Translational Regulation by Short RNAs in Mammalian Cells
By
Christian Paul Petersen
FAsSos
B.A. Chemistry and B.A. History (2000)
Grinnell College
L
Q
FEB0 1 006
0
LIBRARIES
Submitted to the Department of Biology
In Partial Fulfillment of the Requirements for
the Degree of
Doctor of Philosophy
ARWYO.
at the
Massachusetts Institute of Technology
February 2006
© 2006 Massachusetts Institute of Technology
All rights reserved.
,4
I
Signature of Author:
s~
(8and
_ -
-
Department of Biology
November 11, 2005
Io
v
Certified by:
v
2
Phillip A. Sharp
Professor of Biology
Thesis Supervisor
Accepted by:
_
I- ,
\.
-I
_
Steven P. Bell
Professor of Biology
Chair, Biology Graduate Committee
Translational Regulation by Short RNAs in Mammalian Cells
By
Christian Paul Petersen
Submitted to the Department of Biology on November 11, 2005
in Partial Fulfillment of the Requirements for the Degree of
Doctor of Philosophy in Biology.
ABSTRACT
The large complexity of animals is thought to depend upon the regulation of gene expression
and not the number of genes in a genome. Gene expression is a highly conserved process in
which genes encoded by DNA are transcribed in the nucleus into messenger RNA, spliced,
and exported to the cytoplasm, where they are translated into proteins. It was therefore a
profound surprise when RNA itself, in the form of -21nt short RNAs, was discovered to
have major generalized roles in the regulation of mRNAs which are typically 100 times
larger in size. These short RNAs, siRNAs and microRNAs, exert their influence on gene
expression in mammals by RNA interference (RNAi) and translational repression.
RNAi initiated by exogenous siRNAs results in mRNA degradation whereas many
endogenous microRNAs cause translational repression. Some factors which produce siRNAs
from double-stranded RNA or microRNAs from hairpin precursors are shared and some are
unique to each pathway. Our work shows the interaction between short RNA and target
mRNA, not the origin of the short RNA, dictates the outcome of silencing. Perfectly or
nearly perfectly complementary basepairing between short RNA and target mRNA causes
RNAi-mediated degradation of the mRNA, whereas partial basepairing results in
translational repression and a degree of mRNA degradation. This repression depends upon
the number of binding sites within a target mRNA, and there is a synergistic relationship
between binding site number and the degree of silencing.
Further investigation of the mechanism revealed a post-initiation block to translation
by short RNAs. Translationally repressed mRNAs associate with polyribosomes, and IRESinitiated translation, which bypasses normal initiation, can be repressed by short RNA.
Polyribosomes associated with repressed mRNA are sensitive to treatment with the
puromycin, demonstrating that these ribosomes can complete the elongation cycle. Pulselabeling shows that short RNAs likely act before production of complete protein. Short
RNAs cause an increase of translational termination at a stop codon. After a brief inhibition
of translation initiation in vivo, ribosomes dissociate more rapidly from repressed mRNAs
than from active mRNAs. These results show that short RNAs repress translation after
initiation by a novel mechanism which causes ribosome drop-off.
Thesis Supervisor: Phillip A. Sharp
Title: Professor of Biology
2
TABLE OF CONTENTS
Abstract..............................................................................................
2
Acknowledgements
.................................................................................
4
Chapter 1. siRNAs and miRNAs ..................................................................
RNA interference
Short interfering RNAs (siRNAs) ..............................................
6
RISC................................................................................
7
7
microRNAs
Discovery of miRNAs ...........................................................
miRNA genomics ................................................................
10
10
Biogenesis......................................................
11...................
Specificity of miRNA/mRNA interactions....................................
13
miRNA targets ....................................................................
Range of biology ..................................................................
mRNA degradation by miRNAs and P-body localization ..................
14
15
17
Pathways of translation-coupled RNA decay.................................
Eukaryotic translation.............................................................
20
21
Translational repression by 3' UTRs ...........................................
Mechanism of microRNA translational repression ...........................
23
26
References...................................................................................
Chapter 2.
siRNAs can function as miRNAs ......................................................
30
43
Chapter 3.
Short RNAs repress translation after initiation in mammalian cells ................
64
Conclusions.........................................................................................
106
Biographical Note.................................................................................
113
3
ACKNOWLEDGEMENTS
On my committee I'd like to thank Dave Bartel and Tom Rajbhandary for
advising me for 5 and 2 years respectively. I especially thank Dave for saving me at the
th
11
hour from a Mac to PC conversion problem during a talk in Vienna in 2003, and
being a constant guiding hand in my research life. Thanks also to Victor Ambros, for
many interesting discussions, and for opening my eyes to a planaria postdoc.
I can think of no better place to work than the 5th floor of the Cancer Center, and
within the Sharp Lab in particular. My time here was very much brightened by the
presence of brilliant and superlative peers, always willing to talk and listen, both
stimulating and supportive the whole way through. Carl, Dean, Alla, Mauro, Amanda,
Hristo, Will, Mike, Mike, Chonghui, KB, Derek, Lourdes, Amy, Joel, Ann, Keara, Phil,
Seth, Erik, Issac, Al, Carla, Chris, Patrick, Stephan, Peter, Julian, Dave, Ruth. I'll never
forget "ice bucket soccer," the whoopin' stick, mornings of the daily 10x coffee "Novina
Challenge" and of course, evenings at the Muddy.
John Doench traveled with me on this road, and I certainly could not have
persisted without his constant encouragement and help. He's a wonderful collaborator,
and even better friend, a comrade who could bring me back when I was frustrated, and an
ally throughout the journey.
Phil has been an incredible advisor, always challenging me to reach as far as I
can, and helping me to become independent. Thanks for letting me follow the course I
wanted to, for always inspiring me and making me remember what's really important.
Some of my favorite times here have been spent around the circular blackboard in the
hallway, coffee in hand, talking about a new idea.
I'd also like to thank my musical colleagues for preserving my sanity through
countless good grooves and fun gigs. Phil, Dave, Graham, John, Bob and Lee-may the
Max Funk Institut go platinum next year!
I'm very thankful of my many good friends for being so incredibly supportive
through the years. Christopher, you're one of the best listeners I know, and there were
times I might have given up without your encouragement. John, Phil, Seth, Andy, Erik,
thanks for many great games of chance (and skill!) at Guy's Night. Emily Levin, Slavea,
Samadi, Emily Shaw, Josh, John Friskel, Lucia, Nick, Selena, Travis and Misha, you
provided me a lot of stability in my home life away from lab. Matt and Melinda, thanks
for being such incredible and warm friends through all these years.
Sarah, my once and future roommate, I couldn't have asked for someone more
supportive and wonderful in my life. Especially in these last days, you've listened more
than anyone else, and really helped me through this process. Thanks. I'm so glad that I
was able to overcome my fear of salsa dancing at least once a year and a half ago.
Finally, thanks so much to my wonderful family for always loving and supporting
me. Even from a distance, we've managed to have great adventures during my time here.
I'll never forget Paris, Italy, Christmas and Summer visits to Iowa. Mom, I know no one
loves me more. Dad, your thoughtfulness always inspires me. Grandma Sandholm, your
vibrance is a refreshing shot in the arm, and Grandma Petersen, your warmth and grace
are humbling. Andy, you're the best kind of pal and I'm so glad you moved to Boston,
and Jan-Marie, your exuberance never ceases to charm me.
4
For Bill Sandholm and his life of quiet dignity
5
Chapter One
siRNAs and microRNAs
Portions of this chapter originally appeared in Chapter 20 of The RNA World, 3rd Edition
6
RNA interference
Short interfering RNAs (siRNAs)
RNAi was discovered when researchers introduced exogenous double-stranded
RNA into the nematode C. elegans and found that homologous genes were posttranscriptionally silenced (Fire et al. 1998). The pathway is divided into initiator and
effecter steps (Figure 1). RNAi is initiated by double-stranded RNA, which is recognized
and cleaved at a single phosphodiester bond on each strand of the RNA by the RNaseIII
enzyme Dicer to produce 21 nt double-stranded short interfering RNAs (siRNAs)
(Hamilton and Baulcombe 1999; Tuschl et al. 1999; Zamore et al. 2000; Bernstein et al.
2001; Zhang et al. 2004). In the effecter step, one strand of the siRNA is incorporated
into an RNA-induced Silencing Complex (RISC) that causes endonucleolytic cleavage of
homologous mRNA (Hammond et al. 2000; Elbashir et al. 2001a; Nykanen et al. 2001).
SiRNAs are 19-21 nucleotide dsRNA molecules with 3' two nucleotide hydroxyl
overhangs and 5' monophosphates (Elbashir et al. 2001a; Elbashir et al. 2001 b). The
guide strand of the siRNA is sensed by its reduced thermodynamic stability in the 5'
region versus the other strand (Khvorova et al. 2003; Schwarz et al. 2003). This
"functional asymmetry" of a siRNA is detected by R2D2 in combination with Dicer (Liu
et al. 2003; Tomari et al. 2004b). The siRNA is unwound in an ATP dependent step
which requires the helicase Armitage (Tomari et al. 2004a).
RISC
The catalytic core of RISC is the protein Argonaute (Hammond et al. 2001;
Carmell et al. 2002). Argonaute genes were among the first to be identified as required
7
for post-transcriptional gene silencing by dsRNA in such diverse organisms as
Arabidopsis, Neurosopora, C. elegans and Drosophila.
The number of Argonaute gene
varies widely between organisms such that the S. Pombe genome has only one Argonaute
protein but the C. elegans genome contains more than two dozen. Argonaute proteins
contain two highly conserved domains, PAZ and PIWI. The PAZ domain directly
contacts the 3' overhangs of an siRNA in a crystal structure, suggesting that this domain
may recognize siRNAs and deliver them into RISC (Lingel et al. 2003; Yan et al. 2003).
The PIWI domain contacts the 5' region of the siRNA guide strand when bound as an A
form helix to target mRNA. This maneuvering positions catalytic residues within an
RNase H-like fold of the PIWI domain near the scissile phosphate of the target mRNA,
directing cleavage (Liu et al. 2004; Song et al. 2004). Contacts with the 5' end of the
siRNA are essential for catalytic function (Parker et al. 2004; Ma et al. 2005). The
cleavage event produces a 5' phosphate and 3' hydroxyl within the target mRNA ten
nucleotides from the 5' end of the siRNA (Martinez and Tuschl 2004; Schwarz et al.
2004). In some cases, Argonaute paralogs within a genome are known to have specialized
functions. For example, C. elegans rde-1 functions in RNA interference, while alg-I and
alg-2 function in microRNA-mediated
Likewise, Drosophila
silencing (Tabara et al. 1999; Grishok et al. 2001).
ago-2 is necessary for RNAi but ago- is necessary for the mRNA
degradation component of microRNA-mediated silencing (Rehwinkel et al. 2005). In
mammals, ago-2 is required for RNAi, but the function of the other three Argonaute
proteins is unknown (Liu et al. 2004).
Other components have been identified in RISC depending on the fractionation
scheme and assay used. Although stringent fractionation of RISC activity yields a
8
complex approximately large enough to accommodate Argonaute and one other protein,
less stringent procedures produce a RISC of about 80S (Martinez et al. 2002; Pham et al.
2004). Indeed, some components of RISC associate with L5 and L1 I ribosomal proteins
as well as the 5S rRNA (Ishizuka et al. 2002). The proteins VIG, FMRP, and the
micrococcal nuclease Tudor SN have been identified as part of RISC, but the function of
these proteins within RISC remains unknown (Caudy et al. 2002; Caudy et al. 2003).
Possibly, proteins in addition to Argonaute function within the cell to properly localize
RISC function or have other functions in gene silencing.
A major difference between RNAi in plants and worms versus flies and mammals
is the presence of an siRNA-amplification
step which requires RNA-dependent RNA
polymerases (RdRPs) (Cogoni and Macino 1999; Dalmay et al. 2000; Fagard and
Vaucheret 2000; Sijen et al. 2001). In these organisms, siRNAs can either perform
cleavage reactions within RISC or initiate the formation of double stranded RNA using
the target mRNA as a template for RdRP enzymes. These newly generated dsRNAs are
substrates for Dicer and the production of more siRNAs, amplifying the RNAi effect.
Despite the absolute requirement for Dicer and Ago2 homologs in the initiation and
effector steps across diverse species, no homologs of RdRP are known to exist in
mammals or flies. Additionally, siRNAs modified at their 3' end to block priming by
RdRPs are nonetheless functional, suggesting that an amplification step is truly not
essential for RNAi in flies and mammals (Schwarz et al. 2002). Interestingly, the ability
to spread silencing throughout an organism and to transmit silencing through progeny for
several generations correlates with the presence of an RdRP amplification step in plants
and worms. Likewise, spreading has not been observed in mammals or flies.
9
MicroRNAs
Discovery of miRNAs
The first microRNA was discovered when the lin-4 gene was cloned and found to
encode not a protein but a 21-nt RNA (Lee et al. 1993; Wightman et al. 1993). Lin-4
mutants have defects in the heterochronic pathway, which is required for proper larval
developmental timing (Horvitz and Sulston 1980; Chalfie et al. 1981; Ambros and
Horvitz 1984). Genetically, lin-4 was known to interact negatively with the 3'
untranslated region (UTR) of the gene encoding lin-14, and sequencing of lin-14's 3'
UTR revealed multiple sites complementary to lin-4 (Wightman et al. 1991; Lee et al.
1993; Wightman et al. 1993). It was suggested that the lin-4 short RNA directly
regulated gene expression through basepairing interactions with its target messenger
RNA (Figure 1). Another gene within the heterochronic pathway, let-7, was cloned and
found to encode another microRNA (Reinhart et al. 2000). This gene is conserved from
worms to humans (Pasquinelli et al. 2000). One of let-7's target mRNAs was discovered
by forward genetics to be lin-41, an RBCC protein also involved in the heterochronic
pathway (Slack et al. 2000).
miRNA genomics
After the discovery of siRNAs, several labs cloned RNAs approximately 21
nucleotides in length from a variety of sources to begin to define the function of
endogenous short RNAs (Lagos-Quintana et al. 2001; Lau et al. 2001; Lee and Ambros
2001). MicroRNAs are defined to be short RNAs which originate from hairpin
10
precursors in the genome, have 5' phosphate and 3' hydroxyl ends, and are Dicer
products. Computational programs were also developed using validated miRNA
structures to identify new candidate miRNA genes and to estimate the total number of
miRNAs in genomes (Lim et al. 2003a; Lim et al. 2003b). These programs scan a
genome for 60-70 nt regions that can be folded into a hairpin RNA computationally and
are conserved in closely related species. Using a combination of these biochemical,
genetic, and computational approaches, 116 miRNAs have been identified in C. elegans,
78 in Drosophila, 222 in humans, 224 in mouse and 112 in Arabidopsis (miRNA registry
release 5.2 (Griffiths-Jones 2004)). However, some newer approaches give a higher
estimate. For example, phylogenetic shadowing among primate genomes has estimated
the total number of human microRNAs to be as high as 1000 (Berezikov et al. 2005).
MicroRNAs within the same organism can be clustered into families with
identical sequences at positions 1-8 numbered from the 5' end, referred to as the "seed."
The 5' region of the microRNA is the most critical for its function (discussed below), so
members of the same family probably regulate overlapping sets of genes. For example,
there are 9 miRNAs in vertebrates that have an identical seed sequence with the prototype
let-7 miRNA.
Biogenesis
MicroRNA genes are located within intergenic regions or within the introns of
annotated genes, and are found individually or within clusters containing other
microRNAs. They are derived from larger transcription units (> 0.5 kb) termed primrnicroRNAs(Lee et al. 2002). Many pri-microRNAs are capped and polyadenylated,
11
giving further indication that most pri-microRNAs are transcribed by RNA polymerase
11,although there is strong evidence that some miRNAs are processed from pri-miRNAs
transcribed by RNA polymerase III (Lee et al. 2004a; Pfeffer et al. 2005).
Within the nucleus, the Microprocessor complex processes the pri-microRNA into
a 60-70 nt hairpin pre-microRNA with a 2 nt 3' overhang (Lee et al. 2002) through the
activity of the RNase III enzyme Drosha (Lee et al. 2003). Drosha prefers a loop of 10
nucleotides and then cleaves 21 nucleotides along a duplex stem in a largely duplex
region (Zeng et al. 2005). Another member of Microprocessor has been identified as the
DeGeorge critical region 8 gene, DGCR8/Pasha, a dsRNA binding protein (Denli et al.
2004; Gregory et al. 2004; Han et al. 2004; Landthaler et al. 2004). Processing can occur
on a spliced substrate, and the pre-microRNA is ultimately exported to the cytoplasm by
RanGTP and Exportin-5 (Yi et al. 2003; Kim 2004; Lund et al. 2004).
Within the cytoplasm, Dicer recognizes the 2 nt 3' overhang produced by Drosha
and cleaves the pre-microRNA on both strands near the base of the loop to create a
duplex with 2 nt 3' overhangs at both ends. One of these strands is assembled into RISC
as the mature miRNA whereas the other strand, the miRNA*, is typically degraded.
Strand selection follows the same principles of functional asymmetry as do exogenous
siRNAs, with the selected strand having weaker basepairing at the 5' end (Schwarz et al.
2003). As mentioned before, miRNAs in Drosophila are processed by a separate
pathway from siRNAs with a dedicated Dicer, Dcr-l, which does not process siRNAs
(Lee et al. 2004b). Mature miRNAs in humans are found associated with Argonaute
proteins 1-4, and RNA helicases Gemin 3 and 4 (Mourelatos et al. 2002; Meister et al.
2004). In Drosophila, microRNAs also associate with Vasa-Intronic-gene
12
(VIG), a gene
of unknown function, and Tudor SN, a micrococcal nuclease homolog (Caudy et al.
2002; Caudy et al. 2003). MicroRNAs associate with RISC and have RISC activity, but
the complex responsible for translational repression (which may be RISC itself) is
unknown.
A particularly intriguing miRNA-associated protein is the Fragile X Mental
Retardation protein (FMRP) (Caudy et al. 2002; Ishizuka et al. 2002). FMRP, an RNA
binding protein with some sequence specificity, is known to associate with
polyribosomes, and the mental retardation associated with loss of this protein's activity in
humans is consistent with its role in regulating translation of particular mRNAs at
neuronal synapses (Darnell et al. 2001; Antar and Bassell 2003; Veneri et al. 2004).
Interestingly, the activity of FMRP in translational repression is dependent upon
phosphorylation (Ceman et al. 2003). Analysis of RNAi in vitro has shown that FMRP is
not required for mRNA cleavage activity, and knockdown of FMRP has only a small
effect on RNAi activity in cell culture, but FMRP associates with RISC and miRNAs
(Caudy et al. 2002; Ishizuka et al. 2002). It has been hypothesized that FMRP helps
provide specificity for localization of RISC or RISC-like complexes to specific mRNAs
for other activities, such as translational repression.
Specificity of miRNA/mRNA interactions
The 5' region of microRNAs is more conserved than the 3' region. Additionally,
experiments of microRNA-mediated
silencing in mammals, fish and flies have shown
that complementarity to messenger RNA within positions 1-8 of microRNA are the most
crucial for regulation (Doench and Sharp 2004; Kloosterman et al. 2004; Brennecke et al.
13
2005). Extensive 3' complementarity can enhance silencing by a microRNA if the
stability of a pairing in the 5' region is weak. Additionally, there is a statistical
enrichment within mammalian 3' UTRs for conserved 8 nucleotide sequences
complementary to the seed region of microRNAs. The consensus sequence for the
interaction of a microRNA and mRNA is perfect complementarity at positions 2-7 with
no preferred sequence, flanked by basepaired nucleotides at position 8, and neighbored
by an unpaired A at position 1 and to a lesser extent 9 (Lewis et al. 2005). The
mechanistic basis for this consensus structure has not yet been determined.
