvironment, and while established human cell lines engraft well, they
lack the predictive power of the biopsies (Sausville and Burger 2006). Furthermore, the genetic
lesions present in both cell lines and in patient samples are often poorly or incompletely
characterized, which makes it nearly impossible to determine the reasons for the efficacy or
failure of any treatment.
In the case of hematologic malignancies, however, immunodeficient mice engrafted with
genetically modified human HSCs appear to be an excellent compromise between these two
approaches. This system can be used not only to assess the susceptibility of human cells to a
numerous combinations of defined oncogenes, but also to test, and perhaps improve, the in vivo
efficacy of a variety of human-specific anti-neoplastics.
ill
An important and growing class of such human-specific treatments is comprised of
monoclonal antibodies (mAb) directed toward tumor antigens. The possibility to treat cancer
using such antibodies was realized soon after a method to produce them in large quantities was
devised (K5hler and Milstein 1975). Indeed, the first study to assess this treatment showed that
injecting mice with a combination of complement proteins and antibodies directed against a T
cell-specific Thyl antigen suppressed the growth of a transplanted leukemia and led to the cure
of a significant proportion of the animals (Bernstein, Tam, and Nowinski 1980). Subsequent
human trials that used anti-idiotype antibodies against B and T cell lymphoma had limited
success (Miller et al. 1982; Miller et al. 1983), but targeting the CD20 antigen expressed by most
B cells proved to be a more effective strategy (Press et al. 1987). Humanization of this mouse
anti-human antibody - the replacement of its murine constant regions with human equivalents further improved its ability to clear peripheral B cells in macaque monkeys (Reff et al. 1994).
More importantly, treatment with the humanized antibody, now called rituximab, resulted in
significant improvement in clinical outcomes in patients with relapsed and indolent B cell
lymphoma (Maloney et al. 1994; Maloney et al. 1997), and its combination with the CHOP
regimen (cyclophosphamide, doxorubicin, vincristine, and prednisone) increased the rate of
complete remission from 63% to 76% in patients suffering from aggressive diffuse large B cell
lymphoma (Coiffier et al. 2002). The antitumor activity of rituximab has been shown to be at
least partially due its ability to fix complement (Di Gaetano et al. 2003), though the lack of
rituximab effect in mice with defects in Fc receptors suggests that innate immune cells also play
a significant role in mediating rituximab-dependent tumor cell clearance (Clynes et al. 2000).
This role is further supported by the finding that 12 months following treatment, the objective
response rate in patients homozygous for a high-affinity allele of the Fcy receptor IIIA was much
112
higher than that in patients carrying a low-affinity allele (90% vs. 51%, respectively) (Cartron et
al. 2002). Finally, CD20-targeting antibodies conjugated to radioactive particles such as
(tositumomab) and
90Y
1311
or "I1 n (ibritumomab tiuxetan) provide yet another means of tumor-
specific cell killing (reviewed in Imai and Takaoka 2006).
Despite the great promise of antibody-mediated treatment of tumors, especially of nonsolid cancers like lymphoma and leukemia, until recently only three other monoclonal antibodies
have been approved for clinical use against hematologic malignancies (Dougan and Dranoff
2009). One of these is ofatumumab, another anti-CD20 antibody which targets a different CD20
epitope and has just been approved for use in refractory chronic lymphocytic leukemia (CLL)
(Lemery et al. 2010). Another is gemtuzumab ozogamicin, a cytotoxin-linked antibody to CD33,
a molecule expressed by healthy myeloid cells as well as by tumor cells of acute myeloid
leukemia (AML); however, extended clinical trials showed that its addition to standard AML
chemotherapy regimens resulted in more patient deaths and no appreciable clinical benefits, and
the drug was withdrawn from the market on June 21, 2010 (US Food and Drug Administration
2010). Finally, alemtuzumab (also known as Campath-1H) is an antibody that targets the mature
lymphocyte antigen CD52, and which has also been approved for use in refractory CLL; a 2007
literature review of 6 clinical studies involving single-agent alemtuzumab reported a pooled
overall response rate of 38%, of which 6% were complete responses (Fraser et al. 2007).
Notably, the history of alemtuzumab's clinical development largely parallels that of rituximab:
after the antigen was selected, monoclonal rodent (in this case, rat) anti-human antibodies were
generated (Hale et al. 1983), tested in vitro for ability to kill human T cells (Waldmann et al.
1984), humanized (Riechmann et al. 1988), and then quickly moved into human trials, first using
small numbers of patients with unspecified non-Hodgkin lymphoma (e.g. Hale et al. 1988), and
113
subsequently refining clinical application to patients with refractory CLL (Keating et al. 2002).
In another similarity to rituximab, alemtuzumab also clears its target cells by recruiting
complement (Heit et al. 1985) and innate immune cells (Greenwood, Clark, and Waldmann
1993), suggesting that these are the general mechanisms of action of monoclonal antibodies that
are not conjugated to cytotoxic agents.
This dearth of antibodies, after 30 years of research, is not for the lack of suitable antigen
targets, and numerous monoclonal antibody candidates are currently in Phase I or II clinical trials
(reviewed in Schrama, Reisfeld, and Becker 2006).
The rate of their success in the clinic,
however, is quite low, as illustrated by the small number of antibodies currently on the market,
as well as by the recent withdrawal of gemtuzumab. This discrepancy suggests that better animal
models are needed for preclinical therapy screening and validation.
Because monoclonal
antibodies should target human epitopes, humanized mouse models of hematologic malignancies
seem ideal for this task. Thus, having previously developed a humanized mouse model of
precursor B cell ALL, we set out to examine the possibility of using it to model ALL treatment
using a humanized monoclonal antibody in vivo.
114
3.3
Results
3.3.1
Treatment of secondary GMB mice with alemtuzumab results in partial tumor
clearance
In the humanized model of pro-B cell ALL described above, leukemic cells express GFP,
as well as the oncogenes Myc and Bcl-2; for ease of use, GFP* leukemic cells that arise in this
model are thus referred to as "GMB" cells.
As described above, these cells lacked CD20
expression, but they did express CD52, as evidenced by positive staining with an anti-CD52
antibody (Figure 3.1 A).
This finding presented an opportunity to investigate the effects of
alemtuzumab, the anti-CD52 antibody that has been approved by the FDA for treatment of CLL,
in a humanized mouse model of ALL.
Prior to investigating its effect in vivo, however, the effect of alemtuzumab on GMB cells
growing in culture was ascertained. Addition of this antibody to media in which GMB cells
were cultured did not result in an increase in the number of non-viable cells, as assessed by
exclusion of propidium iodide (data not shown). Its lack of effect in vitro indicated either that
alemtuzumab failed to bind cultured GMB cells, or that its binding to cultured target cells was
not sufficient to kill them, either because culture conditions inhibited apoptosis or because
effector molecules or cells that would mediate cell killing in vivo were missing from the culture.
In order to investigate whether alemtuzumab would have any effect on GMB cells in
vivo, a group of secondary mice were generated; this was done by injecting unirradiated NSG
mice with identical numbers of GFP* cells derived from a primary GMB mouse, so that each
secondary mouse received ~10
6
GFP* cells. Approximately 3 weeks later, the blood of these
secondary recipients was assessed for the presence of GFP* cells; in order to mimic the clinical
115
.. ..
....
..
.................
.......
........
A
99.6
0.1
CL
LLI
Alemtuzumab
Day
Day
Day
Day
Day
Day
1
2
3
4
5
6
+
+
I
1+
(0
0
0.3
CD52
Spleen
Blood
(1OuL)
107i
Liver
106-
Bone Marrow
Brain
(1femur)
(1 hemisphere)
1
8
*
0
00
10,
S
103
102
I
I
102
106
1041
o PBS (n=6)
* Alemtuzumab (n=6)
Treatment of secondary GMB mice with alemtuzumab results in partial
Figure 3.1
tumor clearance. (A) GFP+ cells that arise in GMB mice express CD52. Splenocytes were
isolated from GMB mice that had been euthanized due to terminal illness and stained for the
indicated markers. The shown sample is gated on human CD45* cells; numbers indicate percent
cells in the gated region. Representative data from one of at least 3 mice are shown. (B)
Schedule of alemtuzumab administration. Control mice received injections of PBS on the same
days instead. (C) Alemtuzumab treatment partially clears GFP* tumor cells from the blood,
spleen, and liver of secondary GMB mice, but has no significant impact on tumor burden in the
bone marrow or in the brain. Cohorts of secondary GMB mice were matched based on the
frequency of GFP* cells in their blood 17 days after their initial engraftment with GMB cells.
One group was treated with 3 injections of alemtuzumab (5 mg/kg) on post-engraftment days 18,
21, and 24 (closed circles); mice in the other (control) group received injections of PBS on the
same days instead (open circles). The number of GFP* cells in the indicated organs was
examined on post-engraftment day 26; each symbol represents an individual mouse.
Representative data from one of at least 3 independent experiments are shown.
116
process of leukemia diagnosis and treatment, alemtuzumab was not administered until leukemic
blasts appeared in the periphery. Once GFP* cells were detected, mice were divided into mockand alemtuzumab-treated groups, matched based on the frequency of GFP* cells in their blood.
Mice in the alemtuzumab-treated group then received tail vein injections of alemtuzumab, with
doses adjusted to 5 pg of the antibody per gram of mouse body weight (5 mg/kg). Mock-treated
mice received intravenous injections of PBS instead.
In the initial study, mice were injected with alemtuzumab once; notably, GFP* leukemic
cells were almost undetectable in the peripheral blood of the animals seven days after its
administration, which suggested that a more thorough investigation of alemtuzumab's antineoplastic activity was warranted. Therefore, a large cohort of secondary mice was created using
splenocytes from a single primary GMB mouse; 17 days after their initial engraftment with
tumor cells, secondary mice were divided into two matched groups as described above. One
group received 3 injections of alemtuzumab (5 mg/kg) over the course of 7 days, on days 1, 3
and 7 (i.e. post-engraftment days 18, 21, and 24); mice in the other (control) group received
injections of PBS instead (Figure 3.1B).
Two days after the end of treatment (i.e. post-
engraftment day 26), some of the mice from both groups were sacrificed, and tumor burden in
various internal organs was determined (Figure 3.1C).
Consistent with previous results, the
number of leukemic cells was reduced >20-fold in the peripheral blood of alemtuzumab-treated
animals, with GFP* cells entirely undetectable in the blood of 2 of the 6 animals. This effect was
accompanied by striking decreases in the number of leukemic cells in the spleen (~1400-fold
median decrease) and in the liver (-300-fold median decrease) (Figure 3.1C). Leukemia burden
in the bone marrow and brain, however, was not significantly affected by alemtuzumab
administration (Figure 3.1 C).
117
The remaining mice from this experiment (10 in each group) were used to assess the
effect of alemtuzumab treatment on survival. Indeed, mice that were treated with alemtuzumab
lived significantly longer than those that received PBS instead (p <0.01), with a median survival
time increasing from 34 to 55 days (Figure 3.2).
100
t:i
>80-
C40
Um
4020 -
no
-
PBS (n=10)
-
Alemtuzumab(n=10)
<0.01
0
0
10
20
30
40
50
60
70
80
90
Time (days post-engraftment)
Figure 3.2
Kaplan-Meier survival analysis of mice treated with PBS or alemtuzumab.
Alemtuzumab treatment significantly increased mouse survival (p<0.01); median survival was
increased from 34 to 55 days. On day 0, unirradiated secondary mice were engrafted with 106
GMB cells each. On day 17 post-engraftment, mice were divided into 2 groups, matched based
on the frequency of GFP* cells in their blood; on days 18, 21, and 24 post-engraftment (shown
by arrows) mice received intravenous injections of either PBS or alemtuzumab (5 mg/kg).
Mouse health was monitored throughout; animals were euthanized when declared moribund by
veterinary technicians. Representative data from one of at least 3 independent experiments are
shown; n indicates the number of mice in each group.
118
3.3.2
The Fc region of alemtuzumab is essential to its anti-tumor function
The anti-leukemic activity of alemtuzumab can be mediated by one or more of several
possible mechanisms. Although the function of CD52 is poorly understood, it is possible that
alemtuzumab binding interferes with a vital function of this molecule.
Alternatively,
alemtuzumab binding could recruit complement or effector cells of the innate immune system to
CD52* cells. In order to distinguish between these possibilities, the effect of alemtuzumab was
compared to that of its F(ab') 2 fragment, which contains the bivalent antigen-binding region of
the antibody, but lacks its Fc region that normally serves as the binding site for effector
molecules or cells. Secondary GMB mice were injected with the same molar amount of fulllength alemtuzumab or its F(ab') 2 fragments, and the leukemic cell burden was assessed two
days later (Figure 3.3). As expected, neither of the treatments had a significant effect in the bone
marrow, as compared to injections of PBS alone. In the spleen, alemtuzumab treatment resulted
in a significant decrease in the number of leukemic cells (p <0.05), also as expected. Treatment
with its F(ab') 2 fragments, however, did not result in a significant decrease in the number of
leukemic cells in the spleen (Figure 3.3), indicating that the Fc region of the antibody is essential
for its anti-tumor activity.
3.3.3
Complement does not mediate alemtuzumab's anti-tumor activity in GMB mice
Several components of the immune system can destroy antibody-coated cellular targets,
all of which begin this process by binding to the antibody's Fc region. For example, the Fc
region of the antibody serves as the docking site for members of the classical complement
pathway, the end product of which is a so-called membrane attack complex, a multimeric protein
structure that penetrates the outer membrane of the target cell, thereby lysing it. Alternatively,
effector cells that express Fc receptors may use them to bind to antibody-coated target cells and
119
Bone Marrow
107
Spleen
105
8
0
0
104-
CL 106
LL
(5
103-
-
0
4
L-
E
x
105
102.
z
S
104
10
O PBS
* Alemtuzumab - full-length
x Alemtuzumab- F(ab') 2
Figure 3.3
The Fc region of alemtuzumab is essential for its function. Secondary GMB
mice were divided into groups matched based on the frequency of GFP* cells in their blood and
injected with a single dose of either PBS (open circles), 5mg/kg full-length alemtuzumab (closed
circles), or the purified F(ab') 2 fragment of alemtuzumab (crosses), comprised of the bivalent
antigen-binding part of the antibody, but missing its Fc region. Two days later, total leukemic
burden in the bone marrow (1 femur) and in the spleen was assessed. Representative data from
one of two experiments is shown; each symbol represents an individual mouse. Unpaired t-test
showed no significant differences in leukemic cell number between the control (PBS) group and
either of the treated groups in the bone marrow, and no significant difference between the control
and the F(ab') 2 group in the spleen (p > 0.5); however, the difference in leukemic cell number
between the control group and full-length alemtuzumab group was significant (P < 0.05)
120
destroy them, either by phagocytosis (in the case of macrophages and monocytes), or by
releasing
various
cytotoxic
compounds
(as
done
by
neutrophils
and
NK
cells)
(Janeway, Jr. et al. 2001).
Mice of the NOD strain (such as NSG mice) lack the C5 complement protein, which
recruits subunits of the membrane attack complex; therefore, the complement system does not
function in these mice.
To confirm that complement fixation was not the mechanism of
alemtuzumab-mediated cell killing, GMB cells were cultured in media supplemented with serum
derived from either human blood or from the blood of NSG mice. When alemtuzumab was
added to the culture, the number of non-viable GMB cells increased from baseline only in
samples that contained human serum (Figure 3.4). Anti-tumor activity was proportional to the
concentration of alemtuzumab added to the culture, and disappeared in samples containing
human serum that had been previously heat-inactivated, suggesting that this activity was due to
alemtuzumab-mediated fixation of human complement. Notably, NSG mouse serum showed no
anti-tumor effect (Figure 3.4), indicating that the anti-tumor activity of alemtuzumab in these
mice is not due to complement fixation.
