Regulation of the Arf Tumor Suppressor by E2F Transcription Factors
by
Phillip John laquinta
A.B. Molecular and Cell Biology
University of California, Berkeley, 2000
Submitted to the Department of Biology
in Partial Fulfillment of the Requirements for the Degree of
DOCTOR OF PHILOSOPHY
at the
MASSACHUSETTS INSTITUTE OF TECHNOLOGY
September 2007
© 2007 Massachusetts Institute of Technology
All rights reserved
Signature of Author
Department of Biology
August 14, 2007
Ael,
Certified By
Jacqueline A. Lees
Professor of Biology
Thesis Supervisor
Accepted By
3LS penl P. Bell
MASSACHUSETTS INSTITUTE
OF TECHNOLOGY
SEP 0 7 2007
LIBRARIES
Professor of Biology
Chairman, Graduate Committee
ARCHIVES
Regulation of the Arf Tumor Suppressor by E2F Transcription Factors
by
Phillip John laquinta
Submitted to the Department of Biology
on August 14, 2007 in Partial Fulfillment of the
Requirements for the Degree of
Doctor of Philosophy in Biology
ABSTRACT
Effective tumor suppression requires the appropriate function of two major signaling
pathways, the pRB-E2F growth-control pathway and the p53 stress-response pathway.
Members of the E2F family of transcription factors are key downstream targets of the
retinoblastoma protein, pRB, and mediate the activation of genes required for cellular
proliferation. The Arf tumor suppressor is a key regulator of p53, and causes activation
of p53-mediated cell cycle arrest or apoptosis in the presence of unrestrained proliferation
due to cellular oncogenes. E2F has been predicted to be a regulator of Arf, but the exact
mechanism of this regulation was unclear. In this study, we investigated the manner in
which E2F regulates Arf transcription. We found that Arf is a biologically-relevant target
of E2F, but that E2F regulates Arf in a unique manner distinct from its regulation of cell
cycle-dependent transcription. In wildtype mouse embryonic fibroblasts, the Arf
promoter is specifically repressed by only one E2F isoform, E2F3, and this binding does
not fluctuate during cell cycle progression. In response to oncogenic stress, such as
expression of the oncoproteins c-Myc or adenovirus E1A, or loss of the tumor
suppressors Rb or p53, activating E2F proteins are recruited to Arf and transcription of
the gene is induced. In normal mouse tissues Arf is not expressed, yet E2F does not
participate in its repression. Arf is only activated in response to the uncontrolled
proliferation characteristic of tumor cells, and this correlates with binding of activating
E2F proteins to the Arf promoter in tumor tissue in vivo. Importantly, E2Fs are engaged
in numerous tumor types, regardless of the initiating oncogenic lesion. Finally, we
propose that E2F regulation of Arf is a model for its control of a larger class of proapoptotic genes. The Arf-p53 pathway is critical for preventing tumor initiation by
responding to oncogenic mutation events. We have identified E2F as a key component of
this tumor surveillance pathway, which activates Arf in response to inappropriate
proliferation regardless of the causative tumorigenic lesion.
Thesis Supervisor: Jacqueline A. Lees
Title: Professor of Biology
Acknowledgments
First and foremost, I would like to thank Jackie for all of her help and support throughout
my graduate career. She has helped me develop both the knowledge and confidence that
are required to succeed as a scientist, and has taught me what it means to be a mentor.
Jackie has assembled an excellent group of people to work with. The Lees lab has
provided an excellent combination of intellectual stimulation and general camaraderie,
and I am thankful for everyone in the lab that helped in so many ways.
I am glad to have had the opportunity to pursue my Ph.D. in the Cancer Center. Science
cannot efficiently be performed in isolation, and the general feeling of community here is
unparalleled. I truly believe that there isn't a better place to do science than the 5th floor
of the CCR, and that feeling makes it difficult to expect to find a suitable replacement.
Thanks to everyone who made this a great place to work, especially Duaa and Andrea,
who managed to bridge the E17-E18 divide!
I feel lucky to have been surrounded by so many excellent people during grad school,
who truly made life liveable. The Band-Chris, John, Graham, Dave, Lee, Bob-and the
Pits, managed to keep my mind off the lab, where it should be. At least occasionally.
The Guys-John, Andy, Erik, Seth, Chris, for unforgettable, yet barely rememberable
nights. Plus Lucia, Gretchen, Robyn-for helping to expand my epicurean horizons.
Hannah-you are a wonderful person and friend. Thanks for helping me learn more
about myself. Emily, Ali-you've helped keep me going these last couple years. I won't
say that I can't imagine what it would've been like without you, but I'd rather not try.
Ali, thanks for your support and help finishing this. Your thoughtfulness and generosity
continue to amaze me.
Finally, I am blessed with a wonderful, supportive family. Thank you for always wanting
the best for me.
Thank you all!
TABLE OF CONTENTS
Abstract......................................................................................................................
2
Acknowledgments ......................................................................................................
3
Chapter One Introduction ................................................................................................
7
Part I: The Retinoblastoma Protein-E2F growth-control pathway ............................. 8
A. Cloning and characterization of the retinoblastoma gene family....................... 8
B. The E2F transcription factor family .........................................
.......... 10
i. Discovery and cloning ...................................................... 10
ii. Classification of the E2F proteins..........................................................
12
a. The activating E2Fs .............................................................................
12
b. The repressive E2Fs .....................................................
15
c. E2F6, 7, and 8 ............................................................................................... 17
C. Regulation of the cell cycle by RB-E2F.................................
.......... 19
i. E2F- and pocket protein-mediated transcriptional repression ........................ 21
ii. E2F-mediated transcriptional activation...............................
.......... 23
iii. Post-translational modification and regulation of E2F................................. 24
iv. E2F target genes...............................................................................................
25
D. E2F-mediated apoptosis .....................................................
26
i. Pro-apoptotic E2F target genes....................................................................... 27
ii. E2F-regulated apoptosis in vivo .....................................
........... 29
iii. Specificity of E2F induction of apoptosis ..................................... ..... 30
iv. E2F in the DNA damage response.............................
....
............. 32
Part II: The Arf-p53 stress-response pathway............................................................
A. Regulation of p53 by Mdm2 ..................................................
B. p53 phosphorylation and the DNA damage response ....................................
C. Transcriptional targets of p53................................................
D. Tumor surveillance by Arf-p53 .............................................................
i. Transcriptional regulation of Arf ............................................................
ii. Regulation of the Arf-p53 pathway by oncogenic stress in vivo ......................
References....................................................................................................................
34
34
35
37
39
41
43
45
Chapter Two Repression of the Arf tumor suppressor by E2F3 is required
for normal cell cycle kinetics .........................................
......... 66
Abstract ..................................................................................................
...................... 67
Introduction................................................................................................................... 68
Results............................................................................................................................... 71
E2F3-loss causes induction of p19" and activation of p53 in primary cells ........... 71
The up-regulation of p19 rf accounts for the cell cycle re-entry defect
of the E2f3 M EFs ................................................................................................ 73
E2F3 directly contributes to the transcriptional regulation of Arf in normal cells ... 75
The activating E2Fs are directly involved in activation of Arf in response to
oncogenic stress .................................................................. ............................ 80
Chapter Two Repression of the Arftumor suppressor by E2F3 is required
for normal cell cycle kinetics (Continued)
D iscussion ..................................................................................................................... 83
Experimental Procedures ........................................................................................ 90
A cknow ledgm ents ..................................................................... ............................. 93
.......... 94
References .....................................................................................................
Chapter Three E2F regulates the Arf-p53 tumor surveillance network in response to
oncogenic stress in vitro and in vivo.................................. ...... 99
A bstract .................................................................................................. . . .............. 100
Introduction................................................................................................................. 101
Results..................................
105
Rb inactivation leads to Arf induction and E2F activation...........................
105
E2F activates Arf in Rb-deficient tumors in vivo.................................
108
Multiple oncogenic stresses lead to E2F activation of Arfin vitro ...................... 109
E2F participates in the tumor-surveillance response in multiple
mouse tumor models .......................................................... .............................. 111
Multiple targets genes are regulated by E2F in an Arf-like manner .................... 114
D iscussion .............................................................. ............................................... 117
Experimental Procedures ......................................
121
Acknowledgments ........................................
124
References..............................
.... ......... 125
Chapter Four Discussion ............................................................................................
E2f3 is a repressor of Arf ......................................................................................
Possible mechansims of E2F3-mediated repression of Arf ................. ...................
E2F-independent repression of Arf in vivo.................................
Indirect regulation of Arf by E2F3.................................
E2F as a regulator of the Arf-p53 tumor surveillance response................................
Regulation of E2F in response to oncogenic stress .....................................
Determinants of pro-apoptotic E2F target gene specificity .....................................
Specificity among activating E2Fs in Arf transactivation ..................
E2F-independent oncogenic activation of Arf ...................................
C onclusion ..................................................................................................................
References ........................................
..................................................................
Appendix A Interplay between E2F and Bmil in regulation of Arf in normal
and tumor tissues .................................
Results and Discussion .......................................
E2Fs regulate Arf in response to oncogenic stress independent of Arf activation..
Polycomb proteins Bmil and CBX7 regulate the Ink4a locus in normal and
malignant tissues ........................................
Differential regulation of Arfby Bmil in different tumor types...........................
Bmil regulation determines E2F target gene selectivity .....................................
Experimental Procedures ......................................
Acknowledgements.....................................................................................................
132
134
136
137
138
140
141
143
145
148
150
151
156
157
158
160
163
167
169
170
Appendix A Interplay between E2F and Bmil in regulation of Arfin normal
and tumor tissues (Continued)
References ................................................................
.................................... ....
17 1
Appendix B Regulation of the Arflp53 Tumor Surveillance Network by E2F......
Abstract ..................................................
Introduction .................................................................................................................
Results.............................................
E2f3 is required for Arfrepression in unstressed cells...................
The activating E2Fs are involved in the oncogenic activation of Arf................
D iscussion ....................................................................................... ..........................
Experimental Procedures ......................................
A cknow ledgem ents.....................................................................................................
R eferences .............................................................................................................. .
173
174
175
181
181
187
190
196
198
199
BiographicalNote ........................................
204
ChapterOne
Introduction
The adult human body is composed of approximately one hundred trillion cells, which
are all derived from the single cell of the fertilized oocyte. This expansion occurs as the
result of an exquisitely controlled balance of cell growth, proliferation, differentiation,
and programmed cell death, or apoptosis. At the heart of this expansion is the cell
division cycle, whereby one cell becomes two, through the replication and segregation of
its DNA. Cancer occurs as a consequence of an accumulation of genetic mutations that
disrupt the control of all these processes, leading to deregulated cell division and
propagation of the cancer cell and its progeny, at the expense of organism as a whole.
Part I: The Retinoblastoma Protein-E2F growth-control pathway
A. Cloning and characterization of the retinoblastoma gene family
Retinoblastoma is a cancer of the eye, the hereditary form of which manifests often in
children as multiple focal tumors in one (unilateral) or both eyes (bilateral). Analysis of
the frequency and number of these lesions in unilateral versus bilateral cases led Alfred
Knudson to propose that retinoblastoma was the result of two mutations, and that
individuals exhibiting bilateral or multi-focal retinoblastoma possessed one inherited
germline mutation of a retinoblastoma-susceptibility gene (Knudson 1971). Cytogenetic
analyses identified of a region of chromosome 13 (13q14) commonly deleted in human
retinoblastoma samples (Sparkes et al. 1980; Dryja et al. 1986). A cDNA corresponding
to the retinoblastoma gene (RB-1) was cloned by chromosome walking techniques, and
the homologous mRNA was found to be absent in retinoblastoma-derived cell lines, but
present in normal retinal cells or other tumor cell lines (Friend et al. 1986; Fung et al.
1987; Lee et al. 1987a). Molecular analysis found that the protein encoded by RB-i is a
nuclear phosphoprotein of approximately 110 kilodaltons (Lee et al. 1987b).
Studies of viral oncoproteins expressed by the DNA tumor viruses led to the
discovery that the SV40 T Antigen, and adenovirus E1A and human papillomavirus E7
proteins all bind to the retinoblastoma protein (pRB), and that this interaction is required
for the transforming ability of the viral oncoproteins (DeCaprio et al. 1988; Whyte et al.
1988; Dyson et al. 1989b). Subsequently, two proteins homologous to pRB, p107 and
p130, were also cloned by virtue of their ability to associate with adenovirus E1A (Dyson
et al. 1989a; Li et al. 1993). p107 and p130 share greater homology with each other than
either protein does with pRB (Ewen et al. 1991; Hannon et al. 1993; Li et al. 1993).
Much of the sequence similarity lies in a region of the proteins denoted the "pocket
domain." For this reason, pRB, p107, and p130 are frequently referred to as the pocket
proteins.
Consistent with their significant structural homology, the pocket proteins share a
common role during cell cycle progression, likely due to their shared ability to regulate
the E2F family of transcription factors (discussed below). However, the proteins also
have distinct functions. Most notable is the unique ability of RB-1 to act as a bona fide
tumor suppressor gene in humans. It is possible that this is due to any of the greater than
100 proteins that have been shown to bind pRB (Morris and Dyson 2001). There is some
evidence, though, that the gene encoding p130 (RB2, here denoted p130 for simplicity) is
mutated in a subset of human cancers, suggesting a tumor suppressive role of this protein
in certain cases (Helin et al. 1997; Claudio et al. 2000a; Claudio et al. 2000b). Indeed,
there is accumulating evidence from compound mutant mouse models of a compensatory
role of p130 or p107 in cells that have lost pRB function. For example, mutation of the
mouse Rb gene in retinal cells leads to retinoblastoma only if combined with mutation of
p107 or p130 (MacPherson et al. 2004; MacPherson et al. 2007). Additionally, mice
chimeric for mutations in Rb and either p107 or p130 develop tumors not seen with
mutation of Rb alone, including retinoblastoma (Robanus-Maandag et al. 1998;
Dannenberg et al. 2004). Thus, it is likely that p107 and p130 are unable to compensate
for RB-1 mutation in human retinoblastoma, and this distinction is at the heart of the
differences in tumor spectrum between mice and humans with RB mutations.
B. The E2F transcription factor family
i. Discovery and cloning
E2F was first characterized as a cellular activity that could bind to the adenovirus E2
promoter (E2F stands for E2 Factor), and whose activity increased upon adenoviral
infection (Kovesdi et al. 1986; La Thangue and Rigby 1987). E2F binds the E2 promoter
at two sites with the sequence TTTCGCGC, in a region important for transcriptional
activation of the E2 gene and induction by E1A (Kovesdi et al. 1987; Yee et al. 1987).
Subsequent experiments have determined that some redundancy is tolerated in the E2F
binding site in cellular promoters, identifying a palindromic consensus site of
TTT(C/G)GCGC(C/G)AAA; however, the sequence in the E2 promoter is the most
common and preferred binding site (Kel et al. 2001).
It was soon discovered that in normal cells, E2F exists in a complex with a second
cellular factor, which is dissociated upon E1A expression; this factor was identified as the
retinoblastoma protein, pRB (Bagchi et al. 1991; Chellappan et al. 1991; Chittenden et al.
1991). Based on the ability of the encoded protein to interact with pRB, a cDNA
encoding a subunit of E2F was cloned, and this protein was termed E2F-1 (Helin et al.
1992; Kaelin et al. 1992; Shan et al. 1992). The minimal DNA binding domain of E2F1
was identified (Helin et al. 1992), and low stringency hybridization of this domain to a
cDNA library allowed the identification of additional E2F proteins, termed E2F2 and
E2F3 (Ivey-Hoyle et al. 1993; Lees et al. 1993). In all, eight genes encoding E2F
proteins have been identified, based either on their ability to bind pocket proteins, or
conservation of their DNA binding domain (reviewed in Trimarchi and Lees 2002).
Coincident with the characterization of E2F, a cellular activity named DRTF (for
differentiation-regulated transcription factor) was identified. This factor interacted with
the E2 promoter and its activity decreased with differentiation of murine embryonal
carcinoma stem cells (La Thangue and Rigby 1987). Since DRTF bound to the same
DNA sequence as E2F (La Thangue and Rigby 1987; La Thangue et al. 1990), and
interacted with pRB (Bandara and La Thangue 1991), it became clear that DRTF and
E2F were the same factor. Shortly after the cloning of E2F1, a cDNA encoding an
additional component of DRTF/E2F was isolated and named DP1, for DRTF-polypeptide
1 (Girling et al. 1993). DP1 also possessed the ability to bind E2F-recognition sites in
DNA, and contained a domain homologous to the DNA-binding domain of E2F1 (Girling
et al. 1993). It was soon confirmed that E2F1 and DP1 can form a heterodimer, and that
this dimer binds E2F consensus sites and stimulates transcription (Helin et al. 1993).
More recently, structural analysis of an E2F-DP-DNA complex showed that, despite their
relative divergence in primary amino acid sequence, E2F and DP possess similarly
structured winged-helix DNA-binding domains (Zheng et al. 1999). Indeed, the E2F-DP
dimer binds nearly symmetrically around the CGCGCG palindromic core of the E2F
binding site sequence, and absolutely conserved amino acids in both the E2F and DP
DNA-binding domains make similar base contacts to each half site of the hexamer
(Zheng et al. 1999).
ii. Classification of the E2F proteins
To date, eight genes encoding E2F subunits, and two genes encoding DP subunits, have
been identified (reviewed in Trimarchi and Lees 2002). While DP binding to E2F is
required for DNA binding in vivo, the E2F moiety of the dimer appears to confer the
specificity for all biological properties of the complex, and the E2Fs interact with both
DP1 and DP2 indiscriminately. The E2Fs are typically divided into three subgroups
defined by sequence similarity and functional data: E2F1, 2, and 3 are referred to as the
"activating E2Fs," E2F4 and E2F5 are the "repressive E2Fs," and E2F6, 7, and 8 are
pocket protein- independent transcriptional repressors (Figure 1).
a. The activating E2Fs
This subgroup exhibits a greater degree of sequence similarity to each other than to the
other E2Fs and shares a similar domain structure, with regions responsible for DNA
binding, dimerization with DP, and transactivation/pocket protein binding. They also
possess a nuclear localization signal, and regions implicated in binding to cyclin A.
E2Fl, E2F2, and E2F3 all act as potent transcriptional activators in transient reporter
I
I
I
I
11
Activators
:
I I
1 I
E2F1
E2F2
E2F3a
I
I
I
I
I
W
I
Repressors
[I[
[
E2F3b
E2F4
IU
II
E2F5
I
E2F6
X
E2F7
E2F8
0 =NLS
I
I
I
I
I
I
0 =DNA binding
0 = dimerization
i
= transactivation
Figure 1. The E2F family of transcription factors
The E2F family is divided into three groups based on their structure and function. All
E2Fs contain a homologous DNA-binding region. The "activating E2Fs" E2F1, E2F2,
and E2F3a each contain both a nuclear localization signal (NLS) and a
transactivation/pocket protein-binding domain. The "repressive E2Fs" lack the Nterminal domain present in the activating E2Fs, and E2F4 and E2F5 accordingly lack
NLS sequences. E2F6, E2F7, and E2F8 lack sequences required for transactivation and
pocket protein-bin ding, and therefore are pocket protein-independent repressors of
transcription.
assays (Helin et al. 1993; Lees et al. 1993). Overexpression of any one of these proteins
causes an induction of numerous genes involved in DNA synthesis and cell cycle
progression, and is sufficient to promote cell cycle entry from an arrested state (Johnson
et al. 1993; Qin et al. 1994; Kowalik et al. 1995; Lukas et al. 1996; DeGregori et al.
1997). Consistent with a role in gene activation, the E2Fl, E2F2, and E2F3 proteins are
all present at low or undetectable in quiescent cells, yet their levels and DNA-binding
activity peak as cells re-enter the cell cycle, at a time when their targets are activated
(Moberg et al. 1996; Leone et al. 1998; Leone et al. 2000). Finally, E2F1-3 bind the
promoters of their targets during late GI/S phase, coincident with the activation of
transcription of these genes (Takahashi et al. 2000; Rayman et al. 2002).
More recent genetic studies have shown that normal cellular proliferation is
absolutely dependent on activating E2F activity. Most strikingly, mouse embryonic
fibroblasts (MEFs) lacking E2fl, E2f2, and E2f3 are completely unable to proliferate (Wu
et al. 2001). Other studies suggest specific roles of individual activating E2Fs. E2f3/
MEFS grow more slowly than wildtype MEFs, and are impaired in re-entering the cell
cycle from quiescence (Humbert et al. 2000). While MEFs derived from E2fl 1' mice
have no obvious cell cycle defect (Humbert et al. 2000), MEFs in which either E2F1 or
E2F3 function is acutely ablated using an shRNA are unable to undergo serum-stimulated
cell cycle entry from quiescence (Kong et al. 2007). These experiments support the
theory that E2F-mediated gene activation is critical for normal cell cycle progression.
b. The repressive E2Fs
E2F4 and E2F5 comprise this second subgroup of E2F proteins. E2F4 and E2F5 are
structurally distinct from the activating E2Fs, exhibiting more homology between
themselves than to the activators. Although the E2F4 and E2F5 proteins contain domains
required for DNA binding, dimerization with DP, and transactivation/pocket protein
binding that are also conserved in the activating E2Fs, they lack the N-terminal extension
present in the activating E2Fs, which contains the nuclear localization signal and cyclin
A-binding domain (see Figure 1). Rather, E2F4 and E2F5 contain a non-canonical
hydrophobic nuclear export signal, explaining the predominantly cytoplasmic localization
of E2F4 (Gaubatz et al. 2001). Binding to a pocket protein is required for E2F4 to enter
the nucleus in Go/G 1 phase (Magae et al. 1996; Lindeman et al. 1997; Verona et al. 1997;
Rayman et al. 2002). Because it makes up the majority of E2F activity in the cell
(Moberg et al. 1996), most experiments have focused on elucidating the cellular role of
E2F4; however, based on their high degree of similarity, E2F5 is presumed to function in
a manner analogous to E2F4.
Many biological properties of E2F4 are consistent with its function as a
transcriptional repressor. E2F4 is found in the nucleus and bound to the promoter of its
target genes during Go/G 1, when these genes are not expressed (Verona et al. 1997;
Takahashi et al. 2000; Rayman et al. 2002). In this phase, it is primarily bound by either
pRB or p130 (Verona et al. 1997), and binding of E2F4 to pocket proteins eliminates any
transcriptional activation potential of E2F4 (discussed in Part C below). As cells enter
the cell cycle, E2F4 is removed from the promoter of its target genes coincident with
their activation, and is exported from the nucleus (Verona et al. 1997; Takahashi et al.
2000; Rayman et al. 2002). Additionally, although early characterization of E2F4 found
an ability to activate transcription (Ginsberg et al. 1994; Lukas et al. 1996), subsequent
experiments found that expression E2F4, unlike E2F1, E2F2, and E2F3, was not
sufficient to overcome growth inhibitory signals and induce S-phase entry (Lukas et al.
1996; Mann and Jones 1996; DeGregori et al. 1997). Also unlike the activating E2Fs,
whose expression levels peak coincident with the induction of their target genes, the
expression of E2F4 does not fluctuate during the cell cycle (Moberg et al. 1996;
Lindeman et al. 1997). Finally, while E2Fl, E2F2, and E2F3 associate specifically with
pRB and not other pocket proteins, E2F4 is competent to form complexes with all three
pocket proteins, and E2F5 binds both pRB and p130 (Hijmans et al. 1995; Moberg et al.
1996)
Subsequent to the early characterization of the E2F3 protein, another transcript
from the E2f3 locus was detected that contains a unique first exon, regulated by a
separate promoter, that is spliced to a common exon 2 (Leone et al. 2000). This mRNA
produces a protein, called E2F3b, which contains a truncated N-terminus but maintains
identical sequence throughout the rest of the protein to the originally identified product,
now referred to as E2F3a. Although the biological properties of E2F3b have not been
well-established, what is known suggests it may function as a repressor, in contrast to the
activating role of E2F3a. The overall structure of E2F3b resembles the repressive E2F4
and E2F5. While E2F3b retains cyclin A binding and a nuclear localization signal (He et
al. 2000; Leone et al. 2000), it lacks most of sequence N-terminal to the DNA binding
domain present in the activating E2Fs (Figure 1). Most strikingly, the expression pattern
of E2F3b also mirrors the expression of E2F4 and E2F5. E2F3b protein and mRNA is
present throughout the cell cycle, including in quiescent cells (Leone et al. 2000).
Throughout this document, where the role of E2F3a and E2F3b is indistinguishable, or a
function has not been specifically attributed to one of the two isoforms, they will
collectively be referred to simply as E2F3.
c. E2F6, 7, and 8
This E2F subgroup is distinct from the others E2Fs due to the absence of a pocket
protein-binding and transactivation domain in these proteins. Due to the lack of
transactivation potential, E2F6 was originally predicted to act as either a transcriptional
repressor or a dominant-negative inhibitor of other E2Fs (Trimarchi et al. 1998). It was
shown that E2F6 can block the transcriptional activity of other E2Fs, at least when
overexpressed, and can also actively inhibit transcription when recruited to a reporter
gene via a heterologous DNA-binding domain (Morkel et al. 1997; Cartwright et al.
1998; Gaubatz et al. 1998; Trimarchi et al. 1998). The ability of E2F6 to act as an
inhibitor of transcription is likely due to its association with many transcriptional
repressors of the Polycomb group, including Bmil, Ringl, HPly, EZH2, PHC3, and
others (Trimarchi et al. 1998; Ogawa et al. 2002; Attwooll et al. 2005; Deshpande et al.
2007).
Several biologically-relevant targets of E2F6-mediated repression have been
identified. E2F6 specifically regulates only those targets of E2F that are induced during
G 1/S, not those whose expression peaks later in the cell cycle. E2F6 is partially
responsible for the decrease in expression of these genes as cells traverse through S-phase
(Giangrande et al. 2004). In the absence of E2F6, E2F4 can compensate for this role,
likely explaining the lack of a cell cycle phenotype in E2f6-mutant mouse and cells
(Storre et al. 2002; Giangrande et al. 2004; Pohlers et al. 2005) In the absence of both
E2F6 and E2F4, however, these targets are now derepressed, although no appreciable cell
cycle defect was observed (Giangrande et al. 2004). Additionally, E2F6 has a role in
tissue-specific repression of gonad-specific isoforms of several structural proteins (Stag3,
SMCJlf, TUBA3, and TUBA7). In E2f6/- mice, testis-restricted expression is lost, and
these genes are expressed in several other tissues (Pohlers et al. 2005; Storre et al. 2005).
It is unknown, however, what defines the selectivity of E2F6 binding to only a subset of
E2F target genes, or why certain genes are regulated specifically by E2F6 and not by
other E2Fs.
E2F7 and E2F8, like E2F6, lack sequences implicated in transactivation and pRB
binding, but also absent is the region required for dimerization with DP. Instead, E2F7
and E2F8 both have duplications of the DNA binding domain and can bind DNA
independent of DP, as monomers or homodimers (de Bruin et al. 2003; Di Stefano et al.
2003; Logan et al. 2004; Christensen et al. 2005; Logan et al. 2005; Maiti et al. 2005).
Overexpression of either E2F7 or E2F8 inhibits E2F-mediated transactivation, suggesting
these proteins are repressors of transcription. Based on the induction of the E2F7 and
E2F8 genes during S phase, and the binding of E2F7 to a subset of E2F-responsive
promoters during S phase, E2F7 and E2F8 were proposed to function as repressors of
E2F target genes after their activation in S phase (Di Stefano et al. 2003; Christensen et
al. 2005), analogous to the role suggested for E2F6 (Giangrande et al. 2004).
C. Regulation of the cell cycle by RB-E2F
The formation and dissociation of E2F-pRB complexes is regulated during the cell cycle,
and this correlates with the different functions of E2F. In Go/G 1 phase, E2F is found in
complex with pocket proteins in their hypophosphorylated state, and this complex is not
transcriptionally active. The C-terminal transactivation domain of E2F overlaps with the
binding site for pRB (Helin et al. 1992; Kaelin et al. 1992), and binding of pRB directly
impedes the ability of E2F to activate transcription (Hiebert et al. 1992; Flemington et al.
1993). Structural studies have confirmed that pRB binding masks several conserved
residues required for E2F-mediated transcriptional activation (Lee et al. 2002). In
response to mitogenic cues, cyclin-dependent kinase (CDK) activity is increased, and the
pocket proteins are targeted for phosphorylation initially by cyclin D-CDK4/6 in G 1
phase, followed by cyclin E-CDK2 in G1/S phase (reviewed in Mittnacht 1998).
Phosphorylation of the pocket protein subunit of the complex modifies key residues at the
binding interface (Xiao et al. 2003), and leads to the release of the now transcriptionallycompetent E2F subunit.
Based on the above classification of E2Fs as activators or repressors and their
associations with pocket proteins, the following model of cell cycle-regulation by E2F
can be built (Figure 2). In Go/G 1 phase, the repressive E2Fs, E2F4 and E2F5, while
bound to the pocket proteins p107 and p130, and perhaps pRB, associate with the
promoters of E2F-responsive genes and prevent their transcription. At this time, the
activating E2Fs are bound by pRB, inhibiting their potenitial to activate transcription.
Whether complexes containing pRB and activating E2Fs are involved in the active
repression of target genes is still subject to debate (Stevaux and Dyson 2002). As cells
i0
0
ip
I
ppRB
rýP
a IP
Cell cycle
regulators,
DNA synthesis
enyzymes, etc.
Go/G 1
GI/S
Transcriptional
Repression
Transcriptional
Activation
Figure 2. Regulation of cell cycle-dependant transcription by the pRB-E2F pathway
E2F target genes are regulated by repression of transcription in Go/G 1 phase, followed by
activation in G1/S phase. Repressive complexes containing primarily E2F4 and p130
occupy promoters, and association with chromatin remodeling enzymes such as histone
deacetylases (HDAC) contributes to transcriptional repression. pRB binds to and inhibits
the transcriptional activity of the activating E2Fs 1-3. Upon cell cycle entry, cyclin-cdk
complexes such as cycD-CDK4 overcome inhibition by CDK inhibitors such as p16, and
phosphorylated the pocket proteins pRB and p130. This phosphorylation leads to
disruption of the pocket protein-E2F complexes, causing E2F4 to be exported from the
nucleus, and activating E2Fs to bind the promoters of cell cycle-regulated target genes
and activate their transcription.
are stimulated to enter the cell cycle, cyclin-CDK activity increases and targets the pocket
proteins for phosphorylation, causing a disruption of pocket protein-E2F complexes.
Because they lack nuclear localization signals in the absence of pocket protein-binding,
E2F4 and E2F5 dissociate from DNA and are exported from the nucleus. Activating
E2Fs, relieved of their pRB-mediated inhibition, bind the promoters of their targets and
activate transcription.
i. E2F- and pocket protein-mediated transcriptional repression
In addition to simply preventing transcriptional activation by E2F, a considerable amount
of data support the theory that E2F-pocket protein complexes are able to actively repress
the transcription of target genes when bound to their promoters. For example, mutation
of the E2F-binding site in the B-myb promoter leads to an increase in promoter activity
during Go/Gj phase (Lam and Watson 1993). Since this activation could not be attributed
to activating E2F proteins, it was presumed that an actively repressive E2F-containing
complex binds this promoter during Go/G 1 . Further analysis using in vivo footprinting
found that the E2F site in the B-myb promoter is occupied only in quiescent cells,
supporting the claim that B-myb is regulated solely by repressive complexes (Zwicker et
al. 1996). However, further analysis using the more sensitive chromatin
immunoprecipitation (ChIP) technique found evidence of activating E2F proteins binding
to the B-myb promoter during the G1IS transition, suggesting activating complexes may
also be involved in the regulation of this gene (Takahashi et al. 2000). Finally,
expression of a dominant-negative mutant of E2F1, which binds DNA and displaces
endogenous E2F complexes but lacks transactivation potential, resulted in an increase in
expression of all E2F target genes analyzed, equivalent to the induction seen by wildtype
E2F1 (Zhang et al. 1999; Rowland et al. 2002). While this last experiment firmly
establishes the importance E2F complexes in gene repression, it does not rule out a
function of E2F in gene activation. Indeed, cells expressing this truncated E2F1 protein
are impaired in cell cycle re-entry from quiescence, suggesting E2F-mediated gene
activation is required at least in this setting (Rowland et al. 2002).
Repressive E2F-pocket protein complexes have been shown to associate with
numerous proteins that inhibit transcription (reviewed in Frolov and Dyson 2004). Most
notably, pRB, p107, and p130 interact with histone deacetylases (HDACs) (Brehm et al.
1998; Ferreira et al. 1998; Luo et al. 1998), and HDAC1 and HDAC2 are found at E2Fregulated promoters in Go/G 1 phase along with E2F4 and p107/p130 (Rayman et al.
2002). Expression of HDAC1 enhances pRB-mediated transcriptional repression, and
HDAC inhibitors eliminate pRB's ability to repress E2F-driven transcription (Brehm et
al. 1998). In addition to covalent histone modification, pRB is able to effect nucleosome
sliding and reorganization through its association with BRGl/hBRM, which are
components of the Swi/SNF nucleosome remodeling complex (Dunaief et al. 1994;
Strober et al. 1996). However, it is possible that the involvement of BRG1 in pRBmediated growth suppression is indirectly due to its ability to induce transcription of
CDKNIA/p21 (Hendricks et al. 2004; Kang et al. 2004).
In addition to deacetylation, methylation of histones is also associated with gene
repression, particularly lysine 9 of histone H3 (H3K9). pRB interacts with the histone
methyltransferase SUV39H1, and both are necessary for H3K9 methylation of the cyclin
E promoter and repression of transcription (Nielsen et al. 2001). H3K9 methylation is
also found together with E2F4 and p130 at the cyclin A and cdc6 promoters in quiescent
cells (Ghosh and Harter 2003). Methylation of histones is thought to provide a more
stable repression than deacetylation alone. pRB has been implicated in the stable
repression of E2F target genes during irreversible cell cycle arrest, such as senescence.
pRB is required for the formation of heterchomatic domains in senescent cells, and
interacts with repressed E2F target genes, both of which are enriched in H3K9
methylation (Narita et al. 2003). Additionally, pRB interacts with the DNA
methyltransferase DNMT1, which enhances pRB transcriptional repression ability
(Robertson et al. 2000). However, DNMT1 possesses repressive activity independent of
its catalytic function, so pRB may not necessarily act by targeting DNA methylation to
E2F-responsive promoters.
ii. E2F-mediated transcriptional activation
All E2Fs contain a potent, transferable, transactivation domain (Kaelin et al. 1992),
suggesting that induction of target genes by activating E2F binding in not simply a result
of displacement of the repressive complexes. In support of an active role of E2F in gene
activation, E2Fs are known to interact with a number of transcriptional coactivator
complexes. Most notably, activating E2Fs interact with numerous histone
acetyltransferase (HAT)-containing complexes, including CBP/p300, P/CAF,
GCN5/TRRAP, and a Tip60 complex (reviewed in Dyson 1998). Promoter-binding by
activating E2Fs at the G1/S transition occurs coincident with HAT binding, and prior to
histone acetylation (Caretti et al. 2003; Taubert et al. 2004). E2F-associated HAT
activity likely leaves the chromatin in a more "relaxed" state, and therefore more
accessible to general transcription factors. In fact, E2Fs have been shown to interact
directly with TATA-binding protein while bound to DNA, through their transactivation
domain, and this may contribute to gene activation (Hagemeier et al. 1993; Emili and
Ingles 1995).
iii. Post-translational modification and regulation of E2F
Although the primary means of regulation of E2F is via its binding to pocket proteins,
other mechanisms may contribute to modulation of E2F activity. E2Fs 1-3 contain
sequences implicated in binding to cyclin A, and a cyclin A-containing complex makes
up a major component of E2F activity in growing cells (Chellappan et al. 1991; Mudryj et
al. 1991; Devoto et al. 1992; Lees et al. 1992). Cyclin A/CDK2-mediated
phosphorylation of either the E2F or DP subunit impairs the affinity of the E2F-DP
complex for DNA (Dynlacht et al. 1994; Krek et al. 1994; Xu et al. 1994). The
disruption of E2F DNA-binding activity by cyclin A-associated kinase activity may be
important for inactivation of E2F activity and appropriate S phase exit (Krek et al. 1995).
Finally, phosphorylation of E2F by cdc2 kinase may also contribute to its dissociation
from pocket proteins during G1 phase (Fagan et al. 1994).
The interaction of activating E2Fs with histone acetyltransferases, in addition to
modulating target gene activation, may have a direct effect on E2F activity. E2F1 is
acetylated by the acetyltransferase complexes p300/CBP and P/CAF on a site conserved
in E2F2 and E2F3 (Martinez-Balbas et al. 2000). This acetylation increases both E2FI's
DNA-binding and transactivation ability, as well as increasing its stability, and may
affect its target gene specificity (Pediconi et al. 2003). Additionally, the acetylation state
of E2F1 is counteracted by pRB-associated deacetylases (Martinez-Balbas et al. 2000).
Modification by ubiquitin contributes to the level of E2F activity by modulating
the absolute level of the proteins. E2Fl, 2, and 3a levels increase as cells enter the cell
cycle. As cells progress through S-phase, E2F1 and perhaps other E2Fs are targeted by
the ubiquitin-ligase complex SCFSkp2 for degradation via the ubiquitin-proteasome
pathway (Hateboer et al. 1996; Hofmann et al. 1996; Campanero and Flemington 1997;
Marti et al. 1999). The cell cycle regulation of the SCF complex, as well as the
protection of E2F from degradation by pocket protein binding, ensures that E2F
degradation occurs only after its activity is no longer necessary (Hateboer et al. 1996;
Hofmann et al. 1996; Campanero and Flemington 1997).
iv. E2F target genes
Shortly after the identification of the E2F-recognition site in the adenovirus E2 promoter,
analogous sequences were identified in the promoters of many cellular genes (Hiebert et
al. 1989; Thalmeier et al. 1989; Mudryj et al. 1990). Due to the inferred role of E2F in
cell cycle and growth control, most of the originally characterized genes were involved in
these processes. These included genes encoding key regulators of S phase progression
(cyclin E and cyclin A), nucleotide biosynthesis enzymes (Dihydrofolate reductase,
ribonucleotide reductase, thymidine kinase, thymidylate synthetase), and key components
of the DNA replication machinery (DNA Polymerase cx, Cdc6, PCNA, and several ORC
and MCM subunits) (reviewed in Stevaux and Dyson 2002). Additionally, E2F regulates
components of its own pathway, including E2fl, E2J2, E2f3a, RB-1, and p107. This
allows for both positive and negative feedback regulation of this pathway.
Despite its well characterized role in the G 1/S transition, E2F was also found to
control the expression of key mitotic regulators, including the mitotic kinase cdc2/CDK1.
More recently, unbiased techniques to identify a larger set of E2F target genes-using
microarray analysis of either E2F-induced genes or promoters bound by E2F-have
identified more members of this class (Cyclin B1 and B2, Cdc25A) (Ishida et al. 2001;
Muller et al. 2001; Ren et al. 2002). Furthermore, new classes of E2F targets emerged.
Notably, E2F appears to control many genes involved in DNA repair (Msh2, Rad51),
mitotic checkpoints (Bub3, Mad2), and chromosome structure and dynamics (Smc2,
Smc4, Condensin, several histone variants). This finding suggests that E2F may have an
additional role in regulation of mitosis, beyond its well-characterized control of GI/S
phase. The physiological relevance of these target genes is not entirely clear, although it
has recently been shown that deregulation of Mad2 in RB-mutant cells and tumors
correlates with increased expression of E2F1, contributes to genomic instability, and
accelerates tumorigenesis (Hernando et al. 2004; Sotillo et al. 2007).
D. E2F-mediated apoptosis
Exogenous expression of E2F1 in cell culture, in addition to stimulating DNA synthesis,
induces extensive apoptosis (Qin et al. 1994; Shan and Lee 1994; Kowalik et al. 1995).
Subsequent analysis has found that E2F can activate transcription of a large number of
pro-apoptotic genes (Muller et al. 2001; reviewed in Bracken et al. 2004). In some cases,
this effect is associated with the ability of E2F to activate p53, a key regulator of
apoptosis (Wu and Levine 1994; Kowalik et al. 1995). However, E2F can also induce
apoptosis in a p53-independent manner (Hsieh et al. 1997; Phillips et al. 1997). Thus,
E2F activity can promote both cell proliferation and cell death.
i. Pro-apoptotic E2F target genes
The ability of E2F to activate p53-dependent apoptosis was partially explained by the
finding that E2F1 could activate transcription of the p53 regulator, pl9 Arf , which
indirectly increases p53 protein levels by inhibiting its degradation (DeGregori et al.
1997; Bates et al. 1998; Arf will be discussed in greater detail in Part II). However, E2F
can signal to p53 in the absence of Arf(Rogoff et al. 2002; Russell et al. 2002). E2F
expression leads to induction of p53 phosphorylation and activity, most likely due to the
ability of E2F to transcriptionally activate the p53-kinases Chk2 and ATM (Berkovich
and Ginsberg 2003; Rogoff et al. 2004) (Figure 3). However, despite their transcriptional
activation by E2F, it remains unclear how expression of E2F activates the catalytic
activity of these kinases.
E2F also stimulates p53-dependent apoptosis by contributing to the p53
transcriptional response (Figure 3). First, E2F is able to induce the expression of ASPP1
and ASPP2 (Fogal et al. 2005; Hershko et al. 2005); ASPPs (apoptosis-stimulating
proteins of p53) are co-factors that enhance p53 transcriptional activity, along with
increasing its selectivity for pro-apoptotic targets (Samuels-Lev et al. 2001). E2F also
cooperates in the transcriptional induction of many pro-apoptotic p53 target genes, such
as PERP (Attardi et al. 2000), SIVA (Fortin et al. 2004), Apafl (Fortin et al. 2001), and
the BH3 (Bcl-2 homology region 3)-only proteins PUMA and NOXA (Oda et al. 2000;
Nakano and Vousden 2001; Hershko and Ginsberg 2004). Finally, E2F activates
transcription of the p53-homolog p73, leading to an induction of p53 target genes in a
p53-independent manner (Irwin et al. 2000; Stiewe and Putzer 2000).
DNA Damage
ATM
Chk2
p5
--- Mdm2 H-- ARF
Bax/Bad "
TopBP1
-- E2F~ SirT1
PCAF/p300
p73
Apafl
Caspase-9
I
h
Caspase-3f
APOPTOSIS
Figure 3. Complex regulation of E2F and p53 in the apoptotic response pathway
Many proteins regulate the activity of E2F in the apoptotic response. In turn, E2F
induces a large number of pro-apoptotic genes. Transcriptional targets of E2F are shown
in red; targets of p53 are shown in blue; targets of both E2F and p53 are indicated in
purple.
In addition to activating key regulators of apoptosis, E2F can also activate the
transcription of several components of the core cellular apoptotic machinery (Figure 3).
Most notably, E2F regulates many proteins involved in mitochondria-associated
apoptosis, including some of the proteins mentioned above: Apafl, an integral protein of
the Apoptosome, and many BH3-only proteins, including PUMA, NOXA, Bid, and bik
(Cao et al. 2004; Real et al. 2006), which are key determinants of mitochondrial integrity,
and whose activation potentiates mitochondria-associated apoptosis. Also, E2Fs control
expression of several caspases, including both initiator (Caspase-8 and -9) and effector
(Caspase-3 and -7) caspases. Again, despite causing an increase in the levels of these
proteins, E2F does not necessarily cause their activation. Thus, elevated E2F activity
may instead only lead to a sensitization to apoptosis by causing an accumulation of the
apoptotic machinery. Other pro-apoptotic signals are likely still required to efficiently
induce cell death.
ii. E2F-regulated apoptosis in vivo
Results from several different mutant mouse models support a physiological role of E2F
in regulation of apoptosis. E2F1 is involved in normal programmed cell death during T
cell development. E2f'l- - mice display hypercellularity of the thymus due to a defect in
the ability of E2fll - thymocytes to undergo apoptosis during negative selection (Field et
al. 1996; Zhu et al. 1999; Garcia et al. 2000). This may be due to the inability of the
mutant cells to induce Arf and p53 during this process (Zhu et al. 1999). E2F is also
required in vivo for apoptosis caused by loss of Rb. Rb -#- mouse embryos die in utero
with developmental defects of many tissues, including increased proliferation and
apoptosis in the lens and the nervous system (Jacks et al. 1992; Lee et al. 1992; Lee et al.