MicroRNA targets
Although the number of identified microRNAs is large, there are still few
examples of microRNA targets that have been experimentally confirmed. Strong
evidence of a particular mRNA/microRNA interaction can be obtained through genetic
experiments, where a phenotype due to loss of function in the microRNA can be
suppressed by loss of the target gene. Genetic evidence exists showing the interaction
between microRNA lin-4 and mRNA lin-14, lin-4 and lin-28, let-7 and lin-41, let-7 and
hbl-1, sy-6 and cog-1 in worms and between bantam and hid in flies (Lee et al. 1993;
Slack et al. 2000; Brennecke et al. 2003; Chang et al. 2004). Computational studies have
been used to predict microRNA targets in organisms (Rhoades et al. 2002; Enright et al.
2003; Lewis et al. 2003; John et al. 2004; Jones-Rhoades and Bartel 2004; Kiriakidou et
al. 2004; Lai 2004; Rajewsky and Socci 2004; Rehmsmeier et al. 2004). These
approaches have yielded consistent and successful results in plants, where there are many
target mRNA sequences that are highly homologous to the microRNA, and 5' RACE has
14
been used to validate the expected precise 5' mRNA cleavage product at positions 10 and
11 within the microRNA binding site (Llave et al. 2002). Unlike most animal miRNAs,
murine miR- 196 contains extensive complementarity to its target mRNA, HOXB8, and
regulates it by mRNA cleavage (Mansfield et al. 2004; Yekta et al. 2004).
Most animal microRNAs have fewer near-perfect complementary sequences
within mRNAs, and instead regulate gene expression through multiple partially
complementary interactions within the 3' UTR of genes. Multiple mammalian genome
alignments indicate that 30% of mammalian 3' UTRs contain conserved potential binding
sites to microRNAs. This assigns a vast regulatory function for this class of genes (Lewis
et al. 2005). A similarly large number of mRNAs are targets for miRNA regulation as
indicated by microarray analysis of downregulated mRNAs after the overexpression of a
microRNA in a mammalian cell line (Lim et al. 2005). Some other predictions have been
validated by heterologous reporter assays in mammalian cells, but most predictions await
in vivo verification (Lewis et al. 2003; Lewis et al. 2005).
Range of biology
Genetically-defined
microRNAs control a range of biological processes:
developmental timing, apoptosis, neural asymmetry, cell division and viral replication.
Overexpression studies suggest that miR-181 regulates hematopoetic differentiation in
mice (Chen et al. 2004). In Drosophila, miR-14 regulates fat metabolism and apoptosis
and the bantam miRNA regulates apoptosis and cell division (Brennecke et al. 2003; Xu
et al. 2003). As mentioned before, in worms, developmental timing is regulated by lin-4
and let-7, and left/right asymmetry of chemoreceptor expression is regulated by sy-6
15
(Ambros and Horvitz 1984; Chang et al. 2004). Zebrafish mir-430 controls brain
morphogenesis (Giraldez et al. 2005). In humans, miR-143 inhibits adipocyte
differentiation (Esau et al. 2004) and miR-375 inhibits insulin production in pancreatic
islet cells by interactions with Myotrophin mRNA (Poy et al. 2004). Interestingly,
mammalian miR-32 can target the RNA genome of the primary foamy virus type 1
retrovirus (PVF-1) and limits the replication of this virus in cell culture, indicating that
miRNAs may target exogenous RNAs as well as endogenous mRNAs (Lecellier et al.
2005). Conversely, the liver-specific miR-122 interacts with the 5' region of the
Hepatitis C Virus genome to allow replication of that genome (Jopling et al. 2005).
Many microRNAs show tissue-specific expression patterns, and are likely to be involved
in cell-type specific regulation.
MicroRNAs have also been assigned functions in previously known forms of
mRNA regulation. For example, silencing by 3' UTR AU-rich elements (AREs) within
the 3' UTR of tumor necrosis factor-a (TNF-a) mRNA is dependent upon Agol, Ago2
and Dicer-1 in Drosophila. This silencing also requires miR-16, which is complementary
to TNF-ct ARE sequences (Jing et al. 2005). These results suggest that microRNAs may
direct gene regulation through other AREs as well. MicroRNAs may also be involved in
regulation of mRNA localization. For example, the dsRNA binding protein Staufen is
required for proper localization and translation of mRNAs in Drosophila embryos and
mammalian neurons (Li et al. 1997; Kiebler et al. 1999). Interestingly, Staufen-
dependent localization of oskar mRNA in Drosophila embryos also requires splicing of
oskar mRNA (Hachet and Ephrussi 2004). Although Staufen has not been assigned a
role in microRNA-mediated
silencing, it interacts with FMRP and has recently been
16
shown to direct an mRNA surveillance response dependent on the nonsense-mediated
decay protein Upfl1, but independent of Upf2 and Upf3 (Ohashi et al. 2002; Kim et al.
2005). Possibly, microRNAs are involved in many processes involving proper
localization or quality-control of mRNAs.
MicroRNAs comprise upwards of 4% of mammalian genes yet are predicted to
regulate 30% of protein-coding mRNAs. This prediction has been supported for two
microRNAs by array analysis of the decreases in mRNA levels following transfection of
siRNAs corresponding to two tissue specific microRNAs (Lim et al. 2005). Each
microRNA downregulated the mRNA levels of about 100 genes. The microRNAs
studied in this series were cell type specific for expression in muscle (miR-1) and brain
(miR-124), and they preferentially targeted genes that are not highly expressed in the cell
types where the microRNA is expressed. These observations might suggest that
microRNAs generally function as "micro-managers" to shape cell type specific gene
expression (Bartel 2004). However, further examination of predicted microRNA targets
will be necessary to show whether only a subset of potential targets are substantially
regulated at the protein level.
mRNA degradation by miRNAs and P-body localization
Recent experiments investigating the relationship between the mRNA decay
pathway and RNA silencing support the notion that microRNAs cause a variable degree
of mRNA degradation of their targets. The major mRNA degradation pathway in yeast
involves deadenylation by Ccr4 and Patl exonucleases, recruitment of Sm proteins
Lsml-7 and decapping enzymes Dcpl and Dcp2, and finally, 5' exonucleolytic
degradation initiated by Xrnl (Muhlrad et al. 1994; Tharun and Parker 2001; Tucker et
17
al. 2001; Coller and Parker 2004). 3' exonucleolytic degradation also occurs on the
deadenylated mRNA and is catalyzed by a complex of at least 10 exonucleases termed
the exosome (Anderson and Parker 1998; Allmang et al. 1999). Most of these
components localize to cytoplasmic foci termed P-bodies or GW-bodies in eukaryotic
cells (Ingelfinger et al. 2002; Eystathioy et al. 2003; Sheth and Parker 2003; Cougot et al.
2004; Kshirsagar and Parker 2004). Moreover, experiments have been performed to
suggest that P-bodies are the site of degradation activities and not a storage compartment
for inactive populations of the degradation machinery. First, mRNA degradation
intermediates stabilized by loss of function mutations in Xrnl or Dcpl localize to Pbodies (Sheth and Parker 2003; Cougot et al. 2004). Additionally, inhibition of
translation elongation with cycloheximide leads to mRNA stabilization and the
disappearance of P bodies (Sheth and Parker 2003; Cougot et al. 2004).
RNAi proteins and small RNAs have also been observed to localize near or within
P-bodies. Mammalian Argonaute 1 and Argonaute 2 have been shown to localize within
P bodies (Liu et al. 2005; Pillai et al. 2005; Sen and Blau 2005). Additionally,
transfected reporter mRNAs undergoing RNAi silencing with a perfectly complementary
siRNA or translational silencing with partially complementary siRNA or miRNA show
localization to P-bodies that also stain positive for Lsml (Liu et al. 2005). Interestingly,
miRNAs expressed by nuclear injection of precursors show localization near but not
within P-bodies (Pillai et al. 2005). It is not clear whether localization to P-bodies is a
cause or a consequence of silencing by short RNA. RNAi requires endonucleolytic
cleavage by Ago2, and also requires involves the activities of Xrn 1 to degrade the 3'
cleavage fragment and the Rrp4, Csl4, and Ski2 components of the exosome to degrade
18
the 5' fragment, suggesting that exonucleolytic degradation occurs subsequent to
endonucleolytic cleavage (Orban and Izaurralde 2005). However, it is still not clear
whether the majority of Argonaute 2 activity is present within the P-bodies or elsewhere
in the cell before subsequent P-body localization and repression. To this end, the extent
of P-body localization of a silenced reporter has not been quantitated and it has not been
shown whether core P-body components are required for silencing by RNAi.
Similarly, microRNAs and their target mRNAs have been observed to concentrate
at P-bodies, which is consistent with accounts of mRNA degradation occurring during
microRNA-mediated
silencing (Liu et al. 2005; Pillai et al. 2005). The extent of this
mRNA degradative effect appears variable. For example, in studies of repression of lin14 by lin-4 miRNA, ribonuclease protection assays (RPAs) showed that repression
coincided with a 2-fold mRNA decrease and a 15-fold protein decrease (Olsen and
Ambros 1999). However, another study used Northern analysis to quantitate an mRNA
loss of 5-fold for repressed lin-14 mRNA and noted the presence of mRNA cleavage
products during the repression (Bagga et al. 2005). It is not yet clear whether
translational repression by microRNAs preceeds P-body localization, whether
translational repression is a result of P-body localization, or whether partial P-body
localization occurs independently of translational repression. However, RNAi depletion
of GW- 184, a component of P-bodies, reduces the mRNA degradative effect of miRNAs
by 6-fold in Drosophila S2 cells, and likewise, depletion of Dcp-l and Dcp-2 reduces this
effect by 4-fold, supporting the notion that mRNA degradation by miRNAs in fact occurs
within P-bodies (Rehwinkel et al. 2005). A possible explanation for all of the data is that
microRNAs cause translational repression and subsequent P-body localization and
19
mRNA degradation.
Alternatively, mRNA degradation within P-bodies and translational
repression may be independent pathways controlled by miRNAs. Importantly, the extent
of P-body localization for an mRNA undergoing repression by small RNA has not yet
been accurately assessed. Further studies will be necessary to define the precise
relationship between translational repression, mRNA degradation and P-body localization
for microRNA-mediated silencing.
Pathways of translation-coupled RNA decay
Several distinct pathways have emerged in which mRNAs undergo quality control
dependent upon translation. Nonsense mediated decay (NMD) is a process in which
mRNAs possessing a premature termination codon located upstream of the last intron are
rapidly degraded (Neu-Yilik et al. 2004). Destabilization of an mRNA by NMD requires
its open reading frame to be translated and the pathway is present in yeast, worms, flies
and humans. In another translation-dependent proofreading pathway documented only in
S. cerevisiae,
mRNAs with no stop codon are downregulated by mechanism termed non-
stop mRNA decay (NSD) (Frischmeyer et al. 2002; van Hoof et al. 2002).
This process
requires ski7, an essential component of the exosome. Ski7p contains a GTPase domain
homologous to that found within EF1A and eRF3 (see discussion below), which are
known to interact with the A site of the ribosome during elongation and termination.
Interestingly, the GTPase domain of Ski7p is dispensable for exosome function but
required for NSD, raising the possibility that ribosomes which translate to the end of a
mRNA without encountering a stop codon end up with an empty A site which is
recognized by Ski7.
20
Two emerging translation-related RNA decay pathways are No-Go Decay (NGD)
and Nonfunctional rRNA Decay (NRD), both of which have been observed in S.
cerevisiae.
Strong stem loops positioned in the coding region of mRNAs are known to
inhibit translation elongation, and it recently has been observed that such mRNAs are
rapidly degraded independently of Dcp2p decapping enzyme or Ski7p component of the
exosome. Placement of an additional stem loop in the 5' UTR to inhibit translation
initiation restores the stability of the mRNA, suggesting that translation is required for the
mRNA degradation caused by the internal stem loop. Interestingly, the proteins Dom34p
and Hbslp, sequence and structural homologs of eRF1 and eRF3 respectively, are
required for this process, suggesting that these factors release poorly elongating
ribosomes and trigger decay of the mRNA (Meenakshi Kshirsagar and Dr. Roy Parker,
personal communication).
NRD is a process of quality control for functional ribosomal
RNA. It has been observed that small and large subunits of ribosomal RNA containing
point mutations expected to render them non-functional in translation are degraded posttranscriptionally. The process apparently does not inhibit processing of ribosomal RNA
subunits from their nuclear precursors, and does not impair the rRNA's assembly with
ribosomal proteins to form the 40S and 60S subunits. Therefore, the ability of rRNAs to
perform translation itself is proofread by the cell (Rederick LaRiviere and Dr. Melissa
Moore, personal communication).
Eukaryotic translation
Normal eukaryotic translation initiation occurs by a multi-step process
(Sonenberg and Dever 2003). First, elF4E binds directly to the 5' cap of the mRNA and
21
recruits eIF4G and elF4A to form the eIF4F complex. Next, the 40S small ribosomal
subunit, in association with methionine tRNA, elF2 and eIF3, binds the mRNA through
interactions between eIF3 with eIF4E and eIF4G. The interaction between eIF4E and
eIF4G is stabilized by poly-A binding protein PABP, which makes interactions with
eIF4G and accounts for the synergy observed between cap and polyA tail in translation.
After binding messenger RNA, the complex scans across the 5' UTR of the mRNA in an
eIF4A-dependent manner until encountering the first AUG. In a final step, the 60S
subunit of the ribosome is recruited after GTP hydrolysis by eIF2 and subsequent
dissociation of eIF2 and 3, and the elongation steps of translation commence. In
translational elongation, two factors promote association of amino acyl-tRNA with the
ribosome, EF1A and EF1B, whereas one factor, EF2, catalyzes translocation (Browne
and Proud 2002).
EF1A (functionally equivalent to bacterial EF-Tu) binds GTP, and is
responsible for bringing amino acyl-tRNA to the ribosomal A site. Once the amino acyltRNA is properly positioned in the A site, GTP hydrolysis occurs and EF1A is released
from the ribosome. The EF-Ts homolog EF1B promotes GDP/GTP exchange on EF1A,
recycling it for further use. Removal of EF1A promotes the peptidyl transferase reaction
catalyzed by the large subunit of the ribosome. eEF2 then catalyzes translocation of the
peptidyl-tRNA from the A site to the P site of the ribosome, and deacylated tRNA from
the P site to the E site, and another round of elongation begins. Translation termination
requires two proteins, eRF1 and eRF3 (Kisselev et al. 2003).
eRFI recognizes the stop
codon while binding within the A site of the ribosome and stimulates hydrolysis of the
peptidyl-tRNA bond. eRF3 stimulates eRF1 activity through an unknown mechanism
dependent upon hydrolysis of GTP by its GTPase domain.
22
Interestingly, eRF3 has been implicated in diverse processes. In yeast, the Nterminal domain of eRF3 has prion properties and causes the PSI+I infected state (Doel
et al. 1994). Because eRF3 is sequestered in the PSI+J state, normal termination
becomes inefficient, promoting readthrough of normal stop codons and enhanced
variation due to the addition of C-terminal extensions to many proteins (Wilson et al.
2005). ERF3 is also required for the mitotic G 1/S transition in S. cerevisiae (Kikuchi et
al. 1988). In humans, there are two paralogs of eRF3, eRF3a/GSPT1 and eRF3b/GSPT2.
eRF3a is expressed ubiquitously whereas eRF3b is expressed in proliferating cells and
neurons, although they can functionally complement each other's translation termination
activity (Chauvin et al. 2005). N-terminal polyglycine expansions in eRF3a/GSPT 1 are
associated with gastric cancer and eRF3 is frequently overexpressed in intestinal type
carcinomas (Brito et al. 2005; Malta-Vacas et al. 2005). eRF3a is inhibited by RNaseL,
the RNase activated by long double-stranded RNA in the PKR response (Le Roy et al.
2005). The N-terminal domain of eRF3 is not required for translation termination and
interacts with poly(A) binding protein (PABP), and this interaction is required for
deadenylation-mediated mRNA decay (Hosoda et al. 2003). Interestingly, tethering of
PABP or eRF3 but not eRFl can stabilize a mRNA undergoing nonsense-mediated decay
in yeast. (Amrani et al. 2004).
Translational Repression by 3' UTRs
3' UTRs contain a plethora of sites to control translation. Broadly, translational
control by 3' UTRs can be divided into four types of mechanisms: regulation of polyA
tail length, inhibition of ribosomal small subunit recruitment by impairment of
23
preinitiation complex formation, inhibition of large ribosomal subunit recruitment, and
inhibition after initiation. Deadenylation of mRNA generally decreases its translational
capacity. The best characterized 3' UTR regulatory sequence governing polyadenylation
is the CPE (cytoplasmic polyadenylation element) recognized by CPEB protein. Several
mRNAs involved in cell cycle regulation in Xenopus (mitotic cyclins, cdk2, wee 1 and
Aurora A) contain CPE elements and are translationally activated during oocyte
maturation (Mendez and Richter 2001). Within the oocyte, progesterone activates the
kinase Aurora A/Eg2 to phosphorylate CPEB on serine 174, which then recruits
cytoplasmic polyadenylation specificity factor (CPSF) and thereby poly(A) polymerase
(PAP) (Hake and Richter 1994; Mendez et al. 2000a; Mendez et al. 2000b). Subsequent
polyadenylation results in translational activation. However, germ cells may represent a
unique compartment for this type of regulation because deadenylation within most
somatic cells causes rapid mRNA decay, as discussed above.
Another class of translational repression mechanisms involves inhibition of
ribosomal small subunit association with mRNA by the disruption of eIF4E interactions
with eIF4G. Several proteins binding to the 3' UTR of mRNAs are known to prevent
eIF4E interactions with eIF4G and thereby inhibit initiation. For example, Drosophila
caudal mRNA is repressed by Bicoid protein binding to Bicoid-binding region elements
(BBR) within the 3' UTR of caudal mRNA. Bicoid contains an eIF4E binding motif that
is necessary for association with eIF4E and translational repression. More typically in
this type of regulation of translation initiation, a 3' UTR binding protein recruits an
intermediate protein that makes direct contacts with eIF4E. For example, in addition to
directing transcript-specific polyadenylation, CPEB also represses translation of cyclin
24
B1 mRNA by recruiting the Maskin protein, which in turn binds eIF4E and thereby
excludes elF4G binding (Stebbins-Boaz et al. 1999; Cao and Richter 2002). Likewise,
translational repression elements within the 3' UTR of Drosophila oskar- mRNA bind the
protein Bruno, which in turn recruits Cup, a competitor for eIF4E binding to eIF4G
(Wilhelm et al. 2003; Nakamura et al. 2004). Similarly, nanos mRNA is repressed by 3'
UTR sequences which bind the protein Smaug, which in turn recruit Cup to inhibit eIF4G
binding to eIF4E (Ostareck-Lederer et al. 1994; Ostareck-Lederer and Ostareck 2004).
3' UTRs are also capable of inhibiting translational initiation at the step of large
subunit recruitment.
15-lipoxygenase protein degrades the mitochondrial membranes
during the final stage of erythrocyte development and its mRNA is translationally
regulated by ten 19-nt differentiation control elements (DICE) within its 3' UTR
(Ostareck-Lederer et al. 1994; Ostareck-Lederer and Ostareck 2004). These elements
bind hnRNP K and hnRNP E1 which block 60S subunit joining through an unknown
mechanism (Ostareck et al. 2001; Ostareck-Lederer et al. 2002).
Finally, post-initiation steps of translation can be inhibited by 3' UTRs. Although
both oskar and nanos mRNAs contain regulatory elements that recruit primary and
secondary proteins which inhibit eIF4E association with eIF4G, both mRNAs are
localized to polysomes during translational repression (Clark et al. 2000; Braat et al.