3.3.4
Alemtuzumab's anti-tumor activity in GMB mice is mediated by macrophages
Of the innate immune system effector cells that could mediate the killing of
alemtuzumab-labeled cells, NK cells are the least likely possibility, since NSG mice have been
described as essentially lacking this class of cells (Shultz et al. 2005; Ishikawa et al. 2005).
Furthermore, alemtuzumab's ineffectiveness against tumor cells in the bone marrow, where the
majority of murine granulocytes are thought to be located, suggests that the role granulocytes
play in mediating alemtuzumab's anti-tumor activity is very limited.
121
45%-
40%-
Uo 35%.
30%+
5Human
serum
Human serum (HI)
ONSG serum
NSG serum (HI)
25%-
20%
15%10%5%0%0
1
10
30
100
[Alemtuzumab] (ug/ml)
Figure 3.4
Alemtuzumab-mediated tumor cell killing does not occur through
complement fixation. GFP* splenocytes were isolated from a primary GMB mouse and
cultured in the presence of either human serum, human serum that had been previously heatinactivated (HI), serum derived from NSG mice (NSG serum), or NSG serum that had been heatinactivated. Alemtuzumab was then added to the cultured cells at the indicated concentrations,
and the viability of GFP* cells (i.e. their ability to exclude propidium iodide) was measured 48
hours later. Representative data from one of at least 5 experiments are shown.
122
To determine whether macrophages mediate the anti-tumor effect of alemtuzumab,
macrophages derived from NSG mice were incubated with GMB cells in the absence or presence
of alemtuzumab; the number of viable GFP* cells remaining in culture was assessed at various
points during the incubation. No significant changes in GFP* cell number were seen in the cases
where GMB cells were incubated with macrophages alone or with alemtuzumab alone. When
incubated with both macrophages and alemtuzumab, however, GMB cells rapidly disappeared
from the culture, with 64±4% of the cells remaining 2 hours after the alemtuzumab addition, and
just 25±9% remaining 13 hours after alemtuzumab addition (Figure 3.5). As was the case in
vivo, this effect was dependent on alemtuzumab containing an intact Fc region; GMB cells did
not disappear when they were incubated with macrophages along with the F(ab') 2 fragments of
alemtuzumab instead of the full-length antibody (Figure 3.5).
The results above show that macrophages are able to mediate alemtuzumab's anti-tumor
effect ex vivo. To test whether this is the case in vivo, secondary GMB mice were depleted of
macrophages via an injection of clodronate-containing liposomes.
Specific depletion of
macrophages was confirmed by flow cytometry 48 hours after clodronate liposome injection: a
statistically-significant ~90% reduction in the numbers of CD Ilb+ CD lc~ Gr-I~ macrophages
was observed (Figure 3.6A; p < 0.05), while the numbers of CDllb* Gr-l
granulocytes
remained unaffected (Figure 3.6A; p = 0.21). Injection of these liposomes had no effect on
leukemic cell burden in the spleen (Figure 3.6B: PBS vs. Clodronate, p = 0.35), while treatment
with alemtuzumab reduced tumor burden, consistent with previous results (Figure 3.6B: PBS vs.
Alemtuzumab, p < 0.05). Notably, however, alemtuzumab lost its anti-tumor effect in mice that
had been pre-treated with clodronate liposomes, failing to achieve significant reduction in tumor
123
140 02 hrs
04.5 hrs
E9 hrs
* 13 hrs
M120
'3100
(D
L.80
O 60
40
20
0
GMB cells
Macrophages
Alemtuzumab
+
+
+
+
+
+
F(ab') 2
full-length
Figure 3.5
Macrophages are able to kill GMB cells in vitro in the presence of full-length
alemtuzumab. NSG mice received an intraperitoneal injection of thioglycollate, and their
peritoneal lavage was collected 4 days later. Macrophages were purified from the lavage based
on their expression of the F4/80 antigen, and incubated with GMB splenocytes isolated from a
primary GMB mouse, and full-length alemtuzumab or its F(ab') 2 fragment was added to the
samples.
At the indicated times, GFP* cells remaining in the culture were counted.
Representative data from one of two experiments is shown; each was performed in triplicate.
Mean ± SD is shown for each time point.
124
Macrophages
106.y
Granulocytes
106.
0
6§
0
105.
0105
0
...
E104
z
103.
N
X
x
O PBS
x Clodronate
104-
103.
O PBS
A Alemtuzumab
LL
.a
(9
0
e Clodronate
Clodronate
E
+
Alemtuzumab
z
Figure 3.6 Alemtuzumab loses its anti-neoplastic activity in mice depleted of macrophages.
(A) Depletion of macrophages, but not granulocytes, is seen after an intravenous injection of
clodronate-containing liposomes. Secondary GMB mice received intravenous injections of
either PBS or clodronate-containing liposomes; 48 hours later, the number of splenic CD1 lb+
CD 11 c Gr- I~macrophages and CD 11 b+ Gr- 1+ granulocytes was determined. (B) Macrophage
depletion results in the loss of in vivo alemtuzumab activity. Groups of secondary GMB mice,
matched based on the frequency of GFP* cells in their blood, were injected with clodronatecontaining liposomes or PBS; 48 hours later, they were treated with a single injection of
alemtuzumab (5 mg/kg). Three days after receiving alemtuzumab, mice were euthanized and the
number of GFP* cells in their spleens was determined. Representative data from one of 2
experiments are shown; each symbol represents an individual mouse.
125
burden in mice that had been depleted of macrophages (Figure 3.6B: PBS vs. Clodronate +
Alemtuzumab, p = 0.28). These results show that macrophages are indeed the effector cells that
mediate the anti-tumor effect of alemtuzumab in NSG mice.
3.3.5
Alemtuzumab is able to penetrate the bone marrow, but not the brain
While clearing leukemic cells from the spleen, alemtuzumab did not significantly affect
tumor burden in the brain or bone marrow of secondary GMB mice (Figure 3.1B). This lack of
effect in the bone marrow and in the brain could be due to alemtuzumab's inability to reach
leukemic cells in these tissues.
To test this possibility, alemtuzumab was conjugated to the
fluorescent dye Alexa Fluor 750 (AF750) and injected into secondary GMB mice. Two hours
later, mice were euthanized and the extent of in vivo AF750-alemtuzumab binding to leukemic
cells in the spleen, bone marrow, and brain was assessed (Figure 3.7).
GMB cells from the
spleen and bone marrow had bound AF750-labeled antibody equally brightly, indicating that the
antibody had penetrated these two organs to approximately the same extent. In contrast, GMB
cells harvested from the brain had not bound AF750-alemtuzumab (Figure 3.7); no binding was
seen up to 3 days after the initial infusion of labeled alemtuzumab (data not shown), indicating
that the antibody was unable to reach leukemic cells in the brain.
3.3.6
Bone marrow is not an immune-privileged site for GMB cells
As indicated by the results above, the lack of alemtuzumab anti-tumor activity in the
bone marrow is not due to its inability to reach leukemic cells residing in this organ. This raised
the question of whether the bone marrow microenvironment somehow protects the tumor cells
126
Spleen
Bone Marrow
Brain
'P- AF750%
GFP+AF750+
'P- AF7501
IN-IF-9. ,
GFP+ AF750.
GFP
Figure 3.7
Alemtuzumab is able to reach GFP* cells in the spleen and bone marrow, but
not in the brain. Alemtuzumab was conjugated to the fluorescent dye AlexaFluor 750 and
subsequently injected into secondary GMB mice. Two hours later, mice were euthanized and the
extent of in vivo alemtuzumab binding to GFP+ tumor cells resident in various organs was
determined by flow cytometry. Representative data from one of 3 mice are shown.
127
from being destroyed, despite being bound by alemtuzumab. To determine if this was the case,
secondary GMB mice received intravenous injections of either PBS or alemtuzumab several days
after their engraftment with GMB cells, before the engrafted tumor has had time to expand
substantially.
Four days after initial engraftment, 0.05 ± 0.02% of the bone marrow was
comprised of GFP* cells; in PBS- treated mice this fraction grew to 1.7 ± 0.8%, 7.2 ± 6.2%, and
55.1 ± 22.0% on post-engraftment days 9, 12, and 15, respectively (Figure 3.8B, C, D, top
panels). Administering alemtuzumab (5 mg/kg) instead of PBS on post-engraftment days 4 or 9
resulted in an apparent clearance of GFP* cells from the bone marrow (Figure 3.8B, C, bottom
panels). However, treating the mice on post-engraftment day 12, when GFP* cells comprise
~7% of the bone marrow, failed to clear the leukemia (Figure 3.8D, bottom panel), though the
number of leukemic cells appeared to be reduced in alemtuzumab-treated mice compared to the
mock-treated animals.
These results indicate that bone marrow-resident leukemic cells are
susceptible to alemtuzumab treatment, as long as their numbers remain below a certain threshold.
The spleen of engrafted mice appeared devoid of GFP+ cells until 9 days postengraftment, when only -0.02% of their cells were GFP*, suggesting that injected GMB cells
first home to the bone marrow and spread to other organs only after attaining a certain critical
mass in the bone marrow. Alemtuzumab treatment on post-engraftment day 12, which had failed
to clear leukemic cells from the bone marrow, nevertheless succeeded in clearing them from the
spleen (data not shown).
In order to determine whether administering alemtuzumab when leukemic burden in the
bone marrow is low results in a cure, several mice that had been treated on post-engraftment
days 4 and 9 were not euthanized; instead their health was monitored for symptoms of leukemia,
128
GFP
GFP
GFP
Leukemic cells in the bone marrow remain susceptible to alemtuzumab
Figure 3.8
treatment until a cell frequency threshold is reached. (A) The frequency of GFP* cells was
assessed in secondary GMB mice 4 days after engraftment. On that day, some of the mice were
injected with alemtuzumab (Ab), while the rest received PBS instead. (B) The frequency of
GFP* cells in the bone marrow of PBS- and alemtuzumab-treated secondary mice was examined
on post-engraftment day 9. Some of the mice that had been treated with PBS subsequently
received an injection of alemtuzumab, while the rest continued to be treated with PBS. (C) The
frequency of GFP* cells in the bone marrow of mice treated with PBS or alemtuzumab on day 9
was examined on post-engraftment day 12. Some of the mice that had been treated with PBS
subsequently received an injection of alemtuzumab, while the rest continued to be treated with
PBS. (D) The frequency of GFP* cells in the bone marrow of mice treated with PBS or
alemtuzumab on day 12 was examined on post-engraftment day 15. Numbers indicate percent
cells in the gated region; when this percentage was below 0.01%, 0 was recorded instead.
Representative data from one of two independent experiments are shown.
129
including weight loss, pallor, tachypnea, and lethargy. All of these mice became ill and had to
be euthanized
~6 weeks after initial engraftment;
post-mortem examination revealed
splenomegaly, white bone marrow, and brittle bones. Both the spleen and the bone marrow of
these mice were replete with GFP* cells, indicating a continued presence of minimal residual
disease in these animals, even after a single treatment of alemtuzumab apparently clears them of
all leukemic cells (data not shown).
3.3.7
Combining alemtuzumab with cyclophosphamide leads to a synergistic
anti-neoplastic effect in the bone marrow
The results above suggest that if leukemic cell numbers in the bone marrow are decreased
to below a certain threshold, alemtuzumab will regain its effectiveness. One way to achieve such
reduction is to add one or more chemotherapeutic agents to alemtuzumab treatment. Indeed, the
initial step in ALL treatment, the induction, consists of intense multi-agent chemotherapy.
Several variations of induction therapy exist, and all of these include cyclophosphamide,
vincristine, an anthracycline such as doxorubicin or daunorubicin, and a steroid such as
prednisone or dexamethasone (Aster 2005). To evaluate the effect of these anti-neoplastics in
vivo, secondary GMB mice were injected with a single chemotherapeutic agent, and the
percentage of GFP* cells in their bone marrow was determined 7 days later (Figure 3.9).
Dexamethasone appears to have had no effect on leukemic burden in the bone marrow, and the
effects of vincristine and doxorubicin were also quite modest; moreover, NSG mice did not
tolerate the administration of doxorubicin, with all mice treated with as little as 1 mg/kg of this
drug dying within 1 week. Encouragingly, however, treatment with cyclophosphamide reduced
the leukemic cell burden by >95% (Figure 3.9).
130
100 -
100
80 -
80
60
60
+.
LL 40
40
o20
20
0
0
(9
41
Figure 3.9
Effect of single-agent chemotherapy on bone marrow composition in
secondary GMB mice. Two cohorts of secondary GMB mice were created in separate
experiments; 15 days after engraftment, secondary GMB mice were divided into groups,
matched based on the frequency of GFP* cells in their blood. Mice in one cohort received
injections of either PBS, doxorubicin, dexamethasone, or alemtuzumab; mice in the other cohort
received injections of PBS, cyclophosphamide, or vincristine. All chemotherapeutics were
injected intraperitoneally, except alemtuzumab, which was injected intravenously. Seven days
later, the tumor cell burden in the bone marrow of surviving mice was determined. Means ± SD
are shown; numbers in parentheses indicate the number of mice in each group;
131
Based on these results, a single injection of cyclophosphamide was added to the start of
the 3-injection course of alemtuzumab. Thus, secondary GMB mice were generated as above,
and the number of GFP* cells present in their peripheral blood was determined 2-3 weeks after
their initial engraftment with leukemic cells. The mice were subsequently divided into four
groups, matched the density of circulating GFP* cells. The first group received mock treatment
with PBS; the second received injections of alemtuzumab (5 mg/kg on days 1, 4, and 7 of
treatment); the third was injected once with cyclophosphamide (150 mg/kg on day 1 of
treatment); and the fourth received both the cyclophosphamide and the alemtuzumab regimens.
Tumor cell burden was evaluated in the treated mice on the
9 th
day, or 2 days after the last
alemtuzumab injection; specifically, the number of GFP* cells was determined in the animals'
peripheral blood, spleen, liver, brain, and bone marrow. The schedule of drug administration is
summarized in Figure 3.10.
Day
1
Alemtuzumab
+
Cyclophosphamide
+
Day
2
Day
3
Day
4
+
Day
5
Day
6
Day
7
+
+
Figure 3.10 Alemtuzumab and cyclophosphamide administration schedule. Alemtuzumab
(5 mg/kg) injections were delivered intravenously, while cyclophosphamide (300 mg/kg) was
injected intraperitoneally.
Consistent with previous findings (see Figure 3.1B), treatment with single-agent
alemtuzumab significantly reduced the leukemic cell burden in the peripheral blood, spleen and
liver (unpaired t-test; p <0.05 in all cases), while having no significant effect in the bone marrow
132
or the brain (Figure 3.11). Treatment with single-agent cyclophosphamide was as effective as
alemtuzumab in the peripheral blood, but appears to be less effective in the spleen and in the
liver than single-agent alemtuzumab (though, due to the small number of samples in each group,
no statistically significant difference was observed).
On the other hand, cyclophosphamide
achieved excellent results in the brain, reducing tumor-burden by almost ~200-fold, and had
some effect in the bone marrow as well, reducing tumor burden by ~5-fold (p <0.05), which is
also consistent with previous results (cf. Figure 3.9). The combination of cyclophosphamide and
alemtuzumab achieved similar results to single-agent alemtuzumab in the spleen and liver, and
similar results to single-agent cyclophosphamide in the brain.