1994; Morgenbesser et al. 1994). Additional loss of either E2fl or E2f3 suppresses these
defects, suggesting that both E2F1 and E2F3 are required for induction of apoptosis due
to loss of pRb (Tsai et al. 1998; Ziebold et al. 2001). Intriguingly, a portion of Rb -/;E2f3+ - embryos exhibited suppression of the increased apoptosis, but not the ectopic
proliferation in the peripheral nervous system (Ziebold et al. 2001). Therefore, E2F3 has
a specific role in inducing apoptosis, and is not simply contributing to the abnormal
proliferation of the Rb-mutant cells. Loss of E2fl also abrogated p53-dependent
apoptosis in tumors initiated by pRb inactivation in the brain epithelium (Pan et al. 1998).
Overexpression of E2F1 can also lead to apoptosis in vivo. Targeting expression
of an E2F1 transgene to the squamous epithelium with a keratin 5 promoter led to
increased apoptosis in this tissue, which was dependent on functional p53 (Pierce et al.
1998). This E2Fl-induced apoptosis is consistent with a tumor-suppressive function of
E2F1, exhibited by the appearance of diverse tumor types in E2fl - mice (Yamasaki et al.
1996). Indeed, apoptosis resulting from overexpression of E2F1 also suppresses
papilloma formation in a two-stage skin carcinogenesis model involving ras mutation as
an initiating lesion (Pierce et al. 1999). Thus, E2F-induced apoptosis is important in
several biologically-relevant scenarios, including tumorigenesis.
iii. Specificity of E2F induction of apoptosis
Since the discovery that E2F1 could trigger apoptosis, there have been many conflicting
reports as to whether this is a specific property of E2F1, or if other E2Fs can also
function in the apoptotic response. Initial studies indicated that overexpression of either
E2F2 or E2F3a, unlike E2F1, was unable to induce apoptosis (DeGregori et al. 1997;
Kowalik et al. 1998). However, subsequent studies performed in a similar manner found
that activation of E2F2 or E2F3a could also cause cell death, although possibly not as
efficiently as E2F1 (Vigo et al. 1999; Moroni et al. 2001). There is evidence to support
the ability of E2F2 or E2F3a to activate pro-apoptotic genes (DeGregori et al. 1997;
Nahle et al. 2002), so the unique proclivity of E2F1 to potentiate apoptosis in certain
scenarios may depend on other specific properties of E2Fl. Consistent with this idea,
E2F1 binds to a region of pRB which is unable to regulate other E2Fs, and this
interaction is important in specifically regulating the pro-apoptotic functions of E2F1
(Dick and Dyson 2003)
As mentioned above, both E2F1 and E2F3 are necessary for apoptosis
downstream of Rb mutation in Rb4 - embryos (Tsai et al. 1998; Ziebold et al. 2001),
suggesting regulation of apoptosis is a shared function of these two proteins. On the
contrary, E2fl-loss had no effect on apoptosis due to overexpression of c-Myc, both in
vivo and in vitro (Rounbehler et al. 2002; Baudino et al. 2003). This result could indicate
either that E2F1 is not involved in pro-apoptotic signaling downstream of Myc activation,
or that other E2Fs can compensate for this function in the absence of E2F1. Surprisingly,
a similar study did observe a specific requirement of E2F1, and not E2F2 or E2F3, in
mediating Myc-mediated apoptosis in vitro (Leone et al. 2001), but subtle differences in
the experimental techniques used could possibly explain this discrepancy. Finally,
similar to E2F1, overexpression of E2F3a causes hyperproliferation in vivo and leads to
p53-independent apoptosis (Lazzerini Denchi et al. 2005; Paulson et al. 2006).
Intriguingly, E2F3a is unable to cause apoptosis, either in vitro or in vivo, in cells lacking
E2fl (Lazzerini Denchi and Helin 2005). This result suggests that while other E2Fs may
be able to activate pro-apoptotic genes and ultimately cause cell death, E2F1 function
may be necessary to contribute to, or mediate the apoptotic signal.
iv. E2F in the DNA damage response
In addition to causing apoptosis when overexpressed or downstream of oncogenic stimuli
such as Myc or Rb-loss, E2F has been implicated in DNA damage-induced apoptosis. In
all cases, this seems to be a specific function of E2Fl, and not other activating E2Fs.
Multiple types of DNA damaging agents cause an increase of E2F1 protein levels (Huang
et al. 1997; Blattner et al. 1999; Hofferer et al. 1999; Meng et al. 1999). The stabilization
may be due to disruption of the degradation of E2F1 by the ubiquitin-ligase SCFSkp2
(Marti et al. 1999), due to phosphorylation of the SCFSkp2-interacting domain by the
ATM or Chkl/2 kinases (Lin et al. 2001; Urist et al. 2004). E2F1 can also feed back to
activate the p53-dependent DNA damage-response pathway. Activation of E2F1 leads to
phosphorylation and stabilization of p53 (Rogoff et al. 2002), which is likely due to the
ability of E2F to activate ATM and/or Chk2 (Berkovich and Ginsberg 2003; Rogoff et al.
2004) (Figure 3).
E2F1 activity is regulated both positively and negatively by many posttranslational mechanisms after DNA damage, besides a simple increase in protein levels
(Figure 3). DNA damage-induced phosphorylation of E2F1 by Chkl/2 causes activation
of E2Fl-mediated p73 transcription (Stevens et al. 2003). Also, the phosphorylated Nterminus of E2F1 provides a binding site for the BRCT domains of TopBP1, which
represses E2F activity and causes relocation of E2F1 to foci in the nucleus containing
BRCA1 (Liu et al. 2003), although the function of E2F1 in this location is unclear. DNA
damage also induces E2Fl-mediated activation of the (NAD)-dependent deacetylase
SirTI, which in turn binds and inhibits the activity of E2F1, providing a negative
feedback mechanism in this pathway (Wang et al. 2006). Finally, E2F1 is acetylated on
its N-terminus by the acetylases PCAF and p300 in response to DNA damage, and this
increases E2FI's ability to activate pro-apoptotic target genes such as p73 (MartinezBalbas et al. 2000; Pediconi et al. 2003; Galbiati et al. 2005).
Part II: The Arf-p53 stress-response pathway
The p53 tumor suppressor protein is a key regulator of the response to intrinsic cellular
stresses. p53 is activated in conditions that threaten the integrity of the genome, and
responds by inducing a transcriptional program that either halts cell cycle progression to
allow DNA repair to occur, or initiates apoptosis if the damage is severe. The importance
of p53 in this capacity is underscored by its frequent mutation in human cancers.
Alteration of p53 is the causative mutation in most individuals with Li-Fraumeni
Syndrome, a familial cancer syndrome leading to multiple malignancies of various types
(reviewed in Varley 2003). Additionally, greater than 50% of spontaneous tumors harbor
mutations in p53. Most of the identified mutations affect the ability of p53 to bind DNA
and consequently activate transcription, illustrating that activation of its downstream
effectors is at the core of p53's tumor suppressive ability.
A. Regulation of p53 by Mdm2
p53 activity is regulated almost exclusively on the post-translational level. In normal
unstressed cells, the steady-state level of p53 protein is extremely low due to a very short
half-life. The rapid turn-over of p53 is attributable to its degradation via the ubiquitinproteasome pathway. It is targeted for ubiquitination by the E3 ubiquitin-ligase Mdm2.
In addition to causing it degradation, Mdm2 also inhibits p53's transcriptional ability by
binding and masking its transactivation domain. Mdm2-mediated suppression of p53
levels and activity is its essential function, as evidenced by the fact that Mdm2 -#- mice are
inviable, but additional mutation of p53 rescues their viability (Jones et al. 1995; Montes
de Oca Luna et al. 1995). Finally, Mdm2 itself is a p53-target gene, providing a negativefeedback mechanism suppressing stochastic p53 activation.
Despite its obvious importance, Mdm2 is not the only protein responsible for
controlling p53 protein levels. In fact, at least three other proteins can cause
ubiquitination of p53-Pirh2, COP1, and ARF-BPl1-although the relative importance of
these proteins in p53 regulation is not yet clear (reviewed in Brooks and Gu 2006). The
Mdm2-homolog MdmX also appears to negatively regulate p53, although it does not
possess ubiquitin ligase activity (reviewed in Marine and Jochemsen 2005). Analogous
to Mdm2, MdmX -' - mice display early embryonic lethality, which is also rescued by p53loss, so regulation of p53 by MdmX clearly has an important physiological role (Parant et
al. 2001). The relevance of p53 regulation in tumor suppression is further supported by
the observation of amplification of the human homologs of either Mdm2 or MdmX in a
subset of human cancers, usually correlating with presence of a wildtype p53 gene.
B. p53 phosphorylation and the DNA damage response
The p53 protein is heavily regulated by phosphorylation. At least 17 sites on p53 are
targets of a great number of kinases, which in most cases are stimulated to phosphorylate
p53 in response to various types of DNA-damaging agents (reviewed in Bode and Dong
2004). Phosphorylation leads to an increase in p53 activity in several ways. First, it
causes a conformational change in the protein, increasing DNA-binding affinity and
ability to activate transcription (Hupp and Lane 1994). Next, phosphorylation disrupts
binding of Mdm2, relieving both Mdm2's inhibition of p53 transactivation, and allowing
an increase in p53 protein levels by avoiding Mdm2-mediated ubiquitination and
subsequent degradation (Shieh et al. 1997).
Of the many phosphorylation sites on p53, those that have received the most
attention are the sites in the N-terminal domain, especially serines 15 and 20 of human
p53. These residues are targeted by several kinases activated by DNA damage,
particularly UV- or y-irradiation (reviewed in Bode and Dong 2004). The primary
kinases involved in this response are two PI(3)K-related kinases: ataxia telangiectasia
mutated (ATM), and ATM- and Rad3-related (ATR). ATM and ATR can both directly
phosphorylate the p53 N-terminal domain, as well as activate two additional "transducer"
kinases, Chkl and Chk2, to promote p53 phosphorylation (reviewed in Zhou and Elledge
2000). The integrity of this pathway is clearly important for effective tumor suppression.
Ataxia telangiectasia patients, who carry mutations in ATM, are susceptible to
malignancies of numerous tissues, and a portion of Li-Fraumeni Syndrome patients with
wildtype p53 sequence carry germline mutations in CHK2 (Reed et al. 1966; Bell et al.
1999; Lee et al. 2001).
Other post-translational modifications besides phosphorylation of p53 play a role
in the p53 response to DNA damage. Mdm2 is phosphorylated by the kinases ATM and
DNA-PK (DNA-dependent protein kinase) in response to DNA damage. The amino acid
residues targeted include those within the p53-interaction domain, contributing to
disruption of the Mdm2-p53 interaction (Mayo et al. 1997; Khosravi et al. 1999).
Acetylation of the C-terminal domain of p53 also affects its activity. The histone
acetyltransferases p300 and PCAF are activated by DNA damage to acetylate p53, which
leads to an increase in its DNA binding activity, possibly by changing the conformation
of the protein (Gu et al. 1997; Sakaguchi et al. 1998). All of these mechanisms cooperate
to enact a rapid and concerted p53 response to DNA damage.
C. Transcriptional targets of p53
Once it is activated, p53 is competent to activate transcription of a number of target
genes. Generally, these fall into two classes: cell cycle inhibitory proteins and regulators
of programmed cell death. Of the genes involved in cell cycle arrest, the most important
l , as p21-deficient MEFs are defective in p53-dependent cell
seems to be CDKNIAIp21 C P1
cycle arrest in response to DNA damage (Brugarolas et al. 1995; Deng et al. 1995). p21
induces primarily a GI-arrest due to its inhibition of the G 1/S kinases CDK2 and CDK4/6
(Sherr and Roberts 1999). p53 can also trigger a G2/M phase arrest via its induction of
GADD45 and 14-3-30, which inhibit the activation of the Cyclin B/CDK1 kinase
required for mitotic progression (Hollander et al. 1993; Hermeking et al. 1997).
p53 activates the transcription of genes participating in both the extrinsic (death
receptor-mediated) and intrinsic (mitochondria-associated) apoptotic pathways (reviewed
in Fridman and Lowe 2003). p53 target genes in the extrinsic pathway include the death
receptors Fas/CD95 and Killer/DR5, as well as Fas ligand (Table 1). Although p53
control of extrinsic pathway components is unlikely to directly lead to apoptosis, it may
either sensitize the cell to extracellular apoptotic cues, or potentiate already present
signaling. p53 contribution to the intrinsic apoptotic pathway involves transcriptional
activation of effectors at many levels. The Bcl-2 family member Bax is induced by p53,
and is part of the core complex involved in cytochrome c release from the mitochondria
(reviewed in Scorrano and Korsmeyer 2003). p53 also activates transcription of a
Gene
p53 target? E2F ta
p7 3
Caspase-3, -7, -8, -9
ASPP1/2
SIVA
PERP
NOXA
Puma
Apafl
Bax
Bid
Fas/CD95
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
-
Killer/DR5
+
-
Fas ligand
+
-
-
Table 1. Many pro-apoptotic genes are targets of both E2F and p53
number of genes encoding BH3-only proteins, including Bid, Noxa, and Puma, which
function either to increase the apoptotic function of Bax, or inhibit the protective effects
of Bcl-2. At the effector level, p53 activates transcription of the gene encoding Apafl,
which functions with caspase-9 to initiate caspase activation (Moroni et al. 2001).
Several of these genes are also regulated by E2F, consistent with the ability of E2F and
p53 to cooperate in regulation of apoptosis (Table 1).
Depending on the stimulus, p53 may respond by activating transcription of genes
of one or both of these classes. How this specificity is achieved is currently unclear, but
probably involves modification of p53 or specific binding proteins. The ASPP proteins
are p53 co-factors which enhance its selectivity for pro-apoptotic targets (Samuels-Lev et
al. 2001). As discussed above, the ASPP1 and ASPP2 genes are transcriptional targets of
E2F, as are several other pro-apoptotic targets of p53 (Table 1). Therefore, concerted
activation of p53 and E2F may partially contribute to induction of p53-dependent
apoptosis. Indeed, cells expressing E1A, which increases E2F transcriptional activity by
inactivating pRB-family proteins, are highly sensitized to undergo p53-dependent
apoptosis in response to DNA-damaging agents (Lowe et al. 1993).
D. Tumor surveillance by Arf-p53
Arf was discovered as an alternate product of the Cdkn2all/Ink4a locus, which encodes the
CDK inhibitor p16
K4A
(Quelle et al. 1995). The Arf gene consists of a separate first
exon greater than ten kilobases upstream of the first exon encoding p 1 6NK4A, which is
then spliced into a common second exon but in a different reading frame than that which
produces p1 6
K4A .
Thus, the protein encoded by the ArfmRNA, denoted p 19Arf for
"alternative reading frame," bears no similarity to the p 1 6 N
K4A
protein on the amino acid
level. Analagous to p1 6 INK4A , however, exogenous expression of p19 Arf can also induce
cell cycle arrest in either G1 or G2 phase of the cell cycle. This is primarily due to the
ability of p19 Arf to indirectly induce p53 activation by inhibiting Mdm2-mediated
ubiquitination (Kamijo et al. 1998; Pomerantz et al. 1998; Stott et al. 1998; Zhang et al.
1998; Honda and Yasuda 1999). p19A f is predominantly a nucleolar protein, and its
ability to inhibit Mdm2 is partially due to sequestration of Mdm2 in the nucleolus,
preventing its interaction with p53 (Tao and Levine 1999; Weber et al. 1999). pl9" f can
also suppress proliferation in a p53-independent manner (Weber et al. 2000; Kuo et al.
2003); this effect is possibly due to interaction of pl9AA f with other transcription factors,
including Myc, E2Fl, and DP1 (reviewed in Sherr 2006).
The INK4A locus was long known to encode a tumor suppressor, due to frequent
disruption of this locus in human cancers (Hall and Peters 1996), and mice carrying a
deletion of Ink4a affecting both p1 6 INK4A and p19 Ar are highly tumor-prone (Serrano et
al. 1996). It was at first presumed that this was due to the p1 6 INK4A protein, the loss of
which is functionally analogous to pRB inactivation. Due to its ability to activate p53,
though, contribution of p 19A f to tumor suppression was also a possibility. This was
confirmed by the construction of a mouse strain specifically deficient in exon 1 of Arf
(Kamijo et al. 1997). Arf'- mice develop tumors with a similar latency and spectrum as
p53'- - and Ink4a -' mice, whereas mice lacking p1 6 INK4A are only modestly susceptible to
tumors, suggesting that loss of p19 A r is a major factor in tumor development in the
Ink4a -' - mice, and confirming the relevance of the regulation of the p53 pathway by
pl9 Arf.
i. Transcriptional regulation of Arf
Most tissues of the mouse, as well as freshly-explanted MEFs in culture, lack expression
of pl9" (Zindy et al. 2003). Arf is induced in vitro only in response to various
conditions of cellular stress, including the "culture shock" of growing MEFs in vitro, or
the expression of cellular or viral oncoproteins (Sherr and DePinho 2000; Lowe and
Sherr 2003). MEFs grown in culture for several passages undergo a permanent state of
cell cycle arrest termed senescence, although the signals regulating this process are not
well understood; in MEFs, Arf is a key component of this response. Arf'- MEFs, like
p53-'- MEFs, do not undergo senescence, but rather grow in culture indefinitely (Kamijo
et al. 1997). Initiation of senescence in wildtype MEFs is attributed to both positive and
negative regulators of Arf. The transcription factor Dmp 1 is responsible for activating
Arf expression in response to senescence signals, and Dmp14- MEFs do not induce Arf
and are immortal (Inoue et al. 2000).
Negative regulation of Arf, primarily by members of the Polycomb-group of
transcriptional repressors, is also required for maintaining Arfinhibition in young MEFs.
MEFs deficient in Bmil or CBX7 undergo premature senescence due to upregulation of
Arf and p16 (Jacobs et al. 1999; Gil et al. 2004). Other Polycomb proteins, especially the
histone methyltransferase Ezh2, dissociate from the Arf and p16 locus as cells undergo
senescence, coincident with the increased expression of these loci (Bracken et al. 2007).
Senescence can be averted by suppression of Arf due to overexpression of the Polycomb
proteins Bmil1, CBX7 or CBX8, or other transcription factors including TBX2, TBX3,
Twist, or Pokemon (Jacobs et al. 1999; Maestro et al. 1999; Jacobs et al. 2000; Lingbeek
et al. 2002; Gil et al. 2004; Maeda et al. 2005). The stresses involved in initiating the
senescence response in cultured MEFs are not entirely clear, but may include such factors
as hyperoxia or persistant growth factor signaling (Sherr and DePinho 2000). Whatever
the stimuli, though, Arf is clearly involved in the response to these stressors.
Arf is induced in response to hyperproliferative signals downstream of cellular or
viral oncogenes, although it is not appreciably up-regulated by normal, mitogenstimulated growth (DeGregori et al. 1997). Many oncogenes have been shown to cause
induction of Arf and subsequently p53, including Ras, Myc, E1A, v-Abl, E2Fl, and E2F2
(DeGregori et al. 1997; Bates et al. 1998; de Stanchina et al. 1998; Palmero et al. 1998;
Radfar et al. 1998; Zindy et al. 1998; Dimri et al. 2000). Depending on the oncogene or
the cellular context, the associated p53 induction leads either to sensitivity to apoptosis or
senescence. For example, Ras expression in all fibroblasts, and E2Fl expression in
human fibroblasts induces senescence, which is dependent on Arf (Kamijo et al. 1997;
Serrano et al. 1997; Dimri et al. 2000). The induction of Arf and activation of p53, and
subsequent induction of apoptosis or senescence appears to be a checkpoint against
hyperproliferation induced by oncogene expression; hence, this response pathway is
referred to as the oncogenic stress response (see Lowe et al. 2004, for review).
As many of the above oncoproteins do not posses direct transcriptional activity, in
most cases it is unknown what is responsible for the transcriptional induction of Arf.
Myc is a transcription factor with a well-defined consensus binding site, but no matches
are found in the Arf promoter. On the other hand, well-conserved E2F-binding sites are
present in both the human and mouse Arf promoter, although several reports suggest that
activation of Arfby E2F may also be indirect. First, activation of a minimal fragment of
the Arf promoter was not completely ablated by mutations in the E2F-binding sites (Parisi
et al. 2002; Berkovich et al. 2003). Next, expression of E1A was equally able to induce
Arf expression in wildtype or E2fl-'-;E2f2-#- MEFs (Palmero et al. 2002); however, this
experiment did not rule out the contribution of E2F3a to Arf activation. Finally, it has
been suggested that Arf is normally regulated by endogenous repressive E2F complexes
in the absence of oncogenic stress (Rowland et al. 2002); however, the fact that Arfis not
induced during cell cycle re-entry implies that, if E2F is indeed involved in the normal
regulation of Arf the mechanism of regulation might differ from most E2F target genes.
ii. Regulation of the Arf-p53 pathway by oncogenic stress in vivo
The crucial function of Arf and p53 as tumor suppressor genes is clearly delineated by
their frequent mutation in a large number of human cancers and the occurrence of
spontaneous tumors in Arf'- and p53 - mice (Donehower et al. 1992; Jacks et al. 1994;
Kamijo et al. 1997). Since Arf and p53 are activated in response to oncogenic stress, and
the loss of their function is required for cellular transformation or oncogenesis, it was
concluded that the endogenous function of the Arf-p53 pathway is to abort the
development of hyperplasia due to oncogenic mutations. For this reason, the Arf-p53
pathway has been referred to as the tumor surveillance pathway (Sherr 1998).
The activation of the Arf-p53 tumor surveillance pathway has been most wellcharacterized in response to Myc expression. Activation of Myc in MEFs leads to a rapid
induction of Arf and p53, and cell lines that survive the initial apoptotic response
invariably sustain mutations in this pathway (Zindy et al. 1998). Similarly, tumors
resulting from directed overexpression of Myc in the hematopoietic compartment (via an
EaMyc transgene) all have disruptions in the pl9Af-Mdm2-p53 network (Eischen et al.
1999). Consistent with this result, mutation of either Arf or p53 in EyMyc transgenic
mice dramatically decreases the latency of tumorigenesis (Schmitt et al. 1999). Finally,
Zindy and colleagues created a novel mouse strain that allows monitoring of Arf
activation in vivo by replacing the first exon of the Arf locus with the coding sequence for
green fluorescent protein (ArfGp). This allele causes a loss of function of Arf, while
placing the expression of GFP under control of the Arf promoter (Zindy et al. 2003).
Mice carrying both the ArfGj
allele and the Ey'Myc transgene are susceptible to
lymphoma, and presence of GFP' lymphoma cells indicates that oncogenic stress present
in these cells is causing activation of the Arf promoter (Zindy et al. 2003); however,
subsequent experiments monitoring more closely the kinetics of GFP expression
suggested that other oncogenic events may be necessary to cause robust activation of Arf
(Bertwistle and Sherr 2007).
The most compelling evidence of the role of the Arf-p53 axis in tumor
surveillance comes from experiments using a mouse model where presence or absence of
p53 activity can be modulated in vivo using a drug-responsive p53 fusion protein
(Christophorou et al. 2006). This study showed that the role of p53 in the DNA damage
response was dispensable for tumor suppression. Rather, p53's ability to eliminate cells
harboring oncogenic mutations is its primary tumor suppressive role. And importantly,
Arf is absolutely required for p53's function in this capacity (Christophorou et al. 2006).
Therefore, the Arf-p53 tumor surveillance pathway is activated in response to oncogenic
proliferation, and the resulting p53-mediated apoptosis or arrest is critical for effective
tumor suppression in vivo.
References
Attardi, L.D., Reczek, E.E., Cosmas, C., Demicco, E.G., McCurrach, M.E., Lowe, S.W.,
and Jacks, T. 2000. PERP, an apoptosis-associated target of p53, is a novel
member of the PMP-22/gas3 family. Genes Dev 14(6): 704-718.
Attwooll, C., Oddi, S., Cartwright, P., Prosperini, E., Agger, K., Steensgaard, P.,
Wagener, C., Sardet, C., Moroni, M.C., and Helin, K. 2005. A novel repressive
E2F6 complex containing the polycomb group protein, EPC1, that interacts with
EZH2 in a proliferation-specific manner. J Biol Chem 280(2): 1199-1208.
Bagchi, S., Weinmann, R., and Raychaudhuri, P. 1991. The retinoblastoma protein
copurifies with E2F-I, an E1A-regulated inhibitor of the transcription factor E2F.
Cell 65(6): 1063-1072.
Bandara, L.R. and La Thangue, N.B. 1991. Adenovirus Ela prevents the retinoblastoma
gene product from complexing with a cellular transcription factor. Nature
351(6326): 494-497.
Bates, S., Phillips, A.C., Clark, P.A., Stott, F., Peters, G., Ludwig, R.L., and Vousden,
K.H. 1998. pl4ARF links the tumour suppressors RB and p53. Nature 395(6698):
124-125.
Baudino, T.A., Maclean, K.H., Brennan, J., Parganas, E., Yang, C., Aslanian, A., Lees,
J.A., Sherr, C.J., Roussel, M.F., and Cleveland, J.L. 2003. Myc-mediated
proliferation and lymphomagenesis, but not apoptosis, are compromised by E2fl
loss. Mol Cell 11(4): 905-914.
Bell, D.W., Varley, J.M., Szydlo, T.E., Kang, D.H., Wahrer, D.C., Shannon, K.E.,
Lubratovich, M., Verselis, S.J., Isselbacher, K.J., Fraumeni, J.F., Birch, J.M., Li,
F.P., Garber, J.E., and Haber, D.A. 1999. Heterozygous germ line hCHK2
mutations in Li-Fraumeni syndrome. Science 286(5449): 2528-2531.
Berkovich, E. and Ginsberg, D. 2003. ATM is a target for positive regulation by E2F-1.
Oncogene 22(2): 161-167.
Berkovich, E., Lamed, Y., and Ginsberg, D. 2003. E2F and Ras synergize in
transcriptionally activating pl4ARF expression. Cell Cycle 2(2): 127-133.
Bertwistle, D. and Sherr, C.J. 2007. Regulation of the Arf tumor suppressor in EmicroMyc transgenic mice: longitudinal study of Myc-induced lymphomagenesis.
Blood 109(2): 792-794.
Blattner, C., Sparks, A., and Lane, D. 1999. Transcription factor E2F-1 is upregulated in
response to DNA damage in a manner analogous to that of p53. Mol Cell Biol
19(5): 3704-3713.
Bode, A.M. and Dong, Z. 2004. Post-translational modification of p53 in tumorigenesis.
Nat Rev Cancer4(10): 793-805.
Bracken, A.P., Ciro, M., Cocito, A., and Helin, K. 2004. E2F target genes: unraveling the
biology. Trends Biochem Sci 29(8): 409-417.
Bracken, A.P., Kleine-Kohlbrecher, D., Dietrich, N., Pasini, D., Gargiulo, G., Beekman,
C., Theilgaard-Monch, K., Minucci, S., Porse, B.T., Marine, J.C., Hansen, K.H.,
and Helin, K. 2007. The Polycomb group proteins bind throughout the INK4AARF locus and are disassociated in senescent cells. Genes Dev 21(5): 525-530.
Brehm, A., Miska, E.A., McCance, D.J., Reid, J.L., Bannister, A.J., and Kouzarides, T.
1998. Retinoblastoma protein recruits histone deacetylase to repress transcription.
Nature 391(6667): 597-601.
Brooks, C.L. and Gu, W. 2006. p53 ubiquitination: Mdm2 and beyond. Mol Cell 21(3):
307-315.
Brugarolas, J., Chandrasekaran, C., Gordon, J.I., Beach, D., Jacks, T., and Hannon, G.J.
1995. Radiation-induced cell cycle arrest compromised by p21 deficiency. Nature
377(6549): 552-557.
Campanero, M.R. and Flemington, E.K. 1997. Regulation of E2F through ubiquitinproteasome-dependent degradation: stabilization by the pRB tumor suppressor
protein. Proc Natl Acad Sci U S A 94(6): 2221-2226.
Cao, Q., Xia, Y., Azadniv, M., and Crispe, I.N. 2004. The E2F-1 transcription factor
promotes caspase-8 and bid expression, and enhances Fas signaling in T cells. J
Immunol 173(2): 1111-1117.
Caretti, G., Salsi, V., Vecchi, C., Imbriano, C., and Mantovani, R. 2003. Dynamic
recruitment of NF-Y and histone acetyltransferases on cell-cycle promoters. J
Biol Chem 278(33): 30435-30440.
Cartwright, P., Muller, H., Wagener, C., Holm, K., and Helin, K. 1998. E2F-6: a novel
member of the E2F family is an inhibitor of E2F- dependent transcription.
Oncogene 17(5): 611-623.
Chellappan, S.P., Hiebert, S., Mudryj, M., Horowitz, J.M., and Nevins, J.R. 1991. The
E2F transcription factor is a cellular target for the RB protein. Cell 65(6): 10531061.
Chittenden, T., Livingston, D.M., and Kaelin, W.G., Jr. 1991. The T/E1A-binding
domain of the retinoblastoma product can interact selectively with a sequencespecific DNA-binding protein. Cell 65(6): 1073-1082.
Christensen, J., Cloos, P., Toftegaard, U., Klinkenberg, D., Bracken, A.P., Trinh, E.,
Heeran, M., Di Stefano, L., and Helin, K. 2005. Characterization of E2F8, a novel
E2F-like cell-cycle regulated repressor of E2F-activated transcription. Nucleic
Acids Res 33(17): 5458-5470.
Christophorou, M.A., Ringshausen, I., Finch, A.J., Swigart, L.B., and Evan, G.I. 2006.
The pathological response to DNA damage does not contribute to p53-mediated
tumour suppression. Nature 443(7108): 214-217.
Claudio, P.P., Howard, C.M., Fu, Y., Cinti, C., Califano, L., Micheli, P., Mercer, E.W.,
Caputi, M., and Giordano, A. 2000a. Mutations in the retinoblastoma-related gene
RB2/p 130 in primary nasopharyngeal carcinoma. Cancer Res 60(1): 8-12.
Claudio, P.P., Howard, C.M., Pacilio, C., Cinti, C., Romano, G., Minimo, C., Maraldi,
N.M., Minna, J.D., Gelbert, L., Leoncini, L., Tosi, G.M., Hicheli, P., Caputi, M.,
Giordano, G.G., and Giordano, A. 2000b. Mutations in the retinoblastoma-related
gene RB2/p 130 in lung tumors and suppression of tumor growth in vivo by
retrovirus-mediated gene transfer. Cancer Res 60(2): 372-382.
Dannenberg, J.H., Schuijff, L., Dekker, M., van der Valk, M., and te Riele, H. 2004.
Tissue-specific tumor suppressor activity of retinoblastoma gene homologs p107
and p130. Genes Dev 18(23): 2952-2962.
de Bruin, A., Maiti, B., Jakoi, L., Timmers, C., Buerki, R., and Leone, G. 2003.
Identification and characterization of E2F7, a novel mammalian E2F family
member capable of blocking cellular proliferation. J Biol Chem 278(43): 4204142049.
de Stanchina, E., McCurrach, M.E., Zindy, F., Shieh, S.Y., Ferbeyre, G., Samuelson,
A.V., Prives, C., Roussel, M.F., Sherr, C.J., and Lowe, S.W. 1998. E1A signaling
to p53 involves the pl9(ARF) tumor suppressor. Genes Dev 12(15): 2434-2442.
DeCaprio, J.A., Ludlow, J.W., Figge, J., Shew, J.Y., Huang, C.M., Lee, W.H., Marsilio,
E., Paucha, E., and Livingston, D.M. 1988. SV40 large tumor antigen forms a
specific complex with the product of the retinoblastoma susceptibility gene. Cell
54(2): 275-283.
DeGregori, J., Leone, G., Miron, A., Jakoi, L., and Nevins, J.R. 1997. Distinct roles for
E2F proteins in cell growth control and apoptosis. Proc Natl Acad Sci U S A
94(14): 7245-7250.
Deng, C., Zhang, P., Harper, J.W., Elledge, S.J., and Leder, P. 1995. Mice lacking
p21CIP1/WAF1 undergo normal development, but are defective in Gl checkpoint
control. Cell 82(4): 675-684.
Deshpande, A.M., Akunowicz, J.D., Reveles, X.T., Patel, B.B., Saria, E.A., Gorlick,
R.G., Naylor, S.L., Leach, R.J., and Hansen, M.F. 2007. PHC3, a component of
the hPRC-H complex, associates with E2F6 during GO and is lost in osteosarcoma
tumors. Oncogene 26(12): 1714-1722.
Devoto, S.H., Mudryj, M., Pines, J., Hunter, T., and Nevins, J.R. 1992. A cyclin Aprotein kinase complex possesses sequence-specific DNA binding activity:
p33cdk2 is a component of the E2F-cyclin A complex. Cell 68(1): 167-176.
Di Stefano, L., Jensen, M.R., and Helin, K. 2003. E2F7, a novel E2F featuring DPindependent repression of a subset of E2F-regulated genes. Embo J 22(23): 62896298.
Dick, F.A. and Dyson, N. 2003. pRB contains an E2Fl-specific binding domain that
allows E2F1-induced apoptosis to be regulated separately from other E2F
activities. Mol Cell 12(3): 639-649.
Dimri, G.P., Itahana, K., Acosta, M., and Campisi, J. 2000. Regulation of a senescence
checkpoint response by the E2F1 transcription factor and pl4(ARF) tumor
suppressor. Mol Cell Biol 20(1): 273-285.
Donehower, L.A., Harvey, M., Slagle, B.L., McArthur, M.J., Montgomery, C.A., Jr.,
Butel, J.S., and Bradley, A. 1992. Mice deficient for p53 are developmentally
normal but susceptible to spontaneous tumours. Nature 356(6366): 215-221.
Dryja, T.P., Rapaport, J.M., Joyce, J.M., and Petersen, R.A. 1986. Molecular detection of
deletions involving band q14 of chromosome 13 in retinoblastomas. Proc Natl
Acad Sci U S A 83(19): 7391-7394.
Dunaief, J.L., Strober, B.E., Guha, S., Khavari, P.A., Alin, K., Luban, J., Begemann, M.,
Crabtree, G.R., and Goff, S.P. 1994. The retinoblastoma protein and BRG1 form a
complex and cooperate to induce cell cycle arrest. Cell 79(1): 119-130.
Dynlacht, B.D., Flores, O., Lees, J.A., and Harlow, E. 1994. Differential regulation of
E2F transactivation by cyclin/cdk2 complexes. Genes Dev 8(15): 1772-1786.
Dyson, N. 1998. The regulation of E2F by pRB-family proteins. Genes Dev 12(15):
2245-2262.
Dyson, N., Buchkovich, K., Whyte, P., and Harlow, E. 1989a. The cellular 107K protein
that binds to adenovirus E1A also associates with the large T antigens of SV40
and JC virus. Cell 58(2): 249-255.
Dyson, N., Howley, P.M., Munger, K., and Harlow, E. 1989b. The human papilloma
virus-16 E7 oncoprotein is able to bind to the retinoblastoma gene product.
Science 243(4893): 934-937.
Eischen, C.M., Weber, J.D., Roussel, M.F., Sherr, C.J., and Cleveland, J.L. 1999.
Disruption of the ARF-Mdm2-p53 tumor suppressor pathway in Myc-induced
lymphomagenesis. Genes Dev 13(20): 2658-2669.
Emili, A. and Ingles, C.J. 1995. Promoter-dependent photocross-linking of the acidic
transcriptional activator E2F-1 to the TATA-binding protein. J Biol Chem
270(23): 13674-13680.
Ewen, M.E., Xing, Y.G., Lawrence, J.B., and Livingston, D.M. 1991. Molecular cloning,
chromosomal mapping, and expression of the cDNA for p107, a retinoblastoma
gene product-related protein. Cell 66(6): 1155-1164.
Fagan, R., Flint, K.J., and Jones, N. 1994. Phosphorylation of E2F-1 modulates its
interaction with the retinoblastoma gene product and the adenoviral E4 19 kDa
protein. Cell 78(5): 799-811.
Ferreira, R., Magnaghi-Jaulin, L., Robin, P., Harel-Bellan, A., and Trouche, D. 1998. The
three members of the pocket proteins family share the ability to repress E2F
activity through recruitment of a histone deacetylase. Proc Natl Acad Sci U S A
95(18): 10493-10498.
Field, S.J., Tsai, F.Y., Kuo, F., Zubiaga, A.M., Kaelin, W.G., Jr., Livingston, D.M.,
Orkin, S.H., and Greenberg, M.E. 1996. E2F-1 functions in mice to promote
apoptosis and suppress proliferation. Cell 85(4): 549-561.
Flemington, E.K., Speck, S.H., and Kaelin, W.G., Jr. 1993. E2F-l-mediated
transactivation is inhibited by complex formation with the retinoblastoma
susceptibility gene product. Proc Natl Acad Sci U S A 90(15): 6914-6918.
Fogal, V., Kartasheva, N.N., Trigiante, G., Llanos, S., Yap, D., Vousden, K.H., and Lu,
X. 2005. ASPP1 and ASPP2 are new transcriptional targets of E2F. Cell Death
Differ 12(4): 369-376.
Fortin, A., Cregan, S.P., MacLaurin, J.G., Kushwaha, N., Hickman, E.S., Thompson,
C.S., Hakim, A., Albert, P.R., Cecconi, F., Helin, K., Park, D.S., and Slack, R.S.
2001. APAF1 is a key transcriptional target for p53 in the regulation of neuronal
cell death. J Cell Biol 155(2): 207-216.
Fortin, A., MacLaurin, J.G., Arbour, N., Cregan, S.P., Kushwaha, N., Callaghan, S.M.,
Park, D.S., Albert, P.R., and Slack, R.S. 2004. The proapoptotic gene SIVA is a
direct transcriptional target for the tumor suppressors p53 and E2F1. J Biol Chem
279(27): 28706-28714.
Fridman, J.S. and Lowe, S.W. 2003. Control of apoptosis by p53. Oncogene 22(56):
9030-9040.
Friend, S.H., Bernards, R., Rogelj, S., Weinberg, R.A., Rapaport, J.M., Albert, D.M., and
Dryja, T.P. 1986. A human DNA segment with properties of the gene that
predisposes to retinoblastoma and osteosarcoma. Nature 323(6089): 643-646.
Frolov, M.V. and Dyson, N.J. 2004. Molecular mechanisms of E2F-dependent activation
and pRB-mediated repression. J Cell Sci 117(Pt 11): 2173-2181.
Fung, Y.K., Murphree, A.L., T'Ang, A., Qian, J., Hinrichs, S.H., and Benedict, W.F.
1987. Structural evidence for the authenticity of the human retinoblastoma gene.
Science 236(4809): 1657-1661.
Galbiati, L., Mendoza-Maldonado, R., Gutierrez, M.I., and Giacca, M. 2005. Regulation
of E2F-1 after DNA damage by p300-mediated acetylation and ubiquitination.
Cell Cycle 4(7): 930-939.
Garcia, I., Murga, M., Vicario, A., Field, S.J., and Zubiaga, A.M. 2000. A role for E2F1
in the induction of apoptosis during thymic negative selection. Cell Growth Differ
11(2): 91-98.
Gaubatz, S., Lees, J.A., Lindeman, G.J., and Livingston, D.M. 2001. E2F4 is exported
from the nucleus in a CRM1-dependent manner. Mol Cell Biol 21(4): 1384-1392.
Gaubatz, S., Wood, J.G., and Livingston, D.M. 1998. Unusual proliferation arrest and
transcriptional control properties of a newly discovered E2F family member, E2F6. ProcNatl Acad Sci U S A 95(16): 9190-9195.
Ghosh, M.K. and Harter, M.L. 2003. A viral mechanism for remodeling chromatin
structure in GO cells. Mol Cell 12(1): 255-260.
Giangrande, P.H., Zhu, W., Schlisio, S., Sun, X., Mori, S., Gaubatz, S., and Nevins, J.R.
2004. A role for E2F6 in distinguishing G1/S- and G2/M-specific transcription.
Genes Dev 18(23): 2941-2951.
Gil, J., Bernard, D., Martinez, D., and Beach, D. 2004. Polycomb CBX7 has a unifying
role in cellular lifespan. Nat Cell Biol 6(1): 67-72.
Ginsberg, D., Vairo, G., Chittenden, T., Xiao, Z.X., Xu, G., Wydner, K.L., DeCaprio,
J.A., Lawrence, J.B., and Livingston, D.M. 1994. E2F-4, a new member of the
E2F transcription factor family, interacts with p107. Genes Dev 8(22): 2665-2679.
Girling, R., Partridge, J.F., Bandara, L.R., Burden, N., Totty, N.F., Hsuan, J.J., and La
Thangue, N.B. 1993. A new component of the transcription factor DRTF1/E2F.
Nature 362(6415): 83-87.
Gu, W., Shi, X.L., and Roeder, R.G. 1997. Synergistic activation of transcription by CBP
and p53. Nature 387(6635): 819-823.
Hagemeier, C., Cook, A., and Kouzarides, T. 1993. The retinoblastoma protein binds E2F
residues required for activation in vivo and TBP binding in vitro. Nucleic Acids
Res 21(22): 4998-5004.
Hall, M. and Peters, G. 1996. Genetic alterations of cyclins, cyclin-dependent kinases,
and Cdk inhibitors in human cancer. Adv Cancer Res 68: 67-108.
Hannon, d.J., Demetrick, D., and Beach, D. 1993. Isolation of the Rb-related p130
through its interaction with CDK2 and cyclins. Genes Dev 7(12A): 2378-2391.
Hateboer, G., Kerkhoven, R.M., Shvarts, A., Bernards, R., and Beijersbergen, R.L. 1996.
Degradation of E2F by the ubiquitin-proteasome pathway: regulation by
retinoblastoma family proteins and adenovirus transforming proteins. Genes Dev
10(23): 2960-2970.
He, Y., Armanious, M.K., Thomas, M.J., and Cress, W.D. 2000. Identification of E2F3B, an alternative form of E2F-3 lacking a conserved N-terminal region.
Oncogene 19(30): 3422-3433.
Helin, K., Holm, K., Niebuhr, A., Eiberg, H., Tommerup, N., Hougaard, S., Poulsen,
H.S., Spang-Thomsen, M., and Norgaard, P. 1997. Loss of the retinoblastoma
protein-related p130 protein in small cell lung carcinoma. Proc Natl Acad Sci U S
A 94(13): 6933-6938.
Helin, K., Lees, J.A., Vidal, M., Dyson, N., Harlow, E., and Fattaey, A. 1992. A cDNA
encoding a pRB-binding protein with properties of the transcription factor E2F.
Cell 70(2): 337-350.
Helin, K., Wu, C.L., Fattaey, A.R., Lees, J.A., Dynlacht, B.D., Ngwu, C., and Harlow, E.
1993. Heterodimerization of the transcription factors E2F-1 and DP-1 leads to
cooperative trans-activation. Genes Dev 7(10): 1850-1861.
Hendricks, K.B., Shanahan, F., and Lees, E. 2004. Role for BRG1 in cell cycle control
and tumor suppression. Mol Cell Biol 24(1): 362-376.
Hermeking, H., Lengauer, C., Polyak, K., He, T.C., Zhang, L., Thiagalingam, S., Kinzler,
K.W., and Vogelstein, B. 1997. 14-3-3 sigma is a p53-regulated inhibitor of G2/M
progression. Mol Cell 1(1): 3-11.
Hernando, E., Nahle, Z., Juan, G., Diaz-Rodriguez, E., Alaminos, M., Hemann, M.,
Michel, L., Mittal, V., Gerald, W., Benezra, R., Lowe, S.W., and Cordon-Cardo,
C. 2004. Rb inactivation promotes genomic instability by uncoupling cell cycle
progression from mitotic control. Nature 430(7001): 797-802.