2004). Treatment of either of these repressed mRNAs with puromycin releases the
mRNAs from polyribosomes into the monosome and free RNP fractions of sucrose
gradients (Clark et al. 2000; Braat et al. 2004). Because puromycin mimics peptidyl
tRNA and is added to the growing polypeptide chain to cause ribosome release,
ribosomes associated with these mRNAs are likely to be unimpaired in their ability to
25
complete the elongation cycle (Blobel and Sabatini 1971). Accordingly, ribosomes have
been observed to dissociate from the repressed mRNA in cell extracts recapitulating
nanos repression upon inhibition of translation initiation with the drug pactamycin (Clark
et al. 2000). No studies of these systems have distinguished between models of ribosome
drop-off or destabilization of the nascent polypeptide chain. However, the nascent
polypeptide associated complex (NAC) is required for translational repression of oskar
mRNA, but this protein could be acting to facilitate either type of repression (Braat et al.
2004).
Interestingly, the helicase Armitage, which is required for RNA interference in
Drosophila, is also required for oskar repression translational repression, indicating that
microRNAs might contribute to oskar regulation (Cook et al. 2004; Tomari et al. 2004a).
Mechanism of miRNA translational repression
MicroRNA regulation also seems to occur at two different separate steps in
translation. The lin-4 microRNA regulates lin-14 and lin-28 after translation initiation in
C. elegans because repressed lin-14 or lin-28 mRNAs associate with polyribosomes
(Olsen and Ambros 1999; Seggerson et al. 2002). However, a reporter mRNA
synthesized in vitro and transfected into Hela cells is repressed by let-7 in a cap-
dependent manner, and an IRES-containing construct cannot be repressed, arguing for
repression at a stage early in initiation (Pillai et al. 2005). The reporter mRNA in this case
did not associate with polyribosomes, another possible indication of a block to initiation.
However, we provide evidence that a reporter of translational silencing by short RNAs in
mammalian cells is repressed after translation initiation through a process that involves
ribosome drop-off (see Ch. 3). Because both oskar and nanos mRNAs are capable of
26
being regulated by their 3' UTRs at the level of initiation and also after initiation (see
above), it may be that different mechanisms of repression occur in different
developmental contexts or that regulation of two stages of translation simultaneously
allows for tight control of gene expression. Indeed, evidence is accumulating that
multiple steps of translation can be repressed on the same mRNA. For example, the 3'
UTR of Drosophila male specific lethal-2 (msl-2) mRNA inhibits recruitment of small
subunit preinitiation complexes to the mRNA and the 5' UTR inhibits scanning by the
subunits which have escaped this block (Beckmann et al. 2005). Additionally, Fragile X
protein FMRP (see above) has been shown to be capable of regulating translational
initiation by inhibiting 80S complex formation in vitro, but in vivo is associated with
polyribosomes and represses translational elongation on some of its targets (Ceman et al.
2003; Khandjian et al. 2004). On the other hand, the critical experiments performed to
date in support of the initiation model for microRNA repression-experiments
in which
uncapped IRES-containing mRNAs cannot be translationally repressed-have not been
rigorously shown to be a translational phenomenon and may not capture the full extent of
regulation which occurs for an mRNA which is transcribed within the nucleus, processed
and exported.
The genetic requirements for translational repression are also not fully known.
Although mammalian Argonaute 2 is required for RISC cleavage of mRNA, it is
dispensable for translational repression (Liu et al. 2004). However, either Argonaute 2, 3
or 4 can cause a repression of translation when tethered to the 3' UTR of a reporter
mRNA in the absence of short RNA (Pillai et al. 2004). This observation suggests that
perhaps all mammalian Argonaute genes can function redundantly to repress translation
27
and these activities are typically targeted to specific mRNAs through interaction with
microRNAs.
28
pri-miRNA
] IHlimill lllIIIIIIIIlllIT lIilll IIIIIII d s RN A
I
t
Dicer, R2D2
Drosha,DGCR8
Exportin 5
1111111111110
siRNA
~
G
11111111111111
Dicer
]
~
Rise
miRNP
miRNA
Cap.
Cap
t-Ir-1t_ft
I.'
Stop
."',
.
miRNA Pathway
siRNA Pathway
mRNA degradation
translational
repression
Figure I. mRNA cleavage and translational repression by short RNAs. On the left, exogenous or
endogenous dsRNA is processed by Dicer to yield an siRNA with a 19 nt duplex, 2 nt 3'
overhangs, and 5' phosphates. Dicer and R2D21oad one strand into the RNA-Induced Silencing
Complex (RISC) based on the asymmetry of thermodynamic stability at each end of the duplex,
while the other strand is rapidly degraded after duplex unwinding. On the right, pri-miRNAs are
transcribed from microRNA genes in the nucleus and the RNase III enzyme Drosha acts with
DGCR8 to processes these into 60-70 nt hairpin pre-miRNAs with a 2 nt 3' overhang which are
then exported into the cytoplasm by Exportin-5 and RanGDP. The pre-miRNA is processed to a
transient siRNA-like duplex by Dicer, and one strand is chosen for assembly into the miRNP
while the other is rapidly degraded. The miRNP, which contains an Argonaute protein, binds
multiple sequences in target gene 3' UTRs with partial complementarity and silences translation
at a step after initiation without significantly degrading the mRNA. MiRNAs can perform target
mRNA cleavage, and siRNAs can mediate translational repression.
29
References
Allmang, C., E. Petfalski, A. Podtelejnikov, M. Mann, D. Tollervey, and P. Mitchell.
1999. The yeast exosome and human PM-Scl are related complexes of 3' --> 5'
exonucleases. Genes Dev 13: 2148-2158.
Ambros, V. and H.R. Horvitz. 1984. Heterochronic mutants of the nematode
Caenorhabditis elegans. Science 226: 409-416.
Amrani, N., R. Ganesan, S. Kervestin, D.A. Mangus, S. Ghosh, and A. Jacobson. 2004. A
faux 3'-UTR promotes aberrant termination and triggers nonsense-mediated
mRNA decay. Nature 432: 112-118.
Anderson, J.S. and R.P. Parker. 1998. The 3' to 5' degradation of yeast mRNAs is a
general mechanism for mRNA turnover that requires the SKI2 DEVH box protein
and 3' to 5' exonucleases of the exosome complex. Embo J 17: 1497-1506.
Antar, L.N. and G.J. Bassell. 2003. Sunrise at the synapse: the FMRP mRNP shaping the
synaptic interface. Neuron 37: 555-558.
Bagga, S., J. Bracht, S. Hunter, K. Massirer, J. Holtz, R. Eachus, and A.E. Pasquinelli.
2005. Regulation by let-7 and lin-4 miRNAs Results in Target mRNA
Degradation. Cell 122: 553-563.
Bartel, D.P. 2004. MicroRNAs: genomics, biogenesis, mechanism, and function. Cell
116: 281-297.
Beckmann, K., M. Grskovic, F. Gebauer, and M.W. Hentze. 2005. A dual inhibitory
mechanism restricts msl-2 mRNA translation for dosage compensation in
Drosophila. Cell 122: 529-540.
Berezikov, E., V. Guryev, J. van de Belt, E. Wienholds, R.H. Plasterk, and E. Cuppen.
2005. Phylogenetic shadowing and computational identification of human
microRNA genes. Cell 120: 21-24.
Bernstein, E., A.A. Caudy, S.M. Hammond, and G.J. Hannon. 2001. Role for a bidentate
ribonuclease in the initiation step of RNA interference. Nature 409: 363-366.
Blobel, G. and D. Sabatini. 1971. Dissociation of mammalian polyribosomes into
subunits by puromycin. Proc Natl Acad Sci U S A 68: 390-394.
Braat, A.K., N. Yan, E. Amrn,D. Harrison, and P.M. Macdonald. 2004. Localization-
dependent oskar protein accumulation; control after the initiation of translation.
Dev Cell 7:125-131.
30
Brennecke, J.., D.R. Hipfner, A. Stark, R.B. Russell, and S.M. Cohen. 2003. bantam
encodes a developmentally regulated microRNA that controls cell proliferation
and regulates the proapoptotic gene hid in Drosophila. Cell 113: 25-36.
Brennecke, J., A. Stark, R.B. Russell, and S.M. Cohen. 2005. Principles of MicroRNA-
Target Recognition. PLoS Biol 3: e85.
Brito, M., J. Malta-Vacas, B. Carmona, C. Aires, P. Costa, A.P. Martins, S. Ramos, A.R.
Conde, and C. Monteiro. 2005. Polyglycine expansions in eRF3/GSPT 1 are
associated with gastric cancer susceptibility. Carcinogenesis.
Browne, G.J. and C.G. Proud. 2002. Regulation of peptide-chain elongation in
mammalian cells. Eur J Biochem 269: 5360-5368.
Cao, Q. and J.D. Richter. 2002. Dissolution of the maskin-eIF4E complex by cytoplasmic
polyadenylation and poly(A)-binding protein controls cyclin B mRNA
translation and oocyte maturation. Embo J 21: 3852-3862.
Carmell, M.A., Z. Xuan, M.Q. Zhang, and G.J. Hannon. 2002. The Argonaute family:
tentacles that reach into RNAi, developmental control, stem cell maintenance, and
tumorigenesis. Genes Dev 16: 2733-2742.
Caudy, A.A., R.F. Ketting, S.M. Hammond, A.M. Denli, A.M. Bathoorn, B.B. Tops, J.M.
Silva, M.M. Myers, G.J. Hannon, and R.H. Plasterk. 2003. A micrococcal
nuclease homologue in RNAi effector complexes. Nature 425: 411-414.
Caudy, A.A., M. Myers, G.J. Hannon, and S.M. Hammond. 2002. Fragile X-related
protein and VIG associate with the RNA interference machinery. Genes Dev 16:
2491-2496.
Ceman, S., W.T. O'Donnell, M. Reed, S. Patton, J. Pohl, and S.T. Warren. 2003.
Phosphorylation influences the translation state of FMRP-associated
polyribosomes. Hum Mol Genet 12: 3295-3305.
Chalfie, M., H.R. Horvitz, and J.E. Sulston. 1981. Mutations that lead to reiterations in
the cell lineages of C. elegans. Cell 24: 59-69.
Chang, S., R.J. Johnston, Jr., C. Frokjaer-Jensen, S. Lockery, and O. Hobert. 2004.
MicroRNAs act sequentially and asymmetrically to control chemosensory
laterality in the nematode. Nature 430: 785-789.
Chauvin, C., S. Salhi, C. Le Goff, W. Viranaicken, D. Diop, and O. Jean-Jean. 2005.
Involvement of human release factors eRF3a and eRF3b in translation termination
and regulation of the termination complex formation. Mol Cell Biol 25: 58015811.
31
Chen, C.Z., L. Li, H.F. Lodish, and D.P. Bartel. 2004. MicroRNAs modulate
hematopoietic lineage differentiation. Science 303: 83-86.
Clark, I.E., D. Wyckoff, and E.R. Gavis. 2000. Synthesis of the posterior determinant
Nanos is spatially restricted by a novel cotranslational regulatory mechanism.
Curr Biol 10: 1311-1314.
Cogoni, C. and G. Macino. 1999. Gene silencing in Neurospora crassa requires a protein
homologous to RNA-dependent RNA polymerase. Nature 399: 166-169.
Coller, J. and R. Parker. 2004. Eukaryotic mRNA decapping. Annu Rev Biochem 73: 861890.
Cook, H.A., B.S. Koppetsch, J. Wu, and W.E. Theurkauf. 2004. The Drosophila SDE3
homolog armitage is required for oskar mRNA silencing and embryonic axis
specification. Cell 116: 817-829.
Cougot, N., S. Babajko, and B. Seraphin. 2004. Cytoplasmic foci are sites of mRNA
decay in human cells. J Cell Biol 165: 31-40.
Dalmay, T., A. Hamilton, S. Rudd, S. Angell, and D.C. Baulcombe. 2000. An RNA-
dependent RNA polymerase gene in Arabidopsis is required for
posttranscriptional gene silencing mediated by a transgene but not by a virus. Cell
101: 543-553.
Darnell, J.C., K.B. Jensen, P. Jin, V. Brown, S.T. Warren, and R.B. Darnell. 2001.
Fragile X mental retardation protein targets G quartet mRNAs important for
neuronal function. Cell 107: 489-499.
Denli, A.M., B.B. Tops, R.H. Plasterk, R.F. Ketting, and G.J. Hannon. 2004. Processing
of primary microRNAs by the Microprocessor complex. Nature 432: 231-235.
Doel, S. M., McCready, S. J., Nierras, C. R., and Cox, B. S. (1994). The dominant
PNM2- mutation which eliminates the psi factor of Saccharomyces cerevisiae is
the result of a missense mutation in the SUP35 gene. Genetics 137, 659-670.
Doench, J.G. and P.A. Sharp. 2004. Specificity of microRNA target selection in
translational repression. Genes Dev 18: 504-511.
Elbashir, S.M., W. Lendeckel, and T. Tuschl. 2001a. RNA interference is mediated by
21- and 22-nucleotide RNAs. Genes Dev 15: 188-200.
Elbashir, S.M., J. Martinez, A. Patkaniowska, W. Lendeckel, and T. Tuschl. 2001b.
Functional anatomy of siRNAs for mediating efficient RNAi in Drosophila
melanogaster embryo lysate. Embo J 20: 6877-6888.
32
Enright, A.J., B. John, U. Gaul, T. Tuschl, C. Sander, and D.S. Marks. 2003. MicroRNA
targets in Drosophila. Genome Biol 5: R1.
Esau, C., X. Kang, E. Peralta, E. Hanson, E.G. Marcusson, L.V. Ravichandran, Y. Sun, S.
Koo, R.J. Perera, R. Jain, N.M. Dean, S.M. Freier, C.F. Bennett, B. Lollo, and R.
Griffey. 2004. MicroRNA-143 regulates adipocyte differentiation. JBiol Chem.
Eystathioy, T., A. Jakymiw, E.K. Chan, B. Seraphin, N. Cougot, and M.J. Fritzler. 2003.
The GW182 protein colocalizes with mRNA degradation associated proteins
hDcpl and hLSm4 in cytoplasmic GW bodies. Rna 9:1171-1173.
Fagard, M. and H. Vaucheret. 2000. Systemic silencing signal(s). Plant Mol Biol 43: 285293.
Fire, A., S. Xu, M.K. Montgomery, S.A. Kostas, S.E. Driver, and C.C. Mello. 1998.
Potent and specific genetic interference by double-stranded RNA in
Caenorhabditis elegans. Nature 391: 806-811.
Frischmeyer, P.A., A. van Hoof, K. O'Donnell, A.L. Guerrerio, R. Parker, and H.C.
Dietz. 2002. An mRNA surveillance mechanism that eliminates transcripts
lacking termination codons. Science 295: 2258-2261.
Giraldez, A.J., R.M. Cinalli, M.E. Glasner, A.J. Enright, M.J. Thomson, S. Baskerville,
S.M. Hammond, D.P. Bartel, and A.F. Schier. 2005. MicroRNAs Regulate Brain
Morphogenesis in Zebrafish. Science.
Gregory, R.I., K.P. Yan, G. Amuthan, T. Chendrimada, B. Doratotaj, N. Cooch, and R.
Shiekhattar. 2004. The Microprocessor complex mediates the genesis of
microRNAs. Nature 432: 235-240.
Griffiths-Jones, S. 2004. The microRNA Registry. Nucleic Acids Res 32: D109-111.
Grishok, A., A.E. Pasquinelli, D. Conte, N. Li, S. Parrish, I. Ha, D.L. Baillie, A. Fire, G.
Ruvkun, and C.C. Mello. 2001. Genes and mechanisms related to RNA
interference regulate expression of the small temporal RNAs that control C.
elegans developmental timing. Cell 106: 23-34.
Hachet, O. and A. Ephrussi. 2004. Splicing of oskar RNA in the nucleus is coupled to its
cytoplasmic localization. Nature 428: 959-963.
Hake, L.E. and J.D. Richter. 1994. CPEB is a specificity factor that mediates cytoplasmic
polyadenylation during Xenopus oocyte maturation. Cell 79: 617-627.
Hamilton, A.J. and D.C. Baulcombe. 1999. A species of small antisense RNA in
posttranscriptional gene silencing in plants. Science 286: 950-952.
33
Hammond, S.M., E. Bernstein, D. Beach, and G.J. Hannon. 2000. An RNA-directed
nuclease mediates post-transcriptional gene silencing in Drosophila cells. Nature
404: 293-296.
Hammond, S.M., S. Boettcher, A.A. Caudy, R. Kobayashi, and G.J. Hannon. 2001.
Argonaute2, a link between genetic and biochemical analyses of RNAi. Science
293:1146-1150.
Han, J., Y. Lee, K.H. Yeom, Y.K. Kim, H. Jin, and V.N. Kim. 2004. The Drosha-DGCR8
complex in primary microRNA processing. Genes Dev 18: 3016-3027.
Horvitz, H.R. and J.E. Sulston. 1980. Isolation and genetic characterization of cell-
lineage mutants of the nematode Caenorhabditis elegans. Genetics 96: 435-454.
Hosoda, N., T. Kobayashi, N. Uchida, Y. Funakoshi, Y. Kikuchi, S. Hoshino, and T.
Katada. 2003. Translation termination factor eRF3 mediates mRNA decay
through the regulation of deadenylation. J Biol Chem 278: 38287-38291.
Ingelfinger, D., D.J. Arndt-Jovin, R. Luhrmann, and T. Achsel. 2002. The human LSm17 proteins colocalize with the mRNA-degrading enzymes Dcpl/2 and Xrnl in
distinct cytoplasmic foci. Rna 8: 1489-1501.
Ishizuka, A., M.C. Siomi, and H. Siomi. 2002. A Drosophila fragile X protein interacts
with components of RNAi and ribosomal proteins. Genes Dev 16: 2497-2508.
Jing, Q., S. Huang, S. Guth, T. Zarubin, A. Motoyama, J. Chen, F. Di Padova, S.C. Lin,
H. Gram, and J. Han. 2005. Involvement of microRNA in AU-rich element-
mediated mRNA instability. Cell 120: 623-634.
John, B., A.J. Enright, A. Aravin, T. Tuschl, C. Sander, and D.S. Marks. 2004. Human
MicroRNA targets. PLoS Biol 2: e363.
Jones-Rhoades, M.W. and D.P. Bartel. 2004. Computational Identification of Plant
MicroRNAs and Their Targets, Including a Stress-Induced miRNA. Mol Cell 14:
787-799.
Jopling, C.L., M. Yi, A.M. Lancaster, S.M. Lemon, and P. Sarnow. 2005. Modulation of
hepatitis C virus RNA abundance by a liver-specific MicroRNA. Science 309:
1577-1581.
Khandjian, E.W., M.E. Huot, S. Tremblay, L. Davidovic, R. Mazroui, and B. Bardoni.
2004. Biochemical evidence for the association of fragile X mental retardation
protein with brain polyribosomal ribonucleoparticles. Proc Natl Acad Sci U S A
101: 13357-13362.
34
Khvorova, A., A. Reynolds, and S.D. Jayasena. 2003. Functional siRNAs and miRNAs
exhibit strand bias. Cell 115: 209-216.
Kiebler, M.A., I. Hemraj, P. Verkade, M. Kohrmann, P. Fortes, R.M. Marion, J. Ortin,
and C.G. Dotti. 1999. The mammalian staufen protein localizes to the
somatodendritic domain of cultured hippocampal neurons: implications for its
involvement in mRNA transport. J Neurosci 19: 288-297.
Kikuchi, Y., H. Shimatake, and A. Kikuchi. 1988. A yeast gene required for the Gl-to-S
transition encodes a protein containing an A-kinase target site and GTPase
domain.Embo J7: 1175-1182.
Kim, V.N. 2004. MicroRNA precursors in motion: exportin-5 mediates their nuclear
export. Trends Cell Biol 14: 156-159.
Kim, Y.K., L. Furic, L. Desgroseillers, and L.E. Maquat. 2005. Mammalian Staufenl
recruits Upfl to specific mRNA 3'UTRs so as to elicit mRNA decay. Cell 120:
195-208.