Strikingly, this combination
achieved significant synergy in the bone marrow, essentially eradicating leukemia in that organ
(~7500-fold decrease, p <0.001; Figure 3.11).
Histological examination of the bone marrow from mice that received various treatments
confirmed these results.
The marrow of untreated secondary GMB mice showed complete
infiltration with uniform blasts, which had abnormally large nuclei, homogeneous nucleoplasm,
and multiple (>2) nucleoli per cell. No other cell type was detectable (Figure 3.12). A similar
bone marrow smear was seen in mice treated with single-agent alemtuzumab. The bone marrow
smears in mice treated with single-agent cyclophosphamide appeared somewhat hypocellular,
but otherwise with a cellular distribution normal for NSG mice, i.e. lacking lymphoid precursors,
but containing numerous myeloid cells, erythroid cells, and megakaryocytes; only small
populations of blast-like cells could be seen.
Finally, in mice treated with both
cyclophosphamide and alemtuzumab, blasts were entirely undetectable, and the bone marrow
appeared indistinguishable from that of an unreconstituted NSG mouse. (Figure 3.12).
133
Spleen
Blood
Liver
(10 Ll)
103
107,
1061
106,
105
x
102.
x
x
105
0
1041
104
10
103
A
102
t
9
0
~
1031
A
1021
A
A
10
I
U
101
1
0
Brain
e
1.
Bone Marrow
(1 femur)
107
108
106
107
1051
106.
A Alemtuzumab
104,
10s,
o Cyclophosphamide
103i
104.
1021
103.
10-
102.
A1
X PBS
Cyclophosphamide
+ Alemtuzumab
Figure 3.11 The effect of cyclophosphamide and alemtuzumab, used separately and in
combination with one another, on tumor burden in secondary GMB mice. Cohorts of
secondary GMB mice were created and divided into matched groups as described above. Mice
were treated with either single-agent alemtuzumab, single agent cyclophosphamide, or the
combination of the two, administered according to the schedule described in Figure 3.10. Two
days after the conclusion of the treatment regimen (i.e. on day 9), mice were euthanized and the
number of GFP* cells in the organs indicated above was determined by flow cytometry.
134
Cyclophosphamide
Cyclophosphamide
+ Alemtuzumab
Figure 3.12 Bone marrow histology confirms the effectiveness of the combination
chemoimmunotherapy. Marrow was obtained from one of the bones not used in enumerating
GFP* cells. After smears were produced, they were stained with Hematoxylin and Eosin, and
their cellular composition was analyzed.
135
3.4
Discussion
In this work, a previously-developed humanized mouse model of pro-B cell ALL was
used in a proof-of-principle study, to determine whether such models are suitable for pre-clinical
evaluation of human-specific anti-neoplastic treatments.
At the time this work was begun,
monoclonal antibodies targeting three different antigens were on the market for clinical use
against hematologic malignancies: CD20-specific rituximab and its radioactively-conjugated
variants, CD33-specific gemtuzumab (since withdrawn for lack of clinical benefit), and CD52specific alemtuzumab.
Because leukemic cells in this model expressed CD52, the target of
alemtuzumab, but neither CD33 nor CD20, alemtuzumab was chosen as the test antibody.
Indeed, its intravenous administration led to a rapid clearance of tumor cells from the peripheral
organs, including the blood, spleen, and liver; however, the drug was ineffective in the brain and
in the bone marrow.
When it was first identified, alemtuzumab-mediated clearance of CD52-expressing cells,
which include mature lymphocytes and myeloid cells, was thought ideal for using this antibody
in a transplant setting, both to prevent rejection and as a treatment of graft-versus-host-disease
(Kottaridis et al. 2000).
Other proposed clinical roles included treatment of autoimmune
diseases such as rheumatoid arthritis and multiple sclerosis (reviewed in Reiff 2005). Most
recently, alemtuzumab was approved by the FDA as a single agent treatment of B cell chronic
lymphocytic leukemia (CLL) in patients who have relapsed from previous treatment regimens
(Demko et al. 2008).
Though it has also been used in several cases of T cell lymphomas
(reviewed in Ravandi and O'Brien 2006), its potential in cases of B cell malignancies has not
been explored. Results presented here show that alemtuzumab may be a promising treatment
against B cell ALL; this is further supported by a case report from 2004, of alemtuzumab
136
treatment resulting in year-long remission seen in an adult B-ALL patient who had previously
relapsed on other therapy (Laporte et al. 2004). Together, these observations make a strong case
of exploring alemtuzumab as a B-ALL treatment in a clinical trial.
The mechanism of alemtuzumab action, however, has not been clearly defined, despite
indications of its ability to recruit complement and effector cytotoxic cells in vitro.
The
mechanism of alemtuzumab-mediated tumor cell clearance in this model was therefore
investigated. The Fc region of the antibody was found to be essential for its function, indicating
that antibody binding per se did not cause tumor cell death; complement was also ruled out,
since NSG mouse serum, as opposed to human serum, had no effect on tumor cell viability.
NSG mice lack NK cells, and since alemtuzumab anti-neoplastic activity was least in the bone
marrow, which is replete with granulocytes and lacks macrophages, and greatest in the spleen,
which has numerous macrophages, macrophages were deemed the most likely effector cells
responsible for alemtuzumab-mediated tumor cell death.
Indeed, macrophages were highly
tumoricidal in vitro, but only in the presence of full-length alemtuzumab, and when their
numbers were depleted in vivo using clodronate-containing liposomes, alemtuzumab activity was
abrogated.
As mentioned above, alemtuzumab was ineffective against tumor cells in the brain and in
the bone marrow of affected mice. Leukemic cells in the brain, or, more specifically, in the
meningeal space, as indicated by histological studies, were not stained by a fluorescently-labeled
alemtuzumab, suggesting that the most likely reason for treatment failure in that organ is the
inability of the antibody to cross the blood-brain barrier. Tumor cells in the bone marrow,
however, were indeed reachable by the alemtuzumab, and the apparent clearance of leukemic
cells from the bone marrow of antibody-treated mice with low tumor cell burden show that this
137
organ is not inherently protective of leukemic cells. Nevertheless, once leukemic cell number
surpassed a certain relatively low threshold, where these cells comprised -7% of total bone
marrow cells, treatment with alemtuzumab as a sole anti-neoplastic agent became ineffective in
this model. This threshold may represent the number of leukemic cells that can be destroyed by
the (relatively few) bone marrow resident macrophages, such that the rate of their destruction
exceeds the rate of leukemic cell proliferation. Alternatively, leukemic cells may be able to
impair macrophage function by secreting certain inhibitory soluble factors; one such potential
inhibitor is the macrophage migration inhibition factor (MIF), which has known functions in
autoimmune disease but has also been shown to prevent NK cell-mediated lysis of tumor cells
(Repp et al. 2000). As the size of the leukemic B cell population rises, so would the local
concentration of any such secreted factors, potentially counteracting the macrophage recruitment
activity of alemtuzumab. Finally, tumor cells may also secrete autocrine signaling molecules
that may aid their survival and proliferation; again, the concentration of such signals would rise
with the size of the tumor, so that larger tumors would be more likely to survive a drug
challenge. A useful goal for future investigations would thus be to determine what signaling
molecules, if any, are secreted by the GFP* tumor cells in this model, and what the effects of
such molecules may be, as well as to understand why these potential self-defense mechanisms
seem to fail the leukemic cells located in the spleen.
If alemtuzumab treatment in the bone marrow is most effective when the tumor size is
small, then combining alemtuzumab administration with that of a more general cytotoxic
chemotherapeutic would be an effective way to improve alemtuzumab activity. Such therapies
are a routine part of ALL treatment, and one of them, cyclophosphamide, was found to be
particularly effective against bone marrow leukemic cells in this humanized model.
138
Furthermore, unlike alemtuzumab, cyclophosphamide was able to deplete tumor cells in the
brain, presumably because its smaller size permits it to access the meningeal space. Strikingly,
while it reduced bone marrow tumor burden by ~10-fold on its own, a much greater synergistic
effect was attained by combining cyclophosphamide with alemtuzumab, with tumor cells
becoming essentially undetectable after such chemoimmune treatment regimen. Whether the
combination of cyclophosphamide and alemtuzumab also results in a significant improvement in
the lifespan of the treatment model animals remains to be investigated; pilot studies to explore
the survival benefit of this drug combination have been initiated.
Part of the great success in combining these two treatments may well be due to
cyclophosphamide-induced shifting of the balance between macrophages and leukemic cells.
This may occur passively, through a cyclophosphamide-mediated reduction in leukemic cells
without any decrease in the number of bone marrow-resident macrophages, which do not divide
and
are thus at least somewhat protected
against
cyclophosphamide's
cytotoxicity.
Alternatively, it is also possible that soluble signals released by large populations of dying
leukemic cells actively recruit macrophages to the bone marrow from other organs; alemtuzumab
staining of leukemic cells that are still viable would enable these newly immigrant macrophages
to target these chemotherapy resistant cells. It is clear that the principles underlying the synergy
between cyclophosphamide and alemtuzumab should be investigated further.
Two recent reports from scientists at the Genzyme Corporation, which owns the global
rights to alemtuzumab, also attempted to elucidate the mechanism of its anti-neoplastic activity.
In one study, a transgenic mouse expressing human CD52 was created, and injections of
alemtuzumab resulted in a clearance of B and T cells from the blood, spleen, and lymph nodes
(Hu et al. 2009).
Depleting these mice of complement by controlled administration of cobra
139
venom had no effect on alemtuzumab immunosuppressive activity; injecting the mice with antiasialo-GM-1 antibody, which is thought to deplete natural killer (NK) cells or with anti-Gr-1
antibody, thought to deplete mice of granulocytes, appeared to abrogate alemtuzumab's activity
completely (Hu et al. 2009). These findings are puzzling: if both NK cells and neutrophils can
mediate alemtuzumab's activity, then depleting either of these two cells types should have little
effect on alemtuzumab's activity, which should proceed via the non-depleted cells. The most
likely explanation for these results is that the antibodies used in the study, anti-asialo-GM1 and
anti-Gr-1, are not very specific. While the authors describe depletion of their target cells by
these antibodies, they make no mention of their likely off-target effects. Indeed, several recent
reports describe the anti-Gr-1 antibody used in this study (anti-Ly6G clone RB6-8C5) as lacking
in
specificity,
and binding
to
other
cells
including
monocytes
and
macrophages
(e.g. Daley et al. 2008).
In the other Genzyme study, xenograft models of CD52* leukemia were created by
engrafting scid mice with several CD52-expressing human cells lines, as well as with Chinese
Hamster Ovary cells that had been transduced with plasmid encoding human CD52 (Siders et al.
2010). The mice were subsequently treated with intravenous alemtuzumab, whose activity was
assessed indirectly, by monitoring mouse survival.
Similar to the first study, removal of
complement had no effect on mouse survival; notably, survival duration was also unaffected by
removing macrophages. In contrast, treatment of the mice with anti-sialo-GM-1 antibody or
anti-Gr-1 antibody led to shorter mouse survival times, which suggests a decrease of
alemtuzumab anti-neoplastic activity (Siders et al. 2010). While the same problems of specificity
of the depleting antibodies are present in this study, the authors' decision to evaluate
alemtuzumab activity almost entirely based on the survival of mice xenografted with tumor cell
140
lines was surprising. Mice were euthanized when they developed hind-limb paralysis, which
develops as the cell lines seed and grow in the brain or spinal cord of the mouse; it is unclear
what role alemtuzumab, which we show cannot cross the blood-brain barrier, can play on the
development of paralyzing tumors in the brain or the spine.
The finding that NK cell or
neutrophil depletion (if indeed it occurred) has a negative effect on paralysis-free survival is
likely to be more relevant to the effect of these cells on tumor development in the nervous
system than to the anti-neoplastic mechanism of alemtuzumab.
From the results presented above, it is clear that, although mice of the NOD strain lack
complement activity, and although NSG mice in particular lack NK cells, the presence of
macrophages appears to be sufficient for antibody-mediated target cell clearance. The exact
mechanism of this clearance - whether macrophages phagocytose target cells or kill them by
releasing cytotoxic compounds - remains to be investigated, potentially by combining
microscopy and video tracking techniques. Another potential point of interest is the nature of the
Fc receptor used by these macrophages to bind alemtuzumab; this can be investigated by looking
at alemtuzumab-mediated tumor cell killing in vitro by macrophages derived from mice with
various Fc receptor defects.
Filling in the details of these processes will further help the
usefulness of this particular model, and hopefully that of other humanized mouse cancer models,
in screening and evaluating anti-neoplastic treatments with monoclonal antibodies.
141
3.5
Materials and Methods
3.5.1
Generation of the pro-B ALL model
The humanized mouse model of pro-B cell acute lymphoblastic leukemia (pro-B ALL)
was generated as described in Chapter 2 of this thesis. Briefly, human CD133* cells were
isolated from cord blood and cultured in vitro in defined media supplemented with several
growth factors. Expanded CD133* cells were re-isolated from the culture and spin-infected with
lentivirus in which the combination of the Ep enhancer and the CD19 promoter control the
expression of the GFP reporter as well as the Myc and Bcl-2 oncogenes (GMB virus). Virusexposed
cells
were
subsequently
engrafted
into
sublethally
irradiated
mice of the
immunodeficient NOD-scidI2rj' (NSG) strain. For ease of use, animals engrafted with human
CD133+ cells that had been spin-infected with the GMB virus are referred to as GMB mice.
Leukemia development in these mice manifested itself as an outgrowth of a population of
GFP* human pro-B cells that also overexpressed Myc and Bcl-2.
These cells were readily
detectable in the peripheral blood of live animals by flow cytometry, and were found in
numerous internal organs of the animals in the late stages of the disease.
Cohorts of secondary mice were generated also as described in Chapter 2 of this thesis.
Briefly, splenocytes were harvested from primary GMB mice, resuspended in StemSpan media,
and injected into groups of age-matched, unirradiated NSG mice. Each secondary recipient was
injected with ~106 GFP* cells. Disease progression in these mice was monitored by determining
the number of GFP* cells present in 10 pl of peripheral blood collected from the tail vein.
All animal use was in accordance with the guidelines set forth by the MIT Committee on
Animal Care.
142
3.5.2
Alemtuzumab and its variants
Clinical-grade alemtuzumab (Genzyme) was obtained at a concentration of 30 mg/ml in
sterile PBS, and stored at 4*C until needed.
Some alemtuzumab was labeled with the Alexa Fluor 750 fluorescent dye, using the
SAIVI Rapid Antibody Labeling Kit (Invitrogen). Dye-labeled alemtuzumab was purified using
a size exclusion column provided with the kit. Subsequently, the concentration of labeled
alemtuzumab was determined using a competitive binding assay, where different dilutions of
unlabeled alemtuzumab were used to compete against a known volume of dye-labeled
aletuzumab for binding of CD52 on GMB cells.
F(ab') 2 fragments of alemtuzumab were generated using the F(ab') 2 Preparation Kit
(Pierce). In brief, alemtuzumab (30mg/ml) was incubated with pepsin, and the resulting F(ab') 2
fragments were separated from the digested Fc fragments by affinity chromatography, using a
protein A column provided with the kit. The purity of the F(ab') 2 fragments was verified by
SDS-PAGE combined with Coumassie staining. Subsequently, the concentration of the F(ab') 2
fragments was determined using a competitive binding assay, where different dilutions of
alemtuzumab were used to compete against a known volume of the F(ab') 2 fragments for binding
of CD52 on GMB cells.