Hershko, T., Chaussepied, M., Oren, M., and Ginsberg, D. 2005. Novel link between E2F
and p53: proapoptotic cofactors of p53 are transcriptionally upregulated by E2F.
Cell Death Differ 12(4): 377-383.
Hershko, T. and Ginsberg, D. 2004. Up-regulation of Bcel-2 homology 3 (BH3)-only
proteins by E2F1 mediates apoptosis. J Biol Chem 279(10): 8627-8634.
Hiebert, S.W., Chellappan, S.P., Horowitz, J.M., and Nevins, J.R. 1992. The interaction
of RB with E2F coincides with an inhibition of the transcriptional activity of E2F.
Genes Dev 6(2): 177-185.
Hiebert, S.W., Lipp, M., and Nevins, J.R. 1989. E1A-dependent trans-activation of the
human MYC promoter is mediated by the E2F factor. Proc Natl Acad Sci U S A
86(10): 3594-3598.
Hijmans, E.M., Voorhoeve, P.M., Beijersbergen, R.L., van 't Veer, L.J., and Bernards, R.
1995. E2F-5, a new E2F family member that interacts with p130 in vivo. Mol Cell
Biol 15(6): 3082-3089.
Hofferer, M., Wirbelauer, C., Humar, B., and Krek, W. 1999. Increased levels of E2F-1dependent DNA binding activity after UV- or gamma-irradiation. Nucleic Acids
Res 27(2): 491-495.
Hofmann, F., Martelli, F., Livingston, D.M., and Wang, Z. 1996. The retinoblastoma
gene product protects E2F-1 from degradation by the ubiquitin-proteasome
pathway. Genes Dev 10(23): 2949-2959.
Hollander, M.C., Alamo, I., Jackman, J., Wang, M.G., McBride, O.W., and Fornace, A.J.,
Jr. 1993. Analysis of the mammalian gadd45 gene and its response to DNA
damage. J Biol Chem 268(32): 24385-24393.
Honda, R. and Yasuda, H. 1999. Association of pl9(ARF) with Mdm2 inhibits ubiquitin
ligase activity of Mdm2 for tumor suppressor p53. Embo J 18(1): 22-27.
Hsieh, J.K., Fredersdorf, S., Kouzarides, T., Martin, K., and Lu, X. 1997. E2F1-induced
apoptosis requires DNA binding but not transactivation and is inhibited by the
retinoblastoma protein through direct interaction. Genes Dev 11(14): 1840-1852.
Huang, Y., Ishiko, T., Nakada, S., Utsugisawa, T., Kato, T., and Yuan, Z.M. 1997. Role
for E2F in DNA damage-induced entry of cells into S phase. CancerRes 57(17):
3640-3643.
Humbert, P.O., Verona, R., Trimarchi, J.M., Rogers, C., Dandapani, S., and Lees, J.A.
2000. E2f3 is critical for normal cellular proliferation. Genes Dev 14(6): 690-703.
Hupp, T.R. and Lane, D.P. 1994. Allosteric activation of latent p53 tetramers. CurrBiol
4(10): 865-875.
Inoue, K., Wen, R., Rehg, J.E., Adachi, M., Cleveland, J.L., Roussel, M.F., and Sherr,
C.J. 2000. Disruption of the ARF transcriptional activator DMP1 facilitates cell
immortalization, Ras transformation, and tumorigenesis. Genes Dev 14(14): 17971809.
Irwin, M., Marin, M.C., Phillips, A.C., Seelan, R.S., Smith, D.I., Liu, W., Flores, E.R.,
Tsai, K.Y., Jacks, T., Vousden, K.H., and Kaelin, W.G., Jr. 2000. Role for the p53
homologue p73 in E2F-1-induced apoptosis. Nature 407(6804): 645-648.
Ishida, S., Huang, E., Zuzan, H., Spang, R., Leone, G., West, M., and Nevins, J.R. 2001.
Role for E2F in control of both DNA replication and mitotic functions as revealed
from DNA microarray analysis. Mol Cell Biol 21(14): 4684-4699.
Ivey-Hoyle, M., Conroy, R., Huber, H.E., Goodhart, P.J., Oliff, A., and Heimbrook, D.C.
1993. Cloning and characterization of E2F-2, a novel protein with the
biochemical properties of transcription factor E2F. Mol Cell Biol 13(12): 78027812.
Jacks, T., Fazeli, A., Schmitt, E.M., Bronson, R.T., Goodell, M.A., and Weinberg, R.A.
1992. Effects of an Rb mutation in the mouse. Nature 359(6393): 295-300.
Jacks, T., Remington, L., Williams, B.O., Schmitt, E.M., Halachmi, S., Bronson, R.T.,
and Weinberg, R.A. 1994. Tumor spectrum analysis in p53-mutant mice. Curr
Biol 4(1): 1-7.
Jacobs, J.J., Keblusek, P., Robanus-Maandag, E., Kristel, P., Lingbeek, M., Nederlof,
P.M., van Welsem, T., van de Vijver, M.J., Koh, E.Y., Daley, G.Q., and van
Lohuizen, M. 2000. Senescence bypass screen identifies TBX2, which represses
Cdkn2a (pl9(ARF)) and is amplified in a subset of human breast cancers. Nat
Genet 26(3): 291-299.
Jacobs, J.J., Kieboom, K., Marino, S., DePinho, R.A., and van Lohuizen, M. 1999. The
oncogene and Polycomb-group gene bmi-1 regulates cell proliferation and
senescence through the ink4a locus. Nature 397(6715): 164-168.
Johnson, D.G., Schwarz, J.K., Cress, W.D., and Nevins, J.R. 1993. Expression of
transcription factor E2F1 induces quiescent cells to enter S phase. Nature
365(6444): 349-352.
Jones, S.N., Roe, A.E., Donehower, L.A., and Bradley, A. 1995. Rescue of embryonic
lethality in Mdm2-deficient mice by absence of p53. Nature 378(6553): 206-208.
Kaelin, W.G., Jr., Krek, W., Sellers, W.R., DeCaprio, J.A., Ajchenbaum, F., Fuchs, C.S.,
Chittenden, T., Li, Y., Farnham, P.J., Blanar, M.A., and et al. 1992. Expression
cloning of a cDNA encoding a retinoblastoma-binding protein with E2F-like
properties. Cell 70(2): 351-364.
Kamijo, T., Weber, J.D., Zambetti, G., Zindy, F., Roussel, M.F., and Sherr, C.J. 1998.
Functional and physical interactions of the ARF tumor suppressor with p53 and
Mdm2. ProcNatl Acad Sci U S A 95(14): 8292-8297.
Kamijo, T., Zindy, F., Roussel, M.F., Quelle, D.E., Downing, J.R., Ashmun, R.A.,
Grosveld, G., and Sherr, C.J. 1997. Tumor suppression at the mouse INK4a locus
mediated by the alternative reading frame product pl9ARF. Cell 91(5): 649-659.
Kang, H., Cui, K., and Zhao, K. 2004. BRG1 controls the activity of the retinoblastoma
protein via regulation of p21CIP1/WAFl/SDI. Mol Cell Biol 24(3): 1188-1199.
Kel, A.E., Kel-Margoulis, O.V., Farnham, P.J., Bartley, S.M., Wingender, E., and Zhang,
M.Q. 2001. Computer-assisted identification of cell cycle-related genes: new
targets for E2F transcription factors. J Mol Biol 309(1): 99-120.
Khosravi, R., Maya, R., Gottlieb, T., Oren, M., Shiloh, Y., and Shkedy, D. 1999. Rapid
ATM-dependent phosphorylation of MDM2 precedes p53 accumulation in
response to DNA damage. Proc Natl Acad Sci U S A 96(26): 14973-14977.
Knudson, A.G., Jr. 1971. Mutation and cancer: statistical study of retinoblastoma. Proc
Natl Acad Sci U SA 68(4): 820-823.
Kong, L.J., Chang, J.T., Bild, A.H., and Nevins, J.R. 2007. Compensation and specificity
of function within the E2F family. Oncogene 26(3): 321-327.
Kovesdi, I., Reichel, R., and Nevins, J.R. 1986. Identification of a cellular transcription
factor involved in E1A trans- activation. Cell 45(2): 219-228.
1987. Role of an adenovirus E2 promoter binding factor in E1A-mediated coordinate
gene control. Proc Natl Acad Sci U S A 84(8): 2180-2184.
Kowalik, T.F., DeGregori, J., Leone, G., Jakoi, L., and Nevins, J.R. 1998. E2F1-specific
induction of apoptosis and p53 accumulation, which is blocked by Mdm2. Cell
Growth Differ 9(2): 113-118.
Kowalik, T.F., DeGregori, J., Schwarz, J.K., and Nevins, J.R. 1995. E2F1 overexpression
in quiescent fibroblasts leads to induction of cellular DNA synthesis and
apoptosis. J Virol 69(4): 2491-2500.
Krek, W., Ewen, M.E., Shirodkar, S., Arany, Z., Kaelin, W.G., Jr., and Livingston, D.M.
1994. Negative regulation of the growth-promoting transcription factor E2F-1 by
a stably bound cyclin A-dependent protein kinase. Cell 78(1): 161-172.
Krek, W., Xu, G., and Livingston, D.M. 1995. Cyclin A-kinase regulation of E2F-1 DNA
binding function underlies suppression of an S phase checkpoint. Cell 83(7):
1149-1158.
Kuo, M.L., Duncavage, E.J., Mathew, R., den Besten, W., Pei, D., Naeve, D., Yamamoto,
T., Cheng, C., Sherr, C.J., and Roussel, M.F. 2003. Arf induces p53-dependent
and -independent antiproliferative genes. CancerRes 63(5): 1046-1053.
La Thangue, N.B. and Rigby, P.W. 1987. An adenovirus E1A-like transcription factor is
regulated during the differentiation of murine embryonal carcinoma stem cells.
Cell 49(4): 507-513.
La Thangue, N.B., Thimmappaya, B., and Rigby, P.W. 1990. The embryonal carcinoma
stem cell Ela-like activity involves a differentiation-regulated transcription factor.
Nucleic Acids Res 18(10): 2929-2938.
Lam, E.W. and Watson, R.J. 1993. An E2F-binding site mediates cell-cycle regulated
repression of mouse B- myb transcription. Embo J 12(7): 2705-2713.
Lazzerini Denchi, E., Attwooll, C., Pasini, D., and Helin, K. 2005. Deregulated E2F
activity induces hyperplasia and senescence-like features in the mouse pituitary
gland. Mol Cell Biol 25(7): 2660-2672.
Lazzerini Denchi, E. and Helin, K. 2005. E2F1 is crucial for E2F-dependent apoptosis.
EMBO Rep 6(7): 661-668.
Lee, C., Chang, J.H., Lee, H.S., and Cho, Y. 2002. Structural basis for the recognition of
the E2F transactivation domain by the retinoblastoma tumor suppressor. Genes
Dev 16(24): 3199-3212.
Lee, E.Y., Chang, C.Y., Hu, N., Wang, Y.C., Lai, C.C., Herrup, K., Lee, W.H., and
Bradley, A. 1992. Mice deficient for Rb are nonviable and show defects in
neurogenesis and haematopoiesis. Nature 359(6393): 288-294.
Lee, E.Y., Hu, N., Yuan, S.S., Cox, L.A., Bradley, A., Lee, W.H., and Herrup, K. 1994.
Dual roles of the retinoblastoma protein in cell cycle regulation and neuron
differentiation. Genes Dev 8(17): 2008-2021.
Lee, S.B., Kim, S.H., Bell, D.W., Wahrer, D.C., Schiripo, T.A., Jorczak, M.M., Sgroi,
D.C., Garber, J.E., Li, F.P., Nichols, K.E., Varley, J.M., Godwin, A.K., Shannon,
K.M., Harlow, E., and Haber, D.A. 2001. Destabilization of CHK2 by a missense
mutation associated with Li-Fraumeni Syndrome. CancerRes 61(22): 8062-8067.
Lee, W.H., Bookstein, R., Hong, F., Young, L.J., Shew, J.Y., and Lee, E.Y. 1987a.
Human retinoblastoma susceptibility gene: cloning, identification, and sequence.
Science 235(4794): 1394-1399.
Lee, W.H., Shew, J.Y., Hong, F.D., Sery, T.W., Donoso, L.A., Young, L.J., Bookstein,
R., and Lee, E.Y. 1987b. The retinoblastoma susceptibility gene encodes a
nuclear phosphoprotein associated with DNA binding activity. Nature 329(6140):
642-645.
Lees, E., Faha, B., Dulic, V., Reed, S.I., and Harlow, E. 1992. Cyclin E/cdk2 and cyclin
A/cdk2 kinases associate with p107 and E2F in a temporally distinct manner.
Genes Dev 6(10): 1874-1885.
Lees, J.A., Saito, M., Vidal, M., Valentine, M., Look, T., Harlow, E., Dyson, N., and
Helin, K. 1993. The retinoblastoma protein binds to a family of E2F transcription
factors. Mol Cell Biol 13(12): 7813-7825.
Leone, G., DeGregori, J., Yan, Z., Jakoi, L., Ishida, S., Williams, R.S., and Nevins, J.R.
1998. E2F3 activity is regulated during the cell cycle and is required for the
induction of S phase. Genes Dev 12(14): 2120-2130.
Leone, G., Nuckolls, F., Ishida, S., Adams, M., Sears, R., Jakoi, L., Miron, A., and
Nevins, J.R. 2000. Identification of a novel E2F3 product suggests a mechanism
for determining specificity of repression by Rb proteins. Mol Cell Biol 20(10):
3626-3632.
Leone, G., Sears, R., Huang, E., Rempel, R., Nuckolls, F., Park, C., Giangrande, P., Wu,
L., Saavedra, H.I., Field, S.J., Thompson, M.A., Yang, H., Fujiwara, Y.,
Greenberg, M.E., Orkin, S., Smith, C., and Nevins, J.R. 2001. Myc requires
distinct E2F activities to induce S phase and apoptosis. Mol Cell 8(1): 105-113.
Li, Y., Graham, C., Lacy, S., Duncan, A.M., and Whyte, P. 1993. The adenovirus E1Aassociated 130-kD protein is encoded by a member of the retinoblastoma gene
family and physically interacts with cyclins A and E. Genes Dev 7(12A): 23662377.
Lin, W.C., Lin, F.T., and Nevins, J.R. 2001. Selective induction of E2F1 in response to
DNA damage, mediated by ATM-dependent phosphorylation. Genes Dev 15(14):
1833-1844.
Lindeman, G.J., Gaubatz, S., Livingston, D.M., and Ginsberg, D. 1997. The subcellular
localization of E2F-4 is cell-cycle dependent. ProcNatl Acad Sci U S A 94(10):
5095-5100.
Lingbeek, M.E., Jacobs, J.J., and van Lohuizen, M. 2002. The T-box repressors TBX2
and TBX3 specifically regulate the tumor suppressor gene pl4ARF via a variant
T-site in the initiator. J Biol Chem 277(29): 26120-26127.
Liu, K., Lin, F.T., Ruppert, J.M., and Lin, W.C. 2003. Regulation of E2F1 by BRCT
domain-containing protein TopBPl. Mol Cell Biol 23(9): 3287-3304.
Logan, N., Delavaine, L., Graham, A., Reilly, C., Wilson, J., Brummelkamp, T.R.,
Hijmans, E.M., Bernards, R., and La Thangue, N.B. 2004. E2F-7: a distinctive
E2F family member with an unusual organization of DNA-binding domains.
Oncogene 23(30): 5138-5150.
Logan, N., Graham, A., Zhao, X., Fisher, R., Maiti, B., Leone, G., and La Thangue, N.B.
2005. E2F-8: an E2F family member with a similar organization of DNA-binding
domains to E2F-7. Oncogene 24(31): 5000-5004.
Lowe, S.W., Cepero, E., and Evan, G. 2004. Intrinsic tumour suppression. Nature
432(7015): 307-315.
Lowe, S.W., Ruley, H.E., Jacks, T., and Housman, D.E. 1993. p53-dependent apoptosis
modulates the cytotoxicity of anticancer agents. Cell 74(6): 957-967.
Lowe, S.W. and Sherr, C.J. 2003. Tumor suppression by Ink4a-Arf: progress and puzzles.
Curr Opin Genet Dev 13(1): 77-83.
Lukas, J., Petersen, B.O., Holm, K., Bartek, J., and Helin, K. 1996. Deregulated
expression of E2F family members induces S-phase entry and overcomes
pl6INK4A-mediated growth suppression. Mol Cell Biol 16(3): 1047-1057.
Luo, R.X., Postigo, A.A., and Dean, D.C. 1998. Rb interacts with histone deacetylase to
repress transcription. Cell 92(4): 463-473.
MacPherson, D., Conkrite, K., Tam, M., Mukai, S., Mu, D., and Jacks, T. 2007. Murine
bilateral retinoblastoma exhibiting rapid-onset, metastatic progression and N-myc
gene amplification. Embo J 26(3): 784-794.
MacPherson, D., Sage, J., Kim, T., Ho, D., McLaughlin, M.E., and Jacks, T. 2004. Cell
type-specific effects of Rb deletion in the murine retina. Genes Dev 18(14): 16811694.
Maeda, T., Hobbs, R.M., Merghoub, T., Guernah, I., Zelent, A., Cordon-Cardo, C.,
Teruya-Feldstein, J., and Pandolfi, P.P. 2005. Role of the proto-oncogene
Pokemon in cellular transformation and ARF repression. Nature 433(7023): 278285.
Maestro, R., Dei Tos, A.P., Hamamori, Y., Krasnokutsky, S., Sartorelli, V., Kedes, L.,
Doglioni, C., Beach, D.H., and Hannon, G.J. 1999. Twist is a potential oncogene
that inhibits apoptosis. Genes Dev 13(17): 2207-2217.
Magae, J., Wu, C.L., Illenye, S., Harlow, E., and Heintz, N.H. 1996. Nuclear localization
of DP and E2F transcription factors by heterodimeric partners and retinoblastoma
protein family members. J Cell Sci 109(Pt 7): 1717-1726.
Maiti, B., Li, J., de Bruin, A., Gordon, F., Timmers, C., Opavsky, R., Patil, K., Tuttle, J.,
Cleghorn, W., and Leone, G. 2005. Cloning and characterization of mouse E2F8,
a novel mammalian E2F family member capable of blocking cellular
proliferation. J Biol Chem 280(18): 18211-18220.
Mann, D.J. and Jones, N.C. 1996. E2F-1 but not E2F-4 can overcome pl6-induced G1
cell-cycle arrest. CurrBiol 6(4): 474-483.
Marine, J.C. and Jochemsen, A.G. 2005. Mdmx as an essential regulator of p53 activity.
Biochem Biophys Res Commun 331(3): 750-760.
Marti, A., Wirbelauer, C., Scheffner, M., and Krek, W. 1999. Interaction between
ubiquitin-protein ligase SCFSKP2 and E2F-1 underlies the regulation of E2F-1
degradation. Nat Cell Biol 1(1): 14-19.
Martinez-Balbas, M.A., Bauer, U.M., Nielsen, S.J., Brehm, A., and Kouzarides, T. 2000.
Regulation of E2F1 activity by acetylation. Embo J 19(4): 662-671.
Mayo, L.D., Turchi, J.J., and Berberich, S.J. 1997. Mdm-2 phosphorylation by DNAdependent protein kinase prevents interaction with p53. CancerRes 57(22): 50135016.
McLure, K.G. and Lee, P.W. 1998. How p53 binds DNA as a tetramer. Embo J 17(12):
3342-3350.
Meng, R.D., Phillips, P., and El-Deiry, W.S. 1999. p53-independent increase in E2F-1
expression enhances the cytotoxic effects of etoposide and of adriamycin. Int J
Oncol 14(1): 5-14.
Mittnacht, S. 1998. Control of pRB phosphorylation. Curr Opin Genet Dev 8(1): 21-27.
Moberg, K., Starz, M.A., and Lees, J.A. 1996. E2F-4 switches from p130 to p107 and
pRB in response to cell cycle reentry. Mol Cell Biol 16(4): 1436-1449.
Montes de Oca Luna, R., Wagner, D.S., and Lozano, G. 1995. Rescue of early embryonic
lethality in mdm2-deficient mice by deletion of p53. Nature 378(6553): 203-206.
Morgenbesser, S.D., Williams, B.O., Jacks, T., and DePinho, R.A. 1994. p53-dependent
apoptosis produced by Rb-deficiency in the developing mouse lens. Nature
371(6492): 72-74.
Morkel, M., Wenkel, J., Bannister, A.J., Kouzarides, T., and Hagemeier, C. 1997. An
E2F-like repressor of transcription. Nature 390(6660): 567-568.
Moroni, M.C., Hickman, E.S., Denchi, E.L., Caprara, G., Colli, E., Cecconi, F., Muller,
H., and Helin, K. 2001. Apaf-1 is a transcriptional target for E2F and p53. Nat
Cell Biol 3(6): 552-558.
Morris, E.J. and Dyson, N.J. 2001. Retinoblastoma protein partners. Adv CancerRes 82:
1-54.
Mudryj, M., Devoto, S.H., Hiebert, S.W., Hunter, T., Pines, J., and Nevins, J.R. 1991.
Cell cycle regulation of the E2F transcription factor involves an interaction with
cyclin A. Cell 65(7): 1243-1253.
Mudryj, M., Hiebert, S.W., and Nevins, J.R. 1990. A role for the adenovirus inducible
E2F transcription factor in a proliferation dependent signal transduction pathway.
Embo J 9(7): 2179-2184.
Muller, H., Bracken, A.P., Vernell, R., Moroni, M.C., Christians, F., Grassilli, E.,
Prosperini, E., Vigo, E., Oliner, J.D., and Helin, K. 2001. E2Fs regulate the
expression of genes involved in differentiation, development, proliferation, and
apoptosis. Genes Dev 15(3): 267-285.
Nahle, Z., Polakoff, J., Davuluri, R.V., McCurrach, M.E., Jacobson, M.D., Narita, M.,
Zhang, M.Q., Lazebnik, Y., Bar-Sagi, D., and Lowe, S.W. 2002. Direct coupling
of the cell cycle and cell death machinery by E2F. Nat Cell Biol 4(11): 859-864.
Nakano, K. and Vousden, K.H. 2001. PUMA, a novel proapoptotic gene, is induced by
p53. Mol Cell 7(3): 683-694.
Narita, M., Nunez, S., Heard, E., Lin, A.W., Hearn, S.A., Spector, D.L., Hannon, G.J.,
and Lowe, S.W. 2003. Rb-mediated heterochromatin formation and silencing of
E2F target genes during cellular senescence. Cell 113(6): 703-716.
Nielsen, S.J., Schneider, R., Bauer, U.M., Bannister, A.J., Morrison, A., O'Carroll, D.,
Firestein, R., Cleary, M., Jenuwein, T., Herrera, R.E., and Kouzarides, T. 2001.
Rb targets histone H3 methylation and HP1 to promoters. Nature 412(6846): 561565.
Oda, E., Ohki, R., Murasawa, H., Nemoto, J., Shibue, T., Yamashita, T., Tokino, T.,
Taniguchi, T., and Tanaka, N. 2000. Noxa, a BH3-only member of the Bcl-2
family and candidate mediator of p53-induced apoptosis. Science 288(5468):
1053-1058.
Ogawa, H., Ishiguro, K., Gaubatz, S., Livingston, D.M., and Nakatani, Y. 2002. A
complex with chromatin modifiers that occupies E2F- and Myc-responsive genes
in GO cells. Science 296(5570): 1132-1136.
Palmero, I., Murga, M., Zubiaga, A., and Serrano, M. 2002. Activation of ARF by
oncogenic stress in mouse fibroblasts is independent of E2F1 and E2F2.
Oncogene 21(19): 2939-2947.
Palmero, I., Pantoja, C., and Serrano, M. 1998. pl9ARF links the tumour suppressor p53
to Ras. Nature 395(6698): 125-126.
Pan, H., Yin, C., Dyson, N.J., Harlow, E., Yamasaki, L., and Van Dyke, T. 1998. Key
roles for E2F1 in signaling p53-dependent apoptosis and in cell division within
developing tumors. Mol Cell 2(3): 283-292.
Parant, J., Chavez-Reyes, A., Little, N.A., Yan, W., Reinke, V., Jochemsen, A.G., and
Lozano, G. 2001. Rescue of embryonic lethality in Mdm4-null mice by loss of
Trp53 suggests a nonoverlapping pathway with MDM2 to regulate p53. Nat
Genet 29(1): 92-95.
Parisi, T., Pollice, A., Di Cristofano, A., Calabro, V., and La Mantia, G. 2002.
Transcriptional regulation of the human tumor suppressor pl4(ARF) by E2F1,
E2F2, E2F3, and Spl-like factors. Biochem Biophys Res Commun 291(5): 11381145.
Paulson, Q.X., McArthur, M.J., and Johnson, D.G. 2006. E2F3a stimulates proliferation,
p53-independent apoptosis and carcinogenesis in a transgenic mouse model. Cell
Cycle 5(2): 184-190.
Pediconi, N., lanari, A., Costanzo, A., Belloni, L., Gallo, R., Cimino, L., Porcellini, A.,
Screpanti, I., Balsano, C., Alesse, E., Gulino, A., and Levrero, M. 2003.
Differential regulation of E2F1 apoptotic target genes in response to DNA
damage. Nat Cell Biol 5(6): 552-558.
Phillips, A.C., Bates, S., Ryan, K.M., Helin, K., and Vousden, K.H. 1997. Induction of
DNA synthesis and apoptosis are separable functions of E2F- 1. Genes Dev
11(14): 1853-1863.
Pierce, A.M., Gimenez-Conti, I.B., Schneider-Broussard, R., Martinez, L.A., Conti, C.J.,
and Johnson, D.G. 1998. Increased E2F1 activity induces skin tumors in mice
heterozygous and nullizygous for p53. ProcNatl Acad Sci U S A 95(15): 88588863.
Pierce, A.M., Schneider-Broussard, R., Gimenez-Conti, I.B., Russell, J.L., Conti, C.J.,
and Johnson, D.G. 1999. E2F1 has both oncogenic and tumor-suppressive
properties in a transgenic model. Mol Cell Biol 19(9): 6408-6414.
Pohlers, M., Truss, M., Frede, U., Scholz, A., Strehle, M., Kuban, R.J., Hoffmann, B.,
Morkel, M., Birchmeier, C., and Hagemeier, C. 2005. A role for E2F6 in the
restriction of male-germ-cell-specific gene expression. CurrBiol 15(11): 10511057.
Pomerantz, J., Schreiber-Agus, N., Liegeois, N.J., Silverman, A., Alland, L., Chin, L.,
Potes, J., Chen, K., Orlow, I., Lee, H.W., Cordon-Cardo, C., and DePinho, R.A.
1998. The Ink4a tumor suppressor gene product, p 9Arf, interacts with MDM2
and neutralizes MDM2's inhibition of p53. Cell 92(6): 713-723.
Qin, X.Q., Livingston, D.M., Kaelin, W.G., Jr., and Adams, P.D. 1994. Deregulated
transcription factor E2F-1 expression leads to S-phase entry and p53-mediated
apoptosis. ProcNatl Acad Sci U SA 91(23): 10918-10922.
Quelle, D.E., Zindy, F., Ashmun, R.A., and Sherr, C.J. 1995. Alternative reading frames
of the INK4a tumor suppressor gene encode two unrelated proteins capable of
inducing cell cycle arrest. Cell 83(6): 993-1000.
Radfar, A., Unnikrishnan, I., Lee, H.W., DePinho, R.A., and Rosenberg, N. 1998.
pl9(Arf) induces p53-dependent apoptosis during abelson virus-mediated pre-B
cell transformation. Proc Natl Acad Sci U S A 95(22): 13194-13199.
Rayman, J.B., Takahashi, Y., Indjeian, V.B., Dannenberg, J.H., Catchpole, S., Watson,
R.J., te Riele, H., and Dynlacht, B.D. 2002. E2F mediates cell cycle-dependent
transcriptional repression in vivo by recruitment of an HDAC1/mSin3B
corepressor complex. Genes Dev 16(8): 933-947.
Real, P.J., Sanz, C., Gutierrez, O., Pipaon, C., Zubiaga, A.M., and Fernandez-Luna, J.L.
2006. Transcriptional activation of the proapoptotic bik gene by E2F proteins in
cancer cells. FEBS Lett 580(25): 5905-5909.
Reed, W.B., Epstein, W.L., Boder, E., and Sedgwick, R. 1966. Cutaneous manifestations
of ataxia-telangiectasia. Jama 195(9): 746-753.
Ren, B., Cam, H., Takahashi, Y., Volkert, T., Terragni, J., Young, R.A., and Dynlacht,
B.D. 2002. E2F integrates cell cycle progression with DNA repair, replication,
and G(2)/M checkpoints. Genes Dev 16(2): 245-256.
Robanus-Maandag, E., Dekker, M., van der Valk, M., Carrozza, M.L., Jeanny, J.C.,
Dannenberg, J.H., Berns, A., and te Riele, H. 1998. p107 is a suppressor of
retinoblastoma development in pRb-deficient mice. Genes Dev 12(11): 15991609.
Robertson, K.D., Ait-Si-Ali, S., Yokochi, T., Wade, P.A., Jones, P.L., and Wolffe, A.P.
2000. DNMT1 forms a complex with Rb, E2F1 and HDAC1 and represses
transcription from E2F-responsive promoters. Nat Genet 25(3): 338-342.
Rogoff, H.A., Pickering, M.T., Debatis, M.E., Jones, S., and Kowalik, T.F. 2002. E2F1
induces phosphorylation of p53 that is coincident with p53 accumulation and
apoptosis. Mol Cell Biol 22(15): 5308-5318.
Rogoff, H.A., Pickering, M.T., Frame, F.M., Debatis, M.E., Sanchez, Y., Jones, S., and
Kowalik, T.F. 2004. Apoptosis associated with deregulated E2F activity is
dependent on E2F1 and Atm/Nbsl/Chk2. Mol Cell Biol 24(7): 2968-2977.
Rounbehler, R.J., Rogers, P.M., Conti, C.J., and Johnson, D.G. 2002. Inactivation of E2fl
enhances tumorigenesis in a Myc transgenic model. CancerRes 62(11): 32763281.
Rowland, B.D., Denissov, S.G., Douma, S., Stunnenberg, H.G., Bernards, R., and Peeper,
D.S. 2002. E2F transcriptional repressor complexes are critical downstream
targets of pl9(ARF)/p53-induced proliferative arrest. Cancer Cell 2(1): 55-65.
Russell, J.L., Powers, J.T., Rounbehler, R.J., Rogers, P.M., Conti, C.J., and Johnson,
D.G. 2002. ARF differentially modulates apoptosis induced by E2F1 and Myc.
Mol Cell Biol 22(5): 1360-1368.
Sakaguchi, K., Herrera, J.E., Saito, S., Miki, T., Bustin, M., Vassilev, A., Anderson,
C.W., and Appella, E. 1998. DNA damage activates p53 through a
phosphorylation-acetylation cascade. Genes Dev 12(18): 2831-2841.
Samuels-Lev, Y., O'Connor, D.J., Bergamaschi, D., Trigiante, G., Hsieh, J.K., Zhong, S.,
Campargue, I., Naumovski, L., Crook, T., and Lu, X. 2001. ASPP proteins
specifically stimulate the apoptotic function of p53. Mol Cell 8(4): 781-794.
Schmitt, C.A., McCurrach, M.E., de Stanchina, E., Wallace-Brodeur, R.R., and Lowe,
S.W. 1999. INK4a/ARF mutations accelerate lymphomagenesis and promote
chemoresistance by disabling p53. Genes Dev 13(20): 2670-2677.
Scorrano, L. and Korsmeyer, S.J. 2003. Mechanisms of cytochrome c release by
proapoptotic BCL-2 family members. Biochem Biophys Res Commun 304(3):
437-444.
Serrano, M., Lee, H., Chin, L., Cordon-Cardo, C., Beach, D., and DePinho, R.A. 1996.
Role of the INK4a locus in tumor suppression and cell mortality. Cell 85(1): 2737.
Serrano, M., Lin, A.W., McCurrach, M.E., Beach, D., and Lowe, S.W. 1997. Oncogenic
ras provokes premature cell senescence associated with accumulation of p53 and
p16INK4a. Cell 88(5): 593-602.
Shan, B. and Lee, W.H. 1994. Deregulated expression of E2F-1 induces S-phase entry
and leads to apoptosis. Mol Cell Biol 14(12): 8166-8173.
Shan, B., Zhu, X., Chen, P.L., Durfee, T., Yang, Y., Sharp, D., and Lee, W.H. 1992.
Molecular cloning of cellular genes encoding retinoblastoma-associated proteins:
identification of a gene with properties of the transcription factor E2F. Mol Cell
Biol 12(12): 5620-5631.
Sherr, C.J. 1998. Tumor surveillance via the ARF-p53 pathway. Genes Dev 12(19):
2984-2991.
-. 2006. Divorcing ARF and p53: an unsettled case. Nat Rev Cancer6(9): 663-673.
Sherr, C.J. and DePinho, R.A. 2000. Cellular senescence: mitotic clock or culture shock?
Cell 102(4): 407-410.
Sherr, C.J. and Roberts, J.M. 1999. CDK inhibitors: positive and negative regulators of
Gl-phase progression. Genes Dev 13(12): 1501-1512.
Shieh, S.Y., Ikeda, M., Taya, Y., and Prives, C. 1997. DNA damage-induced
phosphorylation of p53 alleviates inhibition by MDM2. Cell 91(3): 325-334.
Sotillo, R., Hernando, E., Diaz-Rodriguez, E., Teruya-Feldstein, J., Cordon-Cardo, C.,
Lowe, S.W., and Benezra, R. 2007. Mad2 overexpression promotes aneuploidy
and tumorigenesis in mice. Cancer Cell 11(1): 9-23.
Sparkes, R.S., Sparkes, M.C., Wilson, M.G., Towner, J.W., Benedict, W., Murphree,
A.L., and Yunis, J.J. 1980. Regional assignment of genes for human esterase D
and retinoblastoma to chromosome band 13q 14. Science 208(4447): 1042-1044.
Stevaux, 0. and Dyson, N.J. 2002. A revised picture of the E2F transcriptional network
and RB function. Curr Opin Cell Biol 14(6): 684-691.
Stevens, C., Smith, L., and La Thangue, N.B. 2003. Chk2 activates E2F-1 in response to
DNA damage. Nat Cell Biol 5(5): 401-409.
Stiewe, T. and Putzer, B.M. 2000. Role of the p53-homologue p73 in E2Fl-induced
apoptosis. Nat Genet 26(4): 464-469.
Storre, J., Elsasser, H.P., Fuchs, M., Ullmann, D., Livingston, D.M., and Gaubatz, S.
2002. Homeotic transformations of the axial skeleton that accompany a targeted
deletion of E2f6. EMBO Rep 3(7): 695-700.
Storre, J., Schafer, A., Reichert, N., Barbero, J.L., Hauser, S., Eilers, M., and Gaubatz, S.
2005. Silencing of the meiotic genes SMClbeta and STAG3 in somatic cells by
E2F6. J Biol Chem 280(50): 41380-41386.
Stott, F.J., Bates, S., James, M.C., McConnell, B.B., Starborg, M., Brookes, S., Palmero,
I., Ryan, K., Hara, E., Vousden, K.H., and Peters, G. 1998. The alternative
product from the human CDKN2A locus, pl4(ARF), participates in a regulatory
feedback loop with p53 and MDM2. Embo J 17(17): 5001-5014.
Strober, B.E., Dunaief, J.L., Guha, and Goff, S.P. 1996. Functional interactions between
the hBRM/hBRG1 transcriptional activators and the pRB family of proteins. Mol
Cell Biol 16(4): 1576-1583.
Takahashi, Y., Rayman, J.B., and Dynlacht, B.D. 2000. Analysis of promoter binding by
the E2F and pRB families in vivo: distinct E2F proteins mediate activation and
repression. Genes Dev 14(7): 804-816.
Tao, W. and Levine, A.J. 1999. P19(ARF) stabilizes p53 by blocking nucleo-cytoplasmic
shuttling of Mdm2. Proc Natl Acad Sci U S A 96(12): 6937-6941.
Taubert, S., Gorrini, C., Frank, S.R., Parisi, T., Fuchs, M., Chan, H.M., Livingston, D.M.,
and Amati, B. 2004. E2F-dependent histone acetylation and recruitment of the
Tip60 acetyltransferase complex to chromatin in late G 1. Mol Cell Biol 24(10):
4546-4556.
Thalmeier, K., Synovzik, H., Mertz, R., Winnacker, E.L., and Lipp, M. 1989. Nuclear
factor E2F mediates basic transcription and trans-activation by El a of the human
MYC promoter. Genes Dev 3(4): 527-536.
Trimarchi, J.M., Fairchild, B., Verona, R., Moberg, K., Andon, N., and Lees, J.A. 1998.
E2F-6, a member of the E2F family that can behave as a transcriptional repressor.
Proc Natl Acad Sci U S A 95(6): 2850-2855.
Trimarchi, J.M. and Lees, J.A. 2002. Sibling rivalry in the E2F family. Nature Reviews
Mol Cell Biol 3: 11-20.
Tsai, K.Y., Hu, Y., Macleod, K.F., Crowley, D., Yamasaki, L., and Jacks, T. 1998.
Mutation of E2f-1 suppresses apoptosis and inappropriate S phase entry and
extends survival of Rb-deficient mouse embryos. Mol Cell 2(3): 293-304.
Urist, M., Tanaka, T., Poyurovsky, M.V., and Prives, C. 2004. p7 3 induction after DNA
damage is regulated by checkpoint kinases Chkl and Chk2. Genes Dev 18(24):
3041-3054.
Varley, J.M. 2003. Germline TP53 mutations and Li-Fraumeni syndrome. Hum Mutat
21(3): 313-320.
Verona, R., Moberg, K., Estes, S., Starz, M., Vernon, J.P., and Lees, J.A. 1997. E2F
activity is regulated by cell cycle-dependent changes in subcellular localization.
Mol Cell Biol 17(12): 7268-7282.
Vigo, E., Muller, H., Prosperini, E., Hateboer, G., Cartwright, P., Moroni, M.C., and
Helin, K. 1999. CDC25A phosphatase is a target of E2F and is required for
efficient E2F- induced S phase. Mol Cell Biol 19(9): 6379-6395.
Wang, C., Chen, L., Hou, X., Li, Z., Kabra, N., Ma, Y., Nemoto, S., Finkel, T., Gu, W.,
Cress, W.D., and Chen, J. 2006. Interactions between E2F1 and SirT1 regulate
apoptotic response to DNA damage. Nat Cell Biol 8(9): 1025-1031.
Weber, J.D., Jeffers, J.R., Rehg, J.E., Randle, D.H., Lozano, G., Roussel, M.F., Sherr,
C.J., and Zambetti, G.P. 2000. p53-independent functions of the pl9(ARF) tumor
suppressor. Genes Dev 14(18): 2358-2365.
Weber, J.D., Taylor, L.J., Roussel, M.F., Sherr, C.J., and Bar-Sagi, D. 1999. Nucleolar
Arf sequesters Mdm2 and activates p53. Nat Cell Biol 1(1): 20-26.
Whyte, P., Ruley, H.E., and Harlow, E. 1988. Two regions of the adenovirus early region
1A proteins are required for transformation. J Virol 62(1): 257-265.
Wu, L., Timmers, C., Maiti, B., Saavedra, H.I., Sang, L., Chong, G.T., Nuckolls, F.,
Giangrande, P., Wright, F.A., Field, S.J., Greenberg, M.E., Orkin, S., Nevins,
J.R., Robinson, M.L., and Leone, G. 2001. The E2F1-3 transcription factors are
essential for cellular proliferation. Nature 414(6862): 457-462.
Wu, X. and Levine, A.J. 1994. p53 and E2F-1 cooperate to mediate apoptosis. Proc Natl
Acad Sci U S A 91(9): 3602-3606.
Xiao, B., Spencer, J., Clements, A., Ali-Khan, N., Mittnacht, S., Broceno, C.,
Burghammer, M., Perrakis, A., Marmorstein, R., and Gamblin, S.J. 2003. Crystal
structure of the retinoblastoma tumor suppressor protein bound to E2F and the
molecular basis of its regulation. Proc Natl Acad Sci U S A 100(5): 2363-2368.
Xu, M., Sheppard, K.A., Peng, C.Y., Yee, A.S., and Piwnica-Worms, H. 1994. Cyclin
A/CDK2 binds directly to E2F- 1 and inhibits the DNA-binding activity of E2F1/DP-1 by phosphorylation. Mol Cell Biol 14(12): 8420-8431.
Yamasaki, L., Jacks, T., Bronson, R., Goillot, E., Harlow, E., and Dyson, N.J. 1996.
Tumor induction and tissue atrophy in mice lacking E2F-1. Cell 85(4): 537-548.
Yee, A.S., Reichel, R., Kovesdi, I., and Nevins, J.R. 1987. Promoter interaction of the
E1A-inducible factor E2F and its potential role in the formation of a multicomponent complex. Embo J 6(7): 2061-2068.
Zhang, H.S., Postigo, A.A., and Dean, D.C. 1999. Active transcriptional repression by the
Rb-E2F complex mediates G1 arrest triggered by pl6INK4a, TGFbeta, and
contact inhibition. Cell 97(1): 53-61.
Zhang, Y., Xiong, Y., and Yarbrough, W.G. 1998. ARF promotes MDM2 degradation
and stabilizes p53: ARF-INK4a locus deletion impairs both the Rb and p53 tumor
suppression pathways. Cell 92(6): 725-734.
Zheng, N., Fraenkel, E., Pabo, C.O., and Pavletich, N.P. 1999. Structural basis of DNA
recognition by the heterodimeric cell cycle transcription factor E2F-DP. Genes
Dev 13(6): 666-674.
Zhou, B.B. and Elledge, S.J. 2000. The DNA damage response: putting checkpoints in
perspective. Nature 408(6811): 433-439.
Zhu, J.W., DeRyckere, D., Li, F.X., Wan, Y.Y., and DeGregori, J. 1999. A role for E2F1
in the induction of ARF, p53, and apoptosis during thymic negative selection.
Cell Growth Differ 10(12): 829-838.
Ziebold, U., Reza, T., Caron, A., and Lees, J.A. 2001. E2F3 contributes both to the
inappropriate proliferation and to the apoptosis arising in Rb mutant embryos.
Genes Dev 15(4): 386-391.
Zindy, F., Eischen, C.M., Randle, D.H., Kamijo, T., Cleveland, J.L., Sherr, C.J., and
Roussel, M.F. 1998. Myc signaling via the ARF tumor suppressor regulates p53dependent apoptosis and immortalization. Genes Dev 12(15): 2424-2433.
Zindy, F., Williams, R.T., Baudino, T.A., Rehg, J.E., Skapek, S.X., Cleveland, J.L.,
Roussel, M.F., and Sherr, C.J. 2003. Arf tumor suppressor promoter monitors
latent oncogenic signals in vivo. Proc Natl Acad Sci U S A 100(26): 15930-15935.
Zwicker, J., Liu, N., Engeland, K., Lucibello, F.C., and Muller, R. 1996. Cell cycle
regulation of E2F site occupation in vivo. Science 271(5255): 1595-1597.