Kiriakidou, M., P.T. Nelson, A. Kouranov, P. Fitziev, C. Bouyioukos, Z. Mourelatos, and
A. Hatzigeorgiou. 2004. A combined computational-experimental approach
predicts human microRNA targets. Genes Dev 18: 1165-1178.
Kisselev, L., M. Ehrenberg, and L. Frolova. 2003. Termination of translation: interplay of
mRNA, rRNAs and release factors? Embo J 22: 175-182.
Kloosterman, W.P., E. Wienholds, R.F. Ketting, and R.H. Plasterk. 2004. Substrate
requirements for let-7 function in the developing zebrafish embryo. Nucleic Acids
Res 32: 6284-6291.
Kshirsagar, M. and R. Parker. 2004. Identification of Edc3p as an enhancer of mRNA
decapping in Saccharomyces cerevisiae. Genetics 166: 729-739.
Lagos-Quintana, M., R. Rauhut, W. Lendeckel, and T. Tuschl. 2001. Identification of
novel genes coding for small expressed RNAs. Science 294: 853-858.
Lai, E.C. 2004. Predicting and validating microRNA targets. Genome Biol 5:115.
Landthaler, M., A. Yalcin, and T. Tuschl. 2004. The human DiGeorge syndrome critical
region gene 8 and Its D. melanogaster homolog are required for miRNA
biogenesis. Curr Biol 14: 2162-2167.
Lau, N.C., L.P. Lim, E.G. Weinstein, and D.P. Bartel. 2001. An abundant class of tiny
RNAs with probable regulatory roles in Caenorhabditis elegans. Science 294:
858-862.
35
Le Roy, F., T. Salehzada, C. Bisbal, J.P. Dougherty, and S.W. Peltz. 2005. A newly
discovered function for RNase L in regulating translation termination. Nat Struct
Mol Biol 12: 505-512.
Lecellier, C.H., P. Dunoyer, K. Arar, J. Lehmann-Che, S. Eyquem, C. Himber, A. Saib,
and O. Voinnet. 2005. A cellular microRNA mediates antiviral defense in human
cells. Science 308: 557-560.
Lee, R.C. and V. Ambros. 2001. An extensive class of small RNAs in Caenorhabditis
elegans. Science 294: 862-864.
Lee, R.C., R.L. Feinbaum, and V. Ambros. 1993. The C. elegans heterochronic gene lin-4
encodes small RNAs with antisense complementarity to lin-14. Cell 75: 843-854.
Lee, Y., C. Ahn, J. Han, H. Choi, J. Kim, J. Yim, J. Lee, P. Provost, O. Radmark, S. Kim,
and V.N. Kim. 2003. The nuclear RNase III Drosha initiates microRNA
processing. Nature 425: 415-419.
Lee, Y., K. Jeon, J.T. Lee, S. Kim, and V.N. Kim. 2002. MicroRNA maturation: stepwise
processing and subcellular localization. Embo J 21: 4663-4670.
Lee, Y., M. Kim, J. Han, K.H. Yeom, S. Lee, S.H. Baek, and V.N. Kim. 2004a.
MicroRNA genes are transcribed by RNA polymerase II. Embo J 23: 4051-4060.
Lee, Y.S., K. Nakahara, J.W. Pham, K. Kim, Z. He, E.J. Sontheimer, and R.W. Carthew.
2004b. Distinct roles for Drosophila Dicer-1 and Dicer-2 in the siRNA/miRNA
silencing pathways. Cell 117: 69-81.
Lewis, B.P., C.B. Burge, and D.P. Bartel. 2005. Conserved seed pairing, often flanked by
adenosines, indicates that thousands of human genes are microRNA targets. Cell
120: 15-20.
Lewis, B.P., .H. Shih, M.W. Jones-Rhoades, D.P. Bartel, and C.B. Burge. 2003.
Prediction of mammalian microRNA targets. Cell 115: 787-798.
Li, P., X. Yang, M. Wasser, Y. Cai, and W. Chia. 1997. Inscuteable and Staufen mediate
asymmetric localization and segregation of prospero RNA during Drosophila
neuroblast cell divisions. Cell 90: 437-447.
Lim, L.P., M.E. Glasner, S. Yekta, C.B. Burge, and D.P. Bartel. 2003a. Vertebrate
microRNA genes. Science 299: 1540.
Lim, L.P., N.C. Lau, P. Garrett-Engele, A. Grimson, J.M. Schelter, J. Castle, D.P. Bartel,
P.S. Linsley, and J.M. Johnson. 2005. Microarray analysis shows that some
microRNAs downregulate large numbers of target mRNAs. Nature 433: 769-773.
36
Lim, L.P., N.C. Lau, E.G. Weinstein, A. Abdelhakim, S. Yekta, M.W. Rhoades, C.B.
Burge, and D.P. Bartel. 2003b. The microRNAs of Caenorhabditis elegans. Genes
Dev 17: 991-1008.
Lingel, A., B. Simon, E. Izaurralde, and M. Sattler. 2003. Structure and nucleic-acid
binding of the Drosophila Argonaute 2 PAZ domain. Nature 426: 465-469.
Liu, J., M.A. Carmell, F.V. Rivas, C.G. Marsden, J.M. Thomson, J.J. Song, S.M.
Hammond, L. Joshua-Tor, and G.J. Hannon. 2004. Argonaute2 is the catalytic
engine of mammalian RNAi. Science 305: 1437-1441.
Liu, J., M.A. Valencia-Sanchez, G.J. Hannon, and R. Parker. 2005. MicroRNA-
dependent localization of targeted mRNAs to mammalian P-bodies. Nat Cell Biol
7: 719-723.
Liu, Q., T.A. Rand, S. Kalidas, F. Du, H.E. Kim, D.P. Smith, and X. Wang. 2003. R2D2,
a bridge between the initiation and effector steps of the Drosophila RNAi
pathway. Science 301: 1921-1925.
Llave, C., Z. Xie, K.D. Kasschau, and J.C. Carrington. 2002. Cleavage of Scarecrow-like
mRNA targets directed by a class of Arabidopsis miRNA. Science 297: 2053-
2056.
Lund, E., S. Guttinger, A. Calado, J.E. Dahlberg, and U. Kutay. 2004. Nuclear export of
microRNA precursors. Science 303: 95-98.
Ma, J.B., Y.R. Yuan, G. Meister, Y. Pei, T. Tuschl, and D.J. Patel. 2005. Structural basis
for 5'-end-specific recognition of guide RNA by the A. fulgidus Piwi protein.
Nature 434: 666-670.
Malta-Vacas, J., C. Aires, P. Costa, A.R. Conde, S. Ramos, A.P. Martins, C. Monteiro,
and M. Brito. 2005. Differential expression of the eukaryotic release factor 3
(eRF3/GSPT ) according to gastric cancer histological types. J Clin Pathol 58:
621-625.
Mansfield, J.H., B.D. Harfe, R. Nissen, J. Obenauer, J. Srineel, A. Chaudhuri, R. FarzanKashani, M. Zuker, A.E. Pasquinelli, G. Ruvkun, P.A. Sharp, C.J. Tabin, and
M.T. McManus. 2004. MicroRNA-responsive 'sensor' transgenes uncover Hoxlike and other developmentally regulated patterns of vertebrate microRNA
expression. Nat Genet 36: 1079-1083.
Martinez, J., A. Patkaniowska, H. Urlaub, R. Luhrmann, and T. Tuschl. 2002. Singlestranded antisense siRNAs guide target RNA cleavage in RNAi. Cell 110: 563-
574.
37
Martinez, J. and T. Tuschl. 2004. RISC is a 5' phosphomonoester-producing
RNA
endonuclease. Genes Dev 18: 975-980.
Meister, G., M. Landthaler, Y. Dorsett, and T. Tuschl. 2004. Sequence-specific inhibition
of microRNA- and siRNA-induced RNA silencing. RNA 10: 544-550.
Mendez, R., L.E. Hake, T. Andresson, L.E. Littlepage, J.V. Ruderman, and J.D. Richter.
2000a. Phosphorylation of CPE binding factor by Eg2 regulates translation of cmos mRNA. Nature 404: 302-307.
Mendez, R., K.G. Murthy, K. Ryan, J.L. Manley, and J.D. Richter. 2000b.
Phosphorylation of CPEB by Eg2 mediates the recruitment of CPSF into an active
cytoplasmic polyadenylation complex. Mol Cell 6:1253-1259.
Mendez, R. and J.D. Richter. 2001. Translational control by CPEB: a means to the end.
Nat Rev Mol Cell Biol 2: 521-529.
Mourelatos, Z., J. Dostie, S. Paushkin, A. Sharma, B. Charroux, L. Abel, J. Rappsilber,
M. Mann, and G. Dreyfuss. 2002. miRNPs: a novel class of ribonucleoproteins
containing numerous microRNAs. Genes Dev 16: 720-728.
Muhlrad, D., C.J. Decker, and R. Parker. 1994. Deadenylation of the unstable mRNA
encoded by the yeast MFA2 gene leads to decapping followed by 5'-->3' digestion
of the transcript. Genes Dev 8: 855-866.
Nakamura, A., K. Sato, and K. Hanyu-Nakamura. 2004. Drosophila cup is an eIF4E
binding protein that associates with Bruno and regulates oskar mRNA translation
in oogenesis. Dev Cell 6: 69-78.
Neu-Yilik, G., N.H. Gehring, M.W. Hentze, and A.E. Kulozik. 2004. Nonsense-mediated
mRNA decay: from vacuum cleaner to Swiss army knife. Genome Biol 5: 218.
Nykanen, A., B. Haley, and P.D. Zamore. 2001. ATP requirements and small interfering
RNA structure in the RNA interference pathway. Cell 107: 309-321.
Ohashi, S., K. Koike, A. Omori, S. Ichinose, S. Ohara, S. Kobayashi, T.A. Sato, and K.
Anzai. 2002. Identification of mRNA/protein (mRNP) complexes containing
Puralpha, mStaufen, fragile X protein, and myosin Va and their association with
rough endoplasmic reticulum equipped with a kinesin motor. J Biol Chem 277:
37804-37810.
Olsen, P.H. and V. Ambros. 1999. The lin-4 regulatory RNA controls developmental
timing in Caenorhabditis elegans by blocking LIN-14 protein synthesis after the
initiation of translation. Dev Biol 216: 671-680.
38
Orban, T.I. and E. Izaurralde. 2005. Decay of mRNAs targeted by RISC requires XRN1,
the Ski complex, and the exosome. RNA 11: 459-469.
Ostareck, D.H., A. Ostareck-Lederer, I.N. Shatsky, and M.W. Hentze. 2001.
Lipoxygenase mRNA silencing in erythroid differentiation: The 3'UTR regulatory
complex controls 60S ribosomal subunit joining. Cell 104: 281-290.
Ostareck-Lederer, A. and D.H. Ostareck. 2004. Control of mRNA translation and
stability in haematopoietic cells: the function of hnRNPs K and El/E2. Biol Cell
96: 407-411.
Ostareck-Lederer, A., D.H. Ostareck, C. Cans, G. Neubauer, K. Bomsztyk, G. Superti-
Furga, and M.W. Hentze. 2002. c-Src-mediated phosphorylation of hnRNP K
drives translational activation of specifically silenced mRNAs. Mol Cell Biol 22:
4535-4543.
Ostareck-Lederer, A., D.H. Ostareck, N. Standart, and B.J. Thiele. 1994. Translation of
15-lipoxygenase mRNA is inhibited by a protein that binds to a repeated sequence
in the 3' untranslated region. Embo J 13: 1476-1481.
Parker, J.S., S.M. Roe, and D. Barford. 2004. Crystal structure of a PIWI protein suggests
mechanisms for siRNA recognition and slicer activity. Embo J 23: 4727-4737.
Pasquinelli, A.E., B.J. Reinhart, F. Slack, M.Q. Martindale, M.I. Kuroda, B. Maller, D.C.
Hayward, E.E. Ball, B. Degnan, P. Muller, J. Spring, A. Srinivasan, M. Fishman,
J. Finnerty, J. Corbo, M. Levine, P. Leahy, E. Davidson, and G. Ruvkun. 2000.
Conservation of the sequence and temporal expression of let-7 heterochronic
regulatory RNA. Nature 408: 86-89.
Pfeffer, S., A. Sewer, M. Lagos-Quintana, R. Sheridan, C. Sander, F.A. Grasser, L.F. van
Dyk, C.K. Ho, S. Shuman, M. Chien, J.J. Russo, J. Ju, G. Randall, B.D.
Lindenbach, C.M. Rice, V. Simon, D.D. Ho, M. Zavolan, and T. Tuschl. 2005.
Identification of microRNAs of the herpesvirus family. Nat Methods 2: 269-276.
Pham, J.W., J.L. Pellino, Y.S. Lee, R.W. Carthew, and E.J. Sontheimer. 2004. A Dicer-2-
dependent 80s complex cleaves targeted mRNAs during RNAi in Drosophila.
Cell 117: 83-94.
Pillai, R.S., C.G. Artus, and W. Filipowicz. 2004. Tethering of human Ago proteins to
mRNA mimics the miRNA-mediated repression of protein synthesis. RNA 10:
1518-1525.
Pillai, R.S., S.N. Bhattacharyya, C.G. Artus, T. Zoller, N. Cougot, E. Basyuk, E.
Bertrand, and W. Filipowicz. 2005. Inhibition of Translational Initiation by let-7
MicroRNA in Human Cells. Science.
39
Poy, M.N., L. Eliasson, J. Krutzfeldt, S. Kuwajima, X. Ma, P.E. Macdonald, S. Pfeffer,
T. Tuschl, N. Rajewsky, P. Rorsman, and M. Stoffel. 2004. A pancreatic isletspecific microRNA regulates insulin secretion. Nature 432: 226-230.
Rajewsky, N. and N.D. Socci. 2004. Computational identification of microRNA targets.
Dev Biol 267: 529-535.
Rehmsmeier, M., P. Steffen, M. Hochsmann, and R. Giegerich. 2004. Fast and effective
prediction of microRNA/target duplexes. RNA 10: 1507-1517.
Rehwinkel, J., I. Behm-Ansmant, D. Gatfield, and E. Izaurralde. 2005. A crucial role for
GW182 and the DCP1 :DCP2 decapping complex in miRNA-mediated gene
silencing. Rna.
Reinhart, B.J., F.J. Slack, M. Basson, A.E. Pasquinelli, J.C. Bettinger, A.E. Rougvie,
H.R. Horvitz, and G. Ruvkun. 2000. The 21-nucleotide let-7 RNA regulates
developmental timing in Caenorhabditis elegans. Nature 403: 901-906.
Rhoades, M.W., B.J. Reinhart, L.P. Lim, C.B. Burge, B. Bartel, and D.P. Bartel. 2002.
Prediction of plant microRNA targets. Cell 110: 513-520.
Schwarz, D.S., G. Hutvagner, T. Du, Z. Xu, N. Aronin, and P.D. Zamore. 2003.
Asymmetry in the assembly of the RNAi enzyme complex. Cell 115: 199-208.
Schwarz, D.S., G. Hutvagner, B. Haley, and P.D. Zamore. 2002. Evidence that siRNAs
function as guides, not primers, in the Drosophila and human RNAi pathways.
Mol Cell 10: 537-548.
Schwarz, D.S., Y. Tomari, and P.D. Zamore. 2004. The RNA-induced silencing complex
is a Mg2+-dependent endonuclease. Curr Biol 14: 787-791.
Seggerson, K., L. Tang, and E.G. Moss. 2002. Two genetic circuits repress the
Caenorhabditis elegans heterochronic gene lin-28 after translation initiation. Dev
Biol 243: 215-225.
Sen, G.L. and H.M. Blau. 2005. Argonaute 2/RISC resides in sites of mammalian mRNA
decay known as cytoplasmic bodies. Nat Cell Biol 7: 633-636.
Sheth, U. and R. Parker. 2003. Decapping and decay of messenger RNA occur in
cytoplasmic processing bodies. Science 300: 805-808.
Sijen, T., J. Fleenor, F. Simmer, K.L. Thijssen, S. Parrish, L. Timmons, R.H. Plasterk,
and A. Fire. 2001. On the role of RNA amplification in dsRNA-triggered gene
silencing. Cell 107: 465-476.
40
Slack, F.J., M. Basson, Z. Liu, V. Ambros, H.R. Horvitz, and G. Ruvkun. 2000. The lin41 RBCC gene acts in the C. elegans heterochronic pathway between the let-7
regulatory RNA and the LIN-29 transcription factor. Mol Cell 5: 659-669.
Sonenberg, N. and T.E. Dever. 2003. Eukaryotic translation initiation factors and
regulators. Curr Opin Struct Biol 13: 56-63.
Song, J.J., S.K. Smith, G.J. Hannon, and L. Joshua-Tor. 2004. Crystal structure of
Argonaute and its implications for RISC slicer activity. Science 305: 1434-1437.
Stebbins-Boaz, B., Q. Cao, C.H. de Moor, R. Mendez, and J.D. Richter. 1999. Maskin is
a CPEB-associated factor that transiently interacts with elF-4E. Mol Cell 4: 10171027.
Tabara, H., M. Sarkissian, W.G. Kelly, J. Fleenor, A. Grishok, L. Timmons, A. Fire, and
C.C. Mello. 1999. The rde-1 gene, RNA interference, and transposon silencing in
C. elegans. Cell 99: 123-132.
Tharun, S. and R. Parker. 2001. Targeting an mRNA for decapping: displacement of
translation factors and association of the Lsmlp-7p complex on deadenylated
yeast mRNAs. Mol Cell 8: 1075-1083.
Tomari, Y., T. Du, B. Haley, D.S. Schwarz, R. Bennett, H.A. Cook, B.S. Koppetsch,
W.E. Theurkauf, and P.D. Zamore. 2004a. RISC assembly defects in the
Drosophila RNAi mutant armitage. Cell 116: 831-841.
Tomari, Y., C. Matranga, B. Haley, N. Martinez, and P.D. Zamore. 2004b. A protein
sensor for siRNA asymmetry. Science 306: 1377-1380.
Tucker, M., M.A. Valencia-Sanchez, R.R. Staples, J. Chen, C.L. Denis, and R. Parker.
2001. The transcription factor associated Ccr4 and Cafl proteins are components
of the major cytoplasmic mRNA deadenylase in Saccharomyces cerevisiae. Cell
104: 377-386.
Tuschl, T., P.D. Zamore, R. Lehmann, D.P. Bartel, and P.A. Sharp. 1999. Targeted
mRNA degradation by double-stranded RNA in vitro. Genes Dev 13: 3191-3197.
van Hoof, A., P.A. Frischmeyer, H.C. Dietz, and R. Parker. 2002. Exosome-mediated
recognition and degradation of mRNAs lacking a termination codon. Science 295:
2262-2264.
Veneri, M., F. Zalfa, and C. Bagni. 2004. FMRP and its target RNAs: fishing for the
specificity. Neuroreport 15: 2447-2450.
Wightman, B., T.R. Burglin, J. Gatto, P. Arasu, and G. Ruvkun. 1991. Negative
regulatory sequences in the lin-14 3'-untranslated region are necessary to generate
41
a temporal switch during Caenorhabditis elegans development. Genes Dev 5:
1813-1824.
Wightman, B., I. Ha, and G. Ruvkun. 1993. Posttranscriptional regulation of the
heterochronic gene lin-14 by lin-4 mediates temporal pattern formation in C.
elegans. Cell 75: 855-862.
Wilhelm, J.E., M. Hilton, Q. Amos, and W.J. Henzel. 2003. Cup is an eIF4E binding
protein required for both the translational repression of oskar and the recruitment
of Barentsz. J Cell Biol 163: 1197-1204.
Wilson, M.A., S. Meaux, R. Parker, and A. van Hoof. 2005. Genetic interactions between
[PSI+] and nonstop mRNA decay affect phenotypic variation. Proc Natl Acad Sci
U S A 102: 10244-10249.