Immediately prior to use, full-length alemtuzumab was diluted to 1 mg/ml in sterile PBS;
similarly, dye-labeled alemtuzumab and alemtuzumab F(ab') 2 fragments were diluted to the
same molar concentration as full-length alemtuzumab.
Weight-adjusted doses of these
compounds were then administered via tail vein injection, so that each mouse received 5 pd of
alemtuzumab (or its variants) per gram of body weight.
143
3.5.3
Chemotherapeutics
Cyclophosphamide, vincristine,
doxorubicin was from Tocris Bioscience.
and dexamethasone
were all from Calbiochem;
Immediately prior to use, chemotherapeutics were
weighed and dissolved at follows: cyclophosphamide (30 mg/ml in PBS), vincristine (0.2 mg/ml
in PBS), dexamethasone (0.1 mg/ml in PBS), doxorubicin (0.5 mg/ml in saline). The drugs were
then kept at room temperature until their injection into mice, at Opl/g mouse body weight.
3.5.4
Tissue preparation, antibodies and flow cytometry
At various time points, mice were euthanized by CO 2 asphyxiation, and their blood, bone
marrow, liver, spleen, and brain were harvested. Marrow was flushed from the bones and cell
suspensions were prepared by passing extracted marrow through a syringe with a 27 gauge
needle. Prior to extraction from euthanized mice, livers were flushed with sterile PBS; after
extraction they were ground using a Bellco 85 ml tissue sieve kit (Bellco Glass). Ground liver
fragments were then incubated with 2 ptg/ml collagenase A (Roche) for 1 hour at 37*C, and
leukocytes were isolated by centrifugation on a discontinuous 35% Percoll gradient (GE
Healthcare).
Leukocytes from the spleen and brain were obtained by grinding these organs
between frosted glass slides and filtering through 70 jim nylon mesh filters (BD Falcon).
Residual erythrocytes in all samples were lysed, and cells were counted. Antibodies to human
CD10, CD19, CD20, CD33, CD34, CD45, CD52, CD133, IgM and to murine CD45.1, CD11b,
CD 11 c, CD 16, CD32, F4/80, and Gr- 1, as well as appropriate isotype controls, were conjugated
to FITC, PE, PerCP/Cy5.5,APC, PE/Cy7 or APC/Cy7 (all from BioLegend). Cells were stained
with indicated antibodies in PBS containing 0.1% w/v bovine serum albumin (Sigma). Stained
cells were analyzed using the C6 flow cytometer (Accuri Cytometers), or the FACSCalibur,
144
FACSCanto or LSR II flow cytometers (BD Biosciences) in the Koch Institute flow cytometry
core facility. Dead cells were excluded from analysis by DAPI or propidium iodide staining.
Flow cytometry results were analyzed using the CFlow (Accuri Cytometers), FACSDiva (BD
Biosciences), or FlowJo (Tree Star) software suites.
3.5.5
Complement-dependent cytotoxicity (CDC) assay
Tumor cells for this assay were purified from splenocytes of secondary GMB mice by
using a combination of PE-conjugated antibody to human CD19 (BioLegend) and the EasySep
PE Selection Kit (Stem Cell Technologies), according to the manufacturers' protocols.
As
verified by flow cytometry, virtually all human CD19* splenocytes from these mice were GFP*
tumor cells.
Tumor cells were incubated in Dulbecco's Modified Eagle Medium (Koch Institute core
media facility) supplemented with 10mM HEPES, 100 U/ml Penicillin, 100 pIg/ml Streptomycin
(all from Mediatech) and 0.1% v/v 2-mercaptoethanol (Sigma). Tumor cells were resuspended
at 2x 106 GFP* cells/ml, and placed in wells of a 96-well flat-bottom plate at 2x 105 GFP*
cells/well.
Where indicated, media was supplemented with either 10% v/v human serum
(Research Blood Components), 10% v/v mouse serum harvested from NSG or B6 mice, or
batches of these sera that had been heat-inactivated by incubation in a 55*C water bath for 2
hours. Alemtuzumab was added at the indicated concentrations, and the cells were incubated in
a humidified incubator at 37*C with 5% CO 2.
After 48 hours, the number of non-viable GFP* cells, defined as those that fail to exclude
propidium iodide, was assessed by flow cytometry, using the C6 flow cytometer and its
accompanying software package (Accuri Cytometers).
145
3.5.6
In vitro tumor cell killing assay
Macrophages for this assay were obtained as follows. NSG mice received intraperitoneal
injections of 1 ml of thioglycollate broth (Sigma); 4 days later, mice were euthanized by CO 2
asphyxiation and their peritoneal lavage was harvested. Macrophages were purified from the
lavage using a combination of APC-conjugated antibody to F4/80 (BioLegend) and the EasySep
APC Selection Kit (Stem Cell Technologies), according to the manufacturers' protocols.
Tumor cells for this assay were purified from splenocytes of secondary GMB mice, as
described above (Section 4.3.6).
Subsequent experiments were performed in RPMI 1640 medium (Koch Institute core
media facility) supplemented with 10% v/v Fetal Bovine Serum, 10mM HEPES buffer, 100
U/ml Penicillin, and 100 pg/ml Streptomycin (all from Mediatech).
GFP* tumor cells were
incubated in the absence or presence of F4/80* macrophages; full-length alemtuzumab, or its
F(ab') 2 fragments were added to the cells as indicated.
vortexed approximately once every hour.
Cells were incubated at 37*C and
At indicated time points after the start of the
incubation, GFP* cells were enumerated using the C6 flow cytometer and the CFlow software
suite (Accuri Cytometers).
3.5.7
In vivo macrophage depletion
Macrophages were depleted in vivo through intravenous injections of clodronate
encapsulated into liposomes. Clodronate was a gift from Roche Diagnostics; it was incorporated
into liposomes (0.69 M) by Dr. Nico van Rooijen, as previously described (Van Rooijen and Van
Kesteren-Hendrikx 2003). Clodronate liposomes were stored at 4*C and were warmed up to
room temperature immediately prior to their injection into tail veins of recipient mice. Each
146
mouse received approximately 100 1dof the clodronate liposome suspension; 48-72 hours later,
splenic macrophage depletion was verified by flow cytometry analysis of splenocytes from
recipient mice; macrophages were defined as CD11 b CD11c Gr-1~ cells, while granulocytes
were defined as CD11b+ Gr-1 cells.
3.5.8
Histology
Samples of murine spleen, liver, and brain were microdissected from mice, incubated in a
10% formalin solution overnight, and then preserved in a 70% ethanol solution until processing.
Whole bone (femur) samples were microdissected from mice, incubated in a 10% formalin
solution overnight, and then transferred into a decalcification solution (10% w/v disodium
ethylenediaminetetraacetate
(EDTA), pH -6.6)
for approximately 15 days.
Following
decalcification, bone samples were preserved in a 70% ethanol solution until processing.
Finally, smears of peripheral blood and freshly-extracted bone marrow were obtained and air
dried prior to processing.
Processing of these samples, including embedding organ samples in paraffin, obtaining 5
pm-thick sections of the embedded organs, and staining samples with the hematoxylin and eosin
(H&E) stain was performed by the Koch Institute core histology facility. Dr. Roderick Bronson
assisted with the analysis of the stained histological samples.
147
3.6
References
Adams, J.M., A.W. Harris, C.A. Pinkert, L.M. Corcoran, W.S. Alexander, S. Cory, R.D.
Palmiter, and R.L. Brinster. 1985. The c-myc oncogene driven by immunoglobulin enhancers
induces lymphoid malignancy in transgenic mice. Nature 318: 533-8.
Aster, J.C. 2005. Diseases of the White Blood Cells, Lymph Nodes, Spleen, and Thymus.
In: Robbins and CotranPathologicBasis ofDisease. AK Abbas, N Fausto, and V Kumar. 7th
ed. Philadelphia, PA: Elsevier, Inc.
Bernstein, I., M. Tam, and R. Nowinski. 1980. Therapy with Monoclonal Antibodies
against a Thymus Differentiation Antigen. Science 207, no. 4426: 68-71.
Brinster, R.L., H.Y. Chen, A Messing, T van Dyke, A.J. Levine, and R.D. Palmiter. 1984.
Transgenic mice harboring SV40 T-antigen genes develop characteristic brain tumors. Cell 37,
no. 2: 367-79.
Cartron, G., L. Dacheux, G. Salles, P. Solal-Celigny, P. Bardos, P. Colombat, and H.
Watier. 2002. Therapeutic activity of humanized anti-CD20 monoclonal antibody and
polymorphism in IgG Fc receptor Fcgamma RIIIa gene. Blood 99, no. 3: 754-8.
Clynes, R.A., T.L. Towers, L.G. Presta, and J.V. Ravetch. 2000. Inhibitory Fc receptors
modulate in vivo cytoxicity against tumor targets. Nature Medicine 6, no. 4: 443-6.
Coiffier, B., E. Lepage, J. Briere, R. Herbrecht, H. Tilly, R. Bouabdallah, P. Morel, et al.
2002. CHOP chemotherapy plus rituximab compared with CHOP alone in elderly patients with
diffuse large-B-cell lymphoma. New EnglandJournal ofMedicine 346, no. 4: 235-42.
Daley, J.M., A.A. Thomay, M.D. Connolly, J.S. Reichner, and J.E. Albina. 2008. Use of
Ly6G-specific monoclonal antibody to deplete neutrophils in mice. JournalofLeukocyte Biology
83, no. 1: 64-70.
Demko, S., J. Summers, P. Keegan, and R. Pazdur. 2008. FDA drug approval summary:
alemtuzumab as single-agent treatment for B-cell chronic lymphocytic leukemia. The Oncologist
13, no. 2: 167-74. doi:10.1634/theoncologist.2007-0218.
http://www.ncbi.nlm.nih.gov/pubmed/18305062.
Di Gaetano, N., E. Cittera, R. Nota, A. Vecchi, V. Grieco, E. Scanziani, M. Botto, M.
Introna, and J. Golay. 2003. Complement activation determines the therapeutic activity of
rituximab in vivo. JournalofImmunology 171, no. 3: 1581-7.
Dougan, M., and G. Dranoff. 2009. Immune therapy for cancer. Annual Review of
Immunology 27: 83-117.
Felsher, D.W. 2003. Cancer revoked: oncogenes as therapeutic targets. Nature Reviews
Cancer 3: 5-10.
148
Fiebig, H.H., A. Maier, and A.M. Burger. 2004. Clonogenic assay with established
human tumour xenografts: correlation of in vitro to in vivo activity as a basis for anticancer drug
discovery. EuropeanJournalof Cancer40, no. 6: 802-20.
Fraser, G., C.A. Smith, K. Imrie, and R. Meyer. 2007. Alemtuzumab in chronic
lymphocytic leukemia. Current Oncology 14, no. 3: 96-109.
Frese, K.K., and D.A. Tuveson. 2007. Maximizing mouse cancer models. Nature Reviews
Cancer 7, no. 9: 645-58.
Greenwood, J., M. Clark, and H. Waldmann. 1993. Structural motifs involved in human
IgG antibody effector functions. EuropeanJournalofImmunology 23, no. 5: 1098-104.
Hale, G., M.R. Clark, R. Marcus, G. Winter, M.J.S. Dyer, J.M. Phillips, L. Riechmann,
and H. Waldmann. 1988. Remission induction in non-Hodgkin lymphoma with reshaped human
monoclonal antibody CAMPATH-1H. Lancet 332, no. 8625: 1394-9.
Hale, G., S. Bright, Gill Chumbley, T. Hoang, D. Metcalf, A.J. Munro, and H.
Waldmann. 1983. Removal of T cells from bone marrow for transplantation: a monoclonal
antilymphocyte antibody that fixes human complement. Blood 62, no. 4: 873-82.
Hanahan, D. 1985. Heritable formation of pancreatic beta-cell tumours in transgenic mice
expressing recombinant insulin/simian virus 40 oncogenes. Nature 315: 115-22.
Heit, W., D. Bunjes, M. Wiesneth, T. Schmeiser, R. Arnold, G. Hale, H. Waldmann, and
H. Heimpel. 1985. Ex vivo T-cell depletion with the monoclonal antibody Campath-1 plus
human complement effectively prevents acute graft-versus-host disease in allogeneic bone
marrow transplantation. British Journalof Haematology 64, no. 3: 479-86.
Hu, Y., M.J. Turner, J. Shields, M.S. Gale, E. Hutto, B.L. Roberts, W.M. Siders, and J.M.
Kaplan. 2009. Investigation of the mechanism of action of alemtuzumab in a human CD52
transgenic mouse model. Immunology 128, no. 2: 260-70.
Imai, K., and A. Takaoka. 2006. Comparing antibody and small-molecule therapies for
cancer. Nature Reviews Cancer6, no. 9: 714-27.
Ishikawa, F., M. Yasukawa, B. Lyons, S. Yoshida, T. Miyamoto, G. Yoshimoto, T.
Watanabe, K. Akashi, L.D. Shultz, and M. Harada. 2005. Development of functional human
blood and immune systems in NOD/SCID/IL2 receptor gamma chain-null mice. Blood 106, no.
5: 1565-73.
Janeway, Jr., C.A., P. Travers, M. Walport, and M.J. Shlomchik. 2001. Immunobiology.
5th ed. New York, NY: Garland Publishing.
149
Keating, M.J., I. Flinn, V. Jain, J.-L. Binet, P. Hillmen, J. Byrd, M. Albitar, et al. 2002.
Therapeutic role of alemtuzumab (Campath-1H) in patients who have failed fludarabine: results
of a large international study. Blood 99, no. 10: 3554-61.
Kelland, L.R. 2004. Of mice and men: values and liabilities of the athymic nude mouse
model in anticancer drug development. EuropeanJournalof Cancer40, no. 6: 827-36.
Kottaridis, P.D., D.W. Milligan, R. Chopra, R.K. Chakraverty, S. Chakrabarti, S.
Robinson, K. Peggs, et al. 2000. In vivo CAMPATH-1H prevents graft-versus-host disease
following nonmyeloablative stem cell transplantation. Blood 96, no. 7: 2419-25.
Kdhler, G., and C. Milstein. 1975. Continuous cultures of fused cells secreting antibody
of predefined specificity. Nature 256: 495-7.
Laporte, J.P., F. Isnard, L. Garderet, L. Fouillard, and N.-C. Gorin. 2004. Remission of
adult acute lymphocytic leukaemia with alemtuzumab. Leukemia 18, no. 9: 1557-8.
Lemery, S.J., J.Z. Zhang, M.D. Rothmann, J. Yang, J.C. Earp, H. Zhao, A. McDougal, et
al. 2010. US Food and Drug Administration Approval: Ofatumumab for the Treatment of
Patients with Chronic Lymphocytic Leukemia Refractory to Fludarabine and Alemtuzumab.
Clinical Cancer Research (Published: 1-22.
Maloney, D.G., A.J. Grillo-Lopez, C.A. White, D. Bodkin, R.J. Schilder, J.A. Neidhart,
N. Janakiraman, et al. 1997. IDEC-C2B8 (Rituximab) Anti-CD20 Monoclonal Antibody
Therapy in Patients With Relapsed Low-Grade Non-Hodgkin's Lymphoma. Blood 90, no. 6:
2188-95.
Maloney, D.G., T.M. Liles, D.K. Czerwinski, C. Waldichuk, J. Rosenberg, A. GrilloLopez, and R. Levy. 1994. Phase I clinical trial using escalating single-dose infusion of chimeric
anti-CD20 monoclonal antibody (IDEC-C2B8) in patients with recurrent B-cell lymphoma.