Chapter Two
Repression of the Arf tumor suppressor by E2F3 is required
for normal cell cycle kinetics
Phillip J. Iaquinta, Aaron Aslanian, Raluca Verona and Jacqueline A. Lees
Genes & Development 18:1413-1422, 2004
Author's Contribution: Figures 3B-D, 4, 5
Abstract
Tumor development is dependent upon the inactivation of two key tumor suppressor
networks, pl6Inkk 4a-cycD/cdk4-pRB-E2F and pl9"'f-mdm2-p53, that regulate cellular
proliferation and the tumor surveillance response. These networks are known to intersect
with one another but the mechanisms are poorly understood. Here we show that E2F
directly participates in the transcriptional control of Arfin both normal and transformed
cells. This occurs in a manner that is significantly different from the regulation of classic
E2F-responsive targets. In wildtype mouse embryonic fibroblasts (MEFs), the Arf
promoter is occupied by E2F3 and not other E2F family members. In quiescent cells, this
role is largely fulfilled by E2F3b, an E2F3 isoform whose function was previously
undetermined. E2f3-loss is sufficient to derepress Arf, triggering activation of p53 and
expression of p21 Cipl . Thus, E2F3 is a key repressor of the p19"-p53 pathway in normal
cells. Consistent with this notion, Arfmutation suppresses the activation of p53 and
p21C ip l in E2f3-deficient MEFs. Arf-loss also rescues the known cell cycle re-entry
defect of E2f -' - cells and this correlates with restoration of appropriate activation of
classic E2F-responsive genes. Our data also demonstrates a direct role for E2F in the
oncogenic activation of Arf. Specifically, we observe recruitment of the endogenous
activating E2Fs, E2F1 and E2F3a, to the Arf promoter. Thus, distinct E2F complexes
directly contribute to the normal repression and oncogenic activation of Arf. We propose
that monitoring of E2F levels and/or activity is a key component of Arf s ability to
respond to inappropriate, but not normal, cellular proliferation.
Introduction
The development of mammalian tumors is dependent upon the disruption of two
key biological activities, the control of cellular proliferation and the apoptotic response
(Hanahan and Weinberg 2000). Remarkably, the Ink4a/Arflocus encodes two distinct
tumor suppressor proteins, p16 In k4a and pl9A
(p4A
rf
in humans), that influence one or
both of these processes (Chin et al. 1998; Sherr 2001). p1 6Ink4a is a core component of the
cell cycle control machinery (Sherr and Roberts 1999). It controls the activity of the G1
kinase, cyclinDocdk4/6, and consequently the phosphorylation status of the pocket
protein family. This family includes the retinoblastoma protein (pRB) tumor suppressor
and its relatives, p107 and p130. In the unphosphorylated state, the pocket proteins bind
to the E2F family of transcription factors and prevent the expression of genes that are
essential for entry into, and passage through, the cell cycle (Trimarchi and Lees 2002).
This inhibition occurs through two distinct mechanisms. pRB binds to the activating
E2Fs, E2Fl, 2 and 3a, and blocks their transcriptional activity. At the same time, the
repressive E2Fs, E2F4 and 5, recruit p107 or p130 and their associated histone
deacetylases to E2F-responsive promoters. Under these conditions, the cell is blocked in
Go/G 1. Mitogenic signaling activates cell cycle re-entry by allowing cyclinD*cdk4/6 to
overcome the repression by p 1 6 I nk 4a . The consequent phosphorylation of the pocket
proteins causes them to dissociate from E2F enabling activation of E2F-responsive genes.
In normal cells, the p16
nk 4a-cyclinD*cdk4/6-pRB-E2F
pathway responds to both positive
and negative growth regulatory signals to determine whether or not a cell will divide
(Sherr and Roberts 1999). This pathway is disrupted in most, if not all, mammalian
tumors through loss of p1 6I n k4a , up-regulation of cyclinD*cdk4/6 or loss of pRB (Sherr
1996). The resulting deregulated proliferation is due, at least in part, to the inappropriate
activation of E2F (Pan et al. 1998; Tsai et al. 1998; Yamasaki et al. 1998; McCaffrey et
al. 1999; Ziebold et al. 2001; Ziebold et al. 2003).
The second product of the Ink4a/Arflocus, p19 Af, is a key component of the p53
tumor surveillance network (Sherr 2001). p 9Arf exists at low or undetectable levels in
most normal cell and tissue types (Zindy et al. 2003). However, its expression is
specifically activated by abnormal proliferative signals. These include the continued in
vitro culturing of mouse embryonic fibroblasts (Kamijo et al. 1997) and the inappropriate
expression of proliferative oncogenes including activated ras, c-myc, E2F, E1A and vAbl (Serrano et al. 1997; de Stanchina et al. 1998; Palmero et al. 1998; Radfar et al.
1998; Zindy et al. 1998; Dimri et al. 2000). Once it is expressed, pl9Arf inhibits the p53
ubiquitin ligase, mdm2, allowing activation of the p53 tumor suppressor (Pomerantz et al.
1998; Stott et al. 1998; Zhang et al. 1998; Honda and Yasuda 1999; Weber et al. 1999;
Llanos et al. 2001). Depending on the cellular context, p53 triggers either cell cycle
arrest (via induction of the cdk inhibitor, p21Cipl) or apoptosis (through activation of
various apoptosis inducers). In either case, this counteracts the effect of the abnormal
proliferative signals. Essentially, pl9 A acts as a defense to oncogenic signals. The
recent analysis of a mouse strain that expresses GFP in place of p19"
f,
confirms that Arf
is induced by the oncogenic signals present in incipient tumors (Zindy et al. 2003). This
explains why inactivation of the p19P-p53 network is essential for the survival and
proliferation of tumor cells in vivo (Sherr 2001).
The ability of Arfto specifically respond to inappropriate, but not normal,
proliferative signals must require a careful balance of transcriptional signals.
Understanding how this is achieved remains a major challenge. Numerous studies have
implicated E2F in this process (Phillips and Vousden 2001). The Arf promoter contains
consensus E2F binding sites and the over-expression of E2F1 is sufficient to trigger its
transcriptional activation (DeGregori et al. 1997; Bates et al. 1998). However, it is
unclear whether this regulation is direct because the identified E2F sites are not required
for E2F-dependent activation (Parisi et al. 2002; Berkovich et al. 2003). There is also
considerable debate as to which E2F family members might activate Arf (Trimarchi and
Lees 2002). Some groups conclude that this is an E2Fl-specific activity while others
propose that this is a shared property of the activating E2Fs. Certainly, E2F1 is not
required for Arfinduction in numerous settings (Palmero et al. 2002; Baudino et al. 2003)
and p19'
f itself
is dispensable for E2F-dependent apoptosis (Russell et al. 2002; Tolbert
et al. 2002; Tsai et al. 2002). These findings could reflect redundancy: perhaps multiple
E2Fs can activate a large panel of apoptotic inducers that includes p19 A f . Alternatively,
E2F may not contribute to Arf activation in vivo. Others have suggested that Arf is
regulated by repressive E2F*pocket protein complexes (Rowland et al. 2002). However,
unlike classic E2F-responsive genes, Arf is not appreciably induced during cell cycle
entry. Thus, if Arf is a genuine E2F target, it must be regulated in a distinct manner from
classic E2F-responsive genes. In this study, we use E2f3-deficient MEFs to probe the
role of E2F in Arf regulation. This analysis shows that a single member of the E2F
family, E2f3, is required to maintain the transcriptional repression of p19"f under normal
proliferative conditions.
Results
E2F3-loss causes induction of p19Af and activation of p53 in primary cells
Two E2F family members, E2F3a and E2F3b, are encoded by a single locus through the
use of different promoters and 5' coding exons (Leone et al. 2000). These proteins share
domains required for DNA binding, heterodimerization and pocket protein binding but
have distinct N-termini comprising either 122 (E2F3a) or 6 (E2F3b) amino acids. We
have previously generated an E2f3 mutant mouse strain that inactivates both of these
proteins. For simplicity, we refer to these mice as E2f3'- or E2F3-deficient. MEFs
derived from E2f3/ animals typically have a reduced rate of proliferation (Humbert et al.
2000). They also display a major defect in mitogen-induced cell cycle re-entry and a
corresponding impairment in the activation of all known E2F-responsive genes examined
(Humbert et al. 2000) (Figure 1A,B). Given these observations, we hypothesized that
pl19A
expression might be altered in E2F3-deficient MEFs if it is a bona fide E2F-target
f in early passage wild-type
gene. To test this notion, we compared the levels of pl9M
versus E2f3' MEFs during cell cycle re-entry (Figure 1). Consistent with previous
studies (Sherr and DePinho 2000), p19Ar was barely detectable in the wild-type cells and
its expression did not vary significantly during the cell cycle (Figure 1B). Strikingly,
while the expression of the classic E2F-responsive targets, cyclin A and p107, was lower
in the E2f3' MEFs than the wild-type controls, that of p19Ar was greatly increased
(Figure 1B). Thus, E2F3-loss affects p9I
from other E2F-responsive genes.
expression but in an entirely distinct manner
A 'EU,UUU
t
0 70,000
' 60,000
50,000
8 40,000
* 30,000
C
S20,000
10,000
0
Time (hours)
B
E2f3++
E2f34-.
0 12 16 20 24 0 12 16 20 24
cyclin A
--:
p107
:•WI:•
.41•·., ,,=.
..
C
- ..:-;-• =V:*3L
**
, *Ii3
E2f3+
p1 9Ar
_
".. p16
In k4 A
E2f3-
0 12 16 20 24 0 12 16 20 24
..- V 6w• - ,"O
" p53 activity
we ebeepeagI•
I
p21 CP1
Figure 1. E2f3' - MEFs have increased levels of pl9 gr f, leading to activation of p53
(A) Wildtype MEFs (solid line) and E2f3/ MEFs (dotted line) were synchronized by
serum starvation and cell cycle re-entry was monitored by [3H]-thymidine incorporation.
(B, C) Total protein extracts were prepared at the indicated times after stimulation with
10% serum and subjected to (B, C) western blotting for cyclin A, p107, p19 f , p16 Ink4a
or p21Cipl or (C) electrophoretic mobility shift assay for active p53.
The predominant function of p19 Arf is to activate p53 by inhibiting its negative
regulator, the ubiquitin ligase mdm2. We therefore used electrophoretic mobility shift
assays (EMSA) to determine whether the induction of pl9"'in the E2f3 - MEFs affected
p53 activity (Figure IC, also 2B). In wild-type MEFs, p53 DNA-binding activity
remained low throughout the cell cycle. p53 activity was elevated in E2F3-deficient
MEFs, especially during quiescence. The p53 protein also showed characteristic
hallmarks of activation: there was an increase in the levels of p53 that was
phosphorylated on Serine 15 and a subtle increase in the total p53 protein levels (data not
shown). Thus, deregulation of p9I rf in E2f3- MEFs is accompanied by the activation of
p53. A known downstream target of p53, the cdk inhibitor p21 Cipl, was also expressed at
higher levels in the E2F3-deficient MEFs (Figure IC), as was p 16 Ink4a, the other protein
expressed from the Ink4a/Arflocus (Figure 1B). It seemed likely that the elevated levels
of p19 Af , p53 and p21 Cipl might contribute to the defective cell cycle entry in the E2F3deficient MEFs.
The up-regulation of p1 9 Arf accounts for the cell cycle re-entry defect of the E2f3/
MEFs
To address the biological consequences of pl9 Ar up-regulation, we intercrossed E2f3 and
Arf mutant mice to generate E2f3- -;A rf
double mutant (DKO) MEFs. We then
examined the ability of these cells to re-enter the cell cycle relative to wild-type, E2f3
-,
and Arf- controls (Figure 2A). Consistent with previous reports (Kamijo et al. 1997), the
Arf MEFs initiated DNA synthesis more rapidly than the wild-type counterparts.
120,000.
twildt
... E2f3
100,000.
--Arf
80,000.
'DKO
60,000.
_/
40,000.
20,000.
|11
5
10
15
20
25
Time (hours)
wildtype
0
12
1
E2f3' "
16 20 24
12
DKO
Arf
7ý'
20224 0
0
12 18 20 24
0
12
16 20
24
p53 activity
,
,
.-.
- -
...
-a,
p21 c ip 1
"
cyclin A
p107
.,
,,
~A~ AAA
1ZU,UUU
wildtype
w
100,000&
80,000
/"
53(
60,000
•• '
• ,':8
KO•+7
7 '
j
~
..
.
d
lalll.,+ll,,i
40,000
20,000
ft.
0
...
...........
ovivivy···
·---5
10
15
20
Time (hours)
25
Figure 2. Elimination of pl9 A rescues cell cycle re-entry and p53-activation defects of
E2f3-deficient MEFs
(A) Wild-type MEFs (solid black line), E2f3' MEFs (dottedblack line), Arf'- MEFs
(solid grey line), and E2f3-'A rf - DKO MEFs (dotted grey line) were synchronized by
serum starvation and cell cycle re-entry was monitored by [3H]-thymidine incorporation.
(B) Total protein extracts were prepared at the indicated times after serum stimulation
and subjected to Western blotting for cyclin A, p107 and p21Cipl or electrophoretic
mobility shift assay for active p53. (C) Wild-type MEFs (solid black line), E2f3- MEFs
(dotted black line), p53 - MEFs (solid grey line), and E2f3-;p53- DKO MEFs (dashed
grey line) were analyzed exactly as described above (A).
Significantly, the cell cycle kinetics of the E2f3-f;Arf DKO MEFs were
indistinguishable from those of the Arf- MEFs. Consistent with this rescue, Arf-mutation
also suppressed the defective mitogen-induced activation of classic E2F-responsive
targets, such as cyclin A and p107, that exists in the E2f3 - cells (Figure 2B). Thus,
pl9Arf-loss is sufficient to over-ride the cell cycle re-entry defect of the E2f3 - MEFs.
EMSA and western blotting experiments showed that Arf mutation also suppressed the
activation of p53 and the induction of p21Cipl in the E2f3 - MEFs (Figure 2B), confirming
that these events are dependent upon the up-regulation of pl9 A f. Importantly, p53
mutation suppressed the cell cycle re-entry defect of the E2f3/ MEFs in an analogous
manner to Arf mutation (Figure 2C). This correlated with suppression of the p21Cip l
induction and restoration of appropriate E2F-responsive gene activation (data not shown).
Taken together, our findings indicate that E2f3 is required to inhibit Arf expression and
this plays an important role in regulating normal cell cycle re-entry by preventing
inappropriate activation of p53.
E2F3 directly contributes to the transcriptional regulation of Arf in normal cells
Although numerous studies implicate E2F in Arf control, it has not been shown that any
E2F family member is a direct transcriptional regulator of this gene. To address this
question, we first asked whether E2F3-loss affects Arf at the transcriptional level. Using
quantitative RT-PCR we examined the mRNA levels of both Arf and a well-characterized
E2F-responsive gene, p107, in wild-type versus E2F3-deficient MEFs (Figure 3A). As
in our previous studies (Humbert et al. 2000), the mitogen-induced activation of the pl07
p107
A
Arf
C
0
"
2
.........
. ................
1.5
V0)a)
1.1
"•
-- E2f3 ++
.. E2f3-1
0.5
0r
5
0
10
15
20
0. I
0
25
5
I
I
10
15
20
25
Time (hours)
Time (hours)
a
WT
1
e3
.
r
E2f3 --
control
Arf
p107
D
AS SS
I
II
a
._
II
E2F3b
a3a
.
E2F3a -I
uu
E2F3b -
a3a +b
· s~-l
I
p107
c
:ontrol
Figure 3. E2F3 is a direct repressor of Arf
(A) Wild-type (solid lines) or E2f3-' (dotted lines) MEFs were synchronized by serumstarvation and RNA was extracted at the indicated times after stimulation. Quantitative
real-time RT-PCR analysis of p107 or ArfmRNA is shown. (B) ChIP analysis of
asynchronous wild-type (WT) or E2f34- MEFs. Sonicated, cross-linked chromatin was
immunoprecipitated with the indicated antibodies, and the purified DNA was analyzed by
PCR with primers specific for the p107 or Arf promoters, or a control sequence lacking
E2F sites (1 kb upstream of the E2fl promoter). Input, 0.5% of chromatin in IP reactions
was analyzed by PCR. (C) Schematic of the E2F3a and E2F3b proteins, and the
antibodies used in ChIP analysis (Black box, DNA-binding domain; light grey box,
dimerization domain; dark grey box, transactivation domain). (D) Cell lysates of
asynchronous (AS) wild-type MEFs or wild-type MEFs incubated in 0.1% serum for 3
days (SS) were subjected to western blotting for the two E2F3 isoforms. ChIP assays for
the indicated E2F and pocket protein family members were performed on the serum
starved wild-type MEFs.
transcript was greatly impaired in the E2f3- MEFs. In contrast, Arf mRNA levels were
significantly higher in E2f3 - MEFs than the wild-type controls (Figure 3A). This upregulation was most striking in the Go time point (Figure 3A), where we observed the
greatest increase in the levels of the p19 Af protein (Figure IB). Thus, E2F3-loss is
acting, at least in part, through changes in the levels of Arf mRNA.
To determine whether E2F3 is directly involved in Arf regulation, we used
chromatin immunopreciptiation (ChIP) to examine binding of E2F family members to the
Arf and p107 promoters (Figure 3B). In asynchronously growing wild-type MEFs, we
detected no significant enrichment of any E2F at a control sequence lacking E2F sites,
one kilobase upstream of the E2F1 promoter. In contrast, several E2F family members
could be detected at the p107 promoter including E2F1, 2, 3 and 4 (Figure 3B, data not
shown). This is entirely consistent with the previous characterization of archetypal
mammalian E2F-responsive genes (Takahashi et al. 2000). Remarkably, the spectrum of
E2F proteins at the Arfpromoter differed completely from this norm: we observed only a
single E2F, E2F3 (Figure 3B). This specificity was not restricted to murine cells, since
E2F3 was also the sole E2F bound to the pl4Ar f promoter in both primary (WI-38) and
transformed (T98G, BJ-T) human cell lines (data not shown). In E2f3- MEFs, there was
no longer any enrichment of the Arf or p107 promoter sequences by the anti-E2F3
antibodies, confirming their specificity (Figure 3B). Strikingly, E2F3-deficiency caused
a slight increase in the level of E2F1 associated with the p107 promoter but there was no
evidence of E2F1, or any other E2F family member, binding to the Arf promoter in these
cells (Figure 3B). Taken together, these data show that E2F3 is directly involved in the
regulation of Arf and that loss of E2F3, without apparent recruitment of E2F1, is
sufficient to allow Arf activation. Based on these findings, we conclude that E2F3
represses Arf expression in normal cells.
It is well established that the E2F proteins can contribute to the repression of E2Fresponsive genes through recruitment of the pocket proteins, pRB, p107 and p130, and
their associated histone deacetylases (Trimarchi and Lees 2002). The E2F3 proteins have
been reported to bind to pRB, but not p107 or p130, in vivo (Moberg et al. 1996; He et al.
2000; Leone et al. 2000). Given this finding, we used ChIP assays to determine whether
one or more pocket proteins were recruited to the Arf promoter along with E2F3 (Figure
3B). Consistent with previous studies, p130, but not pRB, was readily detected at the
p107 promoter. In contrast, none of the pocket proteins were detected at the Arf promoter
(Figure 3B, and data not shown; see also Figure 3D). It is entirely possible that pRB is
present but cannot be detected due to limitations in the assay, the antibodies or the
structure of the pRB/E2F3 repressive complex. However, we consistently detect pRB at
differentiation-associated promoters using the same ChIP conditions (Tina Yuan and
J.A.L., unpublished observations). This raises the possibility that E2F3 mediates Arf
repression in a pocket protein-independent manner.
The E2F3 locus encodes two proteins, E2F3a and E2F3b, which differ only in
their N-terminal sequences (Leone et al. 2000)(Figure 3C). E2F3a has been linked to the
transcriptional activation of E2F-responsive genes, but this does not rule out a role in
repression. The transcriptional properties of E2F3b have not been established. To
discern which species of E2F3 is responsible for regulation of Arf, we made use of two
antibodies raised against the E2F3 proteins. The sc-879x antibody recognizes an epitope
on the unique amino-terminus of E2F3a, and therefore does not cross-react with E2F3b.
In contrast, a carboxyl-terminal antibody (sc-878x) recognizes both E2F3a and E2F3b.
For clarity, we will refer to these antibodies as E2F3a-specific or anti-E2F3a+b. By
detecting ectopically expressed E2F3a and E2F3b proteins, we have confirmed the
specificity of these two reagents (data not shown). These experiments also showed that
the E2F3a-specific antibody has a considerably lower activity in ChIP assays than antiE2F3a+b (data not shown). Despite its low avidity, the E2F3a-specific antibody yielded
a detectable ChIP signal at the p107 promoter (Figure 3B). Under the same conditions,
we did not see any evidence of E2F3a binding to Arf (Figure 3B); however, because of
the poor avidity of the E2F3a-specific antibody, we cannot rule out that E2F3a
contributes to the repression of Arf, yet falls beneath the detection limit of this reagent.
To address this in an alternative way, we took advantage of the differential expression
patterns of the two E2F3 species. E2F3a expression is cell cycle regulated, peaking
during the GI/S transition, while E2F3b expression is constant throughout the cell cycle.
Consequently, E2F3b is the only E2F3 isoform expressed during quiescence (Figure 3D).
Therefore, we performed ChIP from MEFs that had been arrested in Go/G 1 by serum
deprivation (Figure 3D). In this setting, the p107 promoter was specifically occupied by
E2F4 and p130, the key components of the archetypal repressive E2F/pocket protein
complex. At the same time, we still specifically detected E2F3 at the Arf promoter using
the anti-E2F3a+b antibody. This analysis strongly implicates E2F3b in the repression of
Arf in quiescent cells, yet does not exclude contribution of E2F3a, along with E2F3b, in
asynchronous cells.
The activating E2Fs are directly involved in activation of Arf in response to
oncogenic stress
It is well documented that Arf is a key regulator of the mammalian tumor surveillance
response network. Through an as yet undetermined mechanism, the inappropriate
expression of numerous oncogenes induces the expression of pl 9". The resulting p53
activation triggers either cell cycle arrest (via p21Cipl induction) or apoptosis (through
activation of pro-apoptotic genes), thereby circumventing the oncogenes' ability to drive
inappropriate proliferation. Having established a direct role for E2F3 in repression of Arf
in unstressed cells, we sought to determine what role E2F might play during the
activation of Arf by oncogenic challenge.
E2F1 is a potent oncogene. Its over-expression activates both cellular
proliferation and also the induction of pl9" f and high levels of apoptosis (DeGregori et
al. 1997; Bates et al. 1998). This latter response greatly impedes investigation of the
underlying molecular mechanisms. To overcome this problem, we have used MEFs in
which exons 2 and 3 of the Ink4a/Arf locus are deleted (Ink4a/Arf'- MEFs) and therefore
p1 6 Ink4a and pl9 Arf expression is disrupted (Serrano et al. 1996) (Figure 4A). This
mutation does not affect the upstream regulatory region of Arf, which is approximately
13kb upstream of the deletion, allowing us to examine E2F binding at the Arf promoter in
the absence of apoptosis or other secondary events that might result from p19 Arf
induction. We infected these Ink4a/Arf' MEFs with either control or E2Fl-expressing
retroviruses and used ChIP to assess E2F binding to either the Arf or p107 promoters
(Figure 4B). When Ink4a/Arf'- MEFs were infected with a control retrovirus, the
spectrum of E2F complexes detected at the Arf and p107 promoters was similar to that
AA
13
p16
lA
2kb
3
E2F sites
A
pl 9
rf
InK4aA
O,-
vector
I
__
E2F1
II
E1A
Ill
,,
i"
p107
vectoi
E2F1
E1A
+
control
,O
c
cq
cq
LL
LL
r1I
rl
LL
rl
oCO
45.
CL
vectoi
E2F1
E1A
Figure 4. The activating E2Fs bind to the Arf promoter during oncogenic challenge
(A) Schematic of the mouse Ink4a/Arf locus, indicating the exon structure, and the region
deleted in the Ink4a/Arf'- MEFs (bracket). Shaded regions in the exons indicate regions
coding for the p1 6 '"k4a (light grey) and p19n (black) proteins. The small black boxes
indicate two consensus E2F binding sites in the Arf promoter, and the two small arrows
indicate the location of the primers used in ChIP analysis. (B) Ink4a/Arf' MEFs were
infected with retrovirus over-expressing E2F1, E1A, or an empty virus (vector) and
subjected to ChIP assays with the indicated antisera.
observed in wild type, uninfected cells. Over-expression of E2F1 increased the level of
E2F1 associated with the p107 promoter, and caused a coordinate decrease in levels of
bound E2F3 and p130 (Figure 4B). This is consistent with the E2Fl's known ability to
promote cell cycle progression and activate expression of classic E2F-responsive genes
(Trimarchi and Lees 2002). Strikingly, we also detected significant levels of E2F1 at the
Arf promoter, showing that E2F1 can directly contribute to the transcriptional activation
of Arf when it is inappropriately expressed (Figure 4B).
We wished to determine whether the endogenous E2F1 participates in the
induction of Arfby other oncogenes. To address this question, we examined the effect of
over-expressing the adenoviral oncoprotein, E1A (Figure 4B). This promotes
proliferation and tumorigenesis by sequestering the pocket proteins and relieving the
transcriptional inhibition of their associated E2Fs (Ben-Israel and Kleinberger 2002). In
Ink4a/Arf- MEFs expressing E1A, we observed a decrease in p130 binding to the p107
promoter, and an increase in E2F1 binding, as expected (Figure 4B). Notably, we also
detected E2F1 binding to the Arf promoter, showing that the endogenous E2F1 protein
contributes to the activation of Arf arising from E1A expression. In addition, we detected
a weak signal with the E2F3a-specific antibody, indicating that E2F3a was cooperating
with E2F1 in the transcriptional regulation of Arf. Given these findings, we conclude that
the endogenous activating E2Fs play a direct role in the oncogene-induced activation of
Arf and the tumor surveillance network.
Discussion
Taken together, our data show that the E2F proteins play a direct role in the
transcriptional regulation of Aif. This firmly establishes Arf as a bona-fide E2Fresponsive gene. However, the nature of this regulation diverges considerably from that
of archetypal E2F-responsive targets, for example genes encoding key components of the
cell cycle control and DNA replication machinery (Figure 5). These classic E2Fresponsive genes are expressed in a cell-cycle dependent manner that is orchestrated by
the specific binding of the repressive E2F/pocket protein complexes (predominantly
E2F4/pl30) during Go/GI or the activating E2Fs (E2Fl, 2 and 3a) during late G1 and G 1/S
phase. In contrast, our data show that Arfis regulated by a more restricted subset of E2F
complexes whose activity is somehow determined by the stress-status, rather than the cell
cycle staging, of the cell.
In normal cells, Arf is constitutively repressed and our data show that this
correlates with the promoter binding of E2F3, and not other E2F family members. Since
the E2F3a-specific antibody works poorly in ChIP assay, our inability to detect a signal
with this reagent does not exclude the possibility that E2F3a contributes to Arf regulation.
In contrast, the presence of a robust anti-E2F3a+b ChIP signal in quiescent cells that
express E2F3b and not E2F3a, clearly shows that E2F3b is involved. At least in MEFs,
the absence of E2F3 is sufficient to trigger the expression of Arf without obligatory
recruitment of the activating E2Fs. Thus, E2F3b (possibly in parallel with E2F3a) is
required for the constitutive repression of Arf in normal cells. Based on its high
expression in Go/G 1 cells, E2F3b had been proposed to function as a transcriptional
Repression
dass
E2
targets
Activation
0
_f
G1/S
r ..x
NL
Figure 5. Arf is regulated by E2F in a distinct manner from classic E2F-responsive genes
84
repressor (Leone et al. 2000). Our data provide the first direct evidence for this
hypothesis.
Remarkably, our analysis of the double mutant MEFs shows that Arf-loss
completely suppresses the cell cycle entry defect of the E2f3 - MEFs. This correlates
with the loss of activation of the p53 pathway and also restoration of the normal cell
cycle dependent activation of classic E2F-responsive genes. This genetic rescue
experiment is entirely consistent with the notion that E2F3 is acting to repress Arf, and
therefore p53, in a linear pathway. However, it is also possible that the loss of Arf (or
p53) confers a proliferative advantage on the cells that outweighs or overrides the
proliferative disadvantage that results from E2f3-loss. In this scenario, Arf and E2f3
could be acting in parallel pathways or, alternatively, E2f3 could exert its effects through
both Arf/p53-dependent and Arf/p53-independent mechanisms. We currently favor the
second alternative. Taken together, the presence of E2F3 at the Arf promoter and the
derepression of Arf in E2f3 - MEFs strongly support the existence of an Arf-dependent
mechanism. However, additional experiments indicate that the Arf-p53 pathway does not
fully account for the phenotypic consequences of E2F3-loss. First, while loss of Arf or
p53 completely rescues the cell cycle re-entry defect of the E2f3- - MEFs, it only partially
suppresses their asynchronous proliferation defect (A.A. and J.A.L., unpublished
observations). Second, loss of Arf or p53 has no detectable effect on the developmental
phenotypes and the resulting embryonic/neonatal lethality of the E2f3- - mice (A.A. and
J.A.L., unpublished observations). Thus, E2f3 has at least one essential function that is
Arf/p53-independent. This second function remains to be established. We had
previously concluded that the cell cycle re-entry defect of the E2f3- - MEFs reflected a
direct role for E2f3 in the activation of classic E2F-responsive genes. However, this
current study shows that the defect in gene activation in the E2f3' MEFs is fully reversed
by the loss of Arf or p53. Based on the same logic outlined above, these results can be
explained in two ways. First, the defect in activation of classic E2F-responsive genes in
the E2f3' cells could be an indirect consequence of activation of the Arf-p53 pathway.
Alternatively, E2f3 may be required for the appropriate activation of classic E2Fresponsive genes but the consequent loss of this activation in E2F3-deficient cells is
outweighed or overridden by the increased induction of these targets that results from the
loss of Arf orp53. Given the extensive cross-talk between the pRB and p53 pathways,
both models are highly plausible. More subtle experiments will be required to distinguish
between these two possibilities.
Our analysis of the E2f3 mutant cells reinforces a growing body of evidence that
the p19A"-p53 network is the key determinant of the proliferation status of cultured
primary fibroblasts (Sherr 2001). Several other transcriptional regulators, such as Bmil,
TBX2, TBX3 and Twist, have been linked to the repression of Arf and the inhibition of
p53 signaling (Jacobs et al. 1999; Maestro et al. 1999; Jacobs et al. 2000; Brummelkamp
et al. 2002; Lingbeek et al. 2002). There is limited insight into the mechanism(s) of
action of these repressors. In vitro promoter mapping studies show that TBX2 and TBX3
can bind to a variant T-site located within the Initiator sequence of the human Arf
promoter (Lingbeek et al. 2002). However, promoter binding has not been demonstrated
in vivo. Similarly, antibodies against Bmil have not worked in ChIP assays. This is
thought to be an issue of antibody accessibility, since Bmil is a component of the multiprotein polycomb complex (van Lohuizen 1998). However, it is unclear how the Bmil-
polycomb complex is recruited to Arf, with respect to either the target DNA
sequence/chromatin structure or the identity of the component(s) that mediate the
DNA/chromatin binding. Our identification of E2F3 as an additional repressor of Arf
raises additional questions. First, what is the precise nature of the repressive E2F3
complex? Is it a unique function of E2F3b or does E2F3a contribute? Does it involve a
higher order, antibody inaccessible pRB complex or does it function in a pocket proteinindependent manner? Second, what directs E2F3, but not other E2F complexes, to bind
specifically to the Arf promoter in normal cells? Finally, what is the relationship between
E2F3 and the other known Arfrepressors? Do they function independently of one
another or work cooperatively to ensure the repression of Arf? Careful analysis of both
the repressor complexes and the Arf promoter will be required to unravel this complexity.
Our data show that E2F is also involved in the activation of Arf in response to
oncogenic signals. Although there is extensive literature suggesting a link between E2F
and Arf (Trimarchi and Lees 2002), this is the first study to demonstrate that the action of
these proteins is direct. During oncogenic activation, we see recruitment of the
endogenous E2F1 and, to a lesser extent, the other activating E2Fs, E2F2 (P.I. and J.A.L.,
unpublished observations) and E2F3a. It is important to note that we do not completely
lose the anti-E2F3a+b signal at the Arf promoter under conditions of oncogenic stress
(Figure 4B). We believe that this partially reflects differences in the level of oncogenic
activation within the population of infected cells; some have sufficient E2F activation to
disrupt the E2F3b repression while others do not. Indeed, the continued presence of p130
at the p107 promoter in E1A-infected cells, strongly suggests that some cells express
insufficient E1A to fully dissociate the pocket protein/E2F complexes. A second
possibility is that the sustained anti-E2F3a+b signal at the induced Arfpromoter reflects
recruitment of transcriptionally active E2F3a. We suspect that this is the case, at least in
the E1A-expressing cells, because we see a weak signal with the E2F3a-specific antibody
and an enhanced signal with the anti-E2F3a+b antibody. Finally, since there are at least
two E2F consensus binding sites in the Arf promoter, we cannot rule out the possibility
that E2F3b remains bound to the Arf promoter during the stress response, despite
recruitment of E2F1 or other activating E2Fs. In this scenario, the activating E2Fs must
somehow override or negate the repressive function of E2F3b to ensure Arf induction.
Importantly, this study provides considerable insight into the crosstalk between
the two key tumor suppressor networks, pRB-E2F and pl9•-p53. It is already well
established that p53's growth suppressive properties are at least partially dependent upon
the ability of its downstream target, p21Cipl, to inhibit phosphorylation of pRB and
thereby promote its ability to repress E2F (Sherr 2001). In this study, we now show that
E2F also plays a direct role in regulation of the p19"f-p53 pathway. Consistent with
previous hypotheses, the activating E2Fs directly contribute to the induction of Arf that
occurs in response to oncogenic stress, frequently referred to as the tumor surveillance
response. In addition, our data show that E2F3 plays a key role in maintaining the p19
•-
p53 network in the repressed state when there is no oncogenic stress signal. There has
been considerable debate as to how a cell could know whether it initiates inappropriate,
as opposed to appropriate, proliferation and regulate Arf accordingly (Lowe and Sherr
2003). It is well known that the state of E2F complexes is a key determinant of whether
normal cells will divide. Our current finding that various E2F complexes contribute to
both the repressed and activated states of Arf regulation strongly suggests that monitoring
of E2F levels and/or activity is likely to lie at the heart of this tumor surveillance
mechanism.
Experimental Procedures
Generation of mouse strains and MEF preparation
E2f3+';Arf' and E2f3+ ;p53+'- mice were generated by intercrossing E2f3+' mice
(Humbert et al. 2000) with either Arf'- mice (Kamijo et al. 1997) or p53' - (Williams et
al. 1994) respectively. Genotyping was performed as previously described. Double
heterozygous mutant mice were intercrossed and MEFs were prepared from el 3.5
embryos as previously described (Humbert et al. 2000). Ink4a/Arft- mice (Serrano et al.
1996) were used to generate Ink4a/Arf'- MEFs.
Serum starvation and release experiments
Passage 4 MEFs were plated in triplicate onto 3.5-cm dishes at 2 x 105 cells/dish and cell
cycle re-entry was performed as previously described (Humbert et al. 2000). After 48
hours, cells were washed twice with DME and then incubated in low serum (0.1% FCS)
for 72 hours. Cells were subsequently fed with media containing 10% FCS. For each
timepoint, cells were labeled with 5gCi [3H]-thymidine for 1 hour. Cells were harvested
and [3H]-thymidine incorporation was measured as previously described (Moberg et al.
1996).
RNA preparation and Quantitative Real-time PCR analysis
Passage 4 MEFs were plated onto 15-cm dishes at 3 x 106 cells/dish and cell cycle reentry was performed as described above. For each time point, cells were harvested and
total RNA was isolated using RNeasy (Qiagen) and an on-column DNAse step was
performed according to manufacturer's instructions. cDNAs were generated with
Superscript First Strand Synthesis System (Invitrogen). Quantitative real-time PCR
reactions using SYBR Green dye (Applied Biosystems) were run in triplicate on an ABI
Prism 7000 Real-time PCR machine (Applied Biosystems). Control 18S rRNA reactions
(Applied Biosystems) were also run to normalize ACt values. Fold change was
calculated as 2A(AACt). Primer sequences for Arf were 5'CACCGGAATCCTGGACCAG-3' and 5'-GCAGTTCGAATCTGCACCGT-3' and for
p107 were 5'-GATGCTCATCTGACCGGAGT-3' and 5'ATAAGTCACGTAGGCGCACA-3'.
Protein preparation, western blotting and gel retardation assays
Passage 4 MEFs were plated onto 15-cm dishes at 3 x 106 cells/dish and cell cycle reentry was performed as described above. For each time point, cells were harvested and
total protein was isolated as described previously (Moberg et al. 1996). Western blotting
was performed using 100gtg whole cell extract using anti-cyclin A (Santa Cruz sc-596),
anti-pl07 (Santa Cruz sc318), anti-pl9" (Novus NB200-106), anti-pl6Ink4 a (Santa Cruz
sc-1207), anti-p21cipl (Santa Cruz sc-6246). In Figure 3D, extracts were prepared as
above from asynchronous MEFs, or MEFs incubated in 0.1% serum for 3 days. Western
blotting was performed on 30gg extract using the anti-E2F3a+b antibody (sc-878, Santa
Cruz). p53 gel retardation assays were performed in the presence of supershifting
antibody using NuShift (Geneka) according to the manufacturer's instructions.
Retroviral Infection
Infections were performed exactly as described (Serrano et al. 1997), except that 15-cm
plates were used at all steps, and the procedure was scaled up accordingly. Target
Ink4a/Arf' MEFs were selected for two days in 2 mg/mL puromycin, grown for a further
two days, and then subjected to ChIP analysis as described below. pBabe-Puro, pBabePuro-E2F1 (Humbert et al. 2000), and LPC-12S-E1A have been described (de Stanchina
et al. 1998).
Chromatin Immunoprecipitation (ChIP)
ChIP was performed essentially as described (Takahashi et al. 2000). Early-passage
(passage 3-5) MEFs were used for all experiments. Sonicated, cross-linked chromatin
corresponding to approximately 3x10 6 cells was immunoprecipitated with the following
antibodies: E2Fl, sc-193; E2F3a, sc-879x; E2F3a+b, sc-878x; E2F4, sc-1082x; p130, sc317x (all from Santa Cruz); pRB, MS-594 and MS-595 (Neomarkers); control (antiLuciferase) 05-603 (Upstate Biotechnology). 3-4% of the precipitated DNA, or 0.5%
input DNA, was amplified by thirty cycles of PCR using the primer sequences: p107 (5'TTAGAGTCCGAGGTCCATCTTCT-3' and 5'-GGGCTCGTCCTCGAACATATCC3'); Arf (5'-GCTGGCTGTCACCGCGAT-3' and 5'-GCGTTGAGGCACCTCGAGA3'); E2fl-upstream (control) (5'-TGGAGGTCAAGTAGTGGCCCAAA-3' and 5'ACAATGTCTGGTTTGCTCCGCCC-3'). PCR products were resolved on 8%
polyacrylamide gels and stained with ethidium bromide.
Acknowledgments
We thank Chuck Sherr, Tyler Jacks and Ron DePinho for providing Arf, p53 and
Ink4a/Arfmutant mice and also for stimulating discussions of this project. We are also
grateful to Phil Sharp, Steve Bell and members of the Lees lab for helpful discussions
during this study and the preparation of this manuscript. J.A.L. is a Daniel K. Ludwig
Scholar. This work was supported by a grant from the NIH (PO1-CA42063) to J.A.L.
References
Bates, S., Phillips, A.C., Clark, P.A., Stott, F., Peters, G., Ludwig, R.L., and Vousden,
K.H. 1998. pl4ARF links the tumour suppressors RB and p53. Nature 395(6698):
124-125.
Baudino, T.A., Maclean, K.H., Brennan, J., Parganas, E., Yang, C., Aslanian, A., Lees,
J.A., Sherr, C.J., Roussel, M.F., and Cleveland, J.L. 2003. Myc-mediated
proliferation and lymphomagenesis, but not apoptosis, are compromised by E2fl
loss. Mol Cell 11(4): 905-914.
Ben-Israel, H. and Kleinberger, T. 2002. Adenovirus and cell cycle control. Front Biosci
7: d1369-1395.
Berkovich, E., Lamed, Y., and Ginsberg, D. 2003. E2F and Ras synergize in
transcriptionally activating pl4ARF expression. Cell Cycle 2(2): 127-133.
Brummelkamp, T.R., Kortlever, R.M., Lingbeek, M., Trettel, F., MacDonald, M.E., van
Lohuizen, M., and Bernards, R. 2002. TBX-3, the gene mutated in UlnarMammary Syndrome, is a negative regulator of p 19ARF and inhibits senescence.
J Biol Chem 277(8): 6567-6572.
Chin, L., Pomerantz, J., and DePinho, R.A. 1998. The INK4a/ARF tumor suppressor: one
gene--two products--two pathways. Trends Biochem Sci 23(8): 291-296.
de Stanchina, E., McCurrach, M.E., Zindy, F., Shieh, S.Y., Ferbeyre, G., Samuelson,
A.V., Prives, C., Roussel, M.F., Sherr, C.J., and Lowe, S.W. 1998. ElA signaling
to p53 involves the pl9(ARF) tumor suppressor. Genes Dev 12(15): 2434-2442.
DeGregori, J., Leone, G., Miron, A., Jakoi, L., and Nevins, J.R. 1997. Distinct roles for
E2F proteins in cell growth control and apoptosis. ProcNatl Acad Sci U S A
94(14): 7245-7250.
Dimri, G.P., Itahana, K., Acosta, M., and Campisi, J. 2000. Regulation of a senescence
checkpoint response by the E2F1 transcription factor and pl4(ARF) tumor
suppressor. Mol Cell Biol 20(1): 273-285.
Hanahan, D. and Weinberg, R.A. 2000. The hallmarks of cancer. Cell 100(1): 57-70.
He, Y., Armanious, M.K., Thomas, M.J., and Cress, W.D. 2000. Identification of E2F3B, an alternative form of E2F-3 lacking a conserved N-terminal region.
Oncogene 19(30): 3422-3433.
Honda, R. and Yasuda, H. 1999. Association of p19(ARF) with Mdm2 inhibits ubiquitin
ligase activity of Mdm2 for tumor suppressor p53. Embo J 18(1): 22-27.
Humbert, P.O., Verona, R., Trimarchi, J.M., Rogers, C., Dandapani, S., and Lees, J.A.
2000. E2f3 is critical for normal cellular proliferation. Genes Dev 14(6): 690-703.
Jacobs, J.J., Keblusek, P., Robanus-Maandag, E., Kristel, P., Lingbeek, M., Nederlof,
P.M., van Welsem, T., van de Vijver, M.J., Koh, E.Y., Daley, G.Q., and van
Lohuizen, M. 2000. Senescence bypass screen identifies TBX2, which represses
Cdkn2a (pl9(ARF)) and is amplified in a subset of human breast cancers. Nat
Genet 26(3): 291-299.
Jacobs, J.J., Kieboom, K., Marino, S., DePinho, R.A., and van Lohuizen, M. 1999. The
oncogene and Polycomb-group gene bmi-1 regulates cell proliferation and
senescence through the ink4a locus. Nature 397(6715): 164-168.
Kamijo, T., Zindy, F., Roussel, M.F., Quelle, D.E., Downing, J.R., Ashmun, R.A.,
Grosveld, G., and Sherr, C.J. 1997. Tumor suppression at the mouse INK4a locus
mediated by the alternative reading frame product p19ARF. Cell 91(5): 649-659.
Leone, G., Nuckolls, F., Ishida, S., Adams, M., Sears, R., Jakoi, L., Miron, A., and
Nevins, J.R. 2000. Identification of a novel E2F3 product suggests a mechanism
for determining specificity of repression by Rb proteins. Mol Cell Biol 20(10):
3626-3632.
Lingbeek, M.E., Jacobs, J.J., and van Lohuizen, M. 2002. The T-box repressors TBX2
and TBX3 specifically regulate the tumor suppressor gene pl4ARF via a variant
T-site in the initiator. J Biol Chem 277(29): 26120-26127.
Llanos, S., Clark, P.A., Rowe, J., and Peters, G. 2001. Stabilization of p53 by pl4ARF
without relocation of MDM2 to the nucleolus. Nat Cell Biol 3(5): 445-452.
Lowe, S.W. and Sherr, C.J. 2003. Tumor suppression by Ink4a-Arf: progress and puzzles.
Curr Opin Genet Dev 13(1): 77-83.
Maestro, R., Dei Tos, A.P., Hamamori, Y., Krasnokutsky, S., Sartorelli, V., Kedes, L.,
Doglioni, C., Beach, D.H., and Hannon, G.J. 1999. Twist is a potential oncogene
that inhibits apoptosis. Genes Dev 13(17): 2207-2217.