Xu, P., S.Y. Vernooy, M. Guo, and B.A. Hay. 2003. The Drosophila microRNA Mir-14
suppresses cell death and is required for normal fat metabolism. Curr Biol 13:
790-795.
Yan, K.S., S. Yan, A. Farooq, A. Han, L. Zeng, and M.M. Zhou. 2003. Structure and
conserved RNA binding of the PAZ domain. Nature 426: 468-474.
Yekta, S., I.H. Shih, and D.P. Bartel. 2004. MicroRNA-directed cleavage of HOXB8
mRNA. Science 304: 594-596.
Yi, R., Y. Qin, I.G. Macara, and B.R. Cullen. 2003. Exportin-5 mediates the nuclear
export of pre-microRNAs and short hairpin RNAs. Genes Dev 17: 3011-3016.
Zamore, P.D., T. Tuschl, P.A. Sharp, and D.P. Bartel. 2000. RNAi: double-stranded RNA
directs the ATP-dependent cleavage of mRNA at 21 to 23 nucleotide intervals.
Cell 101: 25-33.
Zeng, Y., R. Yi, and B.R. Cullen. 2005. Recognition and cleavage of primary microRNA
precursors by the nuclear processing enzyme Drosha. Embo J 24: 138-148.
Zhang, H., F.A. Kolb, L. Jaskiewicz, E. Westhof, and W. Filipowicz. 2004. Single
processing center models for human Dicer and bacterial RNase III. Cell 118: 5768.
42
Chapter Two
siRNAs Can Function as miRNAs
This chapter is presented in the context of its contemporary science, and originally
appeared in Genes and Development 17: 438-42 (2003).
The experiments described here were performed in collaboration with John G. Doench.
43
Abstract
With the discovery of RNA interference (RNAi) and related phenomena, new regulatory
roles attributed to RNA continue to emerge. Here we show, in mammalian tissue culture,
that a short interfering RNA (siRNA) can repress expression of a target mRNA with
partially complementary binding sites in its 3' UTR, much like the demonstrated function
of endogenously encoded microRNAs (miRNAs). The mechanism for this repression is
synergistic, distinct from the catalytic mechanism of mRNA cleavage by siRNAs. The
use of siRNAs to study translational repression holds promise for dissecting the sequence
and structural determinants and general mechanism of gene repression by miRNAs.
44
Introduction
The RNA interference (RNAi) pathway was first recognized in Caenorhabditis
elegans as a response to exogenously introduced long double stranded RNA (dsRNA)
(Fire et al. 1998). An RNase III enzyme, Dicer, cleaves the dsRNA into duplexes of 2123 nt termed short interfering RNAs (siRNAs), which then guide a multicomponent
complex known as RISC (RNA Induced Silencing Complex) to mRNAs sharing perfect
complementarity and target their cleavage (Hamilton and Baulcombe 1999; Tuschl et al.
1999; Zamore et al. 2000; Hammond et al. 2000; Bernstein et al. 2001; Elbashir et al.
2001a). The RNAi pathway has been implicated in silencing transposons in the C.
elegans germline (Tabara et al. 1999; Ketting et al. 1999), silencing Stellate repeats in the
Drosophila germline (Aravin et al. 2001), and serving as an immune response against
invading viruses in plants (reviewed in Baulcombe 2001). Very little, however, is known
about the intrinsic biological role of RNAi in mammalian systems; indeed, no
endogenous siRNAs have been identified in mammals. Nevertheless, transfection of
mammalian cells with exogenous siRNAs has rapidly been adopted as a technology for
targeted gene silencing (Elbashir et al. 2001a).
A related short RNA species, microRNAs (miRNAs), has been identified in
organisms ranging from plants to nematodes to mammals (Lagos-Quintana et al. 2001;
Lau et al. 2001; Lee and Ambros 2001; Reinhart et al. 2002). These endogenous RNA
species are first transcribed as a long RNA and then processed to a pre-miRNA of
70 nt
(Lee et al. 2002). This pre-miRNA forms an imperfect hairpin structure which is
processed by Dicer to produce the mature, single strand -22 nt miRNA (Grishok et al.
2001; Hutvagner et al. 2001; Ketting et al. 2001). Despite the large library of miRNAs
45
now known in animals, only two have a known function; lin-4 and let-7 regulate
endogenous genes involved in developmental timing in C. elegans by partially
basepairing to the 3' UTR of target mRNAs such as lin-14 and lin-41, respectively (Lee
et al. 1993; Wightman et al. 1993; Ha et al. 1996; Reinhart et al. 2000; Slack et al. 2000).
This interaction does not affect the stability of the target mRNA but rather represses gene
expression through an unknown mechanism known as translational repression (Olsen and
Ambros 1999). The polysome profile of the target mRNA does not change upon gene
silencing, suggesting that this repression occurs after initiation of translation, and
potentially occurs post-translationally (Olsen and Ambros 1999). This form of regulation
is likely to be conserved in mammalian cells since overexpression of miR-30 can repress
a reporter gene with partially complementary miR-30 binding sites in its 3' UTR without
affecting mRNA stability (Zeng et al. 2002).
The RNAi pathway of siRNA-directed mRNA cleavage and the miRNA-mediated
translational repression pathway are genetically and biochemically distinct. In addition to
different outcomes, the two pathways have differential requirements for Paz-Piwi domain
(PPD) proteins in C. elegans. Translational repression by lin-4 and let-7 depends on algI and alg-2 for miRNA processing and/or stability yet these genes are not required for
RNAi (Grishok et al. 2001), while rde-1 is needed in RNAi but is not necessary for
translational repression (Tabara et al. 1999). In HeLa cells, Gemin 3 and 4 proteins
immunoprecipitate with RISC activity (Hutvagner and Zamore 2002) and miRNAs
(Mourelatos et al. 2002), but have not been detected as components of purified RISC
activity from S100 extracts (Martinez et al. 2002).
46
In addition to requiring Dicer processing to generate the short RNA, RNAi and
translational repression share common components. The PPD protein eIF2C2 both
immunoprecipitates with miRNAs from HeLa cells (Mourelatos et al. 2002) and copurifies with RISC activity (Martinez et al. 2002). Additionally, endogenous let-7 in
HeLa extracts is capable of directing cleavage of a perfectly complementary target
mRNA, suggesting that RNAi and translational repression share common entry points if
not overlapping machinery (Hutvagner and Zamore 2002). Because of these similarities,
we reasoned that siRNAs may be capable of repressing gene expression via the miRNAmediated pathway.
47
Results and Discussion
To test the ability of siRNAs to function like miRNAs in repressing gene
expression, we designed a binding site that would basepair to the antisense strand of a
siRNA known to be active in vivo for cleavage of the cell-surface receptor CXCR4
mRNA (Fig. 1A). Notably, this binding site contains a central bulge, thereby precluding
RISC-directed mRNA cleavage (Elbashir et al. 2001a; Holen et al. 2002). We introduced
four of these binding sites as consecutive repeats separated by four nucleotides into the 3'
UTR of the Renilla reniformis luciferase reporter gene (Rr-luc); we also made a similar
3' UTR construct with a single binding site with perfect complementarity, to serve as a
positive control for RNAi activity. Transfection of HeLa cells and subsequent luciferase
assays revealed that the CXCR4 siRNA induced at least ten fold silencing of both of
these constructs (Fig. B). RT-PCR showed that the two constructs were suppressed by
two different mechanisms, as the perfectly complementary antisense siRNA:mRNA
interaction resulted in a significant decrease in the steady state mRNA level, while the
bulged interaction did not significantly reduce the mRNA level (Fig. C). Trace
radiolabeling of an independent RT-PCR experiment was also used to better quantitate
RNA levels, normalizing first within a sample to the control Photinus pyralis luciferase
(Pp-luc) and then across samples to the (-) siRNA transfection.
Such quantitation
revealed that the perfectly complementary construct, targeted for RNAi, showed a greater
than ten fold decrease in RNA level, while the bulged construct showed only 1.2 fold
reduction in RNA level (data not shown). Interestingly, the sense strand of the same
CXCR4 siRNA was capable of repressing a mRNA with four bulged binding sites (Fig.
I D).
However, in this case the level of repression was only four fold as compared to the
48
ten fold repression observed above (data not shown). As an additional control, the four
bulged CXCR4 binding sites (Fig. 1A) were introduced into the Pp-luc vector.
Luciferase assays showed six fold repression (data not shown). Northern analysis of
cytoplasmic RNA confirmed that the bulged binding sites do not cause a decrease in
mRNA levels, relative to the B-actin control (Fig. E). Thus, we conclude that a siRNA
can function like a miRNA, repressing gene expression without a concordant decrease in
mRNA stability.
Cloning efforts in many labs have revealed a large library of miRNAs, yet C.
elegans lin-4 and let-7 remain the only miRNAs with known mRNA targets for
translational repression in animals, and no such interactions are known in mammals.
Computational prediction of targets is difficult because the rules for miRNA:mRNA
pairing which function in translational repression have not been determined. Systematic
manipulation of genes encoding miRNAs to explore these rules is complicated because
the mutant genes must be processed by Dicer and the rules for this cleavage are not
known. However, the ability of a siRNA to function by a miRNA-type pathway allows
direct investigation of sequence and structure requirements for translational repression in
the absence of Dicer processing.
To begin to define these rules, different siRNA sequences were tested for their
ability to repress reporters in the luciferase assay. Because both the more effective strand
of the CXCR4 siRNA (Fig. A) and the only previously studied example of miRNA
repression in mammalian cells (Zeng et al. 2002) had a 3'-AGG-5' bulge in the siRNA
strand when paired to the target mRNA, we tested the importance of this sequence. Two
constructs were designed which would basepair to the sense or antisense strand of a
49
siRNA previously used to effectively target GFP mRNA for cleavage. The
siRNA:mRNA interaction with the AGG bulge was two fold more effective than that
with the ACC bulge (Fig. 2, comparison of A & B). By using a different siRNA, the
AGG bulge of the siRNA:mRNA interaction in figure 2A was replaced with an ACC
bulge, and the ACC bulge of the siRNA:mRNA interaction in figure 2B was replaced
with an AGG bulge. (We note that in Fig. 2A the two 3' bases of the siRNA were
changed from UU to CC.) Surprisingly, none of these changes had an effect on the
degree of repression. Therefore, by this assay the sequence of the bulge is not the major
determinant of translational repression activity.
Since in Drosophila embryo extracts the antisense strand of the siRNA sets the
ruler for cleavage of target mRNA, at the ninth nucleotide from its paired 5' end
(Elbashir et al. 2001b), the position of the bulge may be a critical determinant of
translational repression activity. However, both the most effective and least effective
bulges tested (Fig. 1A and 2B, respectively) position the bulge eight basepairs from the 5'
end of the siRNA. Furthermore, another active construct positioned the bulge nine
basepairs from the 5' end (Fig. 2A). We speculate that a combination of these sequence
and structural parameters govern the ability of a siRNA/miRNA to induce translational
repression, but that an expanded study will be necessary to define them.
The number of miRNA binding sites in a target mRNA is a likely determinant of
the effectiveness of translational repression.
Indeed, the lin-14 3' UTR contains seven
potential lin-4 miRNA binding sites, and the lin-41 3' UTR contains one lin-4 miRNA
and two let-7 miRNA binding sites (reviewed in Banerjee and Slack 2002). To
investigate this possibility, a series of Rr-luc reporters with an increasing number of
50
binding sites-0,
2, 4, and 6-were
transfected into HeLa cells with increasing
concentrations of CXCR4 siRNA. The level of repression increased with increasing
number of binding sites and with increasing concentrations of siRNA (Fig. 3A). To
compare the effectiveness of translational repression to mRNA cleavage by siRNAs, a
series of Pp-luc reporters with an increasing number of binding sites-0,1, 2, and
3-perfectly
complementary to the CXCR4 siRNA were transfected with increasing
concentrations of siRNA. Like the translational repression effect observed above, the
level of gene silencing by RNAi increases with increasing number of perfectly
complementary binding sites and with increasing concentration of siRNA (Fig 3B). As
might be expected from a mechanism that results in cleavage of the mRNA, RNAi
silences gene expression to a greater extent than translational repression.
The mechanism of mRNA cleavage in RNAi implies that each siRNA:binding
site interaction will function independently of another interaction; once a mRNA is
cleaved it is expected to be rapidly degraded, and thus a second cleavage event would
have little if any effect on gene expression. To assess this, we divided the repression
observed for each construct in figure 3B by the number of binding sites on that mRNA, at
each concentration of siRNA. These values were then normalized to the repression
observed for a single binding site to assess the relative contribution of each site (Fig. 3D).
As expected, the relative effectiveness of each site remained the same as the number of
binding sites increased. Addition of more binding sites likely only increases the
probability of the single necessary cleavage event, and thus multiple binding sites
function independently of one another. This same analysis was applied to the
translational repression constructs in figure 3A, normalizing to the construct with two
51
binding sites (Fig. 3C). Strikingly, the degree of repression achieved by increasing the
number of sites is not simply additive, as each site in the construct with four binding sites
conferred twice as much repression as each site in the construct with two binding sites.
The effectiveness of each binding site in the construct with six sites was similar to that of
the construct with four sites. These results suggest that the effects of binding multiple
miRNA complexes to the 3' UTR are likely to be synergistic. Ribonucleoprotein
complexes could either mutually stabilize one another or cooperatively interact to more
effectively inhibit translation or both. As with other cooperative interactions in gene
regulation, this would allow a cell to fine-tune the expression of a mRNA by regulating
the degree of binding of different miRNAs to the 3' UTR of the mRNA.
The discovery that siRNAs can function in translational repression as miRNAs,
and that the sequence requirements for this interaction are less stringent than those for
RNAi, may help to explain non-specific effects sometimes observed in experiments
utilizing siRNAs for targeted gene silencing. Using an arbitrary 21 nt sequence, BLAST
searches against the mRNAs predicted from the human genome identify multiple inexact
matches with 16-18 nt complementarity.
Combined with the potential of GU wobble
basepairs, and depending on the overall sequence rules for translational repression, there
may be translational repression of a number of off-target genes by the introduction of a
siRNA intended to knock-down the expression of only the target gene. However, the
mechanistic finding that several binding sites are needed to produce a significant effect
on protein expression may make non-specific siRNA effects the exception rather than the
rule, and to date siRNAs have certainly been used with ostensible specificity.
52
Materials and Methods
DNA constructs and siRNAs
3' UTR binding sites for the siRNAs were constructed by a multimerization of DNA
oligonucleotides (IDT), gel purification, PCR amplification, and restriction digestion.
The products were inserted into the Xbal site immediately downstream of the stop codon
in either the pRL-TK vector coding for the Renilla reniformis luciferase (Rr-luc) or the
pGL3 control vector coding for the Photinus pyralis luciferase (Pp-luc) (Promega).
siRNAs were purchased as single strands, deprotected, and annealed according to the
manufacturer (Dharmacon). All sequences for siRNAs and 3' UTR constructs used in
this study are available on the Sharp Lab website at
http://web.mit.edu/sharplab/RNAi/sequences.html
Cell culture and transfections
Adherent HeLa cells were grown in 10% IFS in DMEM, supplemented with glutamine in
the presence of antibiotics. For all transfections, except those noted below, cells were
transfected with Lipofectin and the PLUS reagent (Invitrogen).
On the day before
transfection, exponentially growing cells were trypsinized and plated into 24-well plates
at a density of 3x104 cells/well in antibiotic-free media. The next day the cells were
transfected with 0.2 tg DNA and 25 nM siRNA in a final volume of 250 ftL. For Fig. E
and Fig. 3, cells were transfected with Lipofectamine 2000, as during the course of this
study we found that this reagent delivers effective doses of siRNAs at lower
concentrations.
On the day before transfection, cells were trypsinized and plated into 24-
well plates at a density of 8x104 cells/well in antibiotic-free media. The next day cells
53
were transfected with 0.8 [tg DNA and 5 nM siRNA, unless noted, in a final volume of
500 pL.
Luciferase assays
Dual-Luciferase assays (Promega) were performed 24 hours post-transfection according
to the manufacturer's protocol and detected with an Optocomp I Luminometer (MGM
Instruments). Rr-luc target vectors were co-transfected with control pGL3, and Pp-luc
target vectors were co-transfected with a pRL-CMV control (Promega). Transfections
were harvested 24 hours post-transfection, and the two luciferase activities consecutively
assayed.
RT-PCR
Total RNA was harvested from transfected HeLa cells using the RNAeasy kit (Qiagen).
Total RNA was DNase treated twice with DNase-Free (Ambion) and reverse transcribed
using Omniscript reverse transcriptase (Qiagen) with a DNA primer complementary to a
region near the SV40 polyadenylation sequence found in both the Pp-luc and Rr-luc
reporter vectors (5'-GCATTCTAGTTGTGGTTTGTCC). Trace radiolabeled PCR
products were detected via autoradiography, and quantitated with ImageQuant software
v. 1.2 (Molecular Dynamics).
Northern Analysis
Cytoplasmic RNA was harvested by hypotonic lysis without detergent and subsequent
needle homogenization of HeLa cells 24h after transfected using Lipofectamine 2000.
Nuclei were pelleted at 1500 x g for 15 min and the supernatant treated with proteinase
K, extracted in phenol:chloroform and again in chloroform, precipitated with isopropanol
and washed with 70% ethanol. Samples were then treated with DNase-Free (Ambion).
54
Northern analysis was performed rsing the NorthernMax kit (Ambion). 10 ~tg of RNA
from the (+) siRNA or (-) siRNA samples were separated by electrophoresis on a 1%
formaldehyde agarose gel and transferred onto Hybond N+ nitrocellulose by downward
transfer (Amersham Pharmacia). The 1.5 kb ORF of the Pp-luc cDNA was generated by
restriction digest of the pGL3 control vector with XbaI and HindIll (New England
Biolabs), and used with DECA-Prime II (Ambion) in the presence of
3 2 P-dATP
to
generate a random-primed DNA used to probe the membrane. The membrane was
stripped and reprobed with 13-actin probe, generated from DECAtemplate-13-actin-mouse
(Ambion).
Acknowledgements
The authors thank A. Grishok for helpful discussion, and C. Novina, D. M. Dykxhoorn,
H. Houbaviy, D. Tantin, and R. Bodner for comments on the manuscript. J.G.D. is a
Howard Hughes Medical Institute Predoctoral Fellow. C.P.P. is a National Science
Foundation Predoctoral Fellow.
55
A
mRNA
c
~
siRNA:
AAGUUUUCAC
AGCUAACA
I I I I I I I I I I
I I I I I I I I
TTCAAAAGUGAGGUCGAUUGU
no sites
+
4 bulged
+
1 perfect
+
Rr-Iuc
siRNA (antisense)
Pp-Iuc
B
D
1.5
mRNA
()
UGUGUUAGCU
I I I I I I I I I
ACACAAUCGA
.f0- 1.0
a..
........
()
~
"Z0.5
I
UU GUGAAAAC
I I I I I I I
CACUUUUG
siRNA (sense)
ceu
siRNA:
+
a:
a
no sites
1 perfect
4 bulged
E
Pp-Iuc
Figure 1
actin
I
Rr-Iuc/Pp-Iuc
o
A
AA
GGGGCUACG
AGGAGCGCA
•• I I I I I I I
I I I I I I I I I
UUCCGAUGCAGGUCCUCGCGU
++
++
cc
B
cc
AA
GGUGCGCUCC
ACGUAGCC
I I I I I I I I I I
I I I I I I I I
CCACGCGAGGACCUGCAUCGG
++
GG
Figure 2
0.5
1.0
1.5
c
A
30
•
c
Owo
•
~
20
~
a.
•
Q)
a:
10
u
•
x
x
x
•
~
0
1
2
x
x
o
u.
o
•
I
~ 0
o
•
3
•
0
4
5
246
6
#
[siRNA] (nM)
B
binding sites
D
100
•
c
80
en
en
~ 60
a.