Blood 84, no. 8: 2457-66.
Messing, A., H.Y. Chen, R.D. Palmiter, and R.L. Brinster. 1985. Peripheral neuropathies,
hepatocellular carcinomas and islet cell adenomas in transgenic mice. Nature 316: 461-3.
Miller, R.A., A.R. Oseroff, P.T. Stratte, and R. Levy. 1983. Monoclonal antibody
therapeutic trials in seven patients with T-cell lymphoma. Blood 62, no. 5: 988-95.
Miller, R.A., D.G. Maloney, R. Warnke, and R. Levy. 1982. Treatment of B cell
lymphoma with monoclonal anti-idiotype antibody. New England JournalofMedicine 306, no.
9: 517-22.
Ostrand-Rosenberg, S. 2004. Animal models of tumor immunity, immunotherapy and
cancer vaccines. Current Opinion in Immunology 16, no. 2: 143-50.
150
Palmiter, R.D., H.Y. Chen, A. Messing, and R.L. Brinster. 1985. SV40 enhancer and
large-T antigen are instrumental in development of choroid plexus tumours in transgenic mice.
Nature 316: 457-60.
Press, O.W., F. Appelbaum, J.A. Ledbetter, P.J. Martin, J. Zarling, P. Kidd, and E.D.
Thomas. 1987. Monoclonal antibody IF5 (Anti-CD20) Serotherapy of Human B Cell
Lymphomas. Blood 69, no. 2: 584-91.
Ravandi, F., and S. O'Brien. 2006. Alemtuzumab in CLL and other lymphoid neoplasms.
CancerInvestigation 24, no. 7: 718-25.
Reff, M.E., K. Carner, K.S. Chambers, P.C. Chinn, J.E. Leonard, R. Raab, R.A.
Newman, N. Hanna, and D.R. Anderson. 1994. Depletion of B cells in vivo by a chimeric mouse
human monoclonal antibody to CD20. Blood 83, no. 2: 435-45.
Reiff, A. 2005. A review of Catnpath in autoimmune disease: Biologic therapy in the
gray zone between immunosuppression and immunoablation. Hematology 10, no. April: 79-93.
Repp, A.C., E.S. Mayhew, S. Apte, and J.Y. Niederkorn. 2000. Human uveal melanoma
cells produce macrophage migration-inhibitory factor to prevent lysis by NK cells. Journalof
Immunology 165, no. 2: 710-5.
Riechmann, L., M. Clark, H. Waldmann, and G. Winter. 1988. Reshaping human
antibodies for therapy. Nature 332, no. 6162: 323-7.
Sausville, E.A., and A.M. Burger. 2006. Contributions of human tumor xenografts to
anticancer drug development. Cancer Research 66, no. 7: 3351-4.
Schrama, D., R.A. Reisfeld, and J.C. Becker. 2006. Antibody targeted drugs as cancer
therapeutics. Nature Reviews DrugDiscovery 5, no. 2: 147-59.
Shultz, L.D., B.L. Lyons, L.M. Burzenski, B. Gott, X. Chen, S. Chaleff, M. Kotb, et al.
2005. Human Lymphoid and Myeloid Cell Development in NOD/LtSz-scid IL2R{gamma}null
Mice Engrafted with Mobilized Human Hemopoietic Stem Cells. JournalofImmunology 174:
6477-89.
Siders, W.M., J. Shields, C. Garron, Y. Hu, P. Boutin, S. Shankara, W. Weber, B.
Roberts, and J.M. Kaplan. 2010. Involvement of neutrophils and natural killer cells in the antitumor activity of alemtuzumab in xenograft tumor models. Leukemia & Lymphoma 51, no. 7:
1293-304.
US Food and Drug Administration. FDA: Pfizer Voluntarily Withdraws Cancer
Treatment Mylotarg from U.S. Market. June 21, 2010.
http://www.fda.gov/NewsEvents/Newsroom/PressAnnouncements/ucm216448.htm.
151
Van Rooijen, N., and E. Van Kesteren-Hendrikx. 2003. " In Vivo " Depletion of
Macrophages by Liposome-Mediated " Suicide ". Methods in Enzymology 373, no. 1984: 3-16.
Waldmann, H., G. Hale, G. Cividalli, Z. Weshler, D. Manor, E.A. Rachmilewitz, A.
Polliak, et al. 1984. Elimination of graft-versus-host disease by in-vitro depletion of alloreactive
lymphocytes with a monoclonal rat anti-human lymphocyte antibody (CAMPATH-1). 324, no.
8401: 483-6.
152
Chapter 4
Summary and Future Directions
153
4.1 Summary
The ability to engraft human hematopoietic stem cells (HSCs) into severely
immunodeficient mice provides an excellent opportunity to study the development and function
of the human immune system in a small animal model. Recent advances made in the field of
hematopoietic stem cell culture, whereby human HSCs can be expanded up to 20-fold in a
defined media supplemented by several cytokines and without the use of supporting stromal
cells, extend this possibility further. In particular, in vitro HSC expansion greatly enhances the
efficiency with which these normally-quiescent cells can be transduced with viral vectors
carrying exogenous genes. In turn, rapid and efficient transgenesis of human HSCs allows for
the modeling and study of a variety of processes involved in the development and function of the
human immune system as well as the dysregulation of these processes that leads to hematologic
malignancies.
In this work, the latter opportunity was pursued.
Because the majority of human
leukemias and lymphomas are of B cell origin, it seemed most relevant to model precisely these
types of disorders. Consequently, the combination of the Ep. enhancer and the human CD19
promoter, the activity of which has been previously described as being highly restricted to B
cells, was used to control the expression of two oncogenes highly relevant to human lymphomas,
namely Myc and Bcl-2, as well as the GFP reporter. Stoichiometric expression of two or more
transgenes was attained by separating their sequences within the expression cassette with the 2A
peptide sequence, which induces a ribosomal skip in translation of the messenger RNA
molecule. Finally, stable transduction of human HSCs was achieved by employing a lentiviral
vector.
154
After optimizing the conditions for virus production, in vitro-expanded human CD133*
cells, a population greatly enriched for HSCs, were spin-infected with lentiviruses carrying the
GFP reporter alone (G), in combination with Bcl-2 (GB) or Myc (GM), or with both oncogenes
(GMB).
The cells were then engrafted into sublethally irradiated, severely immunodeficient
NOD/scid, ycn" (NSG) mice.
Cells transduced with the G virus gave rise to small percentages of GFP* cells, which in
most likelihood corresponded to the fraction of HSCs transduced with the lentivirus;
furthermore, these cells served to confirm the B lineage restriction of the promoter.
Many more GFP* B cells arose from HSCs that had been transduced with the GB virus;
all stages of B cell development were seen among the expanded GB cells, though an increased
proportion of pro-B cells in the periphery, as compared to the relative proportions of GFP~
human B cells in GB mice as well as the proportions of both GFP~ and GFP+ B cells in the G
mice, indicated a mild Bcl-2-dependent block in differentiation. Efforts to culture GB cells ex
vivo or to transplant them into secondary mice did not succeed. As Bcl-2 is an anti-apoptotic
protein that does not induce proliferation, attempts were made to stimulate GB cell proliferation
exogenously, by repeated injections of the TNP-LPS mitogen, ultimately also proved to be
unsuccessful.
In contrast to great B cell expansion seen in GB mice, animals engrafted with human
cells that had been spin-infected with the GM virus failed to develop any detectable levels of
GFP* cells. Though it is possible that lentiviral infection failed in these cases, the most likely
explanation for this phenotype is a rapid Myc-induced apoptosis of cells overexpressing this
transgene.
155
Finally, a rapidly progressing, aggressive hematologic malignancy involving GFP+
human pro-B cells consistently developed in mice reconstituted with human cells that had been
spin-infected with the GMB virus. Leukemic blasts were in the pro-B cell stage of development,
and the pattern of organ penetration by these cells resembled human acute lymphoblastic
leukemia (pro-B ALL). Given the phenotypes of the GB and GM mice, the likely explanation
for the GMB phenotype is a Bcl-2-mediated rescue of developing transgenic B cells from Mycinduced apoptosis; the rapid appearance GFP* pro-B cells that soon comprised the overwhelming
majority among all leukocytes, as well as the oligoclonal nature of the leukemia, confirmed that
Bcl-2 and Myc together are sufficient for development of overt malignancy.
GMB cells were easily transplantable into secondary NSG mice, in which they gave rise
to an aggressive disseminated leukemia that appeared identical to the disease which arose in the
primary GMB mice. This allowed for the creation of large cohorts of secondary mice, each
engrafted with an identical number of GFP* leukemic cells, which could be used to evaluate the
effectiveness and the mechanism of action of human-specific anti-neoplastics. One such class of
treatments that is increasingly used in cancer therapy is monoclonal antibodies; one of these,
alemtuzumab, targets the CD52 cell surface protein that is expressed by GMB cells.
Alemtuzumab is FDA-approved for treatment of CLL, and its potential role in ALL therapy has
not been systematically explored; the GMB model of human pro-B ALL was therefore used to
investigate this possibility, as well as a proof of principle that humanized mouse models of
cancer can be used for evaluating human-specific drugs.
Notably, treatment of secondary GMB mice with single-agent alemtuzumab significantly
reduced leukemic cell burden in the peripheral organs, though the drug was ineffective in the
brain and the bone marrow. The effect of the drug was shown both in vitro and in vivo to be
156
mediated by macrophages, which destroyed the leukemic cells after binding to the antibody's Fc
regions. The lack of therapeutic effect in the brain was shown to be due to the drug's inability to
reach its target cells in the meningeal space; although alemtuzumab was able to reach leukemic
cells in the bone marrow, it was only effective in that organ if population of leukemic cells was
below a certain small threshold (- 5% of the total bone marrow population). Even in those
cases, however, a single dose of alemtuzumab was not enough to eradicate minimal residual
disease.
The addition of the DNA alkylating agent cyclophosphamide, a chemotherapeutic
commonly used in leukemia treatment, to the alemtuzumab regimen helped to decrease tumor
cell burden in both the meninges and in the bone marrow; in the latter case, its synergistic effect
with alemtuzumab is quite striking, with leukemic cells essentially eliminated after this
combination chemoimmune treatment.
These results show that alemtuzumab should be
considered for clinical trials in treatment of ALL; they also show that humanized mouse models
of leukemia can indeed be useful tools in the preclinical screening and evaluation of humanspecific monoclonal antibodies, as well as other potential targets of small molecule
chemotherapy that are not well conserved between mice and humans.
4.2
Future Directions
In light of the presented results, several directions of future investigation seem
particularly useful. As discussed above, the phenotypes produced by overexpression of Myc or
Bcl-2 alone were non-malignant, and offer the opportunity to study the potential of other genes
to cooperate with either Myc, to promote cell survival, or with Bcl-2, to promote tumor
development. In addition, it would be useful to assess any additional mutations that arise in the
course of the leukemia that develops in GMB mice, especially those that give rise to particular
157
cancer phenotypes, such as seeding of the spine and the resulting hind limb paralysis.
In
addition, certain aspects of the successful in vivo response of secondary GMB mice to
alemtuzumab and cyclophosphamide remain to be clarified.
These include the ability the
combination treatment to confer significant survival benefit to the mice, as well as the
mechanistic aspects of the response itself: which murine Fc receptors are involved in
macrophage binding to alemtuzumab, for example, and what processes are used by macrophages
to accomplish killing the leukemic blasts.
One potential criticism of using humanized mice as tools to screen biological antineoplastic treatments, such as monoclonal antibodies, is that these mice lack several components
of the human immune system deemed vital in mediating the anti-tumor response. These include
NK cells, missing in the NSG mice due to the lack of the common gamma chain, and
complement, which is defective in NOD-strain mice due to their lack of the Clq component
(regardless, murine complement does not seem to bind to human antibodies). Furthermore, the
components of the innate immune system that are present, such as macrophages, are of murine
origin, so that an antibody's ability to mediate anti-tumor responses via macrophages in these
mice may not translate into effective clinical treatment. Human NK cells and macrophages,
however, do not arise in primary humanized mice, which is thought to be due to the
incompatibility of murine cytokines important for myeloid and NK cell development and the
human receptors for these cytokines on the progenitors of these cells. A recent report, however,
proposes an elegant way to resolve this problem (Chen, Khoury, & Chen, 2009). The authors
performed hydrodynamic injections of plasmids that encode human cytokines into NSG mice
engrafted with human cells. This involves a rapid injection of a relatively large volume of fluid
containing the vectors into the mice, which induces transient liver damage.
The injured
158
hepatocytes take up the injected vectors from the bloodstream, and subsequently produce and
secrete the cytokines encoded within. This procedure resulted in a lasting in vivo production of
the cytokines and the subsequent emergence of human NK cells (using vectors that encode
human IL-15 and Flt-3-ligand) and macrophages (using a vector that encodes M-CSF instead).
Presumably, components of the human complement system could be induced as well.
Using these advances, it becomes possible to construct a more complete humanized
mouse model of a response to monoclonal antibody-mediated anti-neoplastic treatment. After
human CD133+ cells are expanded in vitro, most could be used to generate standard humanized
mice, while a small proportion could be infected with an oncogene-bearing lentivirus and
engrafted into other mice. Leukemic cells that arise from transduced HSCs could then be
transplanted into secondary recipients - not "empty" NSG mice, as was done in this study, but
into animals reconstituted with an immune system derived from the same human donor. A
limiting dilution of leukemic cells could be used to simulate cancer growth from a single cell;
assessing anti-neoplastic treatment in these mice is likely to underscore any potential immune
system side effects that may be seen in patients.
Other anti-neoplastic treatments could also be evaluated using this model. GMB mice
may be particularly useful in assessing inhibitors of Bcl-2, considering that its activity likely
rescues the developing cells from Myc-induced apoptosis. GMB cells, however, were quite
resistant to all single-agent anti-neoplastic therapies that were attempted in this study, in vivo and
in vitro (e.g. Figure 3.9 and data not shown). On the other hand, GMB cells can be easily
cultured in vitro, and are quite susceptible to further transduction using lentiviral or retroviral
vectors.
This property offers an excellent opportunity to screen for human mediators of
resistance to not only traditional cytotoxic and genotoxic chemotherapeutics,
such as
159
cyclophosphamide, but also to biological treatments, such as monoclonal antibodies.
Such a
screen could be performed by infecting GMB cells with an shRNA library ex vivo, followed by
positively sorting infected cells and using them to generate cohorts of secondary GMB mice.
After a round of treatment, the remaining cells will be re-isolated, and the over-representation or
under-representation of RNAi constructs within these remaining cells may yield clues as to the
mechanisms employed by the surviving tumor cells to escape treatment, as occurs with
alemtuzumab in the bone marrow, for example. Alternatively, a similar method could be used to
identify genes that mediate certain characteristic behaviors of the tumor, for example its initial
tropism to the bone marrow, and its subsequent penetration of the meningeal space. Indeed,
these approaches have been successfully used to identify novel mediators of tumor progression
in mice, including tumor suppressors (Bric et al., 2009) and regulators of cell motility
(Meacham, Ho, Dubrovsky, Gertler, & Hemann, 2009). Identifying drug resistance mechanisms
used by human tumor cells would allow a more direct approach to selecting useful targets for
cancer treatment.