McCaffrey, J., Yamasaki, L., Dyson, N.J., Harlow, E., and Griep, A.E. 1999. Disruption
of retinoblastoma protein family function by human papillomavirus type 16 E7
oncoprotein inhibits lens development in part through E2F-1. Mol Cell Biol 19(9):
6458-6468.
Moberg, K., Starz, M.A., and Lees, J.A. 1996. E2F-4 switches from p130 to p107 and
pRB in response to cell cycle reentry. Mol Cell Biol 16(4): 1436-1449.
Palmero, I., Murga, M., Zubiaga, A., and Serrano, M. 2002. Activation of ARF by
oncogenic stress in mouse fibroblasts is independent of E2F1 and E2F2.
Oncogene 21(19): 2939-2947.
Palmero, I., Pantoja, C., and Serrano, M. 1998. pl9ARF links the tumour suppressor p53
to Ras. Nature 395(6698): 125-126.
Pan, H., Yin, C., Dyson, N.J., Harlow, E., Yamasaki, L., and Van Dyke, T. 1998. Key
roles for E2F1 in signaling p53-dependent apoptosis and in cell division within
developing tumors. Mol Cell 2(3): 283-292.
Parisi, T., Pollice, A., Di Cristofano, A., Calabro, V., and La Mantia, G. 2002.
Transcriptional regulation of the human tumor suppressor pl4(ARF) by E2F1,
E2F2, E2F3, and Spl-like factors. Biochem Biophys Res Commun 291(5): 11381145.
Phillips, A.C. and Vousden, K.H. 2001. E2F-1 induced apoptosis. Apoptosis 6(3): 173182.
Pomerantz, J., Schreiber-Agus, N., Liegeois, N.J., Silverman, A., Alland, L., Chin, L.,
Potes, J., Chen, K., Orlow, I., Lee, H.W., Cordon-Cardo, C., and DePinho, R.A.
1998. The Ink4a tumor suppressor gene product, pl9Arf, interacts with MDM2
and neutralizes MDM2's inhibition of p53. Cell 92(6): 713-723.
Radfar, A., Unnikrishnan, I., Lee, H.W., DePinho, R.A., and Rosenberg, N. 1998.
pl9(Arf) induces p53-dependent apoptosis during abelson virus-mediated pre-B
cell transformation. ProcNatl Acad Sci U SA 95(22): 13194-13199.
Rowland, B.D., Denissov, S.G., Douma, S., Stunnenberg, H.G., Bernards, R., and Peeper,
D.S. 2002. E2F transcriptional repressor complexes are critical downstream
targets of p19(ARF)/p53-induced proliferative arrest. CancerCell 2(1): 55-65.
Russell, J.L., Powers, J.T., Rounbehler, R.J., Rogers, P.M., Conti, C.J., and Johnson,
D.G. 2002. ARF differentially modulates apoptosis induced by E2F1 and Myc.
Mol Cell Biol 22(5): 1360-1368.
Serrano, M., Lee, H., Chin, L., Cordon-Cardo, C., Beach, D., and DePinho, R.A. 1996.
Role of the INK4a locus in tumor suppression and cell mortality. Cell 85(1): 2737.
Serrano, M., Lin, A.W., McCurrach, M.E., Beach, D., and Lowe, S.W. 1997. Oncogenic
ras provokes premature cell senescence associated with accumulation of p53 and
pl6INK4a. Cell 88(5): 593-602.
Sherr, C.J. 1996. Cancer cell cycles. Science 274(5293): 1672-1677.
-. 2001. The INK4a/ARF network in tumour suppression. Nat Rev Mol Cell Biol 2(10):
731-737.
Sherr, C.J. and DePinho, R.A. 2000. Cellular senescence: mitotic clock or culture shock?
Cell 102(4): 407-410.
Sherr, C.J. and Roberts, J.M. 1999. CDK inhibitors: positive and negative regulators of
G1-phase progression. Genes Dev 13(12): 1501-1512.
Stott, F.J., Bates, S., James, M.C., McConnell, B.B., Starborg, M., Brookes, S., Palmero,
I., Ryan, K., Hara, E., Vousden, K.H., and Peters, G. 1998. The alternative
product from the human CDKN2A locus, pl4(ARF), participates in a regulatory
feedback loop with p53 and MDM2. Embo J 17(17): 5001-5014.
Takahashi, Y., Rayman, J.B., and Dynlacht, B.D. 2000. Analysis of promoter binding by
the E2F and pRB families in vivo: distinct E2F proteins mediate activation and
repression. Genes Dev 14(7): 804-816.
Tolbert, D., Lu, X., Yin, C., Tantama, M., and Van Dyke, T. 2002. pl9(ARF) is
dispensable for oncogenic stress-induced p53-mediated apoptosis and tumor
suppression in vivo. Mol Cell Biol 22(1): 370-377.
Trimarchi, J.M. and Lees, J.A. 2002. Sibling rivalry in the E2F family. Nature Reviews
Mol Cell Biol 3: 11-20.
Tsai, K.Y., Hu, Y., Macleod, K.F., Crowley, D., Yamasaki, L., and Jacks, T. 1998.
Mutation of E2f-1 suppresses apoptosis and inappropriate S phase entry and
extends survival of Rb-deficient mouse embryos. Mol Cell 2(3): 293-304.
Tsai, K.Y., MacPherson, D., Rubinson, D.A., Crowley, D., and Jacks, T. 2002. ARF is
not required for apoptosis in Rb mutant mouse embryos. CurrBiol 12(2): 159163.
van Lohuizen, M. 1998. Functional analysis of mouse Polycomb group genes. Cell Mol
Life Sci 54(1): 71-79.
Weber, J.D., Taylor, L.J., Roussel, M.F., Sherr, C.J., and Bar-Sagi, D. 1999. Nucleolar
Arf sequesters Mdm2 and activates p53. Nat Cell Biol 1(1): 20-26.
Williams, B.O., Remington, L., Albert, D.M., Mukai, S., Bronson, R.T., and Jacks, T.
1994. Cooperative tumorigenic effects of germline mutations in Rb and p53. Nat
Genet 7(4): 480-484.
Yamasaki, L., Bronson, R., Williams, B.O., Dyson, N.J., Harlow, E., and Jacks, T. 1998.
Loss of E2F-1 reduces tumorigenesis and extends the lifespan of Rbl(+/-)mice.
Nat Genet 18(4): 360-364.
Zhang, Y., Xiong, Y., and Yarbrough, W.G. 1998. ARF promotes MDM2 degradation
and stabilizes p53: ARF-INK4a locus deletion impairs both the Rb and p53 tumor
suppression pathways. Cell 92(6): 725-734.
Ziebold, U., Lee, E.Y., Bronson, R.T., and Lees, J.A. 2003. E2F3 loss has opposing
effects on different pRB-deficient tumors, resulting in suppression of pituitary
tumors but metastasis of medullary thyroid carcinomas. Mol Cell Biol 23(18):
6542-6552.
Ziebold, U., Reza, T., Caron, A., and Lees, J.A. 2001. E2F3 contributes both to the
inappropriate proliferation and to the apoptosis arising in Rb mutant embryos.
Genes Dev 15(4): 386-391.
Zindy, F., Eischen, C.M., Randle, D.H., Kamijo, T., Cleveland, J.L., Sherr, C.J., and
Roussel, M.F. 1998. Myc signaling via the ARF tumor suppressor regulates p53dependent apoptosis and immortalization. Genes Dev 12(15): 2424-2433.
Zindy, F., Williams, R.T., Baudino, T.A., Rehg, J.E., Skapek, S.X., Cleveland, J.L.,
Roussel, M.F., and Sherr, C.J. 2003. Arf tumor suppressor promoter monitors
latent oncogenic signals in vivo. ProcNatl Acad Sci U SA 100(26): 15930-15935.
Chapter Three
E2F regulates the Arf-p53 tumor surveillance network in response to
oncogenic stress in vitro and in vivo.
Phillip J. laquinta and Jacqueline A. Lees
Author's contribution: Figures 1 - 4
Abstract
The p19f/p53 network is a key tumor surveillance mechanism, which responds to
oncogenic stimuli by initiating cell cycle arrest or apoptosis. Here we show that
activating E2F complexes are a key intermediate in this response. E2Fs 1-3 bind to the
Arf promoter in response to oncogenic stress, both in MEFs and in vivo tumors. This
mechanism is engaged by numerous diverse tumorigenic events, including loss of either
the Rb or p53 tumor suppressor or expression of oncogenic Ras or c-Myc. Finally, we
show that E2F regulates many other pro-apoptotic genes in a manner similar to Arf
100
Introduction
The regulation of both normal and tumor cells is controlled by the activity of two key
regulatory networks: the pl6'n14a-CDK-pRB-E2F proliferation-control pathway, and the
p19A•-mdm2-p53 stress-response pathway. The importance of these two pathways is
underscored by the fact that several components of both pathways are commonly mutated
in a diverse range of human tumors (Chin et al. 1998; Sherr 2001). The pl6ink4a-CDK pRB-E2F pathway controls normal cell growth, by responding to growth signals in the
cellular environment, and ultimately leading to the induction of a large number of genes
required for entry into and progression through the cell cycle (Trimarchi and Lees 2002).
The p19A"-Mdm2-p53 pathway controls the response to intrinsic cellular stresses, such as
DNA damage, senescence and oncogenic stress, leading to induction of cell cycle arrest
or apoptosis.
The central regulatory protein in the pl6ink4a-CDK-pRB-E2F pathway is the tumor
suppressor protein, pRB. pRB and its related pocket proteins, p107 and p130, act to
restrain cell proliferation primarily through their interaction with different members of
the E2F transcription factor family (reviewed in Dyson 1998). In Go/G 1,
hypophosphorylated pRB binds to E2F1-3 and inhibits their ability to activate target
genes required for DNA replication and cell cycle progression. At the same time, p107
and p130 bind to E2F4/5, and the resulting complexes associate with the promoters of
E2F target genes and repress their activity through the recruitment of histone deacetylases
and other chromatin-modifying enzymes. Upon growth factor stimulation,
phosphorylation of the pocket protein subunit by cyclin-CDK complexes leads to the
disruption of the pocket protein-E2F complex. Repressive E2F4/5-pocket protein
101
complexes then dissociate from the DNA and are replaced by free activating E2F proteins
(E2F1, 2, and 3), leading to the transcriptional activation of these target genes. A large
ink4a
fraction of human tumors contain mutations within one of the components of the p16
CDK-pRB-E2F pathway that result in functional inactivation of pRB and thereby
presumably the inappropriate activation of E2F1, 2 and 3 (Sherr 1996).
Overexpression of any individual activating E2F protein is sufficient to cause
quiescent cells to initiate DNA synthesis and enter the cell cycle (Johnson et al. 1993;
Qin et al. 1994; Kowalik et al. 1995; Lukas et al. 1996; DeGregori et al. 1997).
However, many cases of deregulated E2F activity can lead to induction of apoptosis (Qin
et al. 1994; Shan and Lee 1994; Kowalik et al. 1995; Vigo et al. 1999). This effect is
likely due to the ability of E2F to target the transcriptional activation of a number of proapoptotic genes (reviewed in Bracken et al. 2004). One candidate target of E2F in this
role is the Arf gene. Expression of pl9" f (the protein product of Arf) prevents Mdm2mediated degradation of p53, leading to increased levels of p53 protein (Pomerantz et al.
1998; Stott et al. 1998; Zhang et al. 1998; Honda and Yasuda 1999; Weber et al. 1999).
In most cases, this leads to sensitization to, or induction of, p53-dependent apoptosis.
Unlike other E2F target genes, Arf expression is not modulated during the cell
cycle. During normal cell growth in culture, and in most normal mouse tissues, p19 Arf
exists at low or undetectable levels (Zindy et al. 2003). However, Arf transcriptionis
dramatically induced upon expression of numerous cellular oncogenes in vitro, and in
several tumor types in vivo (reviewed in Sherr 2001). The role of this pathway in tumor
suppression is evidenced by the frequent mutation of either Arf orp53 in human tumors
(Chin et al. 1998). Additionally, mice lacking either Arfor p53 are highly prone to
102
tumorigenesis (Kamijo et al. 1997; Attardi and Jacks 1999). The key tumor-suppressive
role of p53 is the removal of cells harboring potentially oncogenic mutations, and the
activation of this response is completely dependent on Arf (Christophorou et al. 2006).
Finally, it has been shown recently that the Arf-p53 pathway is induced during the
development of retinoblastoma in humans, and that inactivation of this pathway is a
requisite step for tumorigenesis (Laurie et al. 2006).
Several regulatory proteins are known to influence Arfexpression either
positively or negatively, although most have not been shown to act directly via promoter
binding. Two members of the Polycomb group of proteins, Bmi-1 and CBX7, can reduce
expression of both Arf and Ink4a when overexpressed, and prevent the induction of the
Arf-p53 pathway in EplMyc-induced lymphomas (Jacobs et al. 1999b; Scott et al. 2007).
Other factors such as Twist, Pokemon, and TBX2/3 also inhibit Arfexpression when
overexpressed in vitro (Maestro et al. 1999; Lingbeek et al. 2002; Maeda et al. 2005).
The transcription factor Dmp 1 directly activates Arf transcription downstream of Ras
activation (Inoue et al. 1999; Sreeramaneni et al. 2005); however, the mechanism of Arf
activation in response to other oncogenes is unknown. Indeed, it is unclear which factors
regulate the activation of Arf in response to oncogenesis in vivo. The activating E2Fs
appeared to be good candidates for this role because of the high frequency of pRBinactivation, and thereby E2F activation, in human tumors and the early demonstration
that overexpression of either E2F1 or E2F2 induces Arf mRNA (DeGregori et al. 1997;
Bates et al. 1998).
Subsequent observations have raised questions as to whether Arf was a bona fide
E2F responsive gene in vivo. First, the E2F consensus binding sites in the Arf promoter
103
are dispensable for Arf activation (Parisi et al. 2002; Berkovich et al. 2003). Second,
neither E2fl nor E2J2 is required for Arf induction in response to expression of either ras
or E1A (Palmero et al. 2002). Finally, the levels of p19A do not fluctuate during the cell
cycle like classic E2F-responsive genes. Recently, we demonstrated that Arf is directly
regulated by E2F, but in a manner distinct from its control of other cell cycle-regulated
target genes (Aslanian et al. 2004; laquinta et al. 2005). The Arf promoter is bound
specifically by an E2F3 species in normal, unstressed MEFs, but overexpression of the
adenoviral E1A oncoprotein in these cells allows the endogenous activating E2Fs (E2F1,
2, and 3a) to bind to the Arf promoter, concomitant with Arf activation. In this study, we
demonstrate that the activating E2Fs play a key role in the tumor surveillance response in
physiologically-relevant conditions; they are recruited to Arf in response to various
oncogenic stimuli in both MEFs and endogenous mouse tumors and also regulate other
pro-apoptotic genes in a similar manner to Arf
104
Results
Rb-inactivation leads to Arf induction and E2F activation
We have shown previously that different E2F proteins regulate the Arf gene in normal
cultured cells, and in response to oncogenic stress (Aslanian et al. 2004). Notably, in
unstressed cells, E2F3 is the predominant E2F protein bound to the Arf promoter. Upon
overexpression of an oncogene such as adenovirus El a, activating E2Fs are relocalized to
the Arf promoter, coincident with activation of this gene. We wished to establish the role
of the E2F in the activation of Arf in response to more physiological tumorigenic events.
First, we addressed whether the functional inactivation of the Rb tumor suppressor was
sufficient to induce E2F to activate Arf. It has been shown that acute loss of Rb is
sufficient to cause quiescent MEFs to initiate DNA synthesis in the absence of growth
factor stimulation (Sage et al. 2003). We took advantage of this cell system to examine
Arf regulation. cRblox•o x MEFs were brought to quiescence by first contact inhibition
followed by growth in low serum. To inactivate pRb expression, quiescent cells were
treated with adenovirus expressing Cre recombinase (or GFP control). After 3 days, RTPCR analysis showed that the Cre' cells contained only the recombined cRb allele and
the pRB protein was no longer detectable (Figure lA). At this time point, we also
observed dramatic up-regulation of the activating E2F species, E2F1 and E2F3a at both
the mRNA and protein levels (Figure lA). This is consistent with the fact that E2fl and
E2f3a are both E2F-responsive genes (Dimri et al. 1994; Hsiao et al. 1994; Adams et al.
2000; Leone et al. 2000). Similarly, the E2F target gene p107 was dramatically induced
by pRB-loss (Figure 1A). Finally, we found that the ArfmRNA and p19'
105
f
protein were
cRbw n MEFs
cRbI 'MEFs
a.
A
E
a.
2
0 0
pRb
Rb
Arf
0*j-" p1 9
p107
p107
C
=
p107
E2F1
-
E2F3a
*
GAPDH
.
" "
WI
+GFP
w-I +Cre
I +GFP
control
+
[
,1+Cre
D
Pituitary
C
D
.
S,:1 +GFP
1+Cre
Ard
IIl
Arf
E2f3a
Ubiquitin
B
4
U.
0
-
5
U.
CM M 04
CM4 CM
-
_ w w w w
.S
p107 F %•6.w
Cdc2 F -- -control 1
,7
p107
Cdc2
Ubiquitin
Wildtype Pituitaries
Rb Pituitary Tumor
Thyroid
0
0
E
E
V_C
U_2
2
_mw
E
Arf
Arf
p107
p107
Cdc2
Cdc2
iiw
WW-
R T-
am
I
-T
control
Ubiquitin
Rb Thyroid Tumor
Figure 1. Loss of Rb in MEFs or in mouse tumors leads to upregulation of Arf
° MEFs were infected with adenovirus expressing GFP or GFP(A) Quiescent cRblox ox
Cre, or stimulated with 15% FBS, and cells were harvested 3d or 18h later, respectively.
Cells were analyzed for gene expression by RT-PCR (left) or Western blot (right). In the
Rb RT-PCR, the upper band represents the wildtype allele, and the lower band is the
° MEFs infected with GFP or
recombined allele. (B) ChIP analysis of quiescent cRblo° ox
GFP-Cre adenovirus. Chromatin was precipitated using the antibodies listed across the
top, and precipitated DNA was analyzed by PCR with primers specific for the promoter
region of the genes indicated at left. "Control" refers to a sequence lacking E2F binding
sites 1 kilobase upstream of the E2fl promoter. (C) RT-PCR analysis of 6 week-old
pituitaries (Rb"' or Rb -),or pituitary tumor from Rb"' mouse. (D) ChIP analysis of
pituitary tumor tissue from Rb ÷' mouse (right), or 7 pooled wildtype pituitaries (left). (E)
RT-PCR analysis of 2 month-old thyroids (Rb ' or Rb '), or thyroid tumor from Rb "
mouse. (F) ChIP analysis of thyroid tumor tissue from Rb+/ mouse.
106
also upregulated by the acute deletion of Rb. Notably, while levels of E2Fl, E2F3a, and
p107 were also significantly induced in serum-treated cells versus quiescent GFP' cells,
Arf expression was only modestly increased by serum (Figure lA). These results show
that Arf expression is fully induced only in response to the abnormal signals resulting
from Rb-loss in quiescent cells, but not appropriate proliferative signals induced by
serum addition.
To determine if the increase in Arfexpression caused by loss of Rb was associated
with an increase in E2F activity, we performed chromatin immunoprecipitation analysis
(ChIP) to examine proteins present at the Arf promoter. Similar to our previous studies in
wildtype MEFs, we found that cRbloxlox MEFs infected with a control virus expressing
GFP primarily showed binding of E2F3 to the Arfpromoter. The absence of ChIP signal
using an E2F3a-specific antibody suggests that E2F3b is primarily responsible for Arf
regulation in quiescent MEFs, although we occasionally detected weaker binding of other
E2Fs including E2F4 or E2F1 (Figure lB, data not shown). Consistent with its
repression in quiescent cells, the p107 promoter was bound primarily by E2F4 and
E2F3b. Despite their low level of expression in quiescent cells, we also consistently
detect binding of the activator E2Fs (E2Fl, 2, 3a) to the p107 promoter, as well as other
E2F target genes. Although it is possible that these proteins exist in repressive
complexes with pRB at these promoters, we have not been able to detect pRB binding by
" MEFs, we observed a dramatic
ChIP (data not shown). In the Cre-infected cRboxlox
increase of E2F1 binding to the Arf promoter, coincident with the activation of this gene
(Figure 1B). Additionally, we consistently detected increased E2F4 binding to the Arf
promoter in these Cre+ cells. Since we have previously shown that E2F4 plays a positive
107
role in the development of pRB-deficient tumors (Lee et al. 2002), this raises the
possibility that E2F4 acts as a transcriptional activator in pRB-deficient cells. Taken
together, these data show that the acute inactivation of Rb in MEFs is sufficient to cause a
rapid elevation in the levels of the activating E2Fs, E2F1 and 3a, to enable E2F binding
to the Arf promoter and trigger Arf activation.
Arf activation in Rb-deficient tumors in vivo
If E2F is an important component of the tumor surveillance pathway in response to Rb
loss, we should see evidence of E2F-mediated regulation of Arf in endogenous mouse
tumors. To address this question, we first examined gene regulation in Rb-mutant tumors
versus normal tissues. When compared to either wildtype pituitaries or young premalignant Rb + - pituitary tissue, ArfmRNA was induced more than ten-fold in Rb
l-
pituitary tumor tissue, to a similar degree as another E2F target gene, Cdc2 (Figure IC).
Interestingly, we did not observe induction of the p107 gene in the pituitary tumor. This
result may reflect the inability of p107 to substitute for pRB in this murine tissue;
however, we have not explored this result further.
Since E2fl, E2f3 and E2f4 all contribute to the development of pRB deficient
murine tumors (Tsai et al. 1998; Yamasaki et al. 1998; Ziebold et al. 2001; Lee et al.
2002; Ziebold et al. 2003), we used ChIP to determine the spectrum of E2F proteins
bound to the Arf promoter, and other E2F target genes, in both normal and malignant
pituitary tissue (Figure lD). We observed dramatically different patterns in these two
settings. In wildtype pituitaries, only E2F3 and E2F4 bound to the Cdc2 and p107
promoters and there was only a weak, but reproducible, E2F2 signal at Arf (Figure 1D).
108
In contrast, in the pituitary tumor tissue from Rb'-mice we now observed robust binding
of the activating E2Fs, E2F1 and 2 to both the p107 and Cdc2 promoters, and also to Arf
promoter (Figure 1D). In addition to pituitary tumors, Rb mutant mice are predisposed to
develop thyroid tumors. In an analogous manner to the pituitary, ArfmRNA was greatly
induced in these tumors (Figure lE). Because of the small size of the mouse thyroid, we
did not conduct ChlP on the wildtype tissue. However, we did examine the tumor tissue
and observed strong binding of E2F1 and 2 to Arf as well as p107 and Cdc2 (Figure IF).
Together, these experiments clearly show evidence of activation of E2F, especially E2F1
and E2F2, associated with the induction of Arf downstream of Rb mutation, both in vitro
and in vivo.
Multiple oncogenic stresses lead to E2F activation of Arf in vitro.
Since E2F is an immediate downstream target of the pRB tumor suppressor, it is easy to
see how E2F can play a central role in the regulation of both proliferation- and apoptosispromoting genes in Rb-deficient tumors. However, Arfis induced in response to
numerous oncogenic stresses, including ones that do not directly regulate E2F. Thus, we
were interested in investigating the participation of E2F in the induction of Arf in
multiple situations. First, we examined the consequences of inactivation of another major
tumor suppressor, p53. It is well established that Arf is greatly induced in p53'-MEFs
but the mechanism of this induction is unknown (Quelle et al. 1995; Stott et al. 1998;
Zindy et al. 1998). Consistent with these studies, we observed elevated levels of p19 "A in
p53-/-MEFs, compared to wildtype MEFs (Figure 2A). We then used ChIP to compare
E2F occupancy of the Arfpromoter in the two genotypes (Figure 2B). In wildtype MEFs,
E2F3 is the sole E2F protein that binds to Arf. This is consistent with our prior study that
109
+
Cu
+
B
04 U
,,-
M
U-LL LL U-M
,.
<,
to
p19Arf
S-Tubulin
.
control
g
p53-4 MEFs
Wildtype MEFs
a
MEFs +MycER
Time +4-OHT Oh 6h 14h 20h
p19Art
a
LLLLLL u
S
Arfw
w
0
Time
Oh
s,
S
._ +4-OHT
[_~
WU
I0
wu w w •
-W
YI
.
v
+2h
p -Tubulin
+6h
Arf
control
Figure 2. E2F is recuited to Arf in response to p53 loss or Myc activation
(A) Western blot, or (B) ChIP analysis of asynchronously growing wildtype or p53'
MEFs. (C, D) Wildtype MEFs expressing MycER were incubated in 0.1% FBS for 3
days, stimulated with 2gM 4-hydroxytamoxifen for the indicated times, and then
processed for Western (C) or ChIP (D) analysis.
110
established a role for E2F3 in Arfrepression in unstressed MEFs (Aslanian et al. 2004).
In contrast, we consistently found that E2F1 and 2 occupied the Arfpromoter in the p53-1
MEFs (Figure 2B). Since p53-'- MEFs have drastically reduced levels of p21Cipl
(Gorospe et al. 1998; Flores et al. 2002), it is likely that the resulting increased CDK
activity, and consequent pRB phosphorylation in these cells ultimately leads to increased
E2F activity, causing the activating E2Fs to localize to the Arf promoter.
Second, we examined the consequences of oncogene activation. Over-expression
of the Myc oncoprotein is known to trigger Arf induction (Zindy et al. 1998). Within 14
hours of tamoxifen-mediated activation of a Myc-ER fusion protein in wildtype MEFs,
we observed a dramatic upregulation in the levels of p19" protein (Figure 2C). Analysis
of the Arf promoter by ChIP showed that Myc activation led to an increase in binding of
the transcriptional activators E2F1 and E2F2, relative to the untreated control (Oh; Figure
2D). This recruitment was detected within 2 hours of tamoxifen treatment, showing that
it precedes the increase in pl9" protein. Interestingly, we also saw recruitment of E2F4
to Arf similar to what we observed in response to Rb-inactivation in MEFs (Figure 1B).
Together, these experiments show that many diverse oncogenic stimuli (Rb or p53-loss,
Myc activation) lead to Arf activation, coincident with recruitment of E2Fs to the Arf
promoter.
E2F participates in the tumor-surveillance response in multiple mouse tumor
models
We found that E2F responds to Rb inactivation both in vitro and in vivo, as well as other
oncogenic stresses in MEFs. To further evaluate the relevance of our in vitro MEF
111
experiments (Figure 2), we investigated mouse tumors initiated by either loss of p53 or
overexpression of Myc. p53-' mice develop a wide spectrum of tumors, the most
common of which are thymic lymphomas derived from CD4÷CD8 ÷ T cells (Donehower
et al. 1992; Jacks et al. 1994). As a non-tumorigenic control, we first examined E2F
promoter-association in the wildtype thymus, which is composed primarily of doublepositive T cells (Figure 3A). In this tissue we detected binding of E2Fs 1-4 to the cell
cycle-regulated Cdc2 promoter; however, no E2Fs were observed at the Arf promoter.
Similar to our findings in the Rb-deficient tumors, analysis of the p534-' lymphoma
showed E2F1-4 regulation of Cdc2, but now the activating E2Fs, E2F1 and 2, were
specifically bound to the Arfpromoter (Figure 3A).
To evaluate the response to Myc signaling in vivo, we used the well-characterized
E/Myc-initiated lymphoma model (Adams et al. 1985; Eischen et al. 1999; Scott et al.
2007). Hematopoietic stem cells were isolated from fetal livers of EuMyc-transgenic
mice, injected into wildtype recipient mice, and these mice were sacrificed at 3-6 months,
upon the development of B-cell lymphoma. As with our analysis of other normal tissues,
no E2Fs associated the Arfpromoter of wildtype spleen (which is composed primarily of
B-cells), while E2F1-4 were all present at the classic E2F-responsive genes, p107 and
Cdc2. In the EpuMyc lymphoma tissue, we saw binding of all E2Fs examined, E2F1-4, to
the Arf promoter (Figure 3B). Indeed, this is comparable to what we observed in MEFs
(Figure 2D), where E2F1, E2F2, and E2F4 all were recruited to Arf after Myc activation.
As an extension of these studies, we also examined the effect of the Ras
oncogene. It is well known that oncogenic Ras leads to induction of Arf in vitro (Serrano
112
A
..o
--
U. u. U. u.
N N WN
W WUW .0
LU LLU
WLU
Arf I
Cdc2
I Lm
LI
control I
Wildtype Thymus
-Zw
IZ
i
Lymphoma
p53yo-Thymic
c÷
"-
•
p107
.
6I Cdc2 I
.
W- =
I
control
Wildtype Spleen
C
LU W U
F
Arf
._
. J
.... I
I
EpIMyc B-cell Lymphoma
cc
a
LL
LL LL.
-- w W W W
L-
DLu W
WL .
.
Arf
p107
Cdc2
60
MIW
control
Wildtype Lung
K-Ras 2Lung Tumor
Figure 3. E2Fs bind the Arf promoter in multiple tumor types
ChIP was performed on wildtype thymus or p53" thymic lymphoma tissue (A); wildtype
C 2D
spleen or E/uMyc-transgenic lymphoma (B); and wildtype lung or tumorous K-rasG
mutant lung (C).
113
et al. 1997) and can also cause a senescence-like state in vivo (Braig et al. 2005; Collado
et al. 2005). Expression of an oncogenic K-rasG12D allele from its endogenous promoter
(K-Ras A2 mutant mice) leads to the development of lung adenocarcinoma (Johnson et al.
2001). By 3 months of age, the lungs of K-ras.A 2 mice are composed of numerous
lesions of varying grade. We performed ChIP analysis of pooled lung tumor tissue from
these mice, compared to wildtype lung tissue (Figure 3A). In the wildtype lung, we saw
no evidence of E2F binding to the Arfpromoter, although E2F1-4 were all detected at the
p107 or Cdc2 promoters. In the K-rasA2 mutant lung tumors, however, E2Fl, E2F2, and
E2F3 were all detected binding to the Arf promoter, indicating that this gene is only
regulated by E2F in the lung in response to oncogenic growth signals downstream of
activated Ras. Together, these experiments show that in several different tumor types,
but not in normal tissues, activating E2F proteins, especially E2F1 and E2F2, are
recruited to the Arf promoter in response to diverse oncogenic lesions.
Multiple targets genes are regulated by E2F in an Arf-like manner
These experiments show that Arfis regulated in a manner distinct from other E2F target
genes-it is activated only in response to oncogenic stress and not normal proliferation,
both in cultured cells and in mouse tissues. Since E2F is known to activate numerous
genes involved in the apoptotic response, we hypothesized that other pro-apoptotic genes
might be regulated in a manner similar to Arf. We performed a candidate-based screen of
genes that had previously been shown to be induced by elevated levels of E2F (Gartel et
al. 1998; Muller et al. 2001; Fortin et al. 2004; Hershko and Ginsberg 2004). By ChIP
analysis, we found that the promoters of four of these genes (Caspase 7, SIVA, NOXA,
and Cdknla/p21) were bound primarily by E2F3 in wildtype MEFs (Figure 4A), similar
114
A
+
Casp7
SIVA
Ll .
-
NOXA
p21
,
Wildtype MEFs
B
Ad
MEFs + E1A
Wildtype Thyroid
Thyroid Tumor
p107
Casp7
Cdc2
SIVA
Casp7
SIVA
NOXA
+
C
II
--
NOXA
p21
Rb Thyroid Tumor
p21
Ubiquitin
Figure 4. Many pro-apoptotic targets are regulated by E2F in a manner similar to Arf
(A) ChIP analysis of asynchronous wildtype MEFs (left), or MEFs expressing E1A
(right) shows spectrum of E2F protein binding to the indicated genes. (B) Wildtype
thyroid or thyroid tumor tissue from Rb * - mouse was subject to RT-PCR analysis for the
indicated genes. (C) ChIP analysis of thyroid tumor tissue from Rb * - mouse using
primers specific for the indicated genes.
115
to Arf. Additionally, expression of adenovirus E1A protein led to the recruitment of the
activating E2F proteins E2F1, E2F2, and E2F3a to their promoters (Figure 4A). Finally,
expression of Caspase 7, SIVA, NOXA, and p21 was induced in Rb-deficient thyroid
tumor tissue, compared to normal thyroid (Figure 4B), and this correlated with binding of
activating E2F proteins to the promoters of these genes (Figure 4C). This analysis
suggests that Arf may be the founding member of a new class of E2F target genes, which
are regulated by oncogenic stress rather than growth factor stimulation.
116
Discussion
The Arf-p53 tumor-surveillance pathway is thought to monitor the proliferation state of
the cell, triggering apoptosis in the presence of oncogenic stress. How this signal is
transmitted, however, was largely unclear. Our data presented here support a model
whereby oncogenic stimuli trigger Arf transcription via activation by the E2F
transcription factor family. Importantly, the E2Fs appear to be engaged regardless of the
source of oncogenic stress, and both by loss of tumor suppressor genes or activation of
cellular oncogenes. Also, by analyzing tumors from various mouse models, we found
evidence that this E2F-Arf pathway is activated in vivo, underscoring its likely
importance in tumor suppression. It is interesting to note that we observed Arf induction
and E2F promoter-binding in fully-developed tumors, at a time when the chance to abort
tumor initiation has clearly passed. We believe that this reflects the persistence of
oncogenic proliferation in the mature tumor cells, which continues to signal to Arfvia
E2F, despite the growth of the tumor. It is likely that most tumors disable their apoptotic
program downstream of Arf, as has been shown in the EuMyc model (Eischen et al.
1999), yet the upstream signaling remains intact. Indeed, it has recently been found that
tumors lacking p53 function express high levels of pl9 Arf, and that restoration of p53 in
these tumor cells lead to apoptosis (Christophorou et al. 2006; Ventura et al. 2007).
Interestingly, we detected no binding of E2Fs to the Arf promoter in normal
mouse tissues, although they are found at the promoters of other E2F targets (e.g. Cdc2,
p107). This result clearly shows that activating E2F proteins are recruited to the Arf
promoter only in response to abnormal proliferation, and not normal proliferative signals
present in normal mouse tissues. Also, since Arf is not expressed in most normal tissues
117
(Zindy et al. 2003; Figure 1; our unpublished results), this suggests that E2Fs are not
involved in the normal repression of Arf in vivo, but only respond by activating Arf in
tumor cells. This is distinct from what we observe in unstressed MEFs, where E2F3 is
normally bound to Arf, presumably in a repressive role (Figure 2B; Aslanian et al. 2004).
It is currently unclear whether E2F3 binding is a specific phenomenon of cultured cells or
whether E2F3 participates in the repression of Arf at specific developmental stages that
are not represented in the adult tissues we have examined. Presumably, other non-E2F
proteins are responsible for enforcing repression of Arf in these normal adult tissues. A
likely candidate is the Polycomb group of proteins, many of which are capable of causing
Arf repression when over-expressed (Jacobs et al. 1999a; Gil et al. 2004). Indeed, we
have observed binding of Bmi-1 to the Arf promoter in several normal mouse tissues
(data not shown). Therefore, the role of E2F in the regulation of Arf in vivo appears to be
largely restricted to its activation in response to oncogenic proliferation.
While our data clearly demonstrate a shift in E2F regulation of Arfin normal
versus tumor tissue, we observed some variation in the specific E2F proteins that are
recruited to Arfin different tumor types. We consistently observe E2F1 and E2F2
binding to the Arfpromoter, regardless of the initiating oncogenic lesion; however, the
contribution of E2F3 and E2F4 is variable. This distinction may be due to a variation in
the ability of different oncogenes to signal to different E2Fs. Consistent with this idea,
we tend to see the same spectrum of E2Fs binding to Arfin response to a given oncogene
both in vivo and in vitro, with the exception of E2F3, which regulates Arf in MEFs
regardless of oncogenic insult. Notably, E2F4 is recruited to Arfin response to Myc
activation both in MEFs and lymphoma cells. Since we do not observed recruitment of
118
the pocket proteins pRb, p107, or p130 to Arf in this setting (data not shown), this raises
the possibility that E2F4 is contributing to the activation of Arfin response to certain
oncogenic stresses.
Several studies have suggested that the ability to induce apoptosis is unique
among E2Fs to E2F1 (DeGregori et al. 1997; Dick and Dyson 2003), although it has been
reported that E2F2 and E2F3 share the role (Vigo et al. 1999). This discrepancy could be
explained in part by the ability of E2F2 or E2F3 to induce expression of E2F1, a known
E2F-responsive gene, which has recently been demonstrated in vivo (Lazzerini Denchi
and Helin 2005). However, other studies clearly show that induction of apoptosis, and
indeed expression of Arf, is independent of E2fl (Palmero et al. 2002; Baudino et al.
2003). Our results support a model whereby multiple E2Fs can contribute to the
activation of Arf and other pro-apoptotic genes, and consequently the induction of cell
death. We clearly observe recruitment of multiple E2F proteins to pro-apoptotic gene
promoters in response to oncogenic stress; however, it remains formally possible that not
all of these E2F species are actively contributing to gene activation. Several studies have
shown that E2F1 is acetylated or phosphorylated in response to DNA damage, and that
this modification can increase its ability to bind DNA and activate transcription (Lin et al.
2001; Pediconi et al. 2003; Galbiati et al. 2005). It remains to be seen whether oncogenic
stress causes similar modifications of E2F1 or other E2Fs, and if this may affect their
ability to contribute to pro-apoptotic gene activation.
E2F is known to induce the expression of many pro-apoptotic genes when
deregulated, although in most cases it is unknown how E2F participates in the regulation
of these genes during normal cell growth. We found that a subset of genes, which are
119
activated by elevated levels of E2F, are also targets of E2F3 in unstressed MEFs; the
promoters of these genes are also bound by activating E2Fs in response to oncogenic
stress in vitro and in Rb-deficient mouse tumors in vivo. This result suggests that E2F
regulation of Arfmay serve as a model for the regulation of many additional genes that
are induced only by inappropriately elevated levels of E2F in the presence of oncogenic
stress. It remains an open question as to how oncogenic versus normal proliferation is
sensed by E2F to create this differential regulation of Arf and other genes. A simple
model would predict that increased levels of activating E2F proteins, coupled with
decreased pRB-family function due to high CDK activity, could lead to excess gene
activation due to increased E2F DNA-binding activity. However, the selection of target
genes may also involve the composition of repressive complexes occupying promoters in
the absence of stress. Our observation of E2F3 binding to Arf as well as other proapoptotic targets in wildtype MEFs is consistent with this hypothesis. However, the lack
of E2F regulation of Arf in normal mouse tissues suggests that other repressive
mechanisms are also involved.
120
Experimental Procedures
Mouse strains
The mouse strains used in this study have been previously described: cRblOxnOx (Sage et
al. 2000); p53 -'- (Williams et al. 1994); K-rasA
2
(Johnson et al. 2001). EulMyc-transgenic
lymphomas were generated exactly as described (Scott et al. 2007). Rb ÷' tumors were
generated by crossing cRblo xo Ox mice to Meox2-Cre transgenic mice to create Rb+C/
;Meox2-Cre mice, which are functionally Rb ÷'. Meox2-Cre mice were purchased from
Jackson Laboratories.
MEF culture
or cRbloxflox
Mouse embryonic fibroblasts (MEFs) were generated from progeny of p53 '4
~ MEFs
intercrosses at embryonic day 13.5 as described (Humbert et al. 2000). cRb'Oxox
were brought to quiescence exactly as described (Sage et al. 2003). Briefly, cells were
maintained at confluence in 10% FBS for three days, grown in 0.1% FBS for 3 days, then
trypsinized and replated at low density in 0.1% FBS and maintained for another 3 days.
Cells were incubated with adenovirus (100 pfu/cell) expressing GFP (Ad5 CMV eGFP)
or GFP-Cre (Ad5 CMV GFP-cre) (U. of Iowa Gene Transfer Vector Core), the media
was changed 24 hours later, and the cells were harvested 2 days later. Alternatively,
quiescent cells were incubated with 15% FBS and harvested after 18 hours.
Retroviral infections
Wildtype MEFs were infected as described (Serrano et al. 1997) with LPC-12S-E1A (de
Stanchina et al. 1998) and pBpuro c-mycERTM (Littlewood et al. 1995) and selected for 3
121
days with puromycin. MEFs expressing c-mycERTM were incubated in 0.1% FBS for 3
days, stimulated with 2gM 4-hydroxytamoxifen (Sigma), and harvested at the indicated
times.
Protein and RNA analysis
Cells were harvested and protein prepared as described (Moberg et al. 1996). Proteins
were detected by Western blot using the following antibodies: pRb (554136, BD
Pharmingen); pl9 A f (sc-32748, Santa Cruz); p107 (sc-318, Santa Cruz); E2F1 (sc-193,
Santa Cruz); E2F3a and E2F3b (sc-878, Santa Cruz); GAPDH (AM4300, Ambion); (3tubulin (T4026, Sigma). RNA was purified using RNeasy (Qiagen), and cDNA was
prepared using the Superscript First Strand Synthesis System (Invitrogen). Specific
cDNAs were amplified by 30 cycles of PCR using 20ng of total cDNA and primers
specific for Arf,p107, Ubiquitin (Aslanian et al. 2004); E2fl ( and ); E2f3a
(GTGGCCCACCGGCAA and ACCATCTGAGAGGTACTGATGGC); E2f3b
(TGCTITCGGAAATGCCCTTA and CCAGTTCCAGCCTTCGCTT); Cdc2
(ACTCCAGGCTGTATCTCATC and CAAGTCTCTGTGAAGAACTCG); SIVA
(CGCCCATCGCTTGTTCATC and CTCACCATCGTCGGCATAGTC); NOXA
(GCAGAGCTACCACCTGAGTTC and CTTTTGCGACTTCCCAGGCA); Casp7
(AGCGAAGACGGAGTTGACG and ATGCGGTACAGATAAGTGGGC); Cdknla
(GACAAGAGGCCCAGTACTTCC and CAATCTGCGCTTGGCGTGATA).
Chromatin Immunoprecipitation
ChIP was performed exactly as described (Aslanian et al. 2004). Mouse tumors or
tissues were dissected and immediately minced and incubated in 1% formaldehyde; or,
122
snap-frozen in liquid nitrogen, stored at -800 C, and cross-linked upon thawing. Tissues
were then disaggregated using a Dounce homogenizer and processed as usual.
Antibodies used were E2Fl, E2F2, E2F3a, E2F3a+b, E2F4 (Aslanian et al. 2004), c-Myc
(sc-764x, Santa Cruz). Primers used were: p107, E2fl-lkb upstream (control) (Aslanian
et al. 2004); Arf (Sreeramaneni et al. 2005); Cdc2
(ACAGAGCTCAAGAGTCAGTTGGC and CGCCAATCCGATTGCACGTAGA);
SIVA (ACAAAACCCGCCACCCTACT and TTAGCGGGATGCTACGTTGG); NOXA
(GAAGTTTCCCTCCCACCTTC and CGCTGGAATCCTCTCTGTTCA); Casp7
(GGTCGCCCAAACGTCGCA andAAAGCAAAAGTCCCAGAGGCGG); Cdknla
(CACAGTTGGTCAGGGACAGA and CCACACTCCTTCACCGA).
123
Acknowledgments
We thank members of the Lees lab for helpful discussion throughout this work, Steve
Bell for helpful comments on the manuscript, and Tyler Jacks for providing p53 and cRb
mice. We are indebted to Mona Spector and Scott Lowe for the EplMyc lymphoma
- lymphoma,
2 lung tumor, Jennifer Dovey for p534
samples, Nathan Young for K-rasLA
and Seth Berman and Eunice Lee for Rb tumors. This project was supported by an NIHNCI grant to J.A.L. (P01-CA042063), and an Integrated Cancer Biology Program
predoctoral grant to P.J.I (U54-CA112967). J.A.L. is a Ludwig Scholar at MIT.