~ 40
oQ
x
•
•
u
•
u.
00
•
x
o 20
123
1
2
3
4
[siRNA] (nM)
Figure 3
5
6
#
binding sites
Figure Legends
Figure 1. siRNAs translationally represses a target mRNA. (A) Schematic of the
proposed interaction between a binding site engineered into the 3' UTR of the target
mRNA and the antisense strand of the CXCR4 siRNA. The thymidines at the 3' end of
the siRNA are deoxynucleotides.
(B) Dual Luciferase assay of transfected HeLa cells.
Three Renilla reniformis luciferase (Rr-luc) constructs were used in this assay. One was
unmodified ("no sites"), one contained a binding site perfectly complementary to the
siRNA strand shown in (A) ("1 perfect"), and one contained four of the binding sites
shown in (A) in tandem repeat ("4 bulged"). A Photinuspyralis luciferase (Pp-luc)
served as an internal transfection control. The cells were transfected with no siRNA
(black bars), a non-specific (targeting GFP) siRNA (white bars), or the CXCR4 siRNA
(gray bars). The ratios of Rr-luc to Pp-luc expression were normalized to the no siRNA
transfections, +/- S.E. from three independent experiments. (C) RT-PCR of harvested
RNA. Total RNA was harvested from cells transfected with the constructs described in
(B), transfected with or without the CXCR4 siRNA. Control experiments demonstrate
that DNA was successfully removed from the RNA preparation and that the PCR was in
the linear range of amplification (data not shown). (D) Schematic of the proposed
interaction between the sense strand of the CXCR4 siRNA and a designed binding site.
(E) RNA analysis of Pp-luc with four bulged CXCR4 binding sites (shown in A),
targeted for translational repression, transfected either with the CXCR4 siRNA (+) or no
siRNA (-). RNA was detected by Northern analysis, probing for either Pp-luc or B-actin.
59
Figure 2. Analysis of sequence and structure rules for siRNA:mRNA interaction. HeLa
cells were transfected with constructs containing four binding sites in tandem repeat with
imperfect complementarity to either the antisense (A) or sense (B) strand of a GFP
siRNA. The effect on luciferase expression is shown by the white bars, +/- S.E. from two
independent experiments, normalized to cells transfected with no siRNA (black bars). A
different siRNA was then used to produce different bulges, shown in gray with arrows.
These new interactions were assayed and are depicted with gray bars.
Figure 3. Comparison of RNAi and translational repression. (A) Titration of Rr-luc
constructs containing 0 (O), 2 (),
4 (X), or 6 ()
of the bulged binding sites, for pairing
with the antisense strand of the CXCR4 siRNA, as depicted in Fig. 1A. The level of
repression achieved is plotted, normalized to cells transfected with no siRNA. (B)
Titration of Pp-luc constructs containing 0 (),
1 (),
2 (X), or 3 ()
binding sites
perfectly complementary to the antisense strand of the CXCR4 siRNA (see Fig. 1A). (C)
Analysis of the relative repression each site contributes for the data presented in (A),
normalized to the construct with two binding sites, +/- S.E. (D) Analysis of the relative
repression each site contributes for the data presented in (B), normalized to the construct
with one binding site, +/- S.E.
60
References
Aravin, A. A., Naumova,
N. M., Tulin, A. V., Vagin, V. V., Rozovsky,
Y. M. and
Gvozdev, V. A. 2001. Double-stranded RNA-mediated silencing of genomic
tandem repeats and transposable elements in the D. melanogaster germline. Curr
Biol 11: 1017-27.
Banerjee, D. and Slack, F. 2002. Control of developmental timing by small temporal
RNAs: a paradigm for RNA-mediated regulation of gene expression. Bioessays
24: 119-29.
Baulcombe, D. 2001. RNA silencing. Diced defence. Nature 409: 295-6.
Bernstein, E., Caudy, A. A., Hammond, S. M. and Hannon, G. J. 2001. Role for a
bidentate ribonuclease in the initiation step of RNA interference. Nature 409:
363-6.
Elbashir, S. M., Harborth, J., Lendeckel, W., Yalcin, A., Weber, K. and Tuschl, T. 2001a.
Duplexes of 21-nucleotide RNAs mediate RNA interference in cultured
mammalian cells. Nature 411: 494-8.
Elbashir, S. M., Martinez, J., Patkaniowska, A., Lendeckel, W. and Tuschl, T. 2001lb.
Functional anatomy of siRNAs for mediating efficient RNAi in Drosophila
melanogaster embryo lysate. Embo J 20: 6877-88.
Fire, A., Xu, S., Montgomery, M. K., Kostas, S. A., Driver, S. E. and Mello, C. C. 1998.
Potent and specific genetic interference by double-stranded RNA in
Caenorhabditis elegans. Nature 391: 806-11.
Grishok, A., Pasquinelli, A. E., Conte, D., Li, N., Parrish, S., Ha, I., Baillie, D. L., Fire,
A., Ruvkun, G. and Mello, C. C. 2001. Genes and mechanisms related to RNA
interference regulate expression of the small temporal RNAs that control C.
elegans developmental timing. Cell 106: 23-34.
Ha, I., Wightman, B. and Ruvkun, G. 1996. A bulged lin-4/lin-14 RNA duplex is
sufficient for Caenorhabditis elegans lin-14 temporal gradient formation. Genes
Dev 10: 3041-50.
Hamilton, A. J. and Baulcombe, D. C. 1999. A species of small antisense RNA in
posttranscriptional gene silencing in plants. Science 286: 950-2.
Hammond, S. M., Bernstein, E., Beach, D. and Hannon, G. J. 2000. An RNA-directed
nuclease mediates post-transcriptional gene silencing in Drosophila cells. Nature
404: 293-6.
61
Holen, T., Amarzguioui, M., Wiiger, M. T., Babaie, E. and Prydz, H. 2002. Positional
effects of short interfering RNAs targeting the human coagulation trigger Tissue
Factor. Nucleic Acids Res 30: 1757-66.
Hutvagner, (G., McLachlan, J., Pasquinelli, A. E., Balint, E., Tuschl, T. and Zamore, P. D.
2001. A cellular function for the RNA-interference enzyme Dicer in the
maturation of the let-7 small temporal RNA. Science 293: 834-8.
Hutvagner, (G. and Zamore, P. D. 2002. A microRNA in a multiple-turnover RNAi
enzyme complex. Science 297: 2056-60.
Ketting, R. F., Fischer, S. E., Bernstein, E., Sijen, T., Hannon, G. J. and Plasterk, R. H.
2001. Dicer functions in RNA interference and in synthesis of small RNA
involved in developmental timing in C. elegans. Genes Dev 15: 2654-9.
Ketting, R. F., Haverkamp, T. H., van Luenen, H. G. and Plasterk, R. H. 1999. Mut-7 of
C. elegans, required for transposon silencing and RNA interference, is a homolog
of Werner syndrome helicase and RNaseD. Cell 99: 133-41.
Lagos-Quintana, M., Rauhut, R., Lendeckel, W. and Tuschl, T. 2001. Identification of
novel genes coding for small expressed RNAs. Science 294: 853-8.
Lau, N. C., Lim, L. P., Weinstein, E. G. and Bartel, D. P. 2001. An abundant class of tiny
RNAs with probable regulatory roles in Caenorhabditis elegans. Science 294:
858-62.
Lee, R. C. and Ambros, V. 2001. An extensive class of small RNAs in Caenorhabditis
elegans. Science 294: 862-4.
Lee, R. C., Feinbaum, R. L. and Ambros, V. 1993. The C. elegans heterochronic gene lin4 encodes small RNAs with antisense complementarity to lin- 14. Cell 75: 843-54.
Lee, Y., Jeon, K., Lee, J. T., Kim, S. and Kim, V. N. 2002. MicroRNA maturation:
stepwise processing and subcellular localization. Embo J 21: 4663-70.
Martinez, J., Patkaniowska, A., Urlaub, H., Luhrmann, R. and Tuschl, T. 2002. SingleStranded Antisense siRNAs Guide Target RNA Cleavage in RNAi. Cell 110: 563.
Mourelatos, Z., Dostie, J., Paushkin, S., Sharma, A., Charroux, B., Abel, L., Rappsilber,
J., Mann, M. and Dreyfuss, G. 2002. miRNPs: a novel class of ribonucleoproteins
containing numerous microRNAs. Genes Dev 16: 720-8.
Olsen, P. H. and Ambros, V. 1999. The lin-4 regulatory RNA controls developmental
timing in Caenorhabditis elegans by blocking LIN-14 protein synthesis after the
initiation of translation. Dev Biol 216: 671-80.
62
Reinhart, B. J., Slack, F. J., Basson, M., Pasquinelli, A. E., Bettinger, J. C., Rougvie, A.
E., Horvitz, H. R. and Ruvkun, G. 2000. The 21-nucleotide let-7 RNA regulates
developmental timing in Caenorhabditis elegans. Nature 403: 901-6.
Reinhart, B. J., Weinstein, E. G., Rhoades, M. W., Bartel, B. and Bartel, D. P. 2002.
MicroRNAs in plants. Genes Dev 16: 1616-26.
Slack, F. J., Basson, M., Liu, Z., Ambros, V., Horvitz, H. R. and Ruvkun, G. 2000. The
lin-41 RBCC gene acts in the C. elegans heterochronic pathway between the let-7
regulatory RNA and the LIN-29 transcription factor. Mol Cell 5: 659-69.
Tabara, H., Sarkissian, M., Kelly, W. G., Fleenor, J., Grishok, A., Timmons, L., Fire, A.
and Mello, C. C. 1999. The rde-1 gene, RNA interference, and transposon
silencing in C. elegans. Cell 99: 123-32.
Tuschl, T., Zamore, P. D., Lehmann, R., Bartel, D. P. and Sharp, P. A. 1999. Targeted
mRNA degradation by double-stranded RNA in vitro. Genes Dev 13: 3191-7.
Wightman, B., Ha, I. and Ruvkun, G. 1993. Posttranscriptional regulation of the
heterochronic gene lin- 14 by lin-4 mediates temporal pattern formation in C.
elegans. Cell 75: 855-62.
Zamore, P. D., Tuschl, T., Sharp, P. A. and Bartel, D. P. 2000. RNAi: double-stranded
RNA directs the ATP-dependent cleavage of mRNA at 21 to 23 nucleotide
intervals. Cell 101: 25-33.
Zeng, Y., Wagner, E. J. and Cullen, B. R. 2002. Both natural and designed micro RNAs
can inhibit the expression of cognate mRNAs when expressed in human cells.
Mol Cell 9:1327-33.
63
Chapter Three
Short RNAs repress translation after initiation in mammalian cells
This chapter is presented in the context of its contemporary science, and has been
submitted for publication.
64
Abstract
MicroRNAs are predicted to regulate the translation of 30% of mammalian proteinencoding genes by interactions with their 3' untranslated regions (UTRs). We use
partially complementary siRNAs to investigate the mechanism by which short RNAs
mediate translational repression in human cells. Repressed mRNAs are associated with
puromycin-sensitive polyribosomes. Circumvention of cap-dependent initiation by the
HCV IRES, as well as scanning and Met-tRNAimet binding by the CrPV IRES indicates
that mRNAs can be repressed by short RNAs after translational initiation. Metabolic
labeling shows that silencing occurs before completion of the nascent polypeptide chain.
Silencing by short RNAs causes a decrease in translational readthrough at a stop codon
and ribosomes associated with repressed mRNAs dissociate rapidly under a block of
translation initiation. These results suggest short RNA translational repression causes
ribosome drop-off.
65
Introduction
MicroRNAs are a class of short -21 nt RNAs which regulate diverse cellular and
molecular processes in plants and animals (Petersen et al., 2005). They constitute
upwards of 4% of human genes and are predicted to regulate as many as 30% of proteinencoding genes (Berezikov et al., 2005; Lewis et al., 2005; Xie et al., 2005). MicroRNAs
are involved in normal development in worms, flies, mammals and have been implicated
in cancer and infectious disease, so it is of great interest to understand the mechanisms
underlying their action (Bartel, 2004).
Short RNAs are capable of silencing gene expression by at least two different
mechanisms in the cytoplasm. Perfectly complementary interactions between short RNA
(siRNA or miRNA) and target mRNA result in mRNA degradation. In contrast,
mismatched interactions between either siRNA or miRNA and the target mRNA can
result in translational repression (Doench et al., 2003; Zeng et al., 2003). The
degradation mechanism requires the endonucleolytic activity of Argonaute 2, whereas
Argonaute 2, 3 or 4 proteins are sufficient to cause translational arrest if tethered to
mRNA (Liu et al., 2004; Pillai et al., 2004). Although microRNAs direct cleavage of
endogenous and artificial substrates containing highly complementary binding sequences,
the majority of interactions between microRNA and mRNAs in animals are only partially
complementary and thus translational inhibition predominates (Hutvagner and Zamore,
2002; Lewis et al., 2003; Yekta et al., 2004). Indeed, the earliest identified miRNAs, lin-
4 and let-7, act to repress translation of their target mRNAs lin-14, lin-28, lin-41
(Brennecke et al., 2003; Olsen and Ambros, 1999; Seggerson et al., 2002). More
recently, it has been reported that bantam miRNA represses translation of hid mRNA and
66
the miR-2 family represses hid, grim, rpr, and skl in drosophila (Brennecke et al., 2003;
Jorgensen and Kurland, 1990). In addition, miR-17 and miR-20 act together to repress
translation of E2F1 in Hela cells (O'Donnell et al., 2005).
The mechanism of translational repression by short RNA has been studied
previously. Lin-14 mRNA is associated with polyribosomes, and its polysomal
distribution is not altered during repression, suggesting that lin-4 miRNA acts after
translation initiation to repress gene expression (Olsen and Ambros, 1999; Seggerson et
al., 2002). Additionally, microRNAs have been observed to co-sediment with
polyribosomes in worms and mammalian cells (Kim et al., 2004; Nelson et al., 2004;
Olsen and Ambros, 1999). Translational repression by short RNA is accompanied by
localization of the mRNA and short RNA at or near P-granules, known sites of mRNA
degradation (Liu et al., 2005; Pillai et al., 2005; Sen and Blau, 2005). Indeed, this
localization is consistent with the observation that microRNAs lin-4 and let-7 cause a
degree of mRNA degradation of their targets (Bagga et al., 2005).
To investigate the mechanism of translational regulation by short RNAs, we have
used a well-characterized system in which siRNA is targeted through imperfectly
complementary interactions to multimerized sequences within the 3' UTR of luciferase
mRNAs (Doench et al., 2003). This system has been shown to recapitulate many of the
phenomena associated with microRNA translational silencing. First, siRNA causes a
decrease in luciferase protein without a significant decrease in mRNA levels, and
additional binding sites and higher concentrations of siRNA increase repression. Second,
complementarity to messenger RNA within the 5' region of the siRNA is critical for
regulation, a phenomenon verified in other systems and organisms (Brennecke et al.,
67
2005; Doench and Sharp, 2004; Kloosterman et al., 2004). This particular system using
an siRNA designed against the CXCR4 mRNA follows the consensus sequence for
predicted mammalian microRNA target sites: perfect complementarity at positions 2-7
with no preferred sequence, flanked by basepaired nucleotides at position 8, and
neighbored by an unpaired A at position 1 and to a lesser extent position 9 (Figure
B)
(Lewis et al., 2005). Additionally, the catalytic subunit of RISC, Argonaute 2, is
required for CXCR4 silencing of a luciferase reporter with one perfectly complementary
binding site but dispensable for silencing a luciferase reporter with six bulged binding
sites (Liu et al., 2004). Finally, this reporter localizes to P-granules upon silencing by
complementary siRNA (Liu et al., 2005).
Using this system, we dissect the mechanism of short RNA translational silencing
in mammalian cells. These results support a model in which short RNAs cause ribosome
drop-off.
Results
Repressed mRNAs associate with polyribosomes
We have previously described a system in mammalian cells that recapitulates
many of the features of microRNA silencing. In this system, multiple binding sites are
inserted in the 3' UTR of a luciferase reporter to which the CXCR4 siRNA can bind
creating a central bulge (Figure
A and B). Transfection of the CXCR4 siRNA along
with the reporter plasmid causes inhibition of protein production as measured by
luciferase assay without a corresponding loss of luciferase mRNA, mimicking the known
outcome of lin-4 miRNA's interaction with lin-14 mRNA in C. elegans (Olsen and
68
Ambros, 1999). With this system, we observe a 30-fold decrease in protein expression in
293T cells at 20 hours post-cotransfection with 5 nM CXCR4 siRNA and a Renilla vector
driven by the TK promoter containing 6 target sites. Quantitation by RPA of mRNA loss
due to CXCR4 siRNA shows no more than a 2-fold decrease in overall messenger RNA
levels, and thus the repression occurs primarily at a translational or post-translational step
in gene expression (Figure 1C).
We next examined the polyribosome profile of the active versus repressed
mRNAs in cytoplasmic extracts made from 293T cells transfected with the above Renilla
reporter and Firefly reporter used as an internal control (lacking binding sites for short
RNA). Cells were extracted with lysis buffer containing 1% NP-40 and 1% deoxycholate
(DOC) and separated by ultracentrifugation on 15-50% linear sucrose gradients (UV
absorbance profiles are shown in figure
D). Under these conditions, both active and
repressed Renilla mRNAs cosediment with polyribosomes, and the distribution of the
mRNA over these fractions was identical within experimental error (Figure
D). As a
control, sedimentation of an internal Firefly control mRNA which was not translationally
inhibited also did not change significantly (Figure
D). Because these mRNAs are
associated with polyribosomes, it is likely that some step after translation initiation is
altered during inhibition by short RNA. As a control for the specificity of observed co-
sedimentation of repressed mRNA with polyribosomes, puromycin release experiments
were performed (see below, Figure 2).
Ribosomes associated with repressed mRNA exhibit peptidyl transferase activity
69
We next tested whether the repressed mRNAs are undergoing active translation
by measuring their responsiveness to a brief incubation (3 minutes) with puromycin.
Puromycin is a chain-terminator that requires ribosomal peptidyl-transferase activity to
be added to the end of the nascent polypeptide chains (Blobel and Sabatini, 1971). Any
off-target effects of puromycin are likely to be minimized during this short (3 minute)
exposure. Polyribosome fractionation and RPA analysis were performed on cells
transfected with targeting or control siRNA and treated or not treated with puromycin for
3 minutes. The profiles of both active and repressed mRNAs similarly shift to fewer
polysomes after a 3 minute incubation with puromycin (Figure 2). Since this drug causes
premature termination of protein synthesis, these results indicate that polysomes on
repressed mRNAs are actively involved in peptidyl transferase activity. In addition, the
sensitivity of active and repressed mRNAs to puromycin importantly demonstrates that
their rapid sedimentation in the gradient reflects a genuine association with
polyribosomes and not with other large non-ribosomal complexes.
IRES initiated translation can be repressed by short RNA
If the mechanism of inhibition was post initiation then functionally bypassing
processes important for normal translational initiation should not affect the inhibition. To
test this prediction, we constructed bicistronic luciferase vectors separated by the
Hepatitis C virus (HCV) or Cricket Paralysis virus Intergenic Region (CrPV-IGR) IRES
sequences. HCV and CrPV-IGR IRES-driven translation requires a subset of initiation
factors that are necessary for cap-dependent translation. HCV IRES directly binds the
40S ribosomal subunit (thereby circumventing the cap requirement for initiation) and
70
requires elF3, eIF2 and methionine tRNA for positioning the 40S at the AUG codon
(Kieft et al., 2001; Pestova et al., 1998). CrPV-IGR IRES-driven translation bypasses all
steps in translational initiation and lacks a requirement for cap-binding, scanning, and all
initiation factors (Wilson et al., 2000).