Finally, the methods described in this work can be used to model other cancers. The
combination of Myc and Bcl-2 was picked initially for their high likelihood of resulting in a
malignant phenotype; other clinically-important oncogenes should also be investigated. These
include Bcl-6, which is upregulated in many cases of diffuse large B cell lymphoma, and was
recently used to make a murine model of this disease (Cattoretti et al., 2005). Tcl-1 is another
promising oncogene, as it was successfully used to generate a mouse model of CLL (Johnson et
al., 2006). Finally, a subset of B-ALL cases contains the BCR-ABL translocation; this disease is
particularly resistant to chemotherapy, underscoring the importance of good mouse models of
treatment. Previously, transduction of human progenitor cells with a retrovirus containing the
160
BCR-ABL fusion did not result in a malignant phenotype (Chalandon et al., 2005); in that case,
however, transgene expression was under the control of the endogenous retroviral promoter,
which was neither strong nor directed to B cells.
Using the CD19 promoter instead could
ameliorate the situation, leading to high oncogene expression early in B cell development.
Indeed, if the oncogenes are sufficient to transform the cell in which they are expressed,
placing them under the control of the CD19 promoter, which is activated very early in B cell
development, is most likely to result in another model of pro-B ALL. Generation of other kinds
of hematological malignancies, such as myeloid or T cell leukemia or lymphoma, or B cell
cancers originating from cells in later stages of their development, will thus require the use of
promoters that are specific to that cell type and developmental stage. These could include
promoters of various surface molecules known to be expressed during a particular period of
cellular development; examples of these include T cell specific promoters of the CD4 antigen
(Marodon et al., 2003), and promoters of CD21 (complement receptor 2) and CD23 (Fc epsilon
receptor II), two molecules that appear on the surface of mature B cells, but, unfortunately, may
also be expressed by cells of the myeloid and T cell lineages (Debnath, Roundy, Weis, & Weis,
2007). An elegant alternative method of targeting transgene expression to specific tissues was
recently proposed by Brown et al. (2007), who use endogenous micro RNA expression profiles
of the target cells to control levels of vector-derived mRNA.
They attain this control by
incorporating specific micro RNA binding sites into the vector sequence, so that the vector
mRNA is only expressed in the target cell, but repressed in other cells by endogenous RNAi. A
combination of this approach and the use of the CD19 promoter, could thus facilitate specific
transgene expression in a particular stage of B cell development. Regardless of the method,
however, attaining precisely targeted oncogene expression will be essential to inodeling
161
hematologic malignancies in humanized mice, or humanized mouse models of any other disease
or condition that requires introduction of exogenous genes into expanding human HSCs.
162
4.3
References
Bric, A., Miething, C., Bialucha, C., Scuoppo, C., Zender, L., Krasnitz, A., et al. (2009).
Functional identification of tumor-suppressor genes through an in vivo RNA interference screen
in a mouse lymphoma model. Cancer Cell, 16(4), 324-35.
Brown, B., Gentner, B., Cantore, A., Colleoni, S., Amendola, M., Zingale, A., et al.
(2007). Endogenous microRNA can be broadly exploited to regulate transgene expression
according to tissue, lineage and differentiation state. Nature Biotechnology, 25(12), 1457-67.
Cattoretti, G., Pasqualucci, L., Ballon, G., Tam, W., Nandula, S., Shen, Q., et al. (2005).
Deregulated BCL6 expression recapitulates the pathogenesis of human diffuse large B cell
lymphomas in mice. Cancer cell, 7(5), 445-55.
Chalandon, Y., Jiang, X., Christ, 0., Loutet, S., Thanopoulou, E., Eaves, A., et al. (2005).
BCR-ABL-transduced human cord blood cells produce abnormal populations in
immunodeficient mice. Leukemia, 19(3), 442-8.
Chen, Q., Khoury, M., & Chen, J. (2009). Expression of human cytokines dramatically
improves reconstitution of specific human-blood lineage cells in humanized mice. Proceedings
of the NationalAcademy of Sciences of the United States ofAmerica, 106(51), 21783-8.
Debnath, I., Roundy, K., Weis, J., & Weis, J. (2007). Defining in vivo transcription factor
complexes of the murine CD21 and CD23 genes. The Journalof, 178, 7139-50.
Johnson, A., Lucas, D., Muthusamy, N., Smith, L., Edwards, R., De Lay, M., et al.
(2006). Characterization of the TCL-1 transgenic mouse as a preclinical drug development tool
for human chronic lymphocytic leukemia. Blood, 108(4), 1334-8.
Marodon, G., Mouly, E., Blair, E., Frisen, C., Lemoine, F., Klatzmann, D., et al. (2003).
Specific transgene expression in human and mouse CD4+ cells using lentiviral vectors with
regulatory sequences from the CD4 gene. Bone, 101(9), 3416-23.
Meacham, C., Ho, E., Dubrovsky, E., Gertler, F., & Hemann, M. (2009). In vivo RNAi
screening identifies regulators of actin dynamics as key determinants of lymphoma progression.
Nature Genetics, 41(10), 1133-7.
163
Appendices
164
A.1
Optimization of lentivirus production
Effective lentiviral infection of human hematopoietic stem cells requires using high titer
virus.
Initial titers of oncogene-bearing lentivirus were approximately 107 virions/ml of
concentrated viral supernatant.
These titers, however, were too low to infect a significant
number of human CD133k cells, since their effective infection requires a multiplicity of infection
(MOI) of at least 10 (Brenner and Malech 2003). Therefore, in order to increase viral titers, we
sought to optimize lentivirus production.
In brief, lentivirus production proceeded as follows. HEK 293FT cells were transfected
using the TransIT-LT1 transfection reagent (Mirus) and a mixture of the appropriate lentiviral
backbone, a plasmid encoding the lentiviral structural proteins (pA8.9), and a third plasmid
encoding the viral coat protein (pVSVG), and cells were incubated at 37*C. Sometime later, the
transfection media was replaced with fresh media, in order to avoid contaminating the virus with
the transfection reagent. Finally, 24-48 hours after the media change, the supernatant containing
the viral particles was collected, filtered, concentrated by ultracentrifugation, aliquoted, and
stored at -80*C.
In an effort to optimize lentivirus production, three variables in this process were
examined: the ratio of the three plasmids with which 293FT cells are transfected, the duration of
transfection, and the time between transfection and the collection of the virus-containing
supernatant.
Previously, the ratio of the lentiviral backbone to pA8.9 to pVSVG used in our laboratory
was 2:1:1.
Changing this ratio to other ratios that have been reported as successful in the
literature, namely 1:1:1 and 3:2:1, did not result in significant changes in viral titer (data not
shown).
165
The suggested transfection time for the TransIT-LT1 reagent is 24-48 hours; however,
near-total transfection of 293FT cells (as evidenced by their becoming GFP*) was observed even
if transfection media were replaced with fresh media after only 12 hours (data not shown). The
transfection time was thus shortened to 12 hours.
Finally, the method and timing of virus harvesting was examined. Twelve hours after the
start of transfection, transfection media was replaced with fresh media; virus-containing
supernatant was collected every 8 hours after that and replaced with fresh media. Viral titer in
each of these 8 hour fractions was compared to that obtained when media was collected once,
after 24 hours (Figure Al). The results indicate that virus production was highest in the first 8
hours after the transfection media change; subsequently, it declined rapidly, with only minimal
virus made 16 to 24 hours after transfection media change (Figure AlA).
Collecting viral
supernatant once, 24 hours after the transfection media change, yielded somewhat lower viral
titers than the total of what was collected in 8-hour long fractions (Figure AlB). This decline in
titer was likely due to viral degradation at 37*C, but it was not large enough to detract from the
convenience of a single viral harvest 24 hours after the transfection media change.
The protocol of lentiviral production was therefore changed to reflect the above findings.
The result of this optimization was a 10-100-fold increase in viral titers, so that viral
concentration was in the range of 108-109 virions/ml.
166
B
A
2
2
E
1.8O
16-24 hours
C 1.6
.0
03harvests
E 18
1 8-16 hours
11.4
0-8 hours
1.2
(total)
'
-
.0
.
1.6h
1.4 -101
>
1.2
'
.2
harvest
(24 hours)
11
(
0.8
0.8
0.6
0.6
0.4
0.4
0.2
0.2
>
0
G
GB
GMB
G
GB
GMB
Figure Al: Optimization of lentivirus production.
(A) Comparison among titers of the G, GB, and GMB virus produced 0-8 hours (black), 8-16
hours (grey), and 16-24 hours (white) after transfection media was changed.
(B) Comparison between 2 methods of virus harvest: collecting 3 fractions, one every 8 hours
(white) vs. harvesting once, 24 hours after transfection media change (black).
167
................................
A.2
....
..
....
.
.
Annotated sequence of the modified pEGFP-2A shuttle vector
e
Most of MCS (including 2 nd ApaI site) removed via joining of the
BglII and BamHI sites (AGATCC). What remains is:
o NheI (GCTAGC)
o AfeI, aka Eco47 III (AGCGCT, blunt)
o AgeI (ACCGGT)
present
e
*
(flanked by 5'
and 3'
added to the tail of GFP; ApaI is within the peptide;
ra
is 3'; underlined sequence is lost when BCL2 is
inserted between ApaI and NotI
Sequencing:
within GFP, 36bp upstream of 2A
TAGTT
GTAATCAATTACGGGGTCATTAGTTCATAGCCCATATATGGAGTTCCGCGTTACATAA
CTTACGGTAAATGGCCCGCCTGGCTGACCGCCCAACGACCCCCGCCCATTGACGTCAATAATGACGTATG
TTCCCATAGTAACGCCAATAGGGACTTTCCATTGACGTCAATGGGTGGAGTATTTACGGTAAACTGCCCA
CTTGGCAGTACATCAAGTGTATCATATGCCAAGTACGCCCCCTATTGACGTCAATGACGGTAAATGGCCC
GCCTGGCATTATGCCCAGTACATGACCTTATGGGACTTTCCTACTTGGCAGTACATCTACGTATTAGTCA
TCGCTATTACCATGGTGATGCGGTTTTGGCAGTACATCAATGGGCGTGGATAGCGGTTTGACTCACGGGG
ATTTCCAAGTCTCCACCCCATTGACGTCAATGGGAGTTTGTTTTGGCACCAAAATCAACGGGACTTTCCA
AAATGTCGTAACAACTCCGCCCCATTGACGCAAATGGGCGGTAGGCGTGTACGGTGGGAGGTCTATATAA
GCAGAGCTGGTTTAGTGAACCGTCAGATCCGCTAGCGCTACCGGACTCAGATC
CGCCACC
GCCCTCTAGAGAATTCACATGTT
GA
ACTCTAGAT
CATAATCAGCCATACCACATTTGTAGAGGTTTTACTTGCTTTAAAAAACCTCCCACACCTCCCCCTGAAC
CTGAAACATAAAATGAATGCAATTGTTGTTGTTAACTTGTTTATTGCAGCTTATAATGGTTACAAATAAA
GCAATAGCATCACAAATTTCACAAATAAAGCATTTTTTTCACTGCATTCTAGTTGTGGTTTGTCCAAACT
CATCAATGTATCTTAAGGCGTAAATTGTAAGCGTTAATATTTTGTTAAAATTCGCGTTAAATTTTTGTTA
AATCAGCTCATTTTTTAACCAATAGGCCGAAATCGGCAAAATCCCTTATAAATCAAAAGAATAGACCGAG
ATAGGGTTGAGTGTTGTTCCAGTTTGGAACAAGAGTCCACTATTAAAGAACGTGGACTCCAACGTCAAAG
GGCGAAAAACCGTCTATCAGGGCGATGGCCCACTACGTGAACCATCACCCTAATCAAGTTTTTTGGGGTC
168
. .
. .
......
GAGGTGCCGTAAAGCACTAAATCGGAACCCTAAAGGGAGCCCCCGATTTAGAGCTTGACGGGGAAAGCCG
GCGAACGTGGCGAGAAAGGAAGGGAAGAAAGCGAAAGGAGCGGGCGCTAGGGCGCTGGCAAGTGTAGCGG
TCACGCTGCGCGTAACCACCACACCCGCCGCGCTTAATGCGCCGCTACAGGGCGCGTCAGGTGGCACTTT
TCGGGGAAATGTGCGCGGAACCCCTATTTGTTTATTTTTCTAAATACATTCAAATATGTATCCGCTCATG
AGACAATAACCCTGATAAATGCTTCAATAATATTGAAAAAGGAAGAGTCCTGAGGCGGAAAGAACCAGCT
GTGGAATGTGTGTCAGTTAGGGTGTGGAAAGTCCCCAGGCTCCCCAGCAGGCAGAAGTATGCAAAGCATG
CATCTCAATTAGTCAGCAACCAGGTGTGGAAAGTCCCCAGGCTCCCCAGCAGGCAGAAGTATGCAAAGCA
TGCATCTCAATTAGTCAGCAACCATAGTCCCGCCCCTAACTCCGCCCATCCCGCCCCTAACTCCGCCCAG
TTCCGCCCATTCTCCGCCCCATGGCTGACTAATTTTTTTTATTTATGCAGAGGCCGAGGCCGCCTCGGCC
TCTGAGCTATTCCAGAAGTAGTGAGGAGGCTTTTTTGGAGGCCTAGGCTTTTGCAAAGATCGATCAAGAG
ACAGGATGAGGATCGTTTCGCATGATTGAACAAGATGGATTGCACGCAGGTTCTCCGGCCGCTTGGGTGG
AGAGGCTATTCGGCTATGACTGGGCACAACAGACAATCGGCTGCTCTGATGCCGCCGTGTTCCGGCTGTC
AGCGCAGGGGCGCCCGGTTCTTTTTGTCAAGACCGACCTGTCCGGTGCCCTGAATGAACTGCAAGACGAG
GCAGCGCGGCTATCGTGGCTGGCCACGACGGGCGTTCCTTGCGCAGCTGTGCTCGACGTTGTCACTGAAG
CGGGAAGGGACTGGCTGCTATTGGGCGAAGTGCCGGGGCAGGATCTCCTGTCATCTCACCTTGCTCCTGC
CGAGAAAGTATCCATCATGGCTGATGCAATGCGGCGGCTGCATACGCTTGATCCGGCTACCTGCCCATTC
GACCACCAAGCGAAACATCGCATCGAGCGAGCACGTACTCGGATGGAAGCCGGTCTTGTCGATCAGGATG
ATCTGGACGAAGAGCATCAGGGGCTCGCGCCAGCCGAACTGTTCGCCAGGCTCAAGGCGAGCATGCCCGA
CGGCGAGGATCTCGTCGTGACCCATGGCGATGCCTGCTTGCCGAATATCATGGTGGAAAATGGCCGCTTT
TCTGGATTCATCGACTGTGGCCGGCTGGGTGTGGCGGACCGCTATCAGGACATAGCGTTGGCTACCCGTG
ATATTGCTGAAGAGCTTGGCGGCGAATGGGCTGACCGCTTCCTCGTGCTTTACGGTATCGCCGCTCCCGA
TTCGCAGCGCATCGCCTTCTATCGCCTTCTTGACGAGTTCTTCTGAGCGGGACTCTGGGGTTCGAAATGA
CCGACCAAGCGACGCCCAACCTGCCATCACGAGATTTCGATTCCACCGCCGCCTTCTATGAAAGGTTGGG
CTTCGGAATCGTTTTCCGGGACGCCGGCTGGATGATCCTCCAGCGCGGGGATCTCATGCTGGAGTTCTTC
GCCCACCCTAGGGGGAGGCTAACTGAAACACGGAAGGAGACAATACCGGAAGGAACCCGCGCTATGACGG
CAATAAAAAGACAGAATAAAACGC-ACGGTGTTGGGTCGTTTGTTCATAAACGCGGGGTTCGGTCCCAGGG
CTGGCACTCTGTCGATACCCCACCGAGACCCCATTGGGGCCAATACGCCCGCGTTTCTTCCTTTTCCCCA
CCCCACCCCCCAAGTTCGGGTGAAGGCCCAGGGCTCGCAGCCAACGTCGGGGCGGCAGGCCCTGCCATAG
CCTCAGGTTACTCATATATACTTTAGATTGATTTAAAACTTCATTTTTAATTTAAAAGGATCTAGGTGAA
GATCCTTTTTGATAATCTCATGACCAAAATCCCTTAACGTGAGTTTTCGTTCCACTGAGCGTCAGACCCC
GTAGAAAAGATCAAAGGATCTTCTTGAGATCCTTTTTTTCTGCGCGTAATCTGCTGCTTGCAAACAAAAA
AACCACCGCTACCAGCGGTGGTTTGTTTGCCGGATCAAGAGCTACCAACTCTTTTTCCGAAGGTAACTGG
CTTCAGCAGAGCGCAGATACCAAATACTGTCCTTCTAGTGTAGCCGTAGTTAGGCCACCACTTCAAGAAC
TCTGTAGCACCGCCTACATACCTCGCTCTGCTAATCCTGTTACCAGTGGCTGCTGCCAGTGGCGATAAGT
CGTGTCTTACCGGGTTGGACTCAAGACGATAGTTACCGGATAAGGCGCAGCGGTCGGGCTGAACGGGGGG
TTCGTGCACACAGCCCAGCTTGGAGCGAACGACCTACACCGAACTGAGATACCTACAGCGTGAGCTATGA
GAAAGCGCCACGCTTCCCGAAGGGAGAAAGGCGGACAGGTATCCGGTAAGCGGCAGGGTCGGAACAGGAG
AGCGCACGAGGGAGCTTCCAGGGGGAAACGCCTGGTATCTTTATAGTCCTGTCGGGTTTCGCCACCTCTG
ACTTGAGCGTCGATTTTTGTGATGCTCGTCAGGGGGGCGGAGCCTATGGAAAAACGCCAGCAACGCGGCC
TTTTTACGGTTCCTGGCCTTTTGCTGGCCTTTTGCTCACATGTTCTTTCCTGCGTTATCCCCTGATTCTG
TGGATAACCGTATTACCGCCATGCAT
169
A.3
Annotated sequence of the pLB2-EpICD19-GFP lentiviral vector
MCS
Xba I (TCTAGA) - 4x cutter (2 sites w/n Em/CD19)
(GCTAGC)
Mlu I (ACGCGT) - 3x cutter
Em enhancer
Mlu I (ACGCGT)
(GGATCC)
M
(ACCGGT)
(Apa I)
Xba I (TCTAGA)
EcoRI (GAATTC) Pci I (ACATGT) -
3x cutter
3x cutter
Asc I
WRE
SAR
3'\SIN\LTR
AmpR
RSV promoter
5'\LTR
Psi
pLL2495 seq primer
FLAP
Apa I
(
)
(
)
seg primer
AR #40
Apa I
170
............