124
References
Adams, J.M., Harris, A.W., Pinkert, C.A., Corcoran, L.M., Alexander, W.S., Cory, S.,
Palmiter, R.D., and Brinster, R.L. 1985. The c-myc oncogene driven by
immunoglobulin enhancers induces lymphoid malignancy in transgenic mice.
Nature 318(6046): 533-538.
Adams, M.R., Sears, R., Nuckolls, F., Leone, G., and Nevins, J.R. 2000. Complex
transcriptional regulatory mechanisms control expression of the E2F3 locus. Mol
Cell Biol 20(10): 3633-3639.
Aslanian, A., laquinta, P.J., Verona, R., and Lees, J.A. 2004. Repression of the Arf tumor
suppressor by E2F3 is required for normal cell cycle kinetics. Genes Dev 18(12):
1413-1422.
Attardi, L.D. and Jacks, T. 1999. The role of p53 in tumour suppression: lessons from
mouse models. Cell Mol Life Sci 55(1): 48-63.
Bates, S., Phillips, A.C., Clark, P.A., Stott, F., Peters, G., Ludwig, R.L., and Vousden,
K.H. 1998. pl4ARF links the tumour suppressors RB and p53. Nature 395(6698):
124-125.
Baudino, T.A., Maclean, K.H., Brennan, J., Parganas, E., Yang, C., Aslanian, A., Lees,
J.A., Sherr, C.J., Roussel, M.F., and Cleveland, J.L. 2003. Myc-mediated
proliferation and lymphomagenesis, but not apoptosis, are compromised by E2f
loss. Mol Cell 11(4): 905-914.
Berkovich, E., Lamed, Y., and Ginsberg, D. 2003. E2F and Ras synergize in
transcriptionally activating pl4ARF expression. Cell Cycle 2(2): 127-133.
Bracken, A.P., Ciro, M., Cocito, A., and Helin, K. 2004. E2F target genes: unraveling the
biology. Trends Biochem Sci 29(8): 409-417.
Braig, M., Lee, S., Loddenkemper, C., Rudolph, C., Peters, A.H., Schlegelberger, B.,
Stein, H., Dorken, B., Jenuwein, T., and Schmitt, C.A. 2005. Oncogene-induced
senescence as an initial barrier in lymphoma development. Nature 436(7051):
660-665.
Chin, L., Pomerantz, J., and DePinho, R.A. 1998. The INK4a/ARF tumor suppressor: one
gene--two products--two pathways. Trends Biochem Sci 23(8): 291-296.
Christophorou, M.A., Ringshausen, I., Finch, A.J., Swigart, L.B., and Evan, G.I. 2006.
The pathological response to DNA damage does not contribute to p53-mediated
tumour suppression. Nature 443(7108): 214-217.
125
Collado, M., Gil, J., Efeyan, A., Guerra, C., Schuhmacher, A.J., Barradas, M., Benguria,
A., Zaballos, A., Flores, J.M., Barbacid, M., Beach, D., and Serrano, M. 2005.
Tumour biology: senescence in premalignant tumours. Nature 436(7051): 642.
de Stanchina, E., McCurrach, M.E., Zindy, F., Shieh, S.Y., Ferbeyre, G., Samuelson,
A.V., Prives, C., Roussel, M.F., Sherr, C.J., and Lowe, S.W. 1998. E1A signaling
to p53 involves the p19(ARF) tumor suppressor. Genes Dev 12(15): 2434-2442.
DeGregori, J., Leone, G., Miron, A., Jakoi, L., and Nevins, J.R. 1997. Distinct roles for
E2F proteins in cell growth control and apoptosis. ProcNatl Acad Sci U S A
94(14): 7245-7250.
Dick, F.A. and Dyson, N. 2003. pRB contains an E2F1-specific binding domain that
allows E2F1-induced apoptosis to be regulated separately from other E2F
activities. Mol Cell 12(3): 639-649.
Dimri, G.P., Hara, E., and Campisi, J. 1994. Regulation of two E2F-related genes in
presenescent and senescent human fibroblasts. J Biol Chem 269(23): 1618016186.
Donehower, L.A., Harvey, M., Slagle, B.L., McArthur, M.J., Montgomery, C.A., Jr.,
Butel, J.S., and Bradley, A. 1992. Mice deficient for p53 are developmentally
normal but susceptible to spontaneous tumours. Nature 356(6366): 215-221.
Dyson, N. 1998. The regulation of E2F by pRB-family proteins. Genes Dev 12(15):
2245-2262.
Eischen, C.M., Weber, J.D., Roussel, M.F., Sherr, C.J., and Cleveland, J.L. 1999.
Disruption of the ARF-Mdm2-p53 tumor suppressor pathway in Myc-induced
lymphomagenesis. Genes Dev 13(20): 2658-2669.
Flores, E.R., Tsai, K.Y., Crowley, D., Sengupta, S., Yang, A., McKeon, F., and Jacks, T.
2002. p 6 3 and p73 are required for p53-dependent apoptosis in response to DNA
damage. Nature 416(6880): 560-564.
Fortin, A., MacLaurin, J.G., Arbour, N., Cregan, S.P., Kushwaha, N., Callaghan, S.M.,
Park, D.S., Albert, P.R., and Slack, R.S. 2004. The proapoptotic gene SIVA is a
direct transcriptional target for the tumor suppressors p53 and E2F1. JBiol Chem
279(27): 28706-28714.
Galbiati, L., Mendoza-Maldonado, R., Gutierrez, M.I., and Giacca, M. 2005. Regulation
of E2F-1 after DNA damage by p300-mediated acetylation and ubiquitination.
Cell Cycle 4(7): 930-939.
Gartel, A.L., Goufman, E., Tevosian, S.G., Shih, H., Yee, A.S., and Tyner, A.L. 1998.
Activation and repression of p21(WAF1/CIP1) transcription by RB binding
proteins. Oncogene 17(26): 3463-3469.
126
Gil, J., Bernard, D., Martinez, D., and Beach, D. 2004. Polycomb CBX7 has a unifying
role in cellular lifespan. Nat Cell Biol 6(1): 67-72.
Gorospe, M., Wang, X., and Holbrook, N.J. 1998. p53-dependent elevation of p21Wafl
expression by UV light is mediated through mRNA stabilization and involves a
vanadate-sensitive regulatory system. Mol Cell Biol 18(3): 1400-1407.
Hershko, T. and Ginsberg, D. 2004. Up-regulation of Bcl-2 homology 3 (BH3)-only
proteins by E2F1 mediates apoptosis. JBiol Chem 279(10): 8627-8634.
Honda, R. and Yasuda, H. 1999. Association of pl9(ARF) with Mdm2 inhibits ubiquitin
ligase activity of Mdm2 for tumor suppressor p53. Embo J 18(1): 22-27.
Hsiao, K.M., McMahon, S.L., and Farnham, P.J. 1994. Multiple DNA elements are
required for the growth regulation of the mouse E2F1 promoter. Genes Dev 8(13):
1526-1537.
Humbert, P.O., Verona, R., Trimarchi, J.M., Rogers, C., Dandapani, S., and Lees, J.A.
2000. E2f3 is critical for normal cellular proliferation. Genes Dev 14(6): 690-703.
Iaquinta, P.J., Aslanian, A., and Lees, J.A. 2005. Regulation of the Arf/p53 tumor
surveillance network by E2F. Cold Spring HarbSymp QuantBiol 70: 309-316.
Inoue, K., Roussel, M.F., and Sherr, C.J. 1999. Induction of ARF tumor suppressor gene
expression and cell cycle arrest by transcription factor DMP1. ProcNatl Acad Sci
U S A 96(7): 3993-3998.
Jacks, T., Remington, L., Williams, B.O., Schmitt, E.M., Halachmi, S., Bronson, R.T.,
and Weinberg, R.A. 1994. Tumor spectrum analysis in p53-mutant mice. Curr
Biol 4(1): 1-7.
Jacobs, J.J., Kieboom, K., Marino, S., DePinho, R.A., and van Lohuizen, M. 1999a. The
oncogene and Polycomb-group gene bmi-1 regulates cell proliferation and
senescence through the ink4a locus. Nature 397(6715): 164-168.
Jacobs, J.J., Scheijen, B., Voncken, J.W., Kieboom, K., Berns, A., and van Lohuizen, M.
1999b. Bmi-1 collaborates with c-Myc in tumorigenesis by inhibiting c-Mycinduced apoptosis via INK4a/ARF. Genes Dev 13(20): 2678-2690.
Johnson, D.G., Schwarz, J.K., Cress, W.D., and Nevins, J.R. 1993. Expression of
transcription factor E2F1 induces quiescent cells to enter S phase. Nature
365(6444): 349-352.
Johnson, L., Mercer, K., Greenbaum, D., Bronson, R.T., Crowley, D., Tuveson, D.A.,
and Jacks, T. 2001. Somatic activation of the K-ras oncogene causes early onset
lung cancer in mice. Nature 410(6832): 1111-1116.
127
Kamijo, T., Zindy, F., Roussel, M.F., Quelle, D.E., Downing, J.R., Ashmun, R.A.,
Grosveld, G., and Sherr, C.J. 1997. Tumor suppression at the mouse INK4a locus
mediated by the alternative reading frame product pl9ARF. Cell 91(5): 649-659.
Kowalik, T.F., DeGregori, J., Schwarz, J.K., and Nevins, J.R. 1995. E2F1 overexpression
in quiescent fibroblasts leads to induction of cellular DNA synthesis and
apoptosis. J Virol 69(4): 2491-2500.
Laurie, N.A., Donovan, S.L., Shih, C.S., Zhang, J., Mills, N., Fuller, C., Teunisse, A.,
Lam, S., Ramos, Y., Mohan, A., Johnson, D., Wilson, M., Rodriguez-Galindo, C.,
Quarto, M., Francoz, S., Mendrysa, S.M., Guy, R.K., Marine, J.C., Jochemsen,
A.G., and Dyer, M.A. 2006. Inactivation of the p53 pathway in retinoblastoma.
Nature 444(7115): 61-66.
Lazzerini Denchi, E. and Helin, K. 2005. E2F1 is crucial for E2F-dependent apoptosis.
EMBO Rep 6(7): 661-668.
Lee, E.Y., Cam, H., Ziebold, U., Rayman, J.B., Lees, J.A., and Dynlacht, B.D. 2002.
E2F4 loss suppresses tumorigenesis in Rb mutant mice. CancerCell 2(6): 463472.
Leone, G., Nuckolls, F., Ishida, S., Adams, M., Sears, R., Jakoi, L., Miron, A., and
Nevins, J.R. 2000. Identification of a novel E2F3 product suggests a mechanism
for determining specificity of repression by Rb proteins. Mol Cell Biol 20(10):
3626-3632.
Lin, W.C., Lin, F.T., and Nevins, J.R. 2001. Selective induction of E2F1 in response to
DNA damage, mediated by ATM-dependent phosphorylation. Genes Dev 15(14):
1833-1844.
Lingbeek, M.E., Jacobs, J.J., and van Lohuizen, M. 2002. The T-box repressors TBX2
and TBX3 specifically regulate the tumor suppressor gene pl4ARF via a variant
T-site in the initiator. J Biol Chem 277(29): 26120-26127.
Littlewood, T.D., Hancock, D.C., Danielian, P.S., Parker, M.G., and Evan, G.I. 1995. A
modified oestrogen receptor ligand-binding domain as an improved switch for the
regulation of heterologous proteins. Nucleic Acids Res 23(10): 1686-1690.
Lukas, J., Petersen, B.O., Holm, K., Bartek, J., and Helin, K. 1996. Deregulated
expression of E2F family members induces S-phase entry and overcomes
pl6INK4A-mediated growth suppression. Mol Cell Biol 16(3): 1047-1057.
Maeda, T., Hobbs, R.M., Merghoub, T., Guemah, I., Zelent, A., Cordon-Cardo, C.,
Teruya-Feldstein, J., and Pandolfi, P.P. 2005. Role of the proto-oncogene
Pokemon in cellular transformation and ARF repression. Nature 433(7023): 278285.
128
Maestro, R., Dei Tos, A.P., Hamamori, Y., Krasnokutsky, S., Sartorelli, V., Kedes, L.,
Doglioni, C., Beach, D.H., and Hannon, G.J. 1999. Twist is a potential oncogene
that inhibits apoptosis. Genes Dev 13(17): 2207-2217.
Moberg, K., Starz, M.A., and Lees, J.A. 1996. E2F-4 switches from p130 to p107 and
pRB in response to cell cycle reentry. Mol Cell Biol 16(4): 1436-1449.
Muller, H., Bracken, A.P., Vernell, R., Moroni, M.C., Christians, F., Grassilli, E.,
Prosperini, E., Vigo, E., Oliner, J.D., and Helin, K. 2001. E2Fs regulate the
expression of genes involved in differentiation, development, proliferation, and
apoptosis. Genes Dev 15(3): 267-285.
Palmero, I., Murga, M., Zubiaga, A., and Serrano, M. 2002. Activation of ARF by
oncogenic stress in mouse fibroblasts is independent of E2F1 and E2F2.
Oncogene 21(19): 2939-2947.
Parisi, T., Pollice, A., Di Cristofano, A., Calabro, V., and La Mantia, G. 2002.
Transcriptional regulation of the human tumor suppressor pl4(ARF) by E2F1,
E2F2, E2F3, and Spl-like factors. Biochem Biophys Res Commun 291(5): 11381145.
Pediconi, N., lanari, A., Costanzo, A., Belloni, L., Gallo, R., Cimino, L., Porcellini, A.,
Screpanti, I., Balsano, C., Alesse, E., Gulino, A., and Levrero, M. 2003.
Differential regulation of E2F1 apoptotic target genes in response to DNA
damage. Nat Cell Biol 5(6): 552-558.
Pomerantz, J., Schreiber-Agus, N., Liegeois, N.J., Silverman, A., Alland, L., Chin, L.,
Potes, J., Chen, K., Orlow, I., Lee, H.W., Cordon-Cardo, C., and DePinho, R.A.
1998. The Ink4a tumor suppressor gene product, pl9Arf, interacts with MDM2
and neutralizes MDM2's inhibition of p53. Cell 92(6): 713-723.
Qin, X.Q., Livingston, D.M., Kaelin, W.G., Jr., and Adams, P.D. 1994. Deregulated
transcription factor E2F-1 expression leads to S-phase entry and p53-mediated
apoptosis. Proc Natl Acad Sci U S A 91(23): 10918-10922.
Quelle, D.E., Zindy, F., Ashmun, R.A., and Sherr, C.J. 1995. Alternative reading frames
of the INK4a tumor suppressor gene encode two unrelated proteins capable of
inducing cell cycle arrest. Cell 83(6): 993-1000.
Sage, J., Miller, A.L., Perez-Mancera, P.A., Wysocki, J.M., and Jacks, T. 2003. Acute
mutation of retinoblastoma gene function is sufficient for cell cycle re-entry.
Nature 424(6945): 223-228.
Sage, J., Mulligan, G.J., Attardi, L.D., Miller, A., Chen, S., Williams, B., Theodorou, E.,
and Jacks, T. 2000. Targeted disruption of the three Rb-related genes leads to loss
of G(1) control and immortalization. Genes Dev 14(23): 3037-3050.
129
Scott, C.L., Gil, J., Hernando, E., Teruya-Feldstein, J., Narita, M., Martinez, D.,
Visakorpi, T., Mu, D., Cordon-Cardo, C., Peters, G., Beach, D., and Lowe, S.W.
2007. Role of the chromobox protein CBX7 in lymphomagenesis. ProcNatl Acad
Sci USA 104(13): 5389-5394.
Serrano, M., Lin, A.W., McCurrach, M.E., Beach, D., and Lowe, S.W. 1997. Oncogenic
ras provokes premature cell senescence associated with accumulation of p53 and
p16INK4a. Cell 88(5): 593-602.
Shan, B. and Lee, W.H. 1994. Deregulated expression of E2F-1 induces S-phase entry
and leads to apoptosis. Mol Cell Biol 14(12): 8166-8173.
Sherr, C.J. 1996. Cancer cell cycles. Science 274(5293): 1672-1677.
-. 2001. The INK4a/ARF network in tumour suppression. Nat Rev Mol Cell Biol 2(10):
731-737.
Sreeramaneni, R., Chaudhry, A., McMahon, M., Sherr, C.J., and Inoue, K. 2005. RasRaf-Arf signaling critically depends on the Dmpl transcription factor. Mol Cell
Biol 25(1): 220-232.
Stott, F.J., Bates, S., James, M.C., McConnell, B.B., Starborg, M., Brookes, S., Palmero,
I., Ryan, K., Hara, E., Vousden, K.H., and Peters, G. 1998. The alternative
product from the human CDKN2A locus, p14(ARF), participates in a regulatory
feedback loop with p53 and MDM2. Embo J 17(17): 5001-5014.
Trimarchi, J.M. and Lees, J.A. 2002. Sibling rivalry in the E2F family. Nature Reviews
Mol Cell Biol 3: 11-20.
Tsai, K.Y., Hu, Y., Macleod, K.F., Crowley, D., Yamasaki, L., and Jacks, T. 1998.
Mutation of E2f-1 suppresses apoptosis and inappropriate S phase entry and
extends survival of Rb-deficient mouse embryos. Mol Cell 2(3): 293-304.
Ventura, A., Kirsch, D.G., McLaughlin, M.E., Tuveson, D.A., Grimm, J., Lintault, L.,
Newman, J., Reczek, E.E., Weissleder, R., and Jacks, T. 2007. Restoration of p53
function leads to tumour regression in vivo. Nature 445(7128): 661-665.
Vigo, E., Muller, H., Prosperini, E., Hateboer, G., Cartwright, P., Moroni, M.C., and
Helin, K. 1999. CDC25A phosphatase is a target of E2F and is required for
efficient E2F- induced S phase. Mol Cell Biol 19(9): 6379-6395.
Weber, J.D., Taylor, L.J., Roussel, M.F., Sherr, C.J., and Bar-Sagi, D. 1999. Nucleolar
Arf sequesters Mdm2 and activates p53. Nat Cell Biol 1(1): 20-26.
Williams, B.O., Morgenbesser, S.D., DePinho, R.A., and Jacks, T. 1994. Tumorigenic
and developmental effects of combined germ-line mutations in Rb and p53. Cold
Spring Harb Symp Quant Biol 59: 449-457.
130
Yamasaki, L., Bronson, R., Williams, B.O., Dyson, N.J., Harlow, E., and Jacks, T. 1998.
Loss of E2F-1 reduces tumorigenesis and extends the lifespan of Rbl(+/-)mice.
Nat Genet 18(4): 360-364.
Zhang, Y., Xiong, Y., and Yarbrough, W.G. 1998. ARF promotes MDM2 degradation
and stabilizes p53: ARF-INK4a locus deletion impairs both the Rb and p53 tumor
suppression pathways. Cell 92(6): 725-734.
Ziebold, U., Lee, E.Y., Bronson, R.T., and Lees, J.A. 2003. E2F3 loss has opposing
effects on different pRB-deficient tumors, resulting in suppression of pituitary
tumors but metastasis of medullary thyroid carcinomas. Mol Cell Biol 23(18):
6542-6552.
Ziebold, U., Reza, T., Caron, A., and Lees, J.A. 2001. E2F3 contributes both to the
inappropriate proliferation and to the apoptosis arising in Rb mutant embryos.
Genes Dev 15(4): 386-391.
Zindy, F., Eischen, C.M., Randle, D.H., Kamijo, T., Cleveland, J.L., Sherr, C.J., and
Roussel, M.F. 1998. Myc signaling via the ARF tumor suppressor regulates p53dependent apoptosis and immortalization. Genes Dev 12(15): 2424-2433.
Zindy, F., Williams, R.T., Baudino, T.A., Rehg, J.E., Skapek, S.X., Cleveland, J.L.,
Roussel, M.F., and Sherr, C.J. 2003. Arf tumor suppressor promoter monitors
latent oncogenic signals in vivo. Proc Natl Acad Sci U S A 100(26): 15930-15935.
131
ChapterFour
Discussion
132
In this study, we have investigated the regulation of Arf, a tumor suppressor gene and key
regulator of the p53 tumor-surveillance pathway, by members of the E2F transcription
factor family. We found that Arfis a genuine E2F target gene, although E2F regulates
Arf in a unique manner. In unstressed wildtype MEFs, the Arf promoter is bound
primarily by E2F3, which is partially responsible for maintaining repression of Arf
throughout the cell cycle (Chapter 2). In response to multiple instances of oncogenic
stress, both in MEFs in culture and in mouse tumors in vivo, activating E2Fs are recruited
to the Arfpromoter coincident with the activation of this gene (Chapter 3).
Activation of the p53 pathway is critical for removal of cells that have undergone
oncogenic mutations and, as a result, have lost normal growth control and are dividing in
an unrestricted manner. Arf is the key upstream regulator of p53's response to such
oncogenic proliferation - in the absence of Arf, p53 is incapable of providing any tumor
suppressive function (Christophorou et al. 2006). Prior to our studies, Arfwas wellknown to be induced in response to numerous oncogenic stresses, although exactly how
this signal was transmitted remained elusive. We found that regardless of the initiating
oncogenic lesion, both in vitro and in vivo, activating E2Fs are recruited to the Arf
promoter, coincident with the induction of Arf transcription (Chapters 2 and 3).
However, activating E2Fs do not regulate Arf during normal cellular proliferation in vivo.
These results suggest that E2F is the key sensor of whether a cell is experiencing normal
or oncogenic proliferation signals. Since E2Fs are critical regulators of the cell cycle,
and are required for the proliferation of both normal and tumor cells, it is understandable
that they would be co-opted for this secondary purpose of tumor surveillance.
133
This work has established the activating E2F transcription factors as a new
component of the Arf-p53 tumor surveillance pathway - E2F triggers the activation of
this pathway in response to oncogenic proliferative signals. E2F is also involved in the
repression or Arf, at least in MEFs. Therefore, similar to its role in the regulation of cell
cycle-dependent transcription, E2F regulates both the repression and activation of Arf
transcription. However, the switch from repression to activation of Arfoccurs only in
response to inappropriate proliferation, and not normal growth signaling. While this
model provides a relatively simple mechanism for E2F-mediated regulation of Arf,
several questions remain unanswered; these are discussed below.
E2f3 is a repressor of Arf
E2f3- MEFs have a substantial defect in proliferation, primarily in their ability to reenter the cell cycle from a quiescent state (Humbert et al. 2000). We found that this
correlates with inappropriate expression of Arf, which is most evident in quiescent cells.
Genetic deletion of Arf in the E2f3 - - background completely suppressed the proliferation
defect due to E2f3 loss, demonstrating that the elevated expression of Arfin these cells
was contributing to their phenotype (Chapter 2). These results led us to suspect that E2F,
especially E2F3, was involved in Arf regulation. However, the fact that Arf levels were
increased in E2f3 -1- MEFs, rather than decreased like most other E2F targets, suggested
that if Arf is indeed regulated by E2F, it was in a manner distinct from other E2F targets.
The E2f3 locus encodes two proteins, E2F3a and E2F3b, which differ only in
their N-terminal sequences. The E2f3- - MEFs used in this study contain a deletion of the
DNA-binding domain that is shared by both proteins, and thus the MEFs lack expression
134
of both E2F3a and E2F3b. Therefore, it was initially unclear whether the proliferation
defect of the E2f3l - - MEFs, and the increased expression of Arf, was due to one or both of
the two protein products of the E2f3 gene. In the initial analysis of the E2f3-' - MEFs, the
authors hypothesized that the inability of E2f3-#- MEFs to efficiently initiate DNA
synthesis and enter the cell cycle was due to their reduced induction of a number of E2F
target genes (Humbert et al. 2000). This conclusion was made primarily based on the
presumed role of E2F3 as an activating E2F, and the ability of exogenous expression of
E2Fl, a clearly defined activator, to rescue the proliferation defect of the E2f3' - MEFs.
At the time, however, the authors were unaware of the existence of the second product of
the E2f3 gene, E2F3b.
The studies which classified E2F3 as an activator were performed with the
initially identified E2F3a species. When E2F3b was identified, it was hypothesized that
it would act as a repressor, based on its structural similarity to E2F4 and it expression
pattern, which showed that E2F3b was present in quiescent cells, unlike the activating
E2Fs (Leone et al. 2000). Our study of the regulation of Arf by E2F3 led us to conclude
that E2F3b was the primary isoform responsible for normal repression of Arf. This
conclusion was based mainly on three observations. First, we could detect binding of an
E2F3 species to the Arf promoter by ChIP in quiescent cells, which express high levels of
E2F3b but little E2F3a. Second, the antibody which most robustly detected this
interaction can recognize both E2F3a and E2F3b, while an antibody specific for E2F3a
did not detect it. Finally, genetic evidence suggested that E2f3 acted negatively on Arf
transcription, and as E2F3b was previously hypothesized to act as a repressor, it was the
135
most likely candidate. However, these experiments were unable to definitively identify
E2F3b as the sole repressor of Arf.
Possible mechansims of E2F3-mediated repression of Arf
If E2F3b is a bonafide repressor of Arf, it remains unclear exactly how this repression is
accomplished. The activation of Arf in E2f3- MEFs, without the obligate recruitment of
activating E2Fs, suggests that E2F3b binds to the Arfpromoter as part of a complex
containing other active repressor proteins. The most obvious candidates for E2Fassociated repression are the pocket proteins. Gel-shift studies have shown that E2F3b
associates exclusively with pRb, and not p107 or p130 (Leone et al. 2000).
Unfortunately, promoter-bound pRb is notoriously difficult to detect using ChIP assays in
mouse cells (Rayman et al. 2002), if indeed it associates with E2F-responsive promoters
at all. Consequently, we have been unable to identify pRb or any other pocket protein
bound to the Arf promoter (Chapter 2). Additionally, since Arf levels are not appreciably
induced during cell cycle re-entry, and E2F3 remains bound to the Arf promoter
throughout cell cycle entry (Appendix B), it is unlikely that pRb is present in this
complex, as CDK phosphorylation of pRb in G1/S phase leads to a dissociation of E2FpRb complexes. If pRb is bound to E2F3b at the Arfpromoter, this complex must be
resistant to, or otherwise unaffected by, CDK phosphorylation.
Alternatively, other repressive proteins may form a complex with E2F3b at the
Arf promoter. The best candidates are the proteins of the Polycomb group, many of
which are know to bind to or otherwise repress the Arf promoter (Jacobs et al. 1999; Gil
et al. 2004; Bracken et al. 2007; Dietrich et al. 2007). E2F3b is not known to directly
136
associate with any of these Polycomb proteins; however, E2F3 interacts directly with the
repressor protein RYBP (Ringl- and YY1-Binding Protein) (Schlisio et al. 2002), and
therefore may interact indirectly with other RYBP-associated transcriptional repressors
such as Ringl or the mouse Polycomb homolog M33. Additionally, E2F6 associates
with Bmil, possibly via its interaction with RYBP, leaving open the possibility that
E2F3b utilizes a similar mechanism to associate with Bmil or other Polycomb proteins,
and forms a complex to cooperatively mediate Arftranscriptional repression.
E2F-independent repression of Arf in vivo
While we observe E2F3 binding to Arf coincident with its repression in MEFs, we have
found that E2F does not appear to regulate Arf in normal mouse tissues in vivo, where it
is also silenced. Instead, we have observed the presence of Bmil at the Arfpromoter in
several mouse tissues (Appendix A), suggesting that Bmil or other Polycomb-group
proteins are sufficient for Arf repression in vivo. This idea is consistent with the
existence of developmental defects in Bmil '/ mice, many of which are rescued by
concomitant mutation of Arf or Arf/Ink4a (van der Lugt et al. 1994; Jacobs et al. 1999;
Leung et al. 2004; Bruggeman et al. 2005; Molofsky et al. 2005; Oguro et al. 2006).
It is still unclear what enables E2F3 to target Arfin MEFs. The proliferation of
MEFs is exquisitely sensitive to Arf, and Arf expression is induced as MEFs are cultured
in vitro (Zindy et al. 1998), which correlates with the loss of Bmil binding to the locus
(Bracken et al. 2007). It is possible that Bmil dissociation from Arf permits E2F3 to bind
and substitute for its repressive role. This may leave Arfin a more transiently repressed
state, allowing more immediate activation upon oncogene expression. Alternatively,
137
since specific loss of E2F3b, the predominant species bound to Arf, does not appear to
lead to activation of Arf (discussed below), it must be considered that the binding of E2F3
to Arf may contribute to the low level of activation of this gene in MEFs.
Indirect regulation of Arf by E2F3
Since the completion of this work, mouse strains specifically deficient for E2F3a or
E2F3b have been generated, and analysis of MEFs derived from these mice has attempted
to resolve which isoform of E2f3 is required for Arf repression (P. Danielian, L.
Friesenhahn, A. M. Faust, J. A. L., unpublished observations). Unexpectedly, E2f3b / MEFs show no defect in proliferation or cell cycle re-entry from quiescence, and Arf
appears to be expressed at wildtype levels. Preliminary ChIP analysis of these cells
showed evidence of weak binding of E2F3a to the Arfpromoter, although not to the
degree which E2F3b binds in wildtype cells. Surprisingly, E2f3a- -MEFs do appear to
have elevated levels of Arf, although they do not display a marked proliferation defect,
and there is significant variability in these phenotypes in different preparations of MEFs.
Therefore, these genetic data are most consistent with the hypothesis that both E2F3a and
E2F3b contribute to regulation of Arf, and that absence of either isoform individually is
insufficient to cause a dramatic effect on Arf levels.
Since E2f3b ' MEFs display no significant phenotype despite being the
predominant species found at the Arf promoter, and E2f3a4 MEFs may show some
degree of Arf de-repression despite weak binding of E2F3a to the Arf promoter in
wildtype MEFs, it remains possible that the effect of E2f3-loss on Arf regulation is
indirect. Genetic analysis predicts that E2F3 may be positively regulating another
138
repressor of Arf, or that it is involved in repression of an activator. The only other known
direct activator of Arfis the transcription factor Dmpl. In fact, it has recently been
shown that E2Fs, including E2F3a and E2F3b, may be involved in repression of Dmpl
transcription (Mallakin et al. 2006). The repression of Dmpl by E2F was found to be
most robust in S phase cells, whereas we found that Arfderepression was maximal in
G0/GI cells, so it seems unlikely that E2F-mediated regulation of Arfis indirectly
attributable to Dmpl. However, it remains formally possible that loss of Dmpl
repression in E2f3l- MEFs is contributing to Arf activation. The contribution of Dmpl to
Arf elevation in E2f3/ - cells could be analyzed by abrogating Dmpl function in E2f3-'
MEFs, either by using siRNA technology, or through the generation of E2f3-;Dmpl -'
MEFs.
Given the preliminary data implicating E2f3a in controlling Arf levels, it may be
more likely that lack of E2F3a- and/or E2F3b-mediated activation of a target gene (or
genes) is responsible for increased Arftranscription in the E2f3-' MEFs. The most wellcharacterized repressor of Arf is the Polycomb-group protein Bmil. Loss of Bmil in
MEFs leads to increased Arflevels and impaired cell proliferation (Jacobs et al. 1999).
Activating E2Fs, including E2F3, have been shown to be able to induce expression of the
Bmil gene, and the endogenous E2F proteins bind to the Bmil promoter (Nowak et al.
2006), although it is unclear whether E2f3-loss would have a dramatic effect on Bmil
levels. Also, Bmil does not appreciably bind to the Arf promoter in MEFs (Bracken et
al. 2007), so it seems unlikely that impaired E2F3-mediated Bmil transcription could lead
to such dramatic Arf activation.
139
Another Polycomb-group protein, the methyltransferase Ezh2, has also been
shown to associate with the Arf promoter in MEFs, albeit weakly (Bracken et al. 2007),
and is therefore a potential regulator of Arf. E2F3 has been shown to bind and activate
the Ezh2 promoter (Bracken et al. 2003), and both E2F3 and Ezh2 are highly expressed in
aggressive human prostate cancer (Varambally et al. 2002; Foster et al. 2004). Although
depletion of Ezh2 does not appear to cause an increase in Arf levels (Bracken et al. 2003;
Bracken et al. 2007). Finally, preliminary experiments to isolate E2F3 target genes in
quiescent cells identified Tbx3 (our unpublished data), which is an additional repressor of
Arf (Lingbeek et al. 2002). Therefore, loss of E2F3 may result in reduced expression of
one or more repressors of Arf transcription, which may ultimately contribute to the
increased Arflevels in E2f3-' MEFs.
E2F as a regulator of the Arf-p53 tumor surveillance response
While our work clearly shows that oncogenic stresses induce E2F to bind to and activate
the Arfpromoter, it is currently unclear what exactly causes this dramatic shift in Arf
regulation. A simple model would predict that the total level of activating E2Fs is the
key determinant of whether E2Fs will bind and Arf will be activated. All cellular
oncogenes, if they are to increase the proliferative capacity of the cell, invariably must
influence the E2F pathway. Indeed, most tumors contain mutations that disrupt pRB
function, which would directly impact the activating E2Fs by leaving them without a
negative regulator. Others might affect the RB-E2F pathway indirectly; for instance by
acquiring growth-promoting mutations resulting in increased CDK activity. Also, since
the activating E2Fs are able to induce their own transcription, they accumulate to high
levels in tumor cells.
140
But why would E2F need to be present at increased levels before it is competent
to activate Atf? It is possible that the repressive complex normally bound to Arfhas a
higher affinity for the promoter, and E2F activity simply needs to reach a higher
concentration before it is able to displace this complex. This hypothesis is consistent
with the fact that most known regulators of Arf are members of the Polycomb group of
transcriptional repressors, which modify chromatin to create a heritable, silenced state.
Arfis normally repressed in most mouse tissues throughout development, and therefore
this sort of stable repression would be desirable to avoid inappropriate activation. Only
when E2F is sufficiently activated by oncogenic stimuli would its levels increase enough
to overcome this repressed state. In contrast to mouse tissues, MEFs in culture
experience conditions such as hyperoxia which may already prime Arf for activation.
This may partially explain the loss of Bmi 1 binding to Arfand its replacement by E2F3 in
MEFs. The E2F3 complex may be less resistant to displacement than the condensed state
of Polycomb-repressed chromatin.
Regulation of E2F in response to oncogenic stress
Other signals may be required to influence E2F to relocate to the Arf promoter in
response to oncogenic stress, beyond just an elevation of E2F protein levels. E2F1 is
post-translationally modified by both phosphorylation and acetylation in response to
DNA damage, and these modifications affect its transcriptional activity (Lin et al. 2001;
Pediconi et al. 2003). It is possible that E2Fs may be modified in an analogous manner in
the presence ,ofoncogenic stress. Oncogenic signals are known to induce DNA damage
(Bartkova et al. 2005; Gorgoulis et al. 2005; Bartkova et al. 2006; Di Micco et al. 2006;
Mallette et al. 2007), so oncogenes may indirectly lead to E2F modification via the DNA
141
damage response pathways. DNA damage-induced E2F1 modification causes a shift in
its target gene specificity, leading to the induction of pro-apoptotic genes such as Apafl
and Caspase7 (Pediconi et al. 2003). Interestingly, Caspase7 was also identified in this
study as a gene selectively induced by oncogenic stress, and not normal proliferation
(Chapter 3). Thus, the signals causing E2F to induce transcription of pro-apoptotic genes
in response to DNA damage and oncogenic stress may be related, and the oncogenic
stress response may require similar post-translational modifications of E2F.
Since Arf is not induced by DNA damage signaling, other determinants must exist
to cause E2F-mediated activation of Arfin response to oncogene expression. These may
include either as-yet undetermined modifications of E2F, or protein interaction partners
that direct E2F to the Arf promoter. Our results indicate that all activating E2Fs
participate in the oncogenic stress response, so it is likely these would include
mechanisms common among these E2Fs, and not, for example, phosphorylation by
ATM, which is thought to specifically target E2F1 (Lin et al. 2001). To elucidate these
mechanisms, an immunoprecipitation-mass spectrometry approach could be used to
identify modifications or interacting proteins of E2F1 in oncogene-expressing cells.
Identified modifications or protein interactions could be compared to results from similar
experiments using lysates from unperturbed cells, or cells treated instead with DNA
damaging agents, to identify oncogene-specific effects. Finally, functional significance
could be tested by using siRNA technology to ablate expression of interacting partners, or
point mutant analysis of modified residues of E2F1, similar to the analysis performed to
assay the relevance of E2F1 acetylation in the DNA damage response (Pediconi et al.
2003).
142
Determinants of pro-apoptotic E2F target gene specificity
Even if a mechanism could be found that controls E2F relocalization to pro-apoptotic
gene promoters in response to oncogenic stress, the question remains how these genes
(i.e. Arf, Noxa, Siva, Caspase 7, and p2]; see Chapter 3) are selected for differential
regulation: that is, E2F activation only in response to inappropriate proliferation, and
E2F3-mediated repression in wildtype MEFs. The specificity is unlikely to come from
the sequence of the E2F binding sites in the promoters of these genes, because they all
match the typical E2F consensus, although there does appear to be a preference for the
TCCCGC core variant, rather than the TCGCGC core present in the E2 promoter (data
not shown). This is unlikely to be the only determinant, as this core binding sequence is
also present in many other E2F target genes that exhibit normal, cell cycle-regulated
transcription.
It is possible that there are additional sequence determinants in the Arf promoter.
Komori and colleagues identified a short sequence motif that is conserved in both the
human and mouse Arf promoter, which is responsive to oncogene induction (by
adenoviral ElA protein) but not serum stimulation, and is required for E2F activation of
the human Af promoter (Komori et al. 2005). They termed this motif EREA, for E2Fresponsive element of the Arf promoter. Sequences similar to EREA are present in the
promoters of the other pro-apoptotic genes we analyzed; however, the minimal region of
EREA required for E2F-responsiveness is very GC-rich (GCGCGCGCC), and as many
promoters contain an over-representation of CpG dinucleotides (e.g. CpG islands), it is
also unlikely that this sequence alone could define the unique regulation of Arfby E2Fs.
143
Since there are no obvious common sequence elements in these pro-apoptotic
targets of E2F, it is likely that some epigenetic factors are involved in the E2F binding
specificity. First, it is possible that methylation of the E2F binding site may affect E2F
binding. It has been shown that methylation of certain E2F sites impairs in vitro binding
of E2F1, but not E2F3; similarly E2F3 can bind and transactivate certain methylated E2F
sites, where E2F1 is incompetent (Campanero et al. 2000). Since the Arf promoter
contains a CpG island which is known to be silenced by hypermethylation (Robertson
and Jones 1998), it is feasible that methylation of the E2F site might contribute to
specificity of E2F3 binding. Methylation of the promoters of Arf and other pro-apoptotic
genes would also contribute to their repression in the absence of oncogenic stress.
It is likely that interaction of E2F3 with other transcriptional regulators impacts
the specificity of E2F3 binding to Arf and other pro-apoptotic genes in MEFs. As
discussed in detail above, numerous Polycomb-group proteins are known to regulate Arf,
and the association of these proteins with the promoter may contribute to E2F3-specific
binding. Consistent with this idea, we have detected evidence of the presence of Bmil at
the Noxa promoter, similar to what we find at Arf (see Appendix A); however, Bmil was
not detected at the other loci, so other factors might also be involved. Bmil could recruit
E2F3 indirectly through the association of E2F3 with RYBP, although preliminary
experiments have thus far failed to find evidence of binding of RYBP to the Arfpromoter
by ChIP analysis (data not shown). Many Polycomb complexes also contain histone
methyltransferases, which can recruit DNA methyltransferases (Esteve et al. 2006; Vire
et al. 2006), potentially contributing to E2F3 specificity via methylation of the E2F
binding site. Indeed the Arfpromoter does appear to bear the methylated histone mark
144
(tri-methyl H3K27) associated with Polycomb-mediated repression (N. Young, personal
communication). Therefore, Bmil binding, along with the other possibilities outlined
above, may target E2F3 to Arf.
Specificity among activating E2Fs in Arftransactivation
While there is remarkable specificity for E2F3 binding to Arfin the absence of oncogenic
stress in MEFs, we observe little specificity between activating E2F recruitment to Arfin
response to different oncogenic stresses (see Chapter 3). Rather, most oncogenic stresses
induce all the activating E2Fs, E2F1, 2, and 3a, to bind Arf (Figure 1). This is consistent
with genetic data showing that, at least in MEFs, E2fl and E2J2 are dispensable for
oncogenic activation of Arf (Palmero et al. 2002). Our results suggest that E2F3a could
be responsible for Arf activation in E2fl-';E2f2'- MEFs. However, data from compound
mutant mouse models shows a requirement for both E2F1 and E2F3 to mediate apoptosis
downstream of Rb mutation, since either E2fl or E2f3 mutation suppresses apoptosis
occurring in Rb --embryos (Tsai et al. 1998; Ziebold et al. 2001). Therefore, either E2F1
and E2F3 are both required in this setting, or there is a threshold of activating E2F
activity required for apoptosis, such that loss of any E2F causes the total level to fall
below this threshold. Although, since Arfis not absolutely required for apoptosis in the
Rb -embryo (Tsai et al. 2002), other pro-apoptotic targets of E2F are also likely
contributing to this effect.
Even though we observe multiple E2Fs contributing to Arf activation in all cases
of oncogenic stress, we did find subtle difference in the E2F species involved in each
case. Regardless of the stress, and both in vitro and in vivo, we always observed E2F1
145
0
130
PR B/p I
Classic,
Cell cycle-regulated
E2F Targets
(e.g. p107)
__%Zý
Go/G 1
G1/S
Arf
MEFs + oncogenic stress
(E1A, c-Myc, loss of p53 or Rb)
Normal MEFs
-F4
/Arf
TUMOR tissue
(oncogenic stress)
Normal tissue
(appropriate proliferation)
Figure 1. Arf is a regulated by E2F via a unique mechanism
Unlike classic, cell cycle-regulated E2F targets such as p107 (top), Arf is regulated by
E2F not according to the cell cycle stage, but rather dependent on the presence or absence
of oncogenic stress. In the absence of oncogenic stress, Arfis bound and repressed by
E2F3 (in MEFs; middle) or Bmil (in mouse tissues; bottom). In the presence of
oncogenic stress, either in MEFs in vitro or in tumor tissues in vivo, activating E2F
proteins are bound to the Arf promoter, coincident with its activation.
146
participating in Arf activation. Additionally, in every tumor type we examined, we
observed E2F2 binding to the Arf promoter. These results suggest that these two E2Fs
may be most important for mediating Arf induction in tumors in vivo, and also chiefly
contribute to proliferation of tumor cells. This is consistent with the well-documented
role of E2F1 in induction of apoptosis and activation of Arf, and the fact that loss of E2fl
can suppress tumorigenesis in mouse models (Pan et al. 1998; Yamasaki et al. 1998).
On the other hand, E2F3 did not contribute to Arf activation downstream of either
Rb or p53 mutation in vivo. This could be explained by the observation that much less
E2F3 activity was found at the cell cycle-regulated promoters of p107 and Cdc2 in these
tumors, compared to E2F1 and E2F2, suggesting that this protein may not contribute
appreciably to gene activation in these tumors. This is surprising, considering that E2f3
mutation suppresses both proliferation and apoptosis in Rb-' embryos (Ziebold et al.
2001), and suppresses pituitary tumor formation in Rb'- mice (Ziebold et al. 2003),
presumably due to a role in gene activation. These results may not be relevant to the role
of E2F3 in proliferation of tumor cells in general, because in other situations, E2f3 is not
required for the growth of Rb-'-tumors (Ziebold et al. 2003; Parisi et al. 2007).
Therefore, our results may partially explain the dispensability of E2F3 in Rb-deficient
tumors. In contrast, E2F3 was found at the promoters of both Arf and cell cycleregulated E2F targets in the K-rasA2 lung tumor, suggesting that the role of E2F3 in
tumor cell proliferation and apoptosis may be either tissue- or oncogene-dependent
(Chapter 3, Figure 3).