HCV or CrPV-IGR reporter plasmids were transfected with targeting or control
siRNAs into 293T cells and luciferase assays were performed the following day. In
these experiments, a novel inhibitor of translation initiation, called hippuristanol, was
used. This compound selectively inhibits eIF4A RNA binding activity, inhibiting capdependent protein synthesis, but not affecting HCV- or CrPV-mediated translation
initiation (Bordeleau et al., submitted). Cells were transfected with bicistronic IRES
constructs and siRNA for 4 hours, exposed to 1 uM hippuristanol or DMSO for 10 hours,
and luciferase assays were performed. Hippuristanol caused a significant 20-fold
reduction of cap-dependent translation of upstream Firefly luciferase but only a 2-fold
decrease of downstream Renilla activity driven by either IRES sequence (Figure 3A).
This modest 2-fold decrease could be due to an indirect effect of the inhibition of
translational processes since it was observed with both IRESes. To determine whether
IRES-dependent translation could be repressed by short RNA, bicistronic constructs were
transfected in the presence of targeting CXCR4 or control siRNA and treated with
hippuristanol or DMSO for 10 hours and luciferase assays were performed. In the
presence or the absence of the initiation inhibitor, upstream Firefly and downstream
Renilla expression were repressed similarly by short RNA (Figure 3B).
71
Repression occurs before synthesis of full length polypeptide
To assess the fate of polypeptides synthesized under normal and siRNA silencing
conditions, we performed metabolic labeling experiments on cells transfected with a
Firefly reporter bearing 6 imperfect CXCR4 binding sites and an N-terminal Flag
epitope. Following a 3 minute pulse of radiolabeled methionine and immunoprecipitation
with anti-FLAG conjugated beads, label accumulated in a 65 kDa band, the full-length of
tagged Firefly polypeptide and also in a faster-migrating smear typical of nascent
polypeptide chains. In pulse-chase experiments, the faster-migrating smear was observed
to be short-lived and thus likely represents labeling of nascent polypeptide chains (data
not shown). As expected, no labeled polypeptides were observed in the untransfected
cells (Figure 4). In contrast to the control, translationally repressed Firefly mRNA
produced neither labeled full-length peptide nor labeled nascent polypeptide chains
during the 3 minute incubation. Because the pulse labeling was done in such a short
period of time, the results of this experiment argue strongly against a model of repression
in which short RNAs cause post-translational degradation of the completed polypeptide
chain. Therefore, this experiment suggested that repression occurs before the completion
of the nascent polypeptide chain.
Silencing by short RNAs increases termination
We addressed whether silencing by this system is capable of influencing
translation termination.
Bicistronic luciferase vectors were constructed to measure the
incidence of translational readthrough at a codon, which is inversely proportional to the
72
frequency of translational termination. The Renilla luciferase with 6 bulged CXCR4
binding sites in its 3'UTR was cloned downstream of Firefly luciferase ORF, and each of
the three stop codons were inserted in-frame between the two ORFs. 293T cells were
transfected with the plasmids and with targeting CXCR4 or control siRNA, and luciferase
assays were performed 20 hours post-transfection.
Translational readthrough was
calculated by dividing downstream Renilla expression by the total Renilla plus Firefly
expression as described previously (Grentzmann et al., 1998). In the absence of
inhibition by siRNA, the incidence of translational readthrough was about 4.5% for each
of the three stop codons, similar to what was reported previously for this kind of assay
(Orlova et al., 2003). The addition of siRNA caused a 2-fold decrease in the efficiency of
translation readthrough for any stop codon (Figure 5A). If this decrease in readthrough
was due to an increase in termination while the ribosome was paused at the stop codon,
the expression of a suppressor tRNA should reduce the degree of termination by reducing
the pause. Consistent with this hypothesis, expression of amber suppressor tRNA
produced an 8-fold increase in readthrough and more importantly eliminated the 2-fold
decrease in readthrough caused by the siRNA (Figure SB). These results indicate that
short RNA translational repression interacts negatively with translational elongation at a
location distant from the binding sites (1 kb) and suggest that short RNAs may accentuate
premature termination or early exit of ribosomes within the open reading frame.
Ribosome drop-off on repressed mRNAs
To test the hypothesis of premature termination, we performed in vivo run-off
experiments with the elF4A inhibitor hippuristanol. Cells co-transfected with the Renilla
73
reporter mRNA downstream of the CMV promoter and either the targeting CXCR4 or
control siRNA were treated either with DMSO or
uM hippuristanol for 4 or 5 minutes
at 37 degrees. Under these conditions, protein repression of this Renilla construct by the
CXCR4 siRNA was 12 fold and mRNA loss was less than 2 fold, as measured by
Northern analysis of cytoplasmic mRNA (data not shown). Although as a drug
hippuristanol may theoretically have off-target effects, the short-term nature of these
experiments should minimize them. Further, hippuristanol displayed the expected
properties of a translation initiation inhibitor in these experiments as treatment for 5
minutes resulted in a profound decrease in total cellular polyribosomes and an
accumulation of 80S monosomes as compared to the DMSO control (Figure 6,
absorbance profiles). Treatment for longer times results in complete dissociation of
polyribosomes (data not shown). Northern analysis of fractionated Renilla mRNA
showed that inhibition of translation initiation by hippuristanol resulted in a more rapid
loss of repressed mRNA (Figure 6, targeting siRNA) from the polyribosome regions of
the gradient than that observed for active mRNAs (Figure 6, control siRNA). These
results indicate that the ribosomes on repressed mRNAs are released from their
association with the mRNA more rapidly than are ribosomes on active mRNAs. The
simplest interpretation of these results is that ribosomes exit prematurely from repressed
mRNAs.
74
Repressed mRNA cofractionates with membrane-associated cytoplasmic
compartment
To test whether the mRNA changes its subcellular localization, cell fractionation
by differential detergent solubility was performed. This method has been used previously
to define subcellular compartments containing individual mRNAs (Lerner et al. 2003).
Free cytoplasm was first solubilized in the mild detergent digitonin, and the remaining
membrane-associated
cytoplasm was solubilized in 1% NP-40 and 1% deoxycholate
(Figure 8A). The remaining insoluble material contained nuclei. Western blotting of the
free cytoplasmic GAPDH and ER resident TRAPalpha proteins shows that the free and
membrane compartments were efficiently separated (Figure 8B).
To determine the subcellular distribution of active versus repressed mRNAs we
performed Ribonuclease Protection Assays (RPA) on each subcellular fraction taken
from 293T cells which were transfected with Renilla microRNA silencing reporter and
Firefly control plasmids and either targeting CXCR4 or control siRNA (Fig 8C). In this
assay, cytoplasmic Renilla mRNA has a slightly greater abundance (65%) in the
membrane compartment compared to Firefly mRNA, which is more equally distributed.
These results are consistent with previous experiments which show that even mRNAs
which do not encode secreted or membrane proteins can have significant abundance in
membrane fractions (Lerner et al. 2003). Strikingly, siRNA causes a 6-fold decrease in
mRNA levels in the free cytoplasm but a 1.5-fold reduction in the membrane and nuclear
compartments.
This result can be interpreted in two ways. Either siRNA causes mRNA
degradation specifically of the free cytoplasmic reporter mRNA or it causes a shift in the
75
subcellular distribution of repressed mRNA such that it is more difficult to extract and
co-fractionates with the ER.
Discussion
This study shows that short RNAs repress translation via a novel mechanism in
eukaryotic cells. Our results strongly indicate that repression occurs after the initiation of
translation because IRES-dependent translation can be repressed and because repressed
mRNAs associate with polyribosomes that actively undergo the peptidyl transferase
reaction. However, pulse-labeling experiments indicate that repression occurs before the
completion of full-length polypeptide chain. Silencing by partially complementary short
RNAs increases termination at a distant stop codon and also causes ribosomes associated
with repressed mRNAs to dissociate more rapidly following inhibition of translational
initiation than those associated with active mRNAs. Together, these observations
strongly suggest that short RNAs repress translation by causing ribosomes to exit
prematurely from their associated mRNAs (Figure 7).
Ribosome drop-off by microRNAs could result indirectly from an inhibition of
elongation rates at every position, favoring stochastic release processes, a phenomenon
described for bacterial RNA polymerase (von Hippel and Yager, 1991). In this case, a
very small decrease of elongation processivity at every step (0.01%) would be sufficient
to cause a significant reduction of the synthesis of full-length polypeptides. Our observed
decrease in efficiency of read-through at a stop codon due to translational inhibition by
short RNAs is consistent with this possibility. Alternatively, microRNA complexes
could directly cause premature termination by recruitment of known termination factors
76
such as eRF3 or induction of processes which result in termination, such as a decrease in
the activities of charged tRNA. In either case, the drop-off model of miRNA silencing
could explain why translationally repressed lin-14 and lin-28 mRNAs associate with
polyribosomes, but do not accumulate more ribosomes than the non-repressed mRNA.
To measure the effect of short RNA on translation termination, we devised a
translational readthrough assay.
In this assay, short RNA bulged binding sites were
placed downstream of an in-frame, bicistronic luciferase reporter in which a stop codon
or an encoding codon was placed between the two ORFs (upstream Firefly abbreviated as
ORF1 in the following paragraphs, downstream Renilla abbreviated as ORF2). Addition
of targeting siRNA resulted in 10-fold repression of ORF1 and 20-fold repression of
ORF2 for the constructs containing UAG and UGA stop codons. Repression was 15-fold
for ORF1 and 26-fold for ORF2 for the construct containing UAA stop codon.
Therefore, in each case, short RNAs repressing translation cause a 2-fold greater
repression of downstream ORF2 versus upstream ORF1. This difference accounts for the
relative difference in translational readthrough of each construct, with or without siRNA
(Figure Sa).
As controls, we used similar vectors to measure the fold repression on constructs
with enhanced translational readthrough between ORF1 and ORF2. In one case, the stop
codon between ORFI and ORF2 was replaced with a codon encoding alanine (data not
shown). This construct was repressed 16-fold for ORF1 and 14-fold for ORF2. In a
second control, a construct expressing amber suppressor tRNA was added to cells which
had been transfected with the UAG-containing vector described above. Suppressor tRNA
caused 8-fold enhanced readthrough (Figure 5b), and after addition of siRNA, repression
77
was 1 -fold for ORF1 and 1 -fold for ORF2. Taken together, these two experiments
indicate that under conditions of high readthrough of the codon between ORFI and
ORF2, there was the same level of repression by short RNA of ORF2 compared to ORFI.
The ribosome drop-off model for microRNA translational repression makes a few
predictions about the outcome of the translational readthrough experiments described
above. First, the theory suggests that additional distance traversed by ribosome enhances
the likelihood of ribosome drop-off, so a longer ORF should be repressed to a greater
degree than a shorter ORF. Therefore, in the readthrough constructs, downstream ORF2
should be repressed to a greater degree than the upstream ORF1. However, there are at
least two ways in which this result does not necessarily argue against the drop-off model.
The expectation of enhanced repression with greater length assumes that drop-off events
are not complete after translation of ORF1. However, it is possible that ribosomes
susceptible to drop-off have done so after completion of ORF1. If enough drop-off evens
occur within ORF1 to reach a state of complete silencing, the additional distance in
ORF2 would not be traversed by ribosomes and therefore, this additional distance would
not increase translational repression.
In the case of this bicistronic reporter, the upstream
distance is 2 kb, which may be long enough to ensure maximal repression under these
conditions. Additionally, in the readthrough constructs, because translation does not
terminate efficiently at the end of ORF1, we assume that little unfused ORF1 protein
product is produced. If so, most of the ORF1 product would be fused to ORF2 and
therefore, repression of the two ORFs would be equal. When ORF1 and ORF2 are
separated by a stop codon, however, the majority of ORFI in the cell is unfused. In these
78
vectors, we detect a greater repression of ORF2, which is fused to ORF1, than ORF1
alone, a result which the drop-off theory anticipates.
The drop-off theory also suggests that a repressed mRNA will produce a
distribution of truncated polypeptides biased toward the N-terminal end. Therefore,
another prediction of the model is that repression of ORF2 should be greater than ORF1,
even when readthrough between the two ORFs is high. In our experiments, we do see a
relative reduction of downstream expression versus upstream expression during
translational repression when ORFI and ORF2 are separated by a termination codon
(Figure 5a). However, as stated above, increasing the readthrough between ORF1 and
ORF2 results in no additional repression of ORF2 versus ORF1 (Figure 5b). Possibly,
the truncated polypeptide chains produced by drop-off are not stable. This would explain
why repression of ORF1 and ORF2 is the same when readthrough between them is high.
In a context where readthrough of an internal codon is very inefficient, however, as is the
case for the stop codon-containing constructs, repression downstream of the inefficient
codon is enhanced versus repression of the upstream luciferase. We conclude from this
experiment that microRNAs act at a distance to enhance the process of termination at a
stop codon. This effect could be caused indirectly by decreasing the translation
elongation efficiency in a manner that is greater for codons with already-low efficiency.
Alternatively, this may directly result from increasing the local concentration of
termination factors.
Inhibition at a post-initiation stage has been observed in a variety of systems in
which 3' UTRs regulate translation. In fact, silencing of lin-14 and lin-28 mRNAs by the
lin-4 microRNA was originally interpreted as repression after translation initiation (Olsen
79
and Ambros, 1999; Seggerson et al., 2002). More recently, unlocalized nanos mRNA
was shown to be regulated by its 3' UTR at a step after translation initiation (Clark et al.,
2000). Similarly, IL- I beta mRNA in human monocytes, ribulose 1,5-bisphosphate
carboxylase mRNA in amaranth seedlings, and CKB mRNA in rat brain are associated
with polyribosomes during translational repression and hence are thought to be regulated
after the initiation of translation (Berry et al., 1990; Ch'ng et al., 1990; Kaspar and
Gehrke, 1994; Shen et al., 2003). These situations may share a common mechanism with
translational repression by siRNA and microRNA.
During the preparation of this manuscript, a report showed that let-7 or tethered
Argonaute proteins can repress translation of a designed target mRNA (Pillai et al.,
2005). This inhibition was proposed to occur at the stage of translation initiation.
Therefore, our data and those obtained by Pillai et al. 2005 appear to support two
different mechanisms for translational repression by microRNAs. The differences in the
data are as follows. The first difference is that we observe that repressed mRNAs are
associated with translating ribosomes whereas Pillai et al could detect a decrease in the
ribosome loading of mRNAs during microRNA repression. Pillai et al. interpret this
difference to reflect a defect in translation initiation caused by microRNAs. However, it
is equally possible that the decreased loading reflects an increase in activity ribosome-
drop off during translational repression. Additionally, the ribosome drop-off model
predicts a labile association between ribosomes and repressed mRNA, so it is possible
that this association was lost in the cell-lysis conditions used by Pillai et al. Both Pillai
and our results describe a change in the extraction properties of polysome bound mRNA
after inhibition by miRNAs (Figure 8).
80
A second difference between the two results emerges from the use of IRES to
functionally address the nature of the translational silencing. Pillai et al. transfect cells
with monocistronic, in vitro transcribed mRNAs and observe 10-fold repression of an
mRNA containing a cap but no repression for a similar mRNA lacking a cap and
containing an IRES. They conclude from this experiment that microRNAs repress a step
in translation during translation initiation. The rationale behind using cap-less mRNAs is
to ensure that the IRES directs a truly cap-independent translational repression.
However, a loss of cap may cause effects on other aspects of translation. In essence,
Pillai et al. are interpreting a negative result, no inhibition. In this regard, the control of
miRNA repression of the transfected capped mRNA is important in interpretation of
these results. However, Pillai et al. do not show that microRNA repression by this assay
of transfection of capped RNA is a translational repression phenomenon. Possibly, they
have recapitulated an mRNA-degradative microRNA phenomenon. If this were the case,
the structured IRES may cause an inability for a 5'-3' exonuclease to degrade the mRNA
in a microRNA-dependent
fashion. Finally, a cap-less mRNA may not accurately
represent the behavior of capped mRNA in an unknown manner. In our IRES
experiments, we use bicistronic plasmid reporters in which viral IRESes are inserted
between two open reading frames. Within the cell, these plasmids express bicistronic
messenger RNA which is capped. In these experiments, inhibition of cap-dependent
translation initiation using the drug hippuristanol, which targets eIF4A, results in 26-fold
downregulation of upstream activity but only 2-fold downregulation of translation
activity downstream of the IRES, suggesting that the IRESes are active in this context.
Both upstream cap-dependent and downstream cap-independent translation is repressible
81
by microRNA, either for the HCV and the CPV IRES, the latter of which requires no
initiation factors for translation. These results suggest that in the context of mRNA
which contains a cap and undergoes essentially normal mRNA maturation and export,
translational repression by microRNA does not affect translation initiation.
Possibly, translational repression by miRNAs has different consequences
depending on the cell type, target mRNA or miRNA sequence. Notably, 3' UTR
regulation of oskar mRNA translation can occur at two different stages. BRE elements in
the 3'UTR of oskar mRNA repress initiation through interactions with Bruno and Cup
proteins, but at a later time in development, the BRE causes a post-initiation repression
where repressed mRNAs cosediment with puromycin-sensitive polyribosomes (Braat et
al., 2004). The general observation that most mammalian microRNAs co-sediment with
polyribosomes suggests that most endogenous targets of miRNAs are indeed regulated
after translational initiation (Kim et al., 2004; Nelson et al., 2004).
No mechanism has been established in eukaryotic cells for ribosome drop-off
within an open reading frame. However, ribosome drop-off is known to occur in vivo
and in vitro in prokaryotic translation in which peptidyl-tRNA dissociates from the
ribosome at significant rates before reaching the stop codon (Jorgensen and Kurland,
1990; Manley, 1978). The mechanism of early peptidyl-tRNA release is not well
understood, but the process requires ribosome recycling factor RRF, elongation factor
EF-G, release factors RF3 and initiation factors IF1 and IF2 (Dincbas et al., 1999;
Heurgue-Hamard et al., 1998; Karimi et al., 1998; Singh and Varshney, 2004).
Additionally, ribosome drop-off by microRNAs could trigger nonsense-mediated decay
(NMD), an mRNA degradation process initiated by a premature termination codon (PTC)
82
located upstream of the final intron in aberrant mRNAs (Neu-Yilik et al., 2004). Indeed,
a connection between short RNAs and NMD has been established in C. elegans, in which
NMD factors sg-2, -5, and -6 are required for RNA interference (Domeier et al., 2000).
Possibly, NMD could explain why microRNAs cause localization of target mRNAs in or
near P-granules and cause a variable amount of mRNA degradation (Bagga et al., 2005;
Liu et al., 2005; Pillai et al., 2005; Sen and Blau, 2005). Alternatively, transiently paused
ribosomes with an increased probability for termination could facilitate nuclease
accessibility within the mRNA, which could account for the appearance of long mRNA
degradation products during lin-4 and let-7 silencing in worms (Bagga et al., 2005).
Future studies will be necessary to address which stages of translational elongation or
termination are influenced by short RNAs as well as which trans acting factors are
involved in short RNA-mediated ribosome drop-off.
83
Methods and Materials
Transfections and cell culture
Cells were transfected with lipofectamine 2000 (invitrogen) according to the
manufacturer's instructions. The media was replaced 4 hours post-transfection. 293T
cells were grown in DMEM supplemented with 10% IFS, penicillin/streptomycin
and L-
glutamine.
Polyribosome fractionation
At 20h post-transfection, one 60 cm plate of 293T cells per gradient were immediately
placed on ice and washed twice with cold PBS containing 100 uM cycloheximide
(sigma), and lysed by addition of 500 uL of lysis buffer ( 10mM potassium acetate, 2
mM magnesium acetate, 10 mM Hepes pH 7.5, 50 mM potassium chloride, 10 mM
magnesium chloride, 2 mM DTT, 1% NP-40 and 1% deoxycholate, supplemented with
lx Complete-mini protease inhibitors, 500 U/ml RNasin, and 100 uM cycloheximide),
scraped and collected in microfuge tubes. The cell mixture was homogenized 8 times
with a 26 gauge needle at 4 degrees and centrifuged for 10 minutes at 4800rpm. Extracts
were layered onto 11 ml 15-50% linear sucrose gradients that were prepared by
horizontal diffusion and centrifuged in an SW-41Ti rotor at 40,000 rpm for 90 minutes.