.......
.........
...........
;..:::::.:.:.:
.........
........
TCTAGAA
CGCGTTAGAGAGGTCTGGTGGAGCCTGCAAAAGTCCAGCTTTCAAAGGAACACAGA
AGTATGTGTATGGAATATTAGAAGATGTTGCTTTTACTCTTAAGTTGGTTCCTAGGAAAAATAGTTAAA
TACTGTGACTTTAAAATGTGAGAGGGTTTTCAAGTACTCATTTTTTTAMTGTCCAAATTCTTGTCAA
TCAGTTTGAGGTCTTGTTTGTGTAGAACTGATATTACTTAAAGTTTAACCGAGGAATGGGAGTGAGGCT
CTCTCATAACCTATTCAGAACTGACTTTTAACAATAATAAATTAAGTTTCAAATATTTTTAAATGAATT
GAGCAATGTTGAGTTGGAGTCAAGATGGCCGATCAGAACCAGAACACCTGCAGCAGCTGGCAGGAjAGCA
GGTCATGTGGCAAGGCTATTTGGGGAAGGGAAAATAAAACCACTAGGTAAACTTGTAGCTGTGGTTTGA
AGAAGTGGTTTTGAAACACTCTGTCCAGCCCCACCAAACCGAAAGTCCAGGCTGAGCAACACCACCT
GGGTAATTTGCATTTCTAAAATAAGTTGAGGATTCAGCCGAAACTGGAGAGGTCCTCTTTTAACTTATT
GAGTTCAACCTTTTAATTTTAGCTTGAGTAGTTCTAGTTTCCCCAAACTTAAGTTTATCGACTTCTAAA
ATGTATTTAGAATTCATTTTCAAAATTAGGTTATGTAAGAAATTGAAGGACTTTAGTGTCTTTAATTTC
TAATATATTTAGAAAACTTCTTAATTACTCTATTATTCTTCCCTCTGATTATTGTCTCATTAT
TCTTTTCCAATACCCGAAGCATTTACAGTGACTTTGTTCATGATCTTTTTTAGTTGTTTGTTTTGCCTT
ACTATTAAGACTTTGACATTCTGGTCAAAACGGCTTCACAAATCTTTTTCAAGACCACTTTCTGAGTAT
TCATTTTAGGAGAAGACTTTTTTTTTAATGAATGCAATTATCTAGACTTATTTAGTTAACTGCT
G-GTTG7GACGCGT
Cc
CGCCACCM
171
GGCCCTCTAGAGAATTCACATGTTG
IGGCGCGC
cacatgtttaagggttccggttccactaggtacaattcgatatcaagcttat
cgataatcaacctctggattacaaaatttgtgaaagattgactggtattcttaactatgttgctccttt
tacgctatgtggatacgctgctttaatgcctttgtatcatgctattgcttcccgtatggctttcatttt
ctcctccttgtataaatcctggttgctgtctctttatgaggagttgtggcccgttgtcaggcaacgtgg
cgtggtgtgcactgtgtttgctgacgcaacccccactggttggggcattgccaccacctgtcagctcct
ttccgggactttcgctttccccctccctattgccacggcggaactcatcgccgcctgccttgcccgctg
ctggacaggggctcggctgttgggcactgacaattccgtggtgttgtcggggaaatcatcgtcctttcc
ttggctgctcgcctgtgttgccacctggattctgcgcgggacgtccttctgctacgtcccttcggccct
caatccagcggaccttccttcccgcggcctgctgccggctctgcggcctcttccgcgtcttcgccttcg
ccctcagacgagtcggatctccctttgggccgcctccccgcatcgatacc
ctcgatcgagacc
tagaaaaacatggagcaatcacaagtagcaatacagcagctaccaatgctgattgtgcctggctagaag
cacaagaggaggaggaggtgggttttccagtcacacctcaggtaccaagcatggggtaaagtactgttc
tcatcacatcatatcaaggttatata-catcaa 'L--a-l
--,"L--gccacagatgtl--act+-agcctttl--aatatttc
tctaatttagtgtatatgcaatqatacT'--.-I --.k-.--tgat'Etctgaga'L--,,--gagtttctcatgtgtaatgatta
tttagagtttctctttcatct-tt--,aaa"L--tt,--+L--gtcta-gt-Lttatttttta.ctgatttgtaagacttct
ttttataatctgcatattacaattctctttactaggg+
-gttgcaaatat"--ttctgtca,-tctatggcc -gacttl---tcttaatggttttttaat+-ttaaaaataagt--*cttaatattcatgc-atctaattaacaatctt
t+-cl--ttgtgattaggacl.-ttgaa,
.cal -aagaaat+--.1 -ttc+--c'L-a ,-,actgaagtcatgatggcatgcttct
all--attattL--tctaaaagatttaaac ttttgcc+k.--tctcca"-ttagac-tataattcactggaat'-ttttt
gtatgl-atggtatgacata+L--qggt l-ccct"U'.-tattttttacatal-aaal-atattt-cctgtttttctaa
aaaagaaaaagatcatcat -ttcccattgl -aaaatgccal-atttttt',--cataggtcacLtacatatatc
aatgggt--ctgt+-tctgagct- -act -tattttatcagcctcact.gtctatccccacacatl--tcatgctt
tg--tctaaatcttqatatttagtggaacattctttccca.ttt,
'--gttctacaagaatatttttgt"Lattcr
t-tt'lu-tgggcttctata'L---acat+-t'--agaatgaggttgg--aaggtacctttaagaccaatgacttacaag
gcagctgtagatcttagccactttttaaaagaaaaggggggactggaagggctaattcactcccagctg
ctttttgcctgtactgggtctctctggttagaccagatctgagcctgggagctctctggctaactaggg
aacccactgcttaagcctcataaagctcgactgtgccttctagttgccagccatctgttgtttgcccct
cccccgtgccttccttgaccctggaaggtgccactcccactgtcctttcctaataaaatgaggaaattg
catcgcattgtctgagtaggtgtcattctattctggggggtggggtggggcaggacagcaagggggagg
attgggaagacaatagcaggcatgctggggatgcggtccggactgtactgggtctctctggttagacca
gatctgagcctgggagctctctggctaactagggaacccactgcttaagcctcaataaagcttgccttg
agtgcttcaagtagtgtgtgcccgtctgttgtgtgactctggtaactagagatccctcagaccctttta
gtcagtgtggaaaatctctagcagcatgtgagcaaaaggccagcaaaaggccaggaaccgtaaaaaggc
cgcgttgctggcgtttttccataggctccgcccccctgacgagcatcacaaaaatcgacgctcaagtca
gaggtggcgaaacccgacaggactataaagataccaggcgtttccccctggaagctccctcgtgcgctc
tcctgttccgaccctgccgcttaccggatacctgtccgcctttctcccttcgggaagcgtggcgctttc
tcatagctcacgctgtaggtatctcagttcggtgtaggtcgttcgctccaagctgggctgtgtgcacga
accccccgttcagcccgaccgctgcgccttatccggtaactatcgtcttgagtccaacccggtaagaca
172
cgacttatcgccactggcagcagccactggtaacaggattagcagagcgaggtatgtaggcggtgctac
agagttcttgaagtggtggcctaactacggctacactagaagaacagtatttggtatctgcgctctgct
gaagccagttaccttcggaaaaagagttggtagctcttgat ccggcaaacaaaccaccgctggtagcgg
tggtttttttgtttgcaagcagcagattacgcgcagaaaaaaaggatct caagaagatcctttgatctt
ttctacggggtctgacgctcagtggaacgaaaactcacgttaagggattttggtcatgagattatcaaa
aaggatcttcacctagatccttttaaattaaaaatgaagttttaaatcaatctaaagtatatatgagta
aacttggtctgacagttaccaatgcttaatcagtgaggcacctatctcagcgatctgtctatttcgttc
atccatagttgcctgactccccgtcgtgtagataactacgatacgggagggcttaccatctggccccag
tgctgcaatgataccgcgagacccacgctcaccggctccagatttatcagcaataaaccagccagccgg
aagggccgagcgcagaagtggtcctgcaactttatccgcctccatccagtctattaattgttgccggga
agctagagtaagtagttcqccagttaatagtttgcgcaacgttgttgccattgctacaggcatcgtggt
gtcacgctcgtcgtttggtatggcttcattcagctccgttcccaacgatcaaggcgagttacatgatc
ccccatgttgtgcaaaaaagcggttagctccttcggtcctccgatcgttgtcagaagtaagttggccgc
agtgttatcactcatggttatggcagcactgcataattctcttactgtcatgccatccqtaagatgctt
ttctgtgactggtgagtactcaaccaagtcattctgagaatagtgtatgcggcgaccgagttgctcttg
cccggcgtcaatacgggataataccgcgccacatagcagaactttaaaagtgctcatcattggaaaacg
ttcttcggggcgaaaactctcaaggatcttaccgctgttgagatccagttcgatgtaacccactcgtgc
acccaactgatcttcagcatcttttactttcaccagcgtttctgggtgagcaaaaacaggaaggcaaaa
tgccgcaaaaaagggaataagggcgacacggaaatgttgaatactcatactcttcctttttcaatatta
ttgaagcatttatcagggttattgtct catgagcggatacatatttgaatgtatttagaaaaataaaca
aataggggttccgcgacatttccccgaaaagtgccacctgac
ggatcgggagatctcccgat
cccctatggtgcactctcagtacaatctgctctgatgccgcatagttaagccagtatctgctccctgct
tgtgtgttggaggtcgctgagtagtgcgcgagcaaaatttaagctacaacaaggcaaggcttgaccgac
aattgcatgaagaatctgcttagggttaggcgttttgcgctgcttcgcgatgtacgggccagatatacg
cgttgacattgattattgactagtcatgttctttcctgcgttatcccctgattctgtggataaccgtat
taccgcctttgagtgagctgataccgctcgccgcagccgaacgaccgagcgcagcgagtcagtgagcga
ggaagcggaagagcgcccaatacgcaaaccgcctctccccgcgcgttggccgattcattaatgcagctg
gcacgacaggtttcccgactggaaagcgggcagtgagcgcaacgcaattaa U ,t g,-tac ca-c
c,- ci tt aUcT c -UIat
t-ar
ca ar
t~
--
c,
ctc
ai
~a
J
a
aQ
t.
a
Wc--
:-,
§{gaacrgtctctctggttagaccaatctgagcctgggagJctctctggctaactaJgga
accoactgcttaagcctcaataaagfcttgccttgagtgcttcaagtagtgtgtgcccgtctgttgtgtg
actctggtaactagagatccctcagacccttttagtcagtgtggaaaatctctagcagtggcgcccgaa
cagatgaggaggacaaggtttgccgatgctcgacc
cacggcaagagcgaggggcggcgactggtgagtacgccaaaaattttgactagcggaggctagaagga
gaaagggggggcgatacggaataaccaggaaatgt
aaggccaggggaaagaaaaaatataaattaaaacatatagtatgggcaagcagggagctagaacgatt
cgcagttaatcctggcctgttagaaacatcagaaggctgtagacaaatactgggacagctacaaccatc
ccttcagacaggatcagaagaacttagatcattatataatacag~tagcaaccctctattgtgtgcatca
173
aaggatagagataaaagacaccaaggaagctttagacaagatagaggaagagcaaaacaaaagtaagac
caccgcacagcaagcggccggccgctgatcttcagacctggaggaggagatatgagggacaattggaga
agtgaattatataaatataaagtagtaaaaattgaaccattaggagtagcacccaccaaggcaaagaga
agagtggtgcagagagaaaaaagagcagtgggaataggagctttgttccttgggttcttgggagcagca
ggaagcactatgggcgcagcgtcaatgacgctgacggtacaggccagacaattattgtctggtatagtg
cagcagcagaacaatttgctgagggctattgaggcgcaacagcatctgttgcaactcacagtctggggc
atcaagcagctccaggcaagaatcctggctgtggaaagatacctaaaggatcaacagctcctggggatt
tggggttgctctggaaaactcatttgcaccactgctgtgccttggaatgctagttggagtaataaatct
ctggaacagatttggaatcacacgacctggatggagtgggacagagaaattaacaattacacaagctta
atacactccttaattgaagaatcgcaaaaccagcaagaaaagaatgaacaagaattattggaattagat
aaatgggcaagtttgtggaattggtttaacataacaaattggctgtggtatataaaattattcataatg
atagtaggaggcttggtaggtttaagaatagtttttgctgtactttctatagtgaatagagttaggcag
ggatattcaccattatcgtttcagacccacctcccaaccccgaggggacccgacaggcccgaaggaata
gaagaagaaggtggagagagagacagagacagatccattcgattagtgaacggatcggcactgcgtgcg
ccaattctgcagacaaa.t-ggca.g*tC-7--L tcaT ccacaa-L. t a -iaaqaaaa(--Tggggga-tq.gggggtac,:- Lg
tqcacTgg aa.aaqaatagtagacataatagcaacagacatacaaacj-,aaaqaa -tacaaaaacaaat--tac
aaaaa-.1-tcaaaat tttcqgg- t: -at t ac ag-gac;, Lgc-agag, 4,1--cca(--,Tt L- gcTttagtaccgggcccggt
gctttgctctgagccagcccaccagtttggaatcractcctttttatgacttgaattttcaagtataaag
tctagtgctaaatttaatttgaacaactgtatagtttttgctggttgggggaaggaaaaaaaatggtgg
cagtgtttttttcagaattagaagtgaaatgaaaacttgttgtgtgtgaggatttctaatgacatgtgg
tggttgcatactgagtgaagccggtgagcattctgccatgtcaccccctcgtgctcagtaatgtacttt
acagaaatcctaaactcaaaagattgatataaaccatgcttcttgtgtatatccggtctcttctctggg
tagtctcactcagcctgcatttctgccagggcccgc
174
-lil-4
A.4
.........