Surprisingly, our ChIP results show an involvement of E2F4 in regulation of Arf
in response to overexpression or activation of Myc, both in vitro and in vivo. We have
147
hypothesized that E2F4 is actually participating in activation of Arfin this setting, rather
than performing its typical function as a repressor. This is primarily because we have not
observed recruitment of p130, E2F4's primary binding partner, to the Arf promoter (data
not shown). Additionally, genetic evidence supports a role for E2F4-mediated activation
in Myc-induced tumorigenesis. Preliminary evidence shows that E2f4 deficiency
suppresses lymphoma development in EVMyc transgenic mice (Rempel et al. 2004),
similar to the suppression seen in E2fl-;EluMyc lines. Since the suppression from loss of
E2fl is due to impaired proliferation (Baudino et al. 2003), it is possible E2F4 is acting in
a similar way, by contributing to target gene activation downstream of Myc.
Analogous to the Myc case, we also observed recruitment of E2F4 to Arf after
acute ablation of the Rb gene in MEFs. Since we do not observe p 130 present at the
same time (data not shown), we presume that E2F4 is functioning as an activator in this
situation. Indeed, E2f4 mutation also suppresses tumor formation in Rb+ - mice (Lee et al.
2002), similar to what is seen for the activators E2F1 and E2F3; this supports the idea
that E2F4 may contribute to activation in Rb-mutant cells. However, Rb-deficient tumors
did not exhibit E2F4 binding to Arf. This is distinct from what we observed in response
to Myc expression, which induced E2F4 binding to the Arf promoter both in MEFs and in
tumors. Therefore, if E2F4 only participates in gene activation immediately after acute
Rb-loss, it is possible that its tumor-promoting activity is important only during the
initiation of Rb-mutant tumors, and E2F4 does not contribute to gene activation in
developed Rb-mutant tumors.
E2F-independent oncogenic activation of Arf
148
Although we observe a perfect correlation between activating E2F binding to Arf and
expression of this gene, we are unable to conclusively prove that E2F-binding is required
for Arfinduction. Since we hypothesized that loss of repression in the E2f3/- MEFs is
sufficient for activation of Arf (Chapter 2), it is possible that Arf is generally regulated
only by repressive complexes. That is, oncogenic stress may cause a loss of repressor
proteins (i.e. E2F3 in MEFs, or Bmi 1 in tissues/tumors), which is sufficient for Arf
activation. Then, when the repressed state of chromatin is "opened up," activating E2Fs
are competent to bind, but are not required for activation. Alternatively, E2F binding
might be a primary event, but their more important role might be to displace the
repressors, rather than to participate in activation. This model is supported by an
experiment where expression of a transactivation-defective E2F1 mutant, which binds
DNA but cannot activate transcription, leads to an increase in Arf expression (Rowland et
al. 2002). These experiments were performed in MEFs, where we have confirmed that
Arf can be induced by loss of repression alone. Whether a similar mechanism might be
functioning in vivo is unclear.
It is difficult to assess the relevance of E2F-mediated activation of Arf genetically,
since there is likely to be redundancy between activating E2Fs, and removal of all
activating E2Fs causes a complete cessation of cell proliferation (Wu et al. 2001).
Instead, careful analysis of the Arfpromoter might be necessary. Komori et al. have
shown that the EREA element in the Arf promoter is sufficient for E2F activation of Arf
in response to oncogenic stress (Komori et al. 2005). If it was found that this sequence
element was required for oncogene-induced Arf activation, this would be strong evidence
that E2F was also required.
149
Finally, it is possible that E2F cooperates with other transcriptional activators to
induce Arf expression. The transcription factor Dmpl is known to activate Arf in
response to Ras activation, but the involvement of Dmpl in the response to other
oncogenes is unknown. Perhaps E2F is required to displace the repressors of Arf, at
which point Dmpl is responsible for Arf activation. Since E2Fs are known to be potent
transcriptional activators, and they are found at the promoter of Arfcoincident with its
transcriptional activation, the most likely explanation is that E2F directly causes the
activation of Arf.
Conclusion
Cancer develops when cells acquire mutations that allow them to increase their
proliferation rate and become independent both of growth cues from the environment and
endogenous anti-proliferative checkpoint mechanisms. Luckily, the cell has a monitor
for this type of unrestrained proliferation: the Arf-p53 tumor surveillance pathway. The
fact that Arf or p53 mutations are found in most human cancers underscores the
importance of this pathway in tumor suppression, since disabling it allows tumors to
grow unchecked. This work has established the E2F transcription factors as key
components of this monitoring mechanism, which sense aberrant proliferation in any
form, and signal for the removal of potentially cancerous cells. As we learn more about
mechanisms the body has developed to sense and prevent cancer, with the benefit of
millions of years of evolution on its side, we may be better equipped to design more
creative strategies to fight this disease, hopefully on a briefer time scale.
150
References
Bartkova, J., Horejsi, Z., Koed, K., Kramer, A., Tort, F., Zieger, K., Guldberg, P.,
Sehested, M., Nesland, J.M., Lukas, C., Orntoft, T., Lukas, J., and Bartek, J. 2005.
DNA damage response as a candidate anti-cancer barrier in early human
tumorigenesis. Nature 434(7035): 864-870.
Bartkova, J., Rezaei, N., Liontos, M., Karakaidos, P., Kletsas, D., Issaeva, N., Vassiliou,
L.V., Kolettas, E., Niforou, K., Zoumpourlis, V.C., Takaoka, M., Nakagawa, H.,
Tort, IF., Fugger, K., Johansson, F., Sehested, M., Andersen, C.L., Dyrskjot, L.,
Orntoft, T., Lukas, J., Kittas, C., Helleday, T., Halazonetis, T.D., Bartek, J., and
Gorgoulis, V.G. 2006. Oncogene-induced senescence is part of the tumorigenesis
barrier imposed by DNA damage checkpoints. Nature 444(7119): 633-637.
Baudino, T.A., Maclean, K.H., Brennan, J., Parganas, E., Yang, C., Aslanian, A., Lees,
J.A., Sherr, C.J., Roussel, M.F., and Cleveland, J.L. 2003. Myc-mediated
proliferation and lymphomagenesis, but not apoptosis, are compromised by E2fl
loss. Mol Cell 11(4): 905-914.
Bracken, A.P., Kleine-Kohlbrecher, D., Dietrich, N., Pasini, D., Gargiulo, G., Beekman,
C., Theilgaard-Monch, K., Minucci, S., Porse, B.T., Marine, J.C., Hansen, K.H.,
and Helin, K. 2007. The Polycomb group proteins bind throughout the INK4AARF locus and are disassociated in senescent cells. Genes Dev 21(5): 525-530.
Bracken, A.P., Pasini, D., Capra, M., Prosperini, E., Colli, E., and Helin, K. 2003. EZH2
is downstream of the pRB-E2F pathway, essential for proliferation and amplified
in cancer. Embo J 22(20): 5323-5335.
Bruggeman, S.W., Valk-Lingbeek, M.E., van der Stoop, P.P., Jacobs, J.J., Kieboom, K.,
Tanger, E., Hulsman, D., Leung, C., Arsenijevic, Y., Marino, S., and van
Lohuizen, M. 2005. Ink4a and Arf differentially affect cell proliferation and
neural stem cell self-renewal in Bmil-deficient mice. Genes Dev 19(12): 14381443.
Campanero, M.R., Armstrong, M.I., and Flemington, E.K. 2000. CpG methylation as a
mechanism for the regulation of E2F activity. Proc Natl Acad Sci U S A 97(12):
6481-6486.
Christophorou, M.A., Ringshausen, I., Finch, A.J., Swigart, L.B., and Evan, G.I. 2006.
The pathological response to DNA damage does not contribute to p53-mediated
tumour suppression. Nature 443(7108): 214-217.
Di Micco, R., Fumagalli, M., Cicalese, A., Piccinin, S., Gasparini, P., Luise, C., Schurra,
C., Garre, M., Nuciforo, P.G., Bensimon, A., Maestro, R., Pelicci, P.G., and
d'Adda di Fagagna, F. 2006. Oncogene-induced senescence is a DNA damage
response triggered by DNA hyper-replication. Nature 444(7119): 638-642.
151
Dietrich, N., Bracken, A.P., Trinh, E., Schjerling, C.K., Koseki, H., Rappsilber, J., Helin,
K., and Hansen, K.H. 2007. Bypass of senescence by the polycomb group protein
CBX8 through direct binding to the INK4A-ARF locus. Embo J 26(6): 16371648.
Esteve, P.O., Chin, H.G., Smallwood, A., Feehery, G.R., Gangisetty, O., Karpf, A.R.,
Carey, M.F., and Pradhan, S. 2006. Direct interaction between DNMT1 and G9a
coordinates DNA and histone methylation during replication. Genes Dev 20(22):
3089-3103.
Foster, C.S., Falconer, A., Dodson, A.R., Norman, A.R., Dennis, N., Fletcher, A.,
Southgate, C., Dowe, A., Dearnaley, D., Jhavar, S., Eeles, R., Feber, A., and
Cooper, C.S. 2004. Transcription factor E2F3 overexpressed in prostate cancer
independently predicts clinical outcome. Oncogene 23(35): 5871-5879.
Gil, J., Bernard, D., Martinez, D., and Beach, D. 2004. Polycomb CBX7 has a unifying
role in cellular lifespan. Nat Cell Biol 6(1): 67-72.
Gorgoulis, V.G., Vassiliou, L.V., Karakaidos, P., Zacharatos, P., Kotsinas, A., Liloglou,
T., Venere, M., Ditullio, R.A., Jr., Kastrinakis, N.G., Levy, B., Kletsas, D.,
Yoneta, A., Herlyn, M., Kittas, C., and Halazonetis, T.D. 2005. Activation of the
DNA damage checkpoint and genomic instability in human precancerous lesions.
Nature 434(7035): 907-913.
Humbert, P.O., Verona, R., Trimarchi, J.M., Rogers, C., Dandapani, S., and Lees, J.A.
2000. E2f3 is critical for normal cellular proliferation. Genes Dev 14(6): 690-703.
Jacobs, J.J., Kieboom, K., Marino, S., DePinho, R.A., and van Lohuizen, M. 1999. The
oncogene and Polycomb-group gene bmi-1 regulates cell proliferation and
senescence through the ink4a locus. Nature 397(6715): 164-168.
Komori, H., Enomoto, M., Nakamura, M., Iwanaga, R., and Ohtani, K. 2005. Distinct
E2F-mediated transcriptional program regulates p14ARF gene expression. Embo
J 24(21): 3724-3736.
Lee, E.Y., Cam, H., Ziebold, U., Rayman, J.B., Lees, J.A., and Dynlacht, B.D. 2002.
E2F4 loss suppresses tumorigenesis in Rb mutant mice. CancerCell 2(6): 463472.
Leone, G., Nuckolls, F., Ishida, S., Adams, M., Sears, R., Jakoi, L., Miron, A., and
Nevins, J.R. 2000. Identification of a novel E2F3 product suggests a mechanism
for determining specificity of repression by Rb proteins. Mol Cell Biol 20(10):
3626-3632.
Leung, C., Lingbeek, M., Shakhova, O., Liu, J., Tanger, E., Saremaslani, P., Van
Lohuizen, M., and Marino, S. 2004. Bmil is essential for cerebellar development
and is overexpressed in human medulloblastomas. Nature 428(6980): 337-341.
152
Lin, W.C., Lin, F.T., and Nevins, J.R. 2001. Selective induction of E2F1 in response to
DNA damage, mediated by ATM-dependent phosphorylation. Genes Dev 15(14):
1833-1844.
Lingbeek, M.E., Jacobs, J.J., and van Lohuizen, M. 2002. The T-box repressors TBX2
and TBX3 specifically regulate the tumor suppressor gene pl4ARF via a variant
T-site in the initiator. J Biol Chem 277(29): 26120-26127.
Mallakin, A., Taneja, P., Matise, L.A., Willingham, M.C., and Inoue, K. 2006.
Expression of Dmp 1 in specific differentiated, nonproliferating cells and its
regulation by E2Fs. Oncogene 25(59): 7703-7713.
Mallette, F.A., Gaumont-Leclerc, M.F., and Ferbeyre, G. 2007. The DNA damage
signaling pathway is a critical mediator of oncogene-induced senescence. Genes
Dev 21(1): 43-48.
Molofsky, A.V., He, S., Bydon, M., Morrison, S.J., and Pardal, R. 2005. Bmi-1 promotes
neural stem cell self-renewal and neural development but not mouse growth and
survival by repressing the p16Ink4a and pl9Arf senescence pathways. Genes Dev
19(12): 1432-1437.
Nowak, K., Kerl, K., Fehr, D., Kramps, C., Gessner, C., Killmer, K., Samans, B.,
Berwanger, B., Christiansen, H., and Lutz, W. 2006. BMI1 is a target gene of
E2F-1 and is strongly expressed in primary neuroblastomas. Nucleic Acids Res
34(6): 1745-1754.
Oguro, H., Iwama, A., Morita, Y., Kamijo, T., van Lohuizen, M., and Nakauchi, H. 2006.
Differential impact of Ink4a and Arf on hematopoietic stem cells and their bone
marrow microenvironment in Bmil-deficient mice. J Exp Med 203(10): 22472253.
Palmero, I., Murga, M., Zubiaga, A., and Serrano, M. 2002. Activation of ARF by
oncogenic stress in mouse fibroblasts is independent of E2F1 and E2F2.
Oncogene 21(19): 2939-2947.
Pan, H., Yin, C., Dyson, N.J., Harlow, E., Yamasaki, L., and Van Dyke, T. 1998. Key
roles for E2F1 in signaling p53-dependent apoptosis and in cell division within
developing tumors. Mol Cell 2(3): 283-292.
Parisi, T., Yuan, T.L., Faust, A.M., Caron, A.M., Bronson, R., and Lees, J.A. 2007.
Selective requirements for E2f3 in the development and tumorigenicity of Rbdeficient chimeric tissues. Mol Cell Biol 27(6): 2283-2293.
Pediconi, N., Ianari, A., Costanzo, A., Belloni, L., Gallo, R., Cimino, L., Porcellini, A.,
Screpanti, I., Balsano, C., Alesse, E., Gulino, A., and Levrero, M. 2003.
Differential regulation of E2F1 apoptotic target genes in response to DNA
damage. Nat Cell Biol 5(6): 552-558.
153
Rayman, J.B., Takahashi, Y., Indjeian, V.B., Dannenberg, J.H., Catchpole, S., Watson,
R.J., te Riele, H., and Dynlacht, B.D. 2002. E2F mediates cell cycle-dependent
transcriptional repression in vivo by recruitment of an HDACl/mSin3B
corepressor complex. Genes Dev 16(8): 933-947.
Robertson, K.D. and Jones, P.A. 1998. The human ARF cell cycle regulatory gene
promoter is a CpG island which can be silenced by DNA methylation and downregulated by wild-type p53. Mol Cell Biol 18(11): 6457-6473.
Rowland, B.D., Denissov, S.G., Douma, S., Stunnenberg, H.G., Bernards, R., and Peeper,
D.S. 2002. E2F transcriptional repressor complexes are critical downstream
targets of pl9(ARF)/p53-induced proliferative arrest. Cancer Cell 2(1): 55-65.
Schlisio, S., Halperin, T., Vidal, M., and Nevins, J.R. 2002. Interaction of YY1 with
E2Fs, mediated by RYBP, provides a mechanism for specificity of E2F function.
Embo J 21(21): 5775-5786.
Tsai, K.Y., Hu, Y., Macleod, K.F., Crowley, D., Yamasaki, L., and Jacks, T. 1998.
Mutation of E2f- 1 suppresses apoptosis and inappropriate S phase entry and
extends survival of Rb-deficient mouse embryos. Mol Cell 2(3): 293-304.
Tsai, K.Y., MacPherson, D., Rubinson, D.A., Crowley, D., and Jacks, T. 2002. ARF is
not required for apoptosis in Rb mutant mouse embryos. Curr Biol 12(2): 159163.
van der Lugt, N.M., Domen, J., Linders, K., van Roon, M., Robanus-Maandag, E., te
Riele, H., van der Valk, M., Deschamps, J., Sofroniew, M., van Lohuizen, M., and
et al. 1994. Posterior transformation, neurological abnormalities, and severe
hematopoietic defects in mice with a targeted deletion of the bmi-1 protooncogene. Genes Dev 8(7): 757-769.
Varambally, S., Dhanasekaran, S.M., Zhou, M., Barrette, T.R., Kumar-Sinha, C., Sanda,
M.G., Ghosh, D., Pienta, K.J., Sewalt, R.G., Otte, A.P., Rubin, M.A., and
Chinnaiyan, A.M. 2002. The polycomb group protein EZH2 is involved in
progression of prostate cancer. Nature 419(6907): 624-629.
Vire, E., Brenner, C., Deplus, R., Blanchon, L., Fraga, M., Didelot, C., Morey, L., Van
Eynde, A., Bernard, D., Vanderwinden, J.M., Bollen, M., Esteller, M., Di Croce,
L., de Launoit, Y., and Fuks, F. 2006. The Polycomb group protein EZH2 directly
controls DNA methylation. Nature 439(7078): 871-874.
Wu, L., Timmers, C., Maiti, B., Saavedra, H.I., Sang, L., Chong, G.T., Nuckolls, F.,
Giangrande, P., Wright, F.A., Field, S.J., Greenberg, M.E., Orkin, S., Nevins,
J.R., Robinson, M.L., and Leone, G. 2001. The E2Fl-3 transcription factors are
essential for cellular proliferation. Nature 414(6862): 457-462.
154
Yamasaki, L., Bronson, R., Williams, B.O., Dyson, N.J., Harlow, E., and Jacks, T. 1998.
Loss of E2F-1 reduces tumorigenesis and extends the lifespan of Rbl (+/-)mice.
Nat Genet 18(4): 360-364.
Ziebold, U., Lee, E.Y., Bronson, R.T., and Lees, J.A. 2003. E2F3 loss has opposing
effects on different pRB-deficient tumors, resulting in suppression of pituitary
tumors but metastasis of medullary thyroid carcinomas. Mol Cell Biol 23(18):
6542-6552.
Ziebold, U., Reza, T., Caron, A., and Lees, J.A. 2001. E2F3 contributes both to the
inappropriate proliferation and to the apoptosis arising in Rb mutant embryos.
Genes Dev 15(4): 386-391.
Zindy, F., Eischen, C.M., Randle, D.H., Kamijo, T., Cleveland, J.L., Sherr, C.J., and
Roussel, M.F. 1998. Myc signaling via the ARF tumor suppressor regulates p53dependent apoptosis and immortalization. Genes Dev 12(15): 2424-2433.
155
Appendix A
Interplay between E2F and Bmil in regulation of Arf
in normal and tumor tissues
Phillip J. Iaquinta, Mona S. Spector, Scott W. Lowe, and Jacqueline A. Lees
All experiments were performed by the author. The tumor samples
used in Figures 1-3 were provided by M.S and S.L.
156
Results and Discussion
We have shown previously that Arf is regulated by E2F in vivo only in response to
oncogene activation (Chapter 3). In normal tissues, E2F is not bound to the Arf promoter,
even though it regulates a separate class of target genes involved in cell cycle regulation.
In tumors initiated by various oncogenic lesions, E2Fs are competent to bind the Arf
promoter coincident with its activation. E2Fs are not the only proteins capable of
affecting Arf expression. Several other proteins have been shown to inhibit Arf
expression when overexpressed, leading to a suppression of either senescence or
apoptosis despite the persistence of oncogenic signaling, and often permitting tumor
progression (Jacobs et al. 1999a; Jacobs et al. 1999b; Maestro et al. 1999; Jacobs et al.
2000; Lingbeek et al. 2002; Gil et al. 2004; Scott et al. 2007).
Expression of the oncoprotein c-Myc under control of the Eg immunoglobulin
enhancer (EyMyc allele) causes the development of B-cell lymphoma in mice (Adams et
al. 1985). Myc is a potent oncogene which induces apoptosis partially due to induction
of Arf transcription (Evan et al. 1992; Zindy et al. 1998). For EluMyc-induced tumors to
progress, they must disable the Arf-p53 tumor surveillance pathway (Eischen et al. 1999).
E/uMyc-transgenic mice carrying an additional germline mutation in Arf orp53 develop
lymphoma with dramatically reduced latency, further demonstrating the importance of
this pathway (Schmitt et al. 1999). If, instead of genetically removing Arf or p53, a
collaborating oncogene which suppresses Arf is expressed, or a key downstream regulator
of p53-dependent apoptosis is removed, Arf or p53 mutations are no longer selected for
(Jacobs et al. 1999b; Schmitt et al. 2002; Scott et al. 2007; Hemann et al. 2004; Hemann
157
et al. 2005). Since we observed E2F recruitment to the Arf promoter in all cases of
oncogenic stress, we investigated whether E2F also regulated Arf even when
coexpression of a repressor caused transcriptional inactivation of the locus.
E2Fs regulate Arf in response to oncogenic stress independent of Arf activation
To examine the whether repression of Arf affected oncogene-induced E2F binding, we
examined tumor samples from E/uMyc-transgenic lymphomas also overexpressing the
oncoproteins Bmil or CBX7, which are known to suppress Arf induction due to Myc
expression (Jacobs et al. 1999a; Jacobs et al. 1999b; Gil et al. 2004; Scott et al. 2007).
We also analyzed tumors co-expressing the anti-apoptotic protein Bcl-2, which disables
Myc-induced apoptosis downstream of p53 (Schmitt et al. 2002), and was not predicted
to influence Arf expression. We first performed RT-PCR analysis of the tumor samples
to assess the mRNA levels of Arf and p16, the other transcript from the Ink4a locus,
which is often regulated similar to Arf. Consistent with previous results (Eischen et al.
1999), we found increased levels of Arf and p16 mRNA in EuMyc-induced lymphoma,
relative to wildtype, non-transgenic spleen tissue (Figure 1A). Expression of either Bmil
or CBX7 caused repression of Arf and p16 in most samples analyzed (Figure 1A) (also
Jacobs et al. 1999b; Scott et al. 2007). All three CBX7-expressing tumors showed
inhibition of both Arf and p16 , while Bmil caused repression of Arf and p16 in 2/3 and
1/3 cases, respectively (Figure 1A and data not shown). Surprisingly, we found that
tumors expressing Bcl-2 also had reduced Arf and p16 levels (2/3 and 3/3 respectively;
Figure 1A and data not shown).
158
mr X
M
A
C.
Normal
spleen
+
0
C.
>1
w1 w5
W
C\j
+
u~l
RT-PCR
Arf
p16
*,-a- j
Ubiquitin
B
0
0
€,J
ir
WT Spleen
EgMyc
EgMyc +Bmil
EgMyc +CBX7
EgMyc +Bcl-2
Arf ChlP
Figure 1. E2F binding to Arfpromoter independent of gene activation
Wildtype spleen, or lymphoma tissue expressing EjiMyc with or without cooperating
oncogenes, was processed by RT-PCR (A) or ChIP (B) analysis.
159
To determine whether modulation of Arftranscription correlated with a change in
E2F promoter association, we performed ChIP assays. Similar to what we have
previously observed (Chapter 3), E2Fs were not detected at the Arf promoter in wildtype
spleen tissue, while tumor tissue of EutMyc-transgenic mice exhibited binding of the
activating E2Fs 1-3 (Figure IB). Strikingly, co-expression of the oncoproteins Bmil,
CBX7 or Bcl-2 had no effect on the recruitment of E2Fs to Arf, despite the repression of
Arf transcription in these tumors (Figure lB). Based on these results, we conclude that
the oncogenic stress caused by Myc signaling is the primary determinant causing E2Fs to
be recruited to Arf, and suppression of Arf expression must occur downstream of E2F
binding.
Polycomb proteins Bmil and CBX7 regulate the Ink4a locus in normal and
malignant tissues
To test the idea that repressor proteins were preventing E2F-mediated activation of Arf,
we performed ChIP analysis of the same tumors used above. As Bmi 1 and CBX7 are
known to be involved in the endogenous regulation of the Ink4a locus (Jacobs et al.
1999a; Gil et al. 2004), we evaluated the presence of these proteins at the Arfor p16
promoters in tissues with or without overexpression of Bmi 1 or CBX7. In normal
wildtype spleen tissue, we could detect robust binding of the Bmi 1 protein to both the Arf
and p16 promoters, as well as weak association of CBX7 to the p16 promoter (Figure
2A). This is consistent with the repression of this locus in normal tissues, and may
partially explain why E2F is dispensable for Arfrepression in tissues, but not MEFs
(Chapter 2). In EaMyc-initiated lymphoma tissue, both Bmil and CBX7 are found at the
160
C
0
0
Wt Spleen
EgMyc
EgMyc +Bmil
EgMyc +CBX7
Arf ChlP
p16 ChlP
Bmil RT
Figure 2. Bmil and CBX7 bind to the Arf and p16 promoters in wildtype and tumor
tissue
Wildtype spleen, or lymphoma tissue expressing EgMyc with or without cooperating
oncogenes, was processed by ChIP (A) or RT-PCR (B) analysis.
161
Arf and p16 promoters (Figure 2A), despite the activation of these genes and the presence
of E2Fs at the promoters in this tumor tissue (Figure 1). The transactivation potential of
E2F is apparently sufficient to overcome Bmil- and CBX7-mediated repression.
Since Bmil or CBX7 overexpression causes the repression of Arf in Mycexpressing lymphoma tissue (Figure lA), we investigated whether this is due to a change
in the promoter binding of these repressor proteins. When Bmil was overexpressed in
the E#uMyc-transgenic lymphomas, we consistently observed a slight but significant
increase in the intensity of Bmil binding to both the Arf and p16 promoters (Figure 2A
and data not shown). In tumors where CBX7 was overexpressed, we observed a dramatic
change in binding of repressor proteins: these tumors exhibited a drastic reduction in
Bmil binding to Arf and p16, yet only a slight increase in binding of CBX7 (Figure 2A).
The lack of intense binding of CBX7 could be explained by poor avidity of this antibody
in ChIP assays, but it remains a possibility that CBX7 affects Arfregulation indirectly;
however, we favor the first explanation, since presence of E2Fs at the Arfpromoter in
these tumors (Figure 1B) in the absence of repressor proteins should lead to Arf
activation.
The striking loss of Bmil binding to the Arf and p16 due to overexpression of
CBX7 could be due to several factors. First, CBX7 could physically replace Bmil or
prevent it from binding to the promoter. The slight increase in CBX7 association with
the Arf promoter is consistent with this possibility. Next, CBX7 overexpression along
with the E/lMyc transgene may allow for tumor development from a distinct initiating
162
cell population, where Bmil is not expressed. Indeed, EtuMyclCBX7-derived lymphomas
are of mature B-cell type, whereas EpuMyc-initiated lymphomas are composed of
immature B-cells (Scott et al. 2007). Finally, CBX7 expression may cause repression of
Bmil expression, or remove selection for Bmil-expressing cells during tumor
development. Consistent with this possibility, we observed a dramatic loss of Bmil
mRNA expression in CBX7-expressing lymphomas (Figure 2B), consistent with what
has been observed previously on the protein level (Scott et al. 2007).
Polycomb proteins such as Bmil and CBX7 are thought to cause repression by
forming a stable, inheritable repressed chromatin state which can spread for long
distances along a chromosome (Schwartz and Pirrotta 2007). This has been directly
confirmed for Polycomb regulation of the Ink4a locus, including by Bmil and CBX7
(Bracken et al. 2007). Therefore, we analyzed localization of Bmil and CBX7 to intronic
sites several kilobases downstream of the first exon of both Arf and p16. We found that
both Bmi 1 and CBX7 also bound to these intronic sites, and the pattern of binding was
similar to the Arf and p16 promoter regions (Figure 3). Bmil binding increased in tumors
where it was overexpressed, and was dramatically decreased in tumors overexpressing
CBX7. These results show that Bmil- and CBX7-mediated repression may involve
spreading along the locus and creating a larger repression domain.
Differential regulation of Arf by Bmil in different tumor types
In addition to its well-known ability to regulate the Ink4a locus, Bmil also plays an
important role in stem cell function (Gil et al. 2005). We found that Bmil was involved
in regulation of Arfboth in normal tissue and lymphoma cells (Figure 2A), which are
163
0
U
CL
C
0
WT spleen
EgMyc
EgMyc +Bmil
EgMyc +CBX7
Arf intron 1
pl6 Intron 1
Figure 3. Bmil and CBX7 bind throughout the Ink4a locus in wildtype and tumor tissue
Wildtype spleen, or lymphoma tissue expressing EgMyc with or without cooperating
oncogenes, was processed by ChIP analysis.
164
derived from a multipotent hematopoietic stem cell. This suggested that Bmil regulation
of Arfwas important for development of tumors derived from a stem cell precursor. To
test this hypothesis, we investigated another tumor model where stem cells are known to
influence tumor development. In the lung, a rare population of stem cells residing at
bronchio-alveolar junction (termed BASCs, for bronchio-alveolar stem cells) may be the
initiating cell in non-small-cell lung cancer (Kim et al. 2005). Increase in the number of
BASCs due to lung injury results in greater incidence of tumors when an oncogenic allele
of K-Ras is activated in the lung, suggesting these stem cells may be involved in tumor
initiation (Kim et al. 2005). To determine if Bmi 1 had a similar role in Arf regulation in
2 mice. We found that
lung tumorigenesis, we examined lung tumor tissue from K-RasLA
Bmil was bound to the Arf promoter both in K-Ras-transgenic lung tumor tissue, as well
as in wildtype lung tissue (Figure 4). Consistent with our previous experiments, we did
not detect any E2Fs at the Arf promoter in the wildtype tissue, but the activating E2Fs 1-3
were recruited to Arfonly in response to the oncogenic proliferation of the tumor cells.
Since Bmil is found at the Arf promoter in both lung tumor tissue (Figure 4) and in
lymphoma cells (Figure 2A), this regulation may be important for tumor development in
L
stem cell-derived tumors. In fact, mutation of Bmil in K-Ras
2
mice largely suppresses
the development of lung tumors, and Bmil - BASCs exhibit increased Arflevels,
suggesting Bmil-mediated suppression of Arf is critical for Ras-induced tumorigenesis in
the lung (J. Dovey and J. Lees, unpublished observations).
To determine whether Bmil regulation of Arf is important for all cases of
tumorigenesis, we examined a tumor model where stem cells have not been implicated in
tumor development. Expression of a fragment of the SV40 T Antigen that targets the
165
Arf
w
Wildtype Lung
K-Ras LA2 Lung Tumor
TgT 121 CPE Tumor
0)
-6
aa
+
c
cc
m
p107
LL
LM
e•-v
0
iii
W
Wildtype Lung
K-Ras LA2 Lung Tumor
TgT 121 CPE Tumor
Figure 4. Bmil binding to the Arf promoter depends on the tumor type
Wildtype lung, pooled K-Ras A 2 lung tumor tissue, or Tag 121-expressing choroid plexus
epithelium tumor tissue was analyzed by ChIP analysis for E2F binding to the Arf or
p107 promoter.
166
pRB-family of proteins (TgT121) specifically in the choroid plexus epithelium results in
slow-growing tumors which exhibit high levels of Arf mRNA and p53-dependent
apoptosis (Tolbert et al. 2002). We assessed regulation of Arf in these tumors by the
ChIP assay. 'We found that, similar to Rb-deficient tumors (Chapter 3), the activating
E2Fs, especially E2F1 an E2F2, were recruited to the Arf promoter in the tumor tissue.
Strikingly, we did not observe Bmil association with the Arf promoter in the TgT 121expressing tumor. Thus, regulation of Arfby Bmi 1 in tumors differs depending on either
the cell of origin, tissue type, or initiating oncogenic lesion of tumors.
Bmil regulation determines E2F target gene selectivity
While E2Fs regulate the expression of cell cycle-related genes in both normal and tumor
tissue (Figure 4; Chapter 3), E2Fs regulate Arf only in response to oncogenic signaling.
Since Bmil regulates Arf but not other E2F target genes (Figure 4), we considered the
possibility that Bmil promoter-association in the absence of cellular stress might
contribute to this selectivity. We previously characterized a subset of genes which, like
Arf, are activated by E2F only in the presence of oncogenic stress (Chapter 3, Figure 4).
We screened these and found one gene, NOXA, whose promoter is bound by Bmil
(Figure 5). This regulation was present both in wildtype lung and lung tumor tissue,
similar to Arf (Figure 5A). We observed binding of Bmil to both the Arf and NOXA
promoters in wildtype spleen and cerebellum as well (Figure 5B). Bmil may function to
enforce stable repression of genes whose stochastic activation would be deleterious to the
cell, such as pro-apoptotic genes like Arf and NOXA. Additionally, Bmil binding in
unstressed cells may contribute to recruitment of activating E2Fs in the presence of
oncogenic stress.
167
Normal Lung
C
o
o
K-RasLA 2 Lung Tumor
+
.
CM
W
L.
c4
W
.LL
a.
E
c4
5
m
W
Arf
p107
NOXA
B
J
oC-U.
C0
uJ
U.
0
rn
ow w
E
=.
0r
C
LLr
0
0
S
UL
w
m
C
Arf
NOXA
Wildtype cerebellum
Wildtype Spleen
Figure 5. The NOXA gene is regulated by Bmil in a manner similar to Arf
(A) Wildtype lung or pooled K-RasA2 lung tumor tissue was analyzed by ChIP analysis
for E2F or Bmil binding to the Arf, p107, or NOXA promoters. (B) Wildtype cerebellum
or spleen tissue was analyzed as in (A).
168
Experimental Procedures
Mouse strains
Fresh tumor tissue was recovered from K-RasA2 (Johnson et al. 2001) or TgT121 (Saenz
Robles et al. 1994) mice and frozen before analysis. EuMyc-transgenic lymphomas were
generated as described (Scott et al. 2007), and vectors encoding Bmil, CBX7, or Bcl-2
were introduced before reimplantation.
RT-PCR
RNA was extracted from tissues or tumors using the Qiagen RNeasy kit according to the
manufacturer's directions. cDNA was prepared using the Superscript First Strand
Synthesis System (Invitrogen). 100ng of cDNA was amplified by 30 cycles of PCR.
Primers used were p16 (GACATCGTGCGATATTTGCG and
GATTGGCCGCGAAGTTC), Bmil (CAGCAATGACTGTGATGC and
CTCCAGCATITCGTCAGTC), Arf, and Ubiquitin (Chapter 3).
ChIP
ChIP was performed exactly as described (Chapter 3). Primers used for amplification of
precipitated DNA were: p16 (TTAGCGCTGTTTCAACGCCC and
GCCACACTCTGCTCCTGACCT), Arf intron 1 (CATTGTCAAAGCCCATCCCC and
ACCCATCATCCAAGGGCTTC), p16 intron 1 (ACCCAAGGCCAAAAGGTGTG and
TGGACTCAGCACCGTGCTTT), and NOXA (Chapter 3). Antibodies used were: E2F1,
E2F2, E2F3a, E2F3a+b, E2F4 (Chapter 3), Bmil (20 gl of monoclonal supernatant 5C9),
CBX7 (#77, (Gil et al. 2004)), Acetyl-Histone H3 (0.25p1 #06-599, Upstate).
169
Acknowledgements
We thank Nathan Young and Tyler Jacks for providing tumor tissue and collaboration in
studying the K-Ras. A 2 model, and Mike Sardo and Terry van Dyke for TgT 121 tumor.
170
References
Adams, J.M., Harris, A.W., Pinkert, C.A., Corcoran, L.M., Alexander, W.S., Cory, S.,
Palmiter, R.D., and Brinster, R.L. 1985. The c-myc oncogene driven by
immunoglobulin enhancers induces lymphoid malignancy in transgenic mice.
Nature 318(6046): 533-538.
Bracken, A.P., Kleine-Kohlbrecher, D., Dietrich, N., Pasini, D., Gargiulo, G., Beekman,
C., Theilgaard-Monch, K., Minucci, S., Porse, B.T., Marine, J.C., Hansen, K.H.,
and Helin, K. 2007. The Polycomb group proteins bind throughout the INK4AARF locus and are disassociated in senescent cells. Genes Dev 21(5): 525-530.
Eischen, C.M., Weber, J.D., Roussel, M.F., Sherr, C.J., and Cleveland, J.L. 1999.
Disruption of the ARF-Mdm2-p53 tumor suppressor pathway in Myc-induced
lymphomagenesis. Genes Dev 13(20): 2658-2669.
Evan, G.I., Wyllie, A.H., Gilbert, C.S., Littlewood, T.D., Land, H., Brooks, M., Waters,
C.M., Penn, L.Z., and Hancock, D.C. 1992. Induction of apoptosis in fibroblasts
by c-myc protein. Cell 69(1): 119-128.
Gil, J., Bernard, D., Martinez, D., and Beach, D. 2004. Polycomb CBX7 has a unifying
role in cellular lifespan. Nat Cell Biol 6(1): 67-72.
Gil, J., Bernard, D., and Peters, G. 2005. Role of polycomb group proteins in stem cell
self-renewal and cancer. DNA Cell Biol 24(2): 117-125.
Hemann, M.T., Bric, A., Teruya-Feldstein, J., Herbst, A., Nilsson, J.A., Cordon-Cardo,
C., Cleveland, J.L., Tansey, W.P., and Lowe, S.W. 2005. Evasion of the p53
tumour surveillance network by tumour-derived MYC mutants. Nature
436(7052): 807-811.
Hemann, M.T., Zilfou, J.T., Zhao, Z., Burgess, D.J., Hannon, G.J., and Lowe, S.W. 2004.
Suppression of tumorigenesis by the p53 target PUMA. Proc Natl Acad Sci U S A
101(25): 9333-9338.
Jacobs, J.J., Keblusek, P., Robanus-Maandag, E., Kristel, P., Lingbeek, M., Nederlof,
P.M., van Welsem, T., van de Vijver, M.J., Koh, E.Y., Daley, G.Q., and van
Lohuizen, M. 2000. Senescence bypass screen identifies TBX2, which represses
Cdkn2a (pl9(ARF)) and is amplified in a subset of human breast cancers. Nat
Genet 26(3): 291-299.
Jacobs, J.J., Kieboom, K., Marino, S., DePinho, R.A., and van Lohuizen, M. 1999a. The
oncogene and Polycomb-group gene bmi-1 regulates cell proliferation and
senescence through the ink4a locus. Nature 397(6715): 164-168.
Jacobs, J.J., Scheijen, B., Voncken, J.W., Kieboom, K., Berns, A., and van Lohuizen, M.
1999b. Bmi-1 collaborates with c-Myc in tumorigenesis by inhibiting c-Mycinduced apoptosis via INK4a/ARF. Genes Dev 13(20): 2678-2690.
171
Johnson, L., Mercer, K., Greenbaum, D., Bronson, R.T., Crowley, D., Tuveson, D.A.,
and Jacks, T. 2001. Somatic activation of the K-ras oncogene causes early onset
lung cancer in mice. Nature 410(6832): 1111-1116.
Kim, C.F., Jackson, E.L., Woolfenden, A.E., Lawrence, S., Babar, I., Vogel, S., Crowley,
D., Bronson, R.T., and Jacks, T. 2005. Identification of bronchioalveolar stem
cells in normal lung and lung cancer. Cell 121(6): 823-835.
Lingbeek, M.E., Jacobs, J.J., and van Lohuizen, M. 2002. The T-box repressors TBX2
and TBX3 specifically regulate the tumor suppressor gene p14ARF via a variant
T-site in the initiator. J Biol Chem 277(29): 26120-26127.
Maestro, R., Dei Tos, A.P., Hamamori, Y., Krasnokutsky, S., Sartorelli, V., Kedes, L.,
Doglioni, C., Beach, D.H., and Hannon, G.J. 1999. Twist is a potential oncogene
that inhibits apoptosis. Genes Dev 13(17): 2207-2217.
Saenz Robles, M.T., Symonds, H., Chen, J., and Van Dyke, T. 1994. Induction versus
progression of brain tumor development: differential functions for the pRB- and
p53-targeting domains of simian virus 40 T antigen. Mol Cell Biol 14(4): 26862698.
Schmitt, C.A., Fridman, J.S., Yang, M., Baranov, E., Hoffman, R.M., and Lowe, S.W.
2002. Dissecting p53 tumor suppressor functions in vivo. CancerCell 1(3): 289298.
Schmitt, C.A., McCurrach, M.E., de Stanchina, E., Wallace-Brodeur, R.R., and Lowe,
S.W. 1999. INK4a/ARF mutations accelerate lymphomagenesis and promote
chemoresistance by disabling p53. Genes Dev 13(20): 2670-2677.
Schwartz, Y.B. and Pirrotta, V. 2007. Polycomb silencing mechanisms and the
management of genomic programmes. Nat Rev Genet 8(1): 9-22.
Scott, C.L., Gil, J., Hernando, E., Teruya-Feldstein, J., Narita, M., Martinez, D.,
Visakorpi, T., Mu, D., Cordon-Cardo, C., Peters, G., Beach, D., and Lowe, S.W.
2007. Role of the chromobox protein CBX7 in lymphomagenesis. ProcNatl Acad
Sci USA 104(13): 5389-5394.
Tolbert, D., Lu, X., Yin, C., Tantama, M., and Van Dyke, T. 2002. pl9(ARF) is
dispensable for oncogenic stress-induced p53-mediated apoptosis and tumor
suppression in vivo. Mol Cell Biol 22(1): 370-377.
Zindy, F., Eischen, C.M., Randle, D.H., Kamijo, T., Cleveland, J.L., Sherr, C.J., and
Roussel, M.F. 1998. Myc signaling via the ARF tumor suppressor regulates p53dependent apoptosis and immortalization. Genes Dev 12(15): 2424-2433.
172
Appendix B
Regulation of the Arf/p53 Tumor Surveillance Network by E2F
Phillip J. Iaquinta, Aaron Aslanian and Jacqueline A. Lees
Cold Spring Harb Symp Quant Biol. (2005) 70: 309-16.
Author's contribution: Figures 1, 3, 4, 5, and 6
173
Abstract
Deregulation of the cell cycle machinery plays a critical role in tumorigenesis. In
particular, functional inactivation of the retinoblastoma protein (pRB) is a key event.
pRB's tumor suppressive activity is at least partially dependent on its ability to regulate
the activity of the E2F transcription factors. E2F controls the expression of genes that
encode the cellular proliferation machinery. E2F can also trigger apoptosis when it is
inappropriately expressed. Here we present evidence that E2F acts to directly regulate the
Arf/p53 tumor surveillance network. In normal cells, a single member of the E2F family,
E2F3, participates in the transcriptional silencing of Arf. In response to oncogenic stress,
the activating E2Fs, E2Fl, 2, and E2F3a, all associate with Arf and promote its
transcription. These findings raise the possibility that E2F acts as a sensor of
inappropriate versus normal proliferative signals and determines whether or not the
Arf/p53 tumor surveillance network is engaged.
174
Introduction
The retinoblastoma gene (RB-1) was the first identified tumor suppressor and it is
mutated in one third of all human tumors (Sherr 1996). In normal cells, the
retinoblastoma protein (pRB) arrests cells in the G1 phase of the cell cycle. This
inhibition is relieved through activation of the cell cycle kinase cyclin D/cdk4 and the
sequential phosphorylation of pRB by cyclinD/cdk4 and cyclinE/cdk2. Negative growth
signals promote cell cycle arrest by increasing the expression of the cdk inhibitor, p16, a
known tumor suppressor. Most, if not all, human tumors carry either inactivating
mutations in Rb or p16 or activating mutations that up-regulate cyclin D/cdk4 (Sherr
1996). Thus, functional inactivation of pRB is an essential step in the tumorigenic
process.
Molecular studies have identified numerous proteins that bind to the pRB tumor
suppressor (Morris and Dyson 2001). The vast majority of these proteins are known
components of transcriptional complexes including chromatin regulators (e.g. swi/snf
proteins, HDACs, and histone methylases) and transcription factors. Of these interactors,
the E2F transcription factors are by far the best characterized (Trimarchi and Lees 2002;
Dimova and Dyson 2005). As we will outline below, there is now overwhelming
evidence that pRB's tumor suppressive activity is at least partially dependent upon its
ability to regulate E2F. In normal cells, E2F controls the expression of genes that encode
essential cellular proteins including cell cycle regulators, nucleotide biosynthesis
enzymes, hisitone varients, DNA damage regulators and DNA repair proteins (Trimarchi
and Lees 2002; Cam and Dynlacht 2003). These classic E2F-responsive genes share a
highly characteristic pattern of transcription: they are repressed during Go/G 1 , get
175
activated in late G1and are switched off again in S/G2/M. This periodic expression is
controlled by the concerted action of the E2F proteins and their associated regulatory
proteins.
We now know that the endogenous E2F activity is generated from the concerted
action of multiple E2F complexes (Trimarchi and Lees 2002). Most E2F complexes are
heterodimeric, containing one E2F and one DP protein, but recent studies have shown
that E2F7 and E2F8 function as homodimers (Trimarchi and Lees 2002; de Bruin et al.
2003; Di Stefano et al. 2003; Christensen et al. 2005; Maiti et al. 2005). The biological
properties of individual E2F complexes are determined largely by the E2F subunit. To
date, eight E2fgenes and nine E2F proteins have been identified (Christensen et al. 2005;
Dimova and Dyson 2005; Maiti et al. 2005). The discrepancy between these two
numbers is explained by the fact that the E2f3 gene encodes two distinct proteins, called
E2F3a and E2F3b, through the use of different promoters and 5' coding exons (Adams et
al. 2000; He et al. 2000; Leone et al. 2000). The E2F proteins can be divided into
different subgroups based on significant differences in their roles and upstream regulation
(Figure 1). The most striking distinction is that individual E2Fs appear to be involved
predominantly in either the repression or activation of E2F-responsive genes.
As their names imply, E2F6, 7 and 8 were the latest E2F family members to be
identified. They share significant sequence homology with the core DNA binding
domain of the other E2F proteins and the over-expression of E2F6, 7 or 8 is sufficient to
enforce the repression of classic E2F-responsive genes (Morkel et al. 1997; Cartwright et
al. 1998; Trimarchi et al. 1998; de Bruin et al. 2003; Di Stefano et al. 2003; Christensen
et al. 2005; Maiti et al. 2005). We still understand little about the role and regulation of
176
I
1t
\-tý
t2~4
fir
-pot;A
1I1
\LfS~
4?
Cellcyel~reulatd gnes Gi/~ (*/Nt
GiSpcfCons
Figure 1. E2F family members are divided into different subgroups, with different
functional properties
The different E2F subgroups positively or negatively regulate different subclasses of
genes (shaded boxes), partially dependent on their upstream regulators and associated
proteins (grey ovals).
177
these three E2Fs in vivo. Notably, in contrast to the other E2F family members, E2F6, 7
and 8 are not regulated by their association with pRB or the related pocket proteins, p107
and p130. Without even this circumstantial link, it is remains an open question as to
whether E2F6, 7 and/or 8 might influence tumorigenesis.
E2F4 and 5 constitute the second E2F-subgroup (Trimarchi and Lees 2002;
Dimova and Dyson 2005). These E2Fs are thought to play a key role in the
transcriptional repression of classic E2F-responsive genes via recruitment of p130 or
p107 and their associated histone deacetylases. The nuclear localization of E2F4 and 5
appears to be dependent upon their association with the pocket proteins (Verona et al.
1997; Gaubatz et al. 2001). Chromatin-immunoprecipitation (ChIP) assays show that
E2F4, p107 and p130 bind to classic E2F-responsive promoters in Go/G 1 when these
genes are actively repressed (Ren et al. 2002; Cam et al. 2004). Cells lacking E2F4 and 5
proliferate normally but they have a defective growth arrest response due to their inability
to appropriately silence E2F-responsive genes (Gaubatz et al. 2000; Landsberg et al.
2003). More recently, E2F3b was cloned and shown to be expressed in quiescent cells in
a similar manner to E2F4 and 5 (He et al. 2000; Leone et al. 2000). On the basis of this
observation, it was proposed that E2F3b would cooperate with E2F4 and 5 in mediating
the transcriptional repression of classic E2F-responsive genes (Leone et al. 2000).
The third E2F subgroup includes E2F1, 2 and 3A (Lees et al. 1993). These E2Fs
are potent transcriptional activators, and they are thought to play an important role in the
transcriptional activation of classic E2F-responsive genes. E2F1, 2 and 3A are
specifically regulated by pRB and not by p107 or p130 in normal cells (Lees et al. 1993).
The resulting pRB/E2F1, 2 or 3A complexes are not detected at the promoters of classic
178
E2F-responsive genes in Go/G 1 cells (Ren et al. 2002; Cam et al. 2004), suggesting that
they do not participate in their active repression. However, E2F1, 2 and 3A bind to these
promoters in mid- to late-G 1, coincident with their release from pRB and the activation of
these genes (Ren et al. 2002; Cam et al. 2004).
Over-expression studies show that the activating E2Fs can override growth arrest
signals and promote cellular proliferation (Johnson et al. 1994; Qin et al. 1994; Lukas et
al. 1996). At the same time, these E2Fs are potent inducers of apoptosis (Qin et al. 1994;
Wu and Levine 1994; Hiebert et al. 1995; Hsieh et al. 1997; Phillips et al. 1997; Phillips
et al. 1999). These opposing forces of proliferation and apoptosis are both classic
hallmarks of tumor cells (Hanahan and Weinberg 2000). Mouse models have provided
unequivocal proof that the activating E2Fs, E2fl and E2f3, promote the development of
pRB-deficient tumors (Pan et al. 1998; Yamasaki et al. 1998; McCaffrey et al. 1999;
Ziebold et al. 2003; Lazzerini Denchi and Helin 2005). Moreover, either directly or
indirectly, these E2Fs contribute to both the ectopic proliferation and apoptosis that
occurs within the developing tumors.
Considerable attention has focused on understanding the mechanism(s) by which
the activating E2Fs stimulate apoptosis. To date, a variety of pro-apoptotic regulators
have been identified as candidate E2F-responsive genes. The best-known example is the
Arf tumor suppressor. The product of the Arf gene, called p19" (in mouse), is a key
component of the p53 tumor surveillance network. p19Af exists at low or undetectable
levels in most normal cells but is activated by inappropriate proliferative signals (Sherr
and Weber 2000). Once it is expressed, pl9
rf inhibits Mdm2,
a ubiquitin ligase,
allowing activation of the p53 tumor suppressor and induction of p53-responsive genes.
179
These target genes promote cell cycle arrest or apoptosis and thereby counteract the
effect of the abnormal proliferative signals. Essentially, pl9 Arf acts as a defense against
oncogenic signals. This explains why inactivation of the p19 f-Mdm2-p53 network,
through either inactivating mutations in Arf or p53 or amplification of Mdm2/Hdm2, is
critical for tumor development (Sherr 2001). Importantly, the analysis of a mouse strain
that expresses GFP in place of p19" f, provides direct in vivo evidence that Arf is not
activated by normal proliferation but is reliably induced by the oncogenic signals that
trigger tumorigenesis (Zindy et al. 2003).
Understanding the mechanism by which Arf responds to inappropriate, but not
normal, proliferative signals remains a key goal. A variety of studies suggest a role for
E2F in the activation of Arf (Phillips and Vousden 2001). The Arf promoter contains
several consensus E2F binding sites and the ectopic expression of the activating E2Fs is
sufficient to trigger Arftranscription (DeGregori et al. 1997; Phillips et al. 1999).
However, it was unclear whether this regulation was direct because the identified E2F
sites were dispensable for E2F-dependent Arf activation (Parisi et al. 2002; Berkovich et
al. 2003) and many oncogenes lead to the activation of Arf (Sherr and Weber 2000).
Moreover, Arf is not expressed in the cell cycle dependent manner that is typically of
classic E2F-responsive genes. Thus, it was unclear whether Arf is a genuine E2Fresponsive gene in vivo. As we describe below, our data show that distinct E2F family
members contribute to the transcriptional regulation of Arf in normal versus tumor cells.
180
Results
E2f3 is required for Arf repression in unstressed cells
Our first insight into the role of E2F in the regulation of Arf came from the analysis of
mouse embryonic fibroblasts (MEFs) derived from an E2f3 mutant mouse strain. This
strain lacks the sequences encoding the E2F DNA binding domain and consequently is
deficient for both the E2F3a and E2F3b proteins (Humbert et al. 2000). The E2f3/ MEFs have a reduced proliferative capacity and also a dramatic impairment in their
ability to re-enter the cell cycle in response to growth factor stimulation (Humbert et al.
2000). This cell cycle re-entry defect correlates closely with a defect in the cell cycledependent induction of classic E2F-responsive genes (Humbert et al. 2000). We
hypothesized that the expression of Arf might also be altered in the E2f3- MEFs if Arfis
a genuine E2F-target gene. To test this idea, we used serum deprivation to arrest early
passage wildtype and E2f3 - MEFs in Go/G 1 and harvested cells at various timepoints
after serum re-addition to assess the state of cell cycle re-entry (through analysis of
incorporated tritiated thymidine) and gene expression (by western blotting). Consistent
with our previous studies, the E2f3'- MEFS showed a dramatic reduction in the level of
mitogen-induced DNA replication (Figure 2A) and the expression of cyclin A, a classic
E2F-responsive gene (Figure 2B). As previously described (Sherr and Weber 2000),
pl9" was present at very low levels in the arrested wildtype cells and its expression was
not induced during the cell cycle re-entry (Figure 2B). In contrast, pl9 Af was
dramatically up-regulated in the E2f3 - MEFs in both the arrested and the mitogen treated
cells (Figure 2B). Quantitative RT-PCR shows that this reflects an increase in the level
181
A
E
C.-
06
0o
8
CE
-I5
0
10
15
20
25
Hours
E2f3+/+
0
E2f3
24 0
12 16 20
12 16 20
.. ll . ...
l
r
I •m
,•
24
cyclinA
- -.
*
pl9
. ,i
•---•
.
p21 P1
p53 p-Serl5
S.
....
....
_
,-_
Arf
- .-
Ca
~
f-Tubulin
Figure 2. E2f3 - MEFs are defective in cell cycle re-entry, due to activation of p19 g rf
and p53
(A) Wild-type MEFs (solid line) or E2f3' MEFs (dottedlines) were synchronized by
serum starvation and cell cycle re-entry was monitored by [3H]-thymidine incorporation
into newly-synthesized DNA at the indicated times. (B) Total protein extracts were
prepared at the indicated times after serum-stimulation and subjected to western blotting
for cyclin A, p19 rf, p21Cipl, phospho-p53(Serl5), or P-Tubulin.
182
of ArfmRNA (data not shown). Thus, E2f3-inactivation alters the transcription of Arf in
the opposite manner from its effect on classic E2F-responsive genes.
The predominant function of pl9" f is to inhibit the ubiquitin ligase Mdm2 and
consequently trigger the stabilization and activation of p53. Consistent with this scheme,
the E2f3 mutant MEFs displayed the classic hallmarks of p53 activation: there was an
increase in the levels of p53 that was phosphorylated on Ser-15 and a dramatic upregulation in the levels of the cdk inhibitor p21, a known transcriptional target of p53
(Figure 2B). Thus, E2f3-inactivation leads to the induction of Arf and the activation of
p53. It is well documented that changes in the levels of pl9 rf , p53 and p21Ciplcan have
a major effect on the properties of MEFs, particularly in their ability to undergo mitogeninduced cell cycle re-entry (Sherr and Weber 2000). Consistent with these observations,
we found that the loss of either Arf orp53 completely suppressed the cell cycle re-entry
defects of the E2fY3 MEFs, including the defect in the expression of classic E2Fresponsive genes (Aslanian et al. 2004). This genetic rescue could arise in two ways.
The loss of Arf (or p53) could confer a proliferative advantage on the cells that outweighs
or overrides the proliferative disadvantage that results from E2J3-loss. Alternatively, it
could reflect the existence of a linear pathway in which E2F3 is required to repress Arf
and therefore prevents activation of p53 and p21Cip.
To determine whether E2F family members are directly involved in the regulation
of Arfin unstressed wildtype cells, we conducted ChIP assays (Figure 3). As a positive
control, we first examined E2F binding to a classic E2F-responsive promoter, p107. In
an asynchronous population of MEFs, we were able to detect E2Fl, 2, 3 and 4 in
association with the p107 promoter (Figure 3). This is consistent with the documented
183
n
I-C
0
ULL
0 WU
Cf)
CO
LL
LL.
W
LU
LU
LUCL
LU
a\j
LLLL
LU
'J
O
Q
Arf
p107
control
Figure 3. The Arfpromoter is specifically bound by E2F3
ChIP analysis was performed on asynchronously growing wild-type MEFs, and binding
of E2F and pocket protein complexes to the Arf and p107 promoters was monitored.
While the classic E2F-responsive promoter, p107, is bound by all E2Fs, E2F3 is the only
species detected at the Arf promoter.
184
role of both repressive (E2F4) and activating (E2F1, 2 and 3A) E2Fs in controlling the
cell cycle dependent expression of this classic target gene (Trimarchi and Lees 2002).
Remarkably, we observed a dramatically different pattern of E2F binding at the Arf
promoter: it was occupied by E2F3 but not other E2F family members. Notably, this
ChIP signal was observed using an antibody that recognizes both E2F3a and E2F3b, but
not an antibody that is specific for E2F3a (Figure 3). This raises the possibility that Arfis
specifically targeted by the E2F3b isoform.
The transcription of classic E2F responsive genes is activated in late G1 because
of a switch in promoter occupancy from repressive to activating E2F complexes. Given
the differential E2F-binding properties of Arf versus classic E2F-responsive genes in
asynchronous cells, we wished to establish how Arf was regulated at distinct cell cycle
stages. To address this issue, we used serum deprivation/re-stimulation assays to isolate
cells are various stages of arrest or cell cycle re-entry. As with our previous studies (see
Figure 2, for example), the cells initiate DNA synthesis 16-20 hours after serum
stimulation. As expected, we found that the p107 promoter, a classic E2F target, was
bound by the repressive E2F4-p130 complex in arrested cells (Oh; Figure 4). In the
enriched S-phase population, the E2F4/p 130 signal was reduced and the activating E2Fs,
E2F1, E2F2, and E2F3a, clearly associated with the p107 promoter (20h; Figure 4). In
striking contrast, E2F3 was the only E2F that was bound to Arf promoter in arrested
MEFs. Moreover, this E2F3 binding was maintained during cell cycle re-entry and we
did not observe recruitment of any other E2Fs to the Arfpromoter (Figure 4). This
analysis clearly shows that normal proliferative signals encountered during cell cycle
entry are insufficient to drive E2F activation of Arf. Rather, Arfexpression is kept low
185
n
+
o
,
N
N
0
W
W
WJ W
vo
a
+
0
.9
0
o
4-
M CMN C
WJ W W
W a.
0
0
M (M
W W
0
N
W
W
D.
.
Oh
12h
20h
24h
Arf
p107
control
Figure 4. The Arf promoter is not activated by E2F during cell cycle re-entry
Wild-type MEFs were synchronized by serum withdrawal, stimulated with 10% serum
for the indicated times, and then subjected to ChIP analysis. Whereas the activating E2Fs
are recruited to the p107 promoter, the Arf promoter is bound only by E2F3 throughout
cell cycle re-entry.
186
throughout the cell cycle, and this correlates with the binding of E2F3. In the E2f3/
MEFs, the de-repression of Arfoccurs without any detectable binding of the activating
E2Fs (data not shown). Thus, we conclude that E2F3 contributes to the transcription
repression of Arf in unstressed cells.
The activating E2Fs are involved in the oncogenic activation of Arf
The experiments above establish a direct role for E2F3 in repression of Arfin unstressed
cells. Given these observations, we wished to determine whether/how the E2F regulation
of Arf changes when the transcription of this gene is induced by oncogenic challenge. To
address this question, we examined the effect of overexpressing the adenoviral
oncoprotein, E1A. This is a potent oncogene that promotes both proliferation and
apoptosis. ElA acts, at least in part, by sequestering the pocket proteins and relieving the
transcriptional inhibition of the endogenous activating E2Fs (Ben-Israel and Kleinberger
2002). We infected early passage wildtype MEFs with either control or E1A-expressing
retroviruses and then used ChIP to assess E2F binding to either the Arf or p107 promoters
(Figure 5). Infection with the control virus did not alter the spectrum of E2F complexes
of these cells:: Arf was still specifically occupied by E2F3 while p107 was bound by
E2Fl, 2, 3 and 4. E1A expression had a fairly subtle effect on the spectrum of E2F
complexes that were bound to the p107 promoter. This included a modest reduction in
the binding of the repressive E2F, E2F4, and a subtle increase in the binding of the
activating E2Fs, E2F1 and 2, that are consistent with E1A's documented ability to
promote the expression of classic E2F target genes (Figure 5). Importantly, E1A had a
much more profound effect on Arf. There was a dramatic recruitment of the activating
E2Fs, E2Fl, 2 and 3A, to the Arf promoter and this correlated with a huge increase in the
187
vector
E1A
p-Tubulin
Arf
I
vector
E1A
wwý
I
p107vector
vectorfl
I
E1A
+
2
L
Scontrol
N
CO
IJ
L
IU
CO
W
L
.L
vector
ElA
Figure 5. The activating E2Fs bind to the Arf promoter in response to oncogenic stress
Wild-type MEFs were infected with retrovirus over-expressing E1A, or an empty virus
(vector) and subjected to Western (A) or ChIP (B) analyses with the indicated antisera.
r f , coincident with
MEFs expressing E1A exhibit dramatically increased levels of pl9 A
recruitment of activating E2Fs (E2Fl, E2F2, and E2F3a) to the Arf promoter.
188
expression of pl9
rf (Figure
5). Given these findings, we conclude that the endogenous
activating E2Fs participate in the activation of Arf and consequently the tumor
surveillance network engaged by the E1A oncogene.
189
Discussion
Tumor development is highly dependent upon the deregulation of two regulatory
networks, the: p 16Ink4a-cycD/cdk4-pRB-E2F pathway that controls cellular proliferation
and the pl9A"-Mdm2-p53 axis that mediates the tumor surveillance response (Sherr
2001). Our data reveal a direct connection between these two networks: E2F plays a key
role in controlling the transcription of the Arftumor suppressor in both normal and tumor
cells.
Through a combination of genetic and biochemical evidence, we have shown that
E2F3 contributes directly to the transcriptional repression of Arf in unstressed cells. The
E2f3 locus is known to encode two distinct isoforms, E2F3a and E2F3b (He et al. 2000;
Leone et al. 2000). E2F3a is expressed in proliferating cells and it is widely accepted to
be an activating E2F (Trimarchi and Lees 2002; Dimova and Dyson 2005). In contrast,
E2F3b is expressed in both quiescent and proliferating cells and, based solely on this
expression pattern, was proposed to be a transcriptional repressor (Leone et al. 2000).
Our ChIP data implicate E2F3b in the transcriptional repression of Arf Specifically, an
antibody that is specific for E2F3a yielded a clear ChIP signal at our classic E2Fresponsive gene, p107, but not at Arf, while an antibody that recognizes the common Cterminus of both E2F3a and E2F3b, detects E2F3 binding to both Arf and p107
promoters. These observations do not rule out the possibility that E2F3a contributes to
the transcription repression of Arf but they suggest that E2F3b is the major player. This
represents the first functional evidence that the E2F3b protein is a repressor of
transcription.
190
Numerous E2F family members have been classified as repressor E2Fs
(Trimarchi and Lees 2002; Dimova and Dyson 2005). Of these, E2F4 and 5 are the best
characterized, and the most closely related to E2F3b. E2F4 and 5 repress transcription of
classic E2F responsive genes in Go/G 1 by virtue of their association with the pocket
proteins, and their associated histone-modifying enzymes. This repression is relieved as
cells enter the cell cycle, when phosphorylation of the pocket protein by CDK activity
leads to a disruption of the E2F-pocket protein complex. E2F3b is known to associate
specifically with pRB in the Gl phase (Leone et al. 2000). However, we were not able to
detect pRB, or any other pocket protein, binding to the Arf promoter (Figures 3 and 4;
data not shown), raising the possibility that E2F3b enforces repression of Arfin a pRBindependent manner. Notably, the binding of E2F3b to Arfpersists during cell cycle
entry even though CDK activity is high, unlike the E2F4-p 130 complex, which is lost
from the pl07 promoter during cell cycle entry (Figure 3). This difference supports the
idea that the repressive E2F3b complex is refractory to CDK activity and therefore does
not contain pRB. At least two other known repressors of Arf Bmi-l and CBX7, are
members of the Polycomb group of transcriptional repressors (Jacobs et al. 1999; Gil et
al. 2004). Since it has been shown previously that another repressive E2F, E2F6, acts in
association with Polycomb proteins (Trimarchi et al. 2001; Ogawa et al. 2002; Attwooll
et al. 2005), it is feasible that E2F3b may cooperate with Bmi-1 and/or CBX7 to engage
repression of Arf.
In addition to their well-known role in regulation of cell cycle entry and DNA
synthesis, E2F proteins have also been implicated in regulation of genes involved in the
apoptotic response. However, there is considerable debate about whether these pro-
191
apoptotic genes are genuine targets in vivo and, more contentiously, which of the E2F
family members are capable of inducing apoptosis. A number of studies argue that the
induction of apoptosis is a specific property of E2F1 and not other E2F family members
(DeGregori et al. 1997; Leone et al. 2001; Lazzerini Denchi and Helin 2005). This
specificity could be due, at least in part, to the presence of a domain unique to E2F1 that
binds pRB and specifically regulates its apoptotic activity (Dick and Dyson 2003).
However, other studies show that the activating E2Fs can all induce apoptosis when they
are ectopically expressed (Vigo et al. 1999; Baudino et al. 2003). Clearly, these studies
do not rule out the possibility that E2F2 and E2F3a might promote apoptosis indirectly by
activating E2F1, a known E2F-responsive gene. Unfortunately, various mouse models
give conflicting answers to this issue. For example, it was recently reported that the
apoptosis arising in an E2f3a-transgenicmouse model occurs in an E2fl-dependent
manner (Lazzerini Denchi and Helin 2005). However, other models clearly show that the
absence of E2fl, or indeed both E2fl and E2f2, does not alter the ability of cells to induce
Arf or undergo apoptosis in response to oncogene activation (Palmero et al. 2002;
Baudino et al. 2003). Our data clearly show that E2F1, 2 and 3A all associate with the
Arf promoter when this gene is induced by the presence of E1A (Figure 5). Notably, this
validates a role for the endogenous E2Fs, as opposed to over-expressed E2Fs, in the
oncogenic response. Based on these observations, we conclude that Arf is a genuine E2F
target and that all three of activating E2Fs cooperate in the activation of this proapoptotic gene. This redundancy, combined with the need to achieve a certain total level
of activating E2Fs, could explain the previous conflicting observations that one or more
192
of the activating E2Fs can be either essential or dispensable for the activation of Arf
and/or apoptosis in different settings.
Unlike most E2F target genes, Arf expression is not induced as cells re-enter the
cell cycle from a quiescent state (Figure 2). We show here that this is likely due to the
failure of activating E2Fs to bind to the Arfpromoter during cell cycle entry, as well as
the persistence of the repressive E2F3 complex (Figure 4). However, many questions
remain regarding this unique regulation of Arf. How is E2F3 specifically targeted to Arf?
What prevents activation of Arf by other E2Fs during cell cycle entry? And how is
oncogenic stress sensed, ultimately leading to activating E2F binding to Arf? To address
this last question: it is possible that the switch from repression to activation requires a
modification of either the E2F3 repressive complex or the activating E2F species, which
only occurs in conditions of oncogene-induced hyper-proliferation. Alternatively, the
overall level of E2F activity may be the key determinant. During normal proliferation,
perhaps the level of E2F activity is only sufficient to bind and activate the promoters of
classic E2F targets. In contrast, the expression of E1A could yield a supra-physiological
level of activating E2Fs that allows binding and activation of both classic E2F-responsive
genes and additional targets like Arf. Importantly, this "supra-activation" model could
account for the activity of other cellular oncogenes, including Ras, c-Myc, and Abl.
These factors all possess the dual ability to promote cellular proliferation, ultimately by
promoting the release of the activating E2Fs, and also activate the Arftumor surveillance
network. It is tempting to speculate that some, or all of these factors, would activate Arf
as an unintended consequence of their need to engage E2F (Figure 6). At least in the case
of Ras, it is clear that another transcription factor, DMP1, contributes to Arf activation
193
Ras
I?
Cell cycle
Dmpl
Sarrest
E1A --
E2F -----
Arf --- Mdm2 ---
p53
Apoptosis
c-Myc,
Abl
E2F3b Bmi-1,
CBX7
Twist,
TBX2/3,
Pokemon
Figure 6. The Arf-p53 pathway is subject to complex regulation.
Arf is known to be directly regulated, both positively and negatively, by numerous factors
(solid lines). This study shows that E1A-induced activation of Arfoccurs via E2F. It
remains possible that signaling to Arf from other oncogenes (Ras, c-Myc, Abl) may occur
through E2F (dotted lines).
194
(Sreeramaneni et al. 2005). However, the levels of the activating E2Fs could act as a
global sensor that would distinguish inappropriate from normal proliferation and mobilize
Arf.
195
Experimental Procedures
MEF preparation and culture
E2f3 +1 mice (Humbert et al. 2000) were intercrossed and MEFs were prepared from
E13.5 embryos as previously described (Humbert et al. 2000). For serum starvation and
release experiments, passage 4 MEFs were incubated in low serum (0.1% FCS) for 72
hours, and subsequently fed with media containing 10% FCS. To monitor DNA
synthesis, cells were labeled with 5StCi [3H]-thymidine for 1 hour, harvested and then
[3H]-thymidine incorporation was measured as described previously (Moberg et al.
1996).
Protein preparation and western blotting
Passage 4 MEFs were plated onto 15-cm dishes at 3 x 106 cells/dish and cell cycle reentry was performed as described above. For each time point, cells were harvested and
total protein was isolated as described previously (Moberg et al. 1996). Western blotting
was performed using 100[ig whole cell extract and antibodies specific for cyclin A (Santa
Cruz sc-596), p19" (Novus NB200-106), p 21Cipl (Santa Cruz sc-6246), phospho-p53
(Serl5) (Cell Signaling Technology #9284), or b-Tubulin (TUB2.1, Sigma T4026).
Chromatin Immunoprecipitation (ChIP)
ChIP was performed essentially as described (Takahashi et al. 2000; Aslanian et al.
2004). Sonicated, cross-linked chromatin corresponding to approximately 3x10 6 cells
was immunoprecipitated with the following antibodies: Normal rabbit IgG (control), sc2027; E2F1, sc-193; E2F2, sc-633x; E2F3a, sc-879x; E2F3a+B, sc-878x; E2F4, sc-
196
1082x; p130, sc-317x (all from Santa Cruz Biotechnology). 3-4% of the precipitated
DNA, or 0.5% input DNA, was amplified by thirty cycles of PCR using primer sequences
for Arf, p107, or 1kb upstream of the E2fl promoter (Aslanian et al. 2004). PCR
products were stained with ethidium bromide after resolution on 8% polyacrylamide gels.
Retroviral Infection
Infections were performed exactly as described (Serrano et al. 1996). Wild-type MEFs
were infected and subsequently selected for two days in 2 mg/mL puromycin, grown for
an additional two days, and then subjected to ChIP analysis as described below. pBabePuro and LPC-12S-E1A have been described (de Stanchina et al. 1998).
197
Acknowledgements
J.A.L. is a Daniel K. Ludwig Scholar, and P.I. was supported by a Ludwig predoctoral
fellowship. This work was supported by a grant from the National Institutes of Health
(PO1-CA42053) to J.A.L.
198
References
Adams, M.R., Sears, R., Nuckolls, F., Leone, G., and Nevins, J.R. 2000. Complex
transcriptional regulatory mechanisms control expression of the E2F3 locus. Mol
Cell Biol 20(10): 3633-3639.
Aslanian, A., laquinta, P.J., Verona, R., and Lees, J.A. 2004. Repression of the Arf tumor
suppressor by E2F3 is required for normal cell cycle kinetics. Genes Dev 18(12):
1413-1422.
Attwooll, C., Oddi, S., Cartwright, P., Prosperini, E., Agger, K., Steensgaard, P.,
Wagener, C., Sardet, C., Moroni, M.C., and Helin, K. 2005. A novel repressive
E2F6 complex containing the polycomb group protein, EPC 1, that interacts with
EZH2, in a proliferation-specific manner. J Biol Chem 280(2): 1199-1208.
Baudino, T.A., Maclean, K.H., Brennan, J., Parganas, E., Yang, C., Aslanian, A., Lees,
J.A., Sherr, C.J., Roussel, M.F., and Cleveland, J.L. 2003. Myc-mediated
proliferation and lymphomagenesis, but not apoptosis, are compromised by E2f
loss. Mol Cell 11(4): 905-914.
Ben-Israel, H. and Kleinberger, T. 2002. Adenovirus and cell cycle control. FrontBiosci
7: d1369-1395.
Berkovich, E., Lamed, Y., and Ginsberg, D. 2003. E2F and Ras synergize in
transcriptionally activating p14ARF expression. Cell Cycle 2(2): 127-133.
Cam, H., Balciunaite, E., Blais, A., Spektor, A., Scarpulla, R.C., Young, R., Kluger, Y.,
and DIynlacht, B.D. 2004. A common set of gene regulatory networks links
metabolism and growth inhibition. Mol Cell 16(3): 399-411.
Cam, H. and Dynlacht, B.D. 2003. Emerging roles for E2F: beyond the G1/S transition
and DNA replication. Cancer Cell 3(4): 311-316.
Cartwright, P., Muller, H., Wagener, C., Holm, K., and Helin, K. 1998. E2F-6: a novel
member of the E2F family is an inhibitor of E2F- dependent transcription.
Oncogene 17(5): 611-623.
Christensen, J., Cloos, P., Toftegaard, U., Klinkenberg, D., Bracken, A.P., Trinh, E.,
Heeran, M., Di Stefano, L., and Helin, K. 2005. Characterization of E2F8, a novel
E2F-like cell-cycle regulated repressor of E2F-activated transcription. Nucleic
Acids Res 33(17): 5458-5470.
de Bruin, A., Maiti, B., Jakoi, L., Timmers, C., Buerki, R., and Leone, G. 2003.
Identification and characterization of E2F7, a novel mammalian E2F family
member capable of blocking cellular proliferation. J Biol Chem 278(43): 4204142049.
199
de Stanchina, E., McCurrach, M.E., Zindy, F., Shieh, S.Y., Ferbeyre, G., Samuelson,
A.V., Prives, C., Roussel, M.F., Sherr, C.J., and Lowe, S.W. 1998. E1A signaling
to p53 involves the pl9(ARF) tumor suppressor. Genes Dev 12(15): 2434-2442.
DeGregori, J.,, Leone, G., Miron, A., Jakoi, L., and Nevins, J.R. 1997. Distinct roles for
E2F proteins in cell growth control and apoptosis. Proc Natl Acad Sci U S A
94(14): 7245-7250.
Di Stefano, L., Jensen, M.R., and Helin, K. 2003. E2F7, a novel E2F featuring DPindependent repression of a subset of E2F-regulated genes. Embo J 22(23): 62896298.
Dick, F.A. and Dyson, N. 2003. pRB contains an E2Fl-specific binding domain that
allows E2Fl-induced apoptosis to be regulated separately from other E2F
activities. Mol Cell 12(3): 639-649.
Dimova, D.K. and Dyson, N.J. 2005. The E2F transcriptional network: old acquaintances
with new faces. Oncogene 24(17): 2810-2826.
Gaubatz, S., Lees, J.A., Lindeman, G.J., and Livingston, D.M. 2001. E2F4 is exported
from the nucleus in a CRM1-dependent manner. Mol Cell Biol 21(4): 1384-1392.
Gaubatz, S., Lindeman, G.J., Ishida, S., Jakoi, L., Nevins, J.R., Livingston, D.M., and
Rempel, R.E. 2000. E2F4 and E2F5 play an essential role in pocket proteinmediated GI control. Mol Cell 6(3): 729-735.
Gil, J., Bernard, D., Martinez, D., and Beach, D. 2004. Polycomb CBX7 has a unifying
role in cellular lifespan. Nat Cell Biol 6(1): 67-72.
Hanahan, D. and Weinberg, R.A. 2000. The hallmarks of cancer. Cell 100(1): 57-70.
He, Y., Armanious, M.K., Thomas, M.J., and Cress, W.D. 2000. Identification of E2F3B, an alternative form of E2F-3 lacking a conserved N-terminal region.
Oncogene 19(30): 3422-3433.
Hiebert, S.W., Packham, G., Strom, D.K., Haffner, R., Oren, M., Zambetti, G., and
Cleveland, J.L. 1995. E2F-1:DP-1 induces p53 and overrides survival factors to
trigger apoptosis. Mol Cell Biol 15(12): 6864-6874.
Hsieh, J.K., Fredersdorf, S., Kouzarides, T., Martin, K., and Lu, X. 1997. E2Fl-induced
apoptosis requires DNA binding but not transactivation and is inhibited by the
retinoblastoma protein through direct interaction. Genes Dev 11(14): 1840-1852.
Humbert, P.O., Verona, R., Trimarchi, J.M., Rogers, C., Dandapani, S., and Lees, J.A.
2000. E2f3 is critical for normal cellular proliferation. Genes Dev 14(6): 690-703.
200
Jacobs, J.J., Kieboom, K., Marino, S., DePinho, R.A., and van Lohuizen, M. 1999. The
oncogene and Polycomb-group gene bmi-1 regulates cell proliferation and
senescence through the ink4a locus. Nature 397(6715): 164-168.
Johnson, D.G., Cress, W.D., Jakoi, L., and Nevins, J.R. 1994. Oncogenic capacity of the
E2F1 gene. Proc Natl Acad Sci U S A 91(26): 12823-12827.
Landsberg, R.L., Sero, J.E., Danielian, P.S., Yuan, T.L., Lee, E.Y., and Lees, J.A. 2003.
The role of E2F4 in adipogenesis is independent of its cell cycle regulatory
activity. Proc Natl Acad Sci U S A 100(5): 2456-2461.
Lazzerini Denchi, E. and Helin, K. 2005. E2F1 is crucial for E2F-dependent apoptosis.
EMBO Rep 6(7): 661-668.
Lees, J.A., Saito, M., Vidal, M., Valentine, M., Look, T., Harlow, E., Dyson, N., and
Helin, K. 1993. The retinoblastoma protein binds to a family of E2F transcription
factors. Mol Cell Biol 13(12): 7813-7825.
Leone, G., Nuckolls, F., Ishida, S., Adams, M., Sears, R., Jakoi, L., Miron, A., and
Nevins, J.R. 2000. Identification of a novel E2F3 product suggests a mechanism
for determining specificity of repression by Rb proteins. Mol Cell Biol 20(10):
3626-3632.
Leone, G., Sears, R., Huang, E., Rempel, R., Nuckolls, F., Park, C., Giangrande, P., Wu,
L., Saavedra, H.I., Field, S.J., Thompson, M.A., Yang, H., Fujiwara, Y.,
Greenberg, M.E., Orkin, S., Smith, C., and Nevins, J.R. 2001. Myc requires
distinct E2F activities to induce S phase and apoptosis. Mol Cell 8(1): 105-113.
Lukas, J., Petersen, B.O., Holm, K., Bartek, J., and Helin, K. 1996. Deregulated
expression of E2F family members induces S-phase entry and overcomes
p16INK4A-mediated growth suppression. Mol Cell Biol 16(3): 1047-1057.
Maiti, B., Li, J., de Bruin, A., Gordon, F., Timmers, C., Opavsky, R., Patil, K., Tuttle, J.,
Cleghom, W., and Leone, G. 2005. Cloning and characterization of mouse E2F8,
a novel mammalian E2F family member capable of blocking cellular
proliferation. J Biol Chem 280(18): 18211-18220.
McCaffrey, J., Yamasaki, L., Dyson, N.J., Harlow, E., and Griep, A.E. 1999. Disruption
of retinoblastoma protein family function by human papillomavirus type 16 E7
oncoprotein inhibits lens development in part through E2F-1. Mol Cell Biol 19(9):
6458-6468.
Moberg, K., Starz, M.A., and Lees, J.A. 1996. E2F-4 switches from p130 to p107 and
pRB in response to cell cycle reentry. Mol Cell Biol 16(4): 1436-1449.
Morkel, M., Wenkel, J., Bannister, A.J., Kouzarides, T., and Hagemeier, C. 1997. An
E2F-like repressor of transcription. Nature 390(6660): 567-568.
201
Morris, E.J. and Dyson, N.J. 2001. Retinoblastoma protein partners. Adv CancerRes 82:
1-54.
Ogawa, H., Ishiguro, K., Gaubatz, S., Livingston, D.M., and Nakatani, Y. 2002. A
complex with chromatin modifiers that occupies E2F- and Myc-responsive genes
in GO cells. Science 296(5570): 1132-1136.
Palmero, I., Murga, M., Zubiaga, A., and Serrano, M. 2002. Activation of ARF by
oncogenic stress in mouse fibroblasts is independent of E2F1 and E2F2.
Oncogene 21(19): 2939-2947.
Pan, H., Yin, C., Dyson, N.J., Harlow, E., Yamasaki, L., and Van Dyke, T. 1998. Key
roles for E2F1 in signaling p53-dependent apoptosis and in cell division within
developing tumors. Mol Cell 2(3): 283-292.
Parisi, T., Pollice, A., Di Cristofano, A., Calabro, V., and La Mantia, G. 2002.
Transcriptional regulation of the human tumor suppressor pl4(ARF) by E2F1,
E2F2, E2F3, and Spl-like factors. Biochem Biophys Res Commun 291(5): 11381145.
Phillips, A.C., Bates, S., Ryan, K.M., Helin, K., and Vousden, K.H. 1997. Induction of
DNA synthesis and apoptosis are separable functions of E2F- 1. Genes Dev
11(14): 1853-1863.
Phillips, A.C., Ernst, M.K., Bates, S., Rice, N.R., and Vousden, K.H. 1999. E2F-1
potentiates cell death by blocking antiapoptotic signaling pathways. Mol Cell
4(5): 771-781.
Phillips, A.C. and Vousden, K.H. 2001. E2F-1 induced apoptosis. Apoptosis 6(3): 173182.
Qin, X.Q., Livingston, D.M., Kaelin, W.G., Jr., and Adams, P.D. 1994. Deregulated
transcription factor E2F-1 expression leads to S-phase entry and p53-mediated
apoptosis. ProcNatl Acad Sci U S A 91(23): 10918-10922.
Ren, B., Cam, H., Takahashi, Y., Volkert, T., Terragni, J., Young, R.A., and Dynlacht,
B.D. 2002. E2F integrates cell cycle progression with DNA repair, replication,
and G(2)/M checkpoints. Genes Dev 16(2): 245-256.
Serrano, M., Lee, H., Chin, L., Cordon-Cardo, C., Beach, D., and DePinho, R.A. 1996.
Role of the INK4a locus in tumor suppression and cell mortality. Cell 85(1): 2737.
Sherr, C.J. 1996. Cancer cell cycles. Science 274(5293): 1672-1677.
-. 2001. The INK4a/ARF network in tumour suppression. Nat Rev Mol Cell Biol 2(10):
731-737.
202
Sherr, C.J. and Weber, J.D. 2000. The ARF/p53 pathway. Curr Opin Genet Dev 10(1):
94-99.
Sreeramaneni, R., Chaudhry, A., McMahon, M., Sherr, C.J., and Inoue, K. 2005. RasRaf-Arf signaling critically depends on the Dmpl transcription factor. Mol Cell
Biol 25(1): 220-232.
Takahashi, Y., Rayman, J.B., and Dynlacht, B.D. 2000. Analysis of promoter binding by
the E2F and pRB families in vivo: distinct E2F proteins mediate activation and
repression. Genes Dev 14(7): 804-816.
Trimarchi, J.M., Fairchild, B., Verona, R., Moberg, K., Andon, N., and Lees, J.A. 1998.
E2F-6, a member of the E2F family that can behave as a transcriptional repressor.
Proc Natl Acad Sci U S A 95(6): 2850-2855.
Trimarchi, J.M., Fairchild, B., Wen, J., and Lees, J.A. 2001. The E2F6 transcription
factor is a component of the mammalian Bmil- containing polycomb complex.
Proc Natl Acad Sci U S A 98(4): 1519-1524.
Trimarchi, J.M. and Lees, J.A. 2002. Sibling rivalry in the E2F family. Nature Reviews
Mol Cell Biol 3: 11-20.
Verona, R., Moberg, K., Estes, S., Starz, M., Vernon, J.P., and Lees, J.A. 1997. E2F
activity is regulated by cell cycle-dependent changes in subcellular localization.
Mol Cell Biol 17(12): 7268-7282.
Vigo, E., Muller, H., Prosperini, E., Hateboer, G., Cartwright, P., Moroni, M.C., and
Helin, K. 1999. CDC25A phosphatase is a target of E2F and is required for
efficient E2F- induced S phase. Mol Cell Biol 19(9): 6379-6395.
Wu, X. and Levine, A.J. 1994. p53 and E2F-1 cooperate to mediate apoptosis. Proc Natl
Acad Sci U S A 91(9): 3602-3606.
Yamasaki, L., Bronson, R., Williams, B.O., Dyson, N.J., Harlow, E., and Jacks, T. 1998.
Loss of E2F-1 reduces tumorigenesis and extends the lifespan of Rbl(+/-)mice.
Nat Genet 18(4): 360-364.
Ziebold, U., Lee, E.Y., Bronson, R.T., and Lees, J.A. 2003. E2F3 loss has opposing
effects on different pRB-deficient tumors, resulting in suppression of pituitary
tumors but metastasis of medullary thyroid carcinomas. Mol Cell Biol 23(18):
6542-6552.
Zindy, F., Williams, R.T., Baudino, T.A., Rehg, J.E., Skapek, S.X., Cleveland, J.L.,
Roussel, M.F., and Sherr, C.J. 2003. Arf tumor suppressor promoter monitors
latent oncogenic signals in vivo. Proc Natl Acad Sci U S A 100(26): 15930-15935.
203
Biographical Note
Phillip J. Iaquinta
Massachusetts Institute of Technology
Center for Cancer Research
Building E17, Room 524
Cambridge, MA 02139
Phone: 617-252-1537
Email: phil.iaquinta@gmail.com
Education
2000-2007
Ph.D., Department of Biology
Massachusetts Institute of Technology
Cambridge, Massachusetts
1996-2000
A.B. (with honors), Molecular and Cell Biology
Emphasis in Biochemistry and Molecular Biology
University of California - Berkeley
Research Experience
2001-2007
Graduate Research
MIT Center for Cancer Research
Cambridge, Massachusetts
Advisor: Jacqueline A. Lees
Thesis Title: Regulation of the Arf Tumor Suppressor by E2F
Transcription Factors
1999-2000
Undergraduate Research
University of California - Berkeley
Advisor: Jeremy Thorner
Publications and Presentations
laquinta PJ, Aslanian A, Lees JA.
Regulation of the Arf/p53 tumor surveillance network by E2F.
Cold Spring Harb Symp Quant Biol. 2005; 70:309-16.
P. Iaquinta and J. Lees (oral presentation)
"Regulation of the tumor suppressor Arf by the E2F transcription factors"
Cold Spring Harbor Laboratory, Cancer Genetics and Tumor Suppressor Genes Meeting
August 18-22, 2004; Cold Spring Harbor, NY.
204
*Aslanian A, *Iaquinta PJ, Verona R, Lees JA.
Repression of the Arf tumor suppressor by E2F3 is required for normal cell cycle kinetics
Genes Dev. 2004 Jun 15;18(12): 1413-22
*Authors contributed equally
Sette C, Inouye CJ, Stroschein SL, laquinta PJ, Thorner J.
Mutational analysis suggests that activation of the yeast pheromone response
mitogen-activated protein kinase pathway involves conformational changes in
the Ste5 scaffold protein.
Mol Biol Cell. 2000 Nov;11(11):4033-49.
Teaching Experience
Spring, 2004
Teaching Assistant, Introduction to Experimental Biology (7.02)
Massachusetts Institute of Technology
Spring, 2002
Teaching Assistant, Introductory Biology (7.013)
Massachusetts Institute of Technology
Awards and Honors
2005-2006
2004-2005
2000
Integrative Cancer Biology Program Graduate Fellowship
Ludwig Fund for Cancer Research, Graduate Fellowship
Biochemistry and Molecular Biology Divisional Citation
205