Annotated sequence of the pLB2-Ep/CD19-GFP/Myc/Bcl-2 lentiviral vecor
MCS
(TCTAGA)
-
3x cutter now
(GCTAGC)
Mlu I (ACGCGT) - 3x cutter now
Em enhancer
Mlu I (ACGCGT)
(GGATCC)
(ACCGGT)
(Apa I - gggccc)
MYC
(Apa I)
Asc I
WRE
seg. primer
SAR
3'\SIN\LTR
AmpR
RSV promoter
5'\LTR
Psi
FLAP
Apa I (
AR #40
Apa I (
pLL2495 seq primer
)
6729. .7104
seq primer
)
175
..........
::..
.......... ....
.......
.....
.....
A
GTGGGTTGGGGCGAAGCACTTAAGAAAA
GTTTTTGAATGAAGTCTTCTTAGTGTCAGAATGTAT
CTTATTAAGGGGGTTAGATCTTTTATTCAATTGCAC
GTTTGAGGTCTTGTTTGTGTAGAACTGATATTACTTAAAGTTTAACCGAGGAATGGGAGTGAGGCTCTCT
CATAACCTATTCAGAACTGACTTTTAACAATAATAATTAAGTTTCAATATTTTTATGAATTGAGCA
ATGTTGAGTTGGAGTCAAGATGGCCGATCAGCCAGCACCTGCAGCAGCTGGCAGGCGGTCAT
GTGGCAAGGCTATTTGGGGAAGGGAAAATAACCACTAGGTAACTTGTAGCTGTGGTTTGAGAJGTG
GTTTTGAAACACTCTGTCCAGCCCCACCAACCGAAGTCCAGGCTGAGCAACACCACCTGGGTAATT
TGCATTTCTAAAATAAGTTGAGGATTCAGCCGAACTGGAGAGGTCCTCTTTTACTTATTGAGTTC
CTTTTAATTTTAGCTTGAGTAGTTCTAGTTTCCCCAAACTTAAGTTTATCGACTTCTAAAATGTATTTAG
AATTCATTTTCAAAATTAGGTTATGTAAGAAATTGAAGGACTTTAGTGTCTTTAATTTCTAATATATTTA
GAAAACTTCTTAAAATTACTCTATTATTCTTCCCTCTGATTATTGGTCTCCATTCAATTCTTTTCCAATA
CCCGAAGCATTTACAGTGACTTTGTTCATGATCTTTTTTAGTTGTTTGTTTTGCCTTACTATTAAGACTT
TGACATTCTGGTCAAACGGCTTCACAATCTTTTTCAAGACCACTTTCTGAGTATTATTTTAGAGAA
AGACTTTTTTTTTAAATGAATGCAATTATCTAGACTTATTTCAGTTGAACATGCTGGTTGGACGCGT
CCCGCCACC
176
oLcqttaqottcaccaaqa
aactatqacctcgact-
q4c ,q
ac
M qcaqccgtat
cccptca
ttctactgcgao ',4
gq4lgagaacttctac-cag:qaLgcag caI a
Ct
44gaaattcgagctgctgcoca
ccccgc'c'ct,gtcdcct
alccgccgptccg
I ggc -at
0 tcdt
4caaq5aqggcqgtggcqgg4qcttctdq
ggagat .3t
4tggtgaaccagagtttcat:ctq cgpcccgg4c
_g "9C 9"4994* d
gac5agaccttcatcaaaaacAtcatcatCcaggactgtatqtggaqcggpttctoq-gccg-plc
a
tcqtct.cagagaaqctggcctcctaccaggct
aa
ccC54 -.ggccac4qCgtctgCtcc!aC; lCl-iqp#
aqqtgCa# 'ttgaqcgccgccgcctca
t,
doi:"tcgqtgqtcttcccctacc-ct,,i !tca:acgacagtagatcgcdcaagtcctgqg,,c,4Ztcqc"g4ctcca
(j:,cctt-CtCtCcgtcct
t'tgptctqctcgacqga5
Cdgagcc
CCt99t9qtcc4t949j4o* aCC9a.CC
aox!aqC'l4'
t,.Otgaggaggaacaag
g g a
qaaatcgA-t gttgtttctgtqga aaaq&-g'gc'agqctcctqgcaaaaggLtcagagte-gga --cacct.t ctg
Ot4gaggcca.caqpaaacc.tcctcacaqcQcactggtc.cltcaagaggtqccacgt'ctpc-aC 4i !Attaqca
ag4ltcctgagAcaqatcaqci iacaacc g a t caccagccccaggtccto, 4,gaClaco.o
tcaaqaggcgaacacacaacgtcttggaqcgcca,,qaggag i4 wqagctaaaac gagot
gcgtgaQcagatcc(;,g
caaggtagtt
g, IAgqAaaaqji a g " tqqa
gcatacatcctgtccgt'cc a ' ac , rca, g aggag(: aa
t 'tt'tctqaagagq4c
at
C
cc
cacatgtttaagggttccggttc
-MGGCGCGCCMcactaggtacaattcgatatcaagcttatqgataatcaacctctggattacaaaatttgtgaaagattga
ctggtattcttaactatgttgctccttttacgctatgtggatacgctgctttaatgcctttgtatcatgc
tattgcttcccgtatggctttcattttctcctccttgtataaatcctggttgctgtctctttatgaggag
ttgtggcccgttgtcaggcaacgtggcgtggtgtgcactgtgtttgctgacgcaacccccactggttggg
gcattgccaccacctgtcagctcctttccgggactttcgctttccccctccctattgccacggcggaact
catcgccgcctgccttgcccgctgctggacaggggctcggctgttgggcactgacaattccgtggtgttg
tcggggaaatcatcgtcctttccttggctgctcgcctgtgttgccacctggattctgcgcgggacgtcct
tctgctacgtcccttcggccctcaatccagcggaccttccttcccgcggcctgctgccggctctgcggcc
177
tcttccgcgtcttcgccttcgccctcagacgagtcggatctccctttgggccgcctccccgcatcgatac
c
ctcgatcgagacctagaaaaacatggagcaatcacaagtagcaatacagcagctaccaatgct
gattgtgcctggctagaagcacaagaggaggaggaggtgggttttccagtcacacctcaggtaccaagca
tggggtaaagtactgl-tctcatcacatcatatcaaggttatataccatcaatattgccacagatgttact
tagccttttaatatttctctaatttagtgtatatgcaatgatagttctctgatttctgagat"-gagtttc
tcatgtgtaatgattatttagagtttctcLttcatcl-.gttcaaaLttttgtctagttttattttttactg
atttgtaagacttctttttata.atctgcatattacaattctctttactggggtgttgcaaatattttctg
tcattctatggcctga%--ttttc-U-LaatggtttttLaatLttaaaaa+L--aagtcttaatattcatgcaatct
aattaacaatc-t,-tctttgtggttaggactt"--gagtcataaga.aatttttctctacactgaagtcatga
tggcatgcttctaL--ai-.tatttLctaaaagatttaaagtt"-tgc--ttctccatttagacttataattcact
ggaatttttttgtgtgtatggta.tgacatatgggttcccttl-.tattttttacatataaatatatttccct
gt-tttctaaaaaagaaaaagatcatcattttcccattgtaaaatgccatatttttttcataggtcactt
acatatatcaatgggtctat'-1--tctgagctctactctattttatcagcctcactgL--ctatccccacacatc
tcatgctttgctctaaatcttgatal--ttagtggaacattctttcccattttgttctacaagaatattL--tt
gtl--attgtcttttgggcttctatataca+.--tttaqaatgaggttggcaaggtacctttaagaccaatgact
tacaaggcagctgtagatcttagccactttttaaaagaaaaggggggactggaagggctaattcactccc
agctgctttttgcctgtactgggtctctctggttagaccagatctgagcctgggagctctctggctaact
agggaacccactgcttaagcctcataaagctcgactgtgccttctagttgccagccatctgttgtttgcc
cctcccccgtgccttccttgaccctggaaggtgccactcccactgtcctttcctaataaaatgaggaaat
tgcatcgcattgtctgagtaggtgtcattctattctggggggtggggtggggcaggacagcaagggggag
gattgggaagacaatagcaggcatgctggggatgcggtccggactgtactgggtctctctggttagacca
gatctgagcctgggagctctctggctaactagggaacccactgcttaagcctcaataaagcttgccttga
gtgcttcaagtagtgtgtgcccgtctgttgtgtgactctggtaactagagatccctcagacccttttagt
cagtgtggaaaatctctagcagcatgtgagcaaaaggccagcaaaaggccaggaaccgtaaaaaggccgc
gttgctggcgtttttccataggctccgcccccctgacgagcatcacaaaaatcgacgctcaagtcagagg
tggcgaaacccgacaggactataaagataccaggcgtttccccctggaagctccctcgtgcgctctcctg
ttccgaccctgccgcttaccggatacctgtccgcctttctcccttcgggaagcgtggcgctttctcatag
ctcacgctgtaggtatctcagttcggtgtaggtcgttcgctccaagctgggctgtgtgcacgaacccccc
gttcagcccgaccgctgcgccttatccggtaactatcgtcttgagtccaacccggtaagacacgacttat
cgccactggcagcagccactggtaacaggattagcagagcgaggtatgtaggcggtgctacagagttctt
gaagtggtggcctaactacggctacactagaagaacagtatttggtatctgcgctctgctgaagccagtt
accttcggaaaaagagttggtagctcttgatccggcaaacaaaccaccgctggtagcggtggtttttttg
tttgcaagcagcagattacgcgcagaaaaaaaggatctcaagaagatcctttgatcttttctacggggtc
tgacgctcagtggaacgaaaactcacgttaagggattttggtcatgagattatcaaaaaggatcttcacc
tagatccttttaaattaaaaatgaagttttaaatcaatctaaagtatatatgagtaaacttggtctgaca
gttaccaatgcttaatcagtgaggcacctatctcagcgatctgtctatttcgttcatccatagttgcctg
actccccgtcgtgtagataactacgatacgggagggcttaccatctggccccagtgctgcaatgataccg
cgagacccacgctcaccggctccagatttatcagcaataaaccagccagccggaagggccgagcgcagaa
gtggtcctgcaactttatccgcctccatccagtctattaattgttgccgggaagctagagtaagtagttc
gccagttaatagtttgcgcaacgttgttgccattgctacaggcatcgtggtgtcacgctcgtcgtttggt
atggcttcattcagctccggttcccaacgatcaaggcgagttacatgatcccccatgttgtgcaaaaaag
cggttagctccttcggtcctccgatcgttgtcagaagtaagttggccgcagtgttatcactcatggttat
178
6LiI
666DBPPBT6~;c~BD;
~
2DD
~
BE B ~E PEE
D~B;B B
PDPPDBBD;PBB4DBB;~DBBPDD
~
EE4~z ~
B
B BEBE
BBBB;DD;cB
~DBPDEPeDrnDBBBB;D 4Bmy~ ~
P;4DPBDEDD;DBDPB~D;BDBPDBBB4DBPD~D~BEB;
BE DD;;B;;;D B
B
B
BPBPD
BE~BPB
B~E~
DBBPBBP;B4;Bp;Bppp
~PEB~B;~
BBB~BB;~pBpD
36
DDD66D6P66D3D3r2Bp~? ~
PBP~rn;P~;p;;ppEpc~;DppEp-eBpo
Eo;;o;p;Bb~~
~
Ebb
;;
B
P;;EEEDE;;P;EPD;EDE;EEE;PbpEPEpbEppE~E~&~;D.eE;;;
PP
B
ED
EDE
EEEE
;~;;B
DEEPEP
DEEP
BE
PPEEE~EDED;
ED;;
DEDEDE
B;DBD;DEED;DPBBPO5
DDDDPpBDEpBBpopDooEEpDBp~P~E
B;B;EPE;;;DDD;o;PEp;BB;DpE;E;EB;BDE;E;B;~Th~
DADE ;EPE;;o;;o;oDBp;;~~~
PE;D;PEED;D;EEEJ~~y
~p.
V
L
~4P~PB~DP.
~
errii
~I
~
~vI Ii
>~
£~,p~ 4 ~ EUp, ~34r~L~
~~ffiim*
~VI
7~)
ii
*
-~
I
LwI
~
6
)I
7
~
2 ~ 9f
6:166D6DDD6D~EDEE~DDBE6D6D5DDD:~D
5
DLLA~&uDL6DKft,
VLrii
b;DE~r;~x~2>c
~
EDD
~
~~t~DJ~-
~
r
~ft
i
41
ft
fI4u4JZ4i5~4B4P 4 b
19
~
DDE~D3BDD~E:~EDEDE:lDD:V4
~
616
6~6 ~6z
666
3:1
336
36
PEDEBBPPPEBBPPPPPP3BD3B;PPPP3BEppEBp3pppppDBpB;BBB;D~~BDBpDDPD ;;;~
1m31P3EP3;;D:1PB:1DPPDDDPDB;BD;DPDDDpp;B;PBD;:1BPDD;PBPBIIB;DEDDP;:1D;PB
BPPD;3;DPPPPBDBBBB3:1;D;;BDPPPPBB;;PD4PD;DB;BPPPP;;;DPPBPDBP:1PDPDDE
3 BDD
PPPPBBBDPPPDBDBBDDDB;;D;DE;:1BPBDDPBDBBDB;p;B;BP;PPBPB:1D;:1pD;EPPDDP
j~
cgtgcgccaattctgcagacaaa-L-ggcagtatt--at -cacaattttaaaagaaaaggggggattgggggg
tacagtc caggggaaagaatagtagacataatagcaacagacatacaaactaaagaa-tacaaaaacaaa
ttacaaaaat -caaaai--t --Lcqqqtttattacagggacagcagagatccagzt -gattagtaccgggccc
ggtgctttgctctgagccagcccaccagtttggaatgactcctttttatgacttgaattttcaagtataa
agtctagtgctaaatttaatttgaacaactgtatagtttttgctggttgggggaaggaaaaaaaatggtg
gcagtgtttttttcagaattagaagtgaaatgaaaacttgttgtgtgtgaggatttctaatgacatgtgg
tggttgcatactgagtgaagccggtgagcattctgccatgtcaccccctcgtgctcagtaatgtacttta
cagaaatcctaaactcaaaagattgatataaaccatgcttcttgtgtatatccggtctcttctctgggta
gtctcactcagcctgcatttctgccagggcccgc
180