Gradients were fractionated by upward displacement with 60% sucrose on an ISCO
fraction-collector, and absorbance at 254 nm was monitored continuously. The addition
of cycloheximide to PBS washes or extract did not change the polysome profile (data not
shown) and was omitted in figure 6. Fractions were supplemented with SDS to 0.5% and
84
treated with proteinase K at 37 degrees for 1 hour. RNA was extracted with acid phenol
(Ambion) and precipitated with isopropanol, washed with 75% Ethanol, and resuspended
in DNase I reaction buffer (DNase-free, Ambion). DNase was removed with anti-DNase
beads and RNA was analyzed by RPA or Northern analysis. Probes for RPA of Renilla
and Firefly luciferase mRNAs were used as described previously and the Northern probe
for Renilla mRNA consisted of a HindIII/XbaI fragment encompassing the open reading
frame (Doench and Sharp, 2004). For polysome run-on analysis in figure 6, 1 uM of
Hipperistanol or DMSO was added to cells for 4 or 5 minutes at 37 degrees. Cells were
harvested and fractionated as described above. Northern analysis was performed using a
probe spanning the open reading frame of Renilla luciferase.
IRES experiments
The HCV plasmid was constructed by PCR cloning HCV IRES into the NheI site of pRL
x 6 and inserting the Firefly luciferase ORF from pGL3 (HindIII, XbaI) into the resulting
vector (HinduIl, SpeI). CrPV IRES sequence was cloned by splint ligation of two
synthetic 100-mers, and PCR cloning into the 5'UTR of pRL-TKx6 and to the resulting
construct the Firefly luciferase ORF was then inserted similarly. The resulting constructs
were verified by DNA sequencing. Bicistronic luciferase vectors with microRNA
binding sites in the 3' UTR of the downstream cistron were constructed by inserting the
Ppluc ORF from pGL3 (HindIII and XbaI) into HindIll and NheI sites in pRL-TK x 6
described previously (Doench et al., 2003). 0.8 ug of reporter plasmid was co-transfected
with 5 nM of targeting CXCR4 or control siRNA (Invitrogen). 4 hours post-transfection,
85
the media was replaced with media containing either DMSO or 1 uM Hipperistanol and
luciferase assays were performed 10 hours later.
Translational readthrough assay
The stop codon of Ppluc ORF of pGL3 was removed by PCR and each of the stop codons
(UAG, UAA, UGA) was inserted. These products were inserted into the bicistronic HCV
IRES construct described above, removing the IRES. The resulting constructs contained
Firefly ORF fused in-frame to Renilla with 18 bp distance between the stop codon and
the first ATG within Renilla ORF. All constructs were sequenced to confirm the
indicated structure. 293T cells were transfected with each of these constructs, with 5 nM
targeting CXCR4 or control siRNA (Invitrogen), and luciferase assays were performed 8
hours later. Readthrough was calculated as a ratio of downstream Renilla expression to
the sum of upstream Firefly plus downstream Renilla (Renilla I (Firefly + Renilla))
(Grentzmann et al., 1998). In experiments with suppressor tRNA, 0.08 ug serine amber
suppressor tRNA plasmid was co-transfected with 0.72 ug readthrough reporter and 5 nM
siRNA.
Metabolic labeling and immunoprecipitaiton
4x10^5 293T cells were co-transfected with 2.4 ug N-terminally flag tagged firefly
luciferase cloned into pcDNA3.1 containing 6 bulged binding sites complementary to
CXCR4 siRNA in its 3' UTR, and either 25 nM targeting CXCR4 siRNA or control
siRNA (Invitrogen). 20h post-transfection, the cells were starved in Met-, Cys- media for
20 min and pulse labeled with 100 uCi 35-S methionine ExpreSS labeling media (NEN)
86
for 3 minutes at 37 degrees. Cells were then washed with cold PBS, lysed in RIPA buffer
and centrifuged for 10 minutes at 10,000 rpm at 4 degrees. Extracts were normalized by
scintillation counting and were pre-cleared by treatment with 1/10 v Sepharose G for 1
hour and the supernatants from this pre-clear were then incubated with anti-FLAG M2
beads for 1.5 h. These beads were washed three times with lysis buffer and eluted with
lx sample buffer lacking DTT. The eluates were separated on a 4-20% Tris-glycine
polyacrylamide gel, dried and visualized by autoradiography.
Subcellular fractionation
Free and membrane associated cytoplasm fractions were isolated by differential
detergent solubility and centrifugation essentially as described previously (Lerner et al.
2003). Briefly, 2x1OA6293T cells were washed twice with cold PBS, and collected in
500 ul lysis buffer (150 mM potassium acetate, 20mM Hepes pH 7.5, 2.5 mM
magnesium acetate, 2 mM DTT, 200 U/ml Superasin (ambion) and Complete-mini
(Roche)). Digitonin (Sigma) was added to 200 ug/ml, the cells were placed on ice for 5
minutes and centrifuged at 4 degrees for 5 minutes at 500g. The supernatant was further
centrifuged for 10 minutes at 7500g and this supernatant contained free cytoplasm. The
post-digitonin pellet was washed once with lysis buffer containing no detergent, extracted
with lysis buffer containing 1% deoxycholate and 1% NP-40 and centrifuged at 4 degrees
for 5 minutes at 500g to give a supernatant that contained the membrane-bound
cytoplasmic fraction.
87
Acknowledgments
Suppressor tRNA plasmid was a kind gift from Dr. U. Rajbhandary.
HCV IRES
sequences were a gift from Dr. S. Lemon. Hippuristanol was a kind gift of Dr. Junichi
Tanaka (University of Ryukyus, Okinawa). C.P.P. acknowledges Dr. D. Housman, Dr. F.
Goldberg, Dr. U. Rajbhandary and Sharp lab members for helpful conversations. This
work was supported by United States Public Health Service RO -GM34277 from the
National Institutes of Health, PO1-CA42063 and U 19 AI056900 from the National
Cancer Institute to PAS and partially by Cancer Center Support (core) grant P30CA14051 from the National Cancer Institute and an NCIC grant (#014313) to J.P. C.P.P
was funded in part by an NSF graduate research fellowship. J.P. is a Canadian Institutes
of Health Research (CIHR) Senior Scientist.
88
A
80S
Dj
I
i
i
ctrl
ctl siRNA
B
Rx6
mRNA
~
AAGUUUUCAC
AGCUAACA
I II
I I I I I I I
I I I I I I I I
TTCAAAAGUGAGGUCGAUUGU
ctrl
CXCR4 siRNA
siRNA (antisense
to CXCR4)
Rx6
25
+targeting
<{
Z
+control
a:
E
C
0
t:
35
~
30
~
25
CV
~
20
CV
15
~
15
u
::l
(f)
(f)
c..
20
Qj
&.
C
10
jij
+-'
o
o
c?
.....
+-'
o
1
-C 10
0
~
siRNA
siRNA
2
3
4
5
6
7
8
9
10 11
7
8
9
10 11
fraction
5
25
<{
0
z
total mRNA
protein
E
20
(5
'-
+-'
E
15
u
u
::l
~
10
jij
+-'
o
o
c?
.:::
5
o
1
2
3
4
5
6
fraction
Figure 1
control siRNA
targeting siRNA
I \
I \
, i
! \
! i
: \
control
!
\
\~.f-"\ II
'".~
. r\ }r \j r'.';<jV
\\
· \JI
'\... /'oJ 'J
\
\
I.....
.6.
2 3 4 5 6 7 8 9 10
1 2
\
\
3min
puromycin
j
i
i
\
\
i
\.
; I
\
3 4 5 6 7 8 9 10
I
\ /\ i
v V
..
'
-'\
\.~..
1
Figure 2
2
3 4 5 6 7 8 9 10
1 2
'"
3 456789
stop
stop
I -:------J.___........
IRES '--:::::::::
A
binding sites
nnnnnn
1.2
• upstream
• downstream
1
c
o
'in
VI
f
0.8
0.
><
cu
'a
cu
0.6
N
E
0.4
L.
o
Z 0.2 -
o
1 uM Hipp
no drug
CPV
HCV
B
1 uM Hipp
no drug
c
o 1.2
'in
• upstream
• downstream
VI
cu
So
1
><
cu
fa
0.8
c
cu
a: 0.6
L.
o
>
0.4
cuL.
;
U.
cu 0.2
>
:wra
cu
L.
Hippuristanol
no drug
Figure 3
+ siRNA
+ siRNA
HCV
no drug
Hippuristanol
CPV
input
plasmid
siRNA
Figure 4
- +
- -
eluate
+
+
- +
+
+
~
stop
t
sop
A
bu~ed
sites
n nnnn
~
_L
5
4.5
4
J:
en
3.5
~
0
~
3
:c
2.5
"'cu~
2
J:
~
1.5
1
0.5
0
+
siRNA
UGA
UAA
UAG
B
+
+ siRNA
siRNA
45
40 -
"& 35
g
30
L.
...,
J: 25
~ 20
~ 15
~ 10
5
o
- siRNA
+
untreated
Figure 5
siRNA
- siRNA
+
su(tRNA)
siRNA
Control siRNA
Targeting siRNA
DMSO
5 min
II
DMSO
'1IIIIi~
4min
i
Smin
¥
•
L~"
l:-
~
..:".
j
•......
::.
f'
.~
It.
-.
'.
~
•
25
25
20
20
ii 15
15
...B0
i-
10
~
3
4
5
6
fraction
Figure 6
c"
~~"
t
,
.~...
,.It:~'
....
10
-
2
.
7
8
9
10
1
2
3
4
5
6
fraction
7
8
9
10
AAAAA
Ca
ribosome drop-off
Figure 7
A
Digitonin
Free soluble
+
+
Pellet
1%NP40,1 %DOC
Membrane associated
Nuclei
B
F
M
siRNA
- +
+
GAPDH! .....
..
TRAPal---
I
I
1 2 3 4 5
C
active
wI F w2 M N
Pp ctrl
Rrx6
Figure 8
repressed
wI F w2 M N
Figure Legends
Figure 1. Repressed mRNA associates with polyribosomes
(A) 293T cells were transfected with pGL3 control and pRL-TK containing 6 binding
sites in its 3'UTR complemtary to CXCR4 siRNA, and with either targeting CXCR4 or
control siRNA (Invitrogen). (B) Schematic illustrating the interaction between CXCR4
siRNA and target mRNA sequence. (C) Protein and total RNA analysis of cells 20h posttransfection.
Luciferase assays were performed and the fold repression by siRNA
calculated by normalizing Renilla to Firefly expression and dividing the ratio obtained
from cells treated with control siRNA into the ratio obtained from cells treated with
targeting CXCR4 siRNA. RNA analysis by RPA was performed simultaneously on total
RNA prepared using Trizol and quantitated as in the luciferase assay. Error bars
represent standard deviations. (D) Extracts prepared from transfected cells were
separated on 15-50% sucrose gradients. The absorbance profile is shown (top panel) with
polysomal fractions indicated. 11 fractions were collected and analyzed by RPA for
abundance of Renilla (bottom band, indicated by bar) and Firefly (top band) mRNA
simultaneously for each siRNA treatment (separate panels). Signal from each fraction
was quantitated and normalized to the total intensity across all fractions for Renilla
reporter and Firefly control (separate panels).
Figure 2. Ribosomes associated with repressed mRNA exhibit peptidyl transferase
activity.
Cells were transfected with Renilla reporter and control or CXCR4 targeting siRNA as in
Figure 1, and 20 hours later were incubated with or without 100 ug/ml puromycin for 3
97
minutes at 37 degrees before lysis and fractionation.
The distribution of Renilla mRNA
was detected by RPA. This experiment was repeated two times.
Figure 3. IRES-dependent translation can be repressed by short RNA.
(A) Bicistronic luciferase vectors containing the Hepatitis C Virus (HCV) and Cricket
Paralysis Virus Intergenic Region (CrPV-IGR) IRESes and short RNA binding sites in
the 3' UTR of the downstream cistron were transfected into 293T cells for 4 hours and
then cells were treated with either DMSO (dark gray) or 1 uM eIF4A inhibitor
hipperistanol (light gray) for 10 hours. Luciferase assays were performed and the
relative amount of upstream Firefly and downstream Renilla activities is shown,
normalized to the activity of each cistron in the absence of drug for each IRES construct.
Results are presented as the average of three experiments with standard deviations
indicated. (B) HCV or CrPV-IGR plasmids were transfected with targeting 5 nM CXCR4
or control siRNA (Invitrogen) for 4 hours then administered DMSO or 1 uM
hipperistanol for 10 h. Luciferase assays are normalized to the control siRNA treatment,
for both DMSO and drug treatments, for each cistron. All experiments were done in
triplicate and error bars represent standard deviations.
Figure 4. Repression occurs prior to synthesis of full-length polypeptide.
293T cells were co-transfected with 2xFlag Ppluc pcDNA3.1 containing 6 bulged binding
sites complementary to CXCR4 siRNA and either targeting CXCR4 siRNA or control
siRNA (Invitrogen).
20h post-transfection, cells were starved in Met- media for 20 min
and then pulse labeled with 100 uCi S35 methionine for 3 minutes at 37 degrees. The
98
cells were then harvested and immunoprecipitated on anti-FLAG M2 beads. The eluates
were separated on a 4-20% Tris-glycine polyacrylamide gel and visualized by
autoradiography.
The bar marks the migration rate of full-length polypeptide, and the
faster migrating label was shown by pulse-chase experiments (data not shown) to be
transient and thus probably nascent polypeptide chains.
Figure 5. Silencing by short RNAs increases termination at stop-codons.
(A) In-frame bicistronic luciferase vector with each of the three possible stop codons
were transfected into 293T cells with either the targeting CXCR4 or control siRNA
(Invitrogen). Luciferase assays were performed 24 hours later, and readthrough was
calculated as the ratio between downstream Renilla activity and the sum of downstream
Renilla plus upstream Firefly activities. Error bars represent standard deviations. (B)
Cotransfection of a plasmid encoding an amber, serine supressor tRNA enhances
translational readthrough of the bicistronic construct containing an amber stop codon and
dramatically reduces the microRNA-dependent reduction in translational readthrough.
Error bars represent standard deviations.
Figure 6. Drop-off of ribosomes associated with repressed mRNAs
Cells were co-transfected with the Renilla luciferase vector containing 6 CXCR4 binding
sites and driven by the CMV promoter and either the targeting CXCR4 siRNA or control
siRNA (Invitrogen).
24 hours later, cells were either treated for 4 or 5 minutes with the
elF4A inhibitor hipperanistol (1 uM) or DMSO at 37 degrees before cell lysis and
polyribosome separation.
10 fractions were collected and RNA was harvested and
99
subjected to Northern analysis. Quantitations are shown below comparing control (light
gray), 4 minute treatment (dark grey) and 5 minute treatment (black) for active mRNAs
treated with control siRNA (bottom right) or repressed mRNAs treated with targeting
CXCR4 siRNA (bottom left), normalizing to the total amount of signal across all
fractions.
Figure 7. Short RNAs repress translation after initiation in human cells. Short RNA
complexes associated with Argonaute proteins bind with mismatches to the 3' UTR of a
target gene and act at a distance to cause drop-off of translating ribosomes at multiple
sites within the open-reading frame. A very small increase in drop-off frequency at
multiple sites would significantly decrease the synthesis of full-length polypeptides.
Note that if the initiation rate is sufficiently high, such ribosome drop-off would not
significantly decrease ribosome loading.
Figure 8. Repressed mRNAs co-fractionates with a membrane-bound compartment
within the cytoplasm. (A) Transfected 293T cells were fractionated by differential
detergent solubility to give a free-soluble cytoplasmic fraction (F) soluble in 200 ug/ml
digitonin, a membrane-bound cytoplasmic fraction (M) soluble in 1% NP-40 and 1%
DOC, and an insoluble fraction which contained nuclei (N). (B) Western blotting of
GAPDH and TRAPalpha shows efficient separation of free-soluble (lane 4 and 5) and
membrane-associated (lane 2 and 3) cytoplasmic compartments compared to
unfractionated extracts (lane 1), regardless of siRNA treatment (lane 4 versus 5 and 2
versus 3). (C) RPA analysis shows that repressed Renilla mRNA (lower band) is lost
100
from the free-soluble compartment (lanes 2 and 7, lower band) but not from the
membrane-soluble compartment (lanes 4 and 9, lower band), whereas there is no change
in the distribution of control Firefly mRNA (upper band in lanes 2, 7, 4 and 9). Washes
are shown, as well as material in nuclei (lanes 1, 3, 5, 6, 8, 10).
101
References
Bagga, S., Bracht, J., Hunter, S., Massirer, K., Holtz, J., Eachus, R., and Pasquinelli, A.
E. (2005). Regulation by let-7 and lin-4 miRNAs Results in Target mRNA Degradation.
Cell 122, 553-563.
Bartel, D. P. (2004). MicroRNAs: genomics, biogenesis, mechanism, and function. Cell
116, 281-297.
Berezikov, E., Guryev, V., van de Belt, J., Wienholds, E., Plasterk, R. H., and Cuppen, E.
(2005). Phylogenetic shadowing and computational identification of human microRNA
genes. Cell 120, 21-24.
Berry, J. O., Breiding, D. E., and Klessig, D. F. (1990). Light-mediated control of
translational initiation of ribulose-1, 5-bisphosphate carboxylase in amaranth cotyledons.
Plant Cell 2, 795-803.
Blobel, G., and Sabatini, D. (1971). Dissociation of mammalian polyribosomes into
subunits by puromycin. Proc Natl Acad Sci U S A 68, 390-394.
Braat, A. K., Yan, N., Amrn,E., Harrison, D., and Macdonald, P. M. (2004). Localization-
dependent oskar protein accumulation; control after the initiation of translation. Dev Cell
7, 125-131.
Brennecke, J., Hipfner, D. R., Stark, A., Russell, R. B., and Cohen, S. M. (2003). bantam
encodes a developmentally regulated microRNA that controls cell proliferation and
regulates the proapoptotic gene hid in Drosophila. Cell 113, 25-36.
Brennecke, J., Stark, A., Russell, R. B., and Cohen, S. M. (2005). Principles of
MicroRNA-Target Recognition. PLoS Biol 3, e85.
Ch'ng, J. L., Shoemaker, D. L., Schimmel, P., and Holmes, E. W. (1990). Reversal of
creatine kinase translational repression by 3' untranslated sequences. Science 248, 10031006.
Clark, I. E., Wyckoff, D., and Gavis, E. R. (2000). Synthesis of the posterior determinant
Nanos is spatially restricted by a novel cotranslational regulatory mechanism. Curr Biol
10, 1311-1314.
Dincbas, V., Heurgue-Hamard, V., Buckingham, R. H., Karimi, R., and Ehrenberg, M.
(1999). Shutdown in protein synthesis due to the expression of mini-genes in bacteria. J
Mol Biol 291, 745-759.
D)oench, J. G., Petersen, C. P., and Sharp, P. A. (2003). siRNAs can function as miRNAs.
Genes Dev 17, 438-442.
102
Doench, J. G., and Sharp, P. A. (2004). Specificity of microRNA target selection in
translational repression. Genes Dev 18, 504-511.
Domeier,
M. E., Morse, D. P., Knight, S. W., Portereiko,
M., Bass, B. L., and Mango, S.
E. (2000). A link between RNA interference and nonsense-mediated decay in
Caenorhabditis elegans. Science 289, 1928-1931.
Grentzmann, G., Ingram, J. A., Kelly, P. J., Gesteland, R. F., and Atkins, J. F. (1998). A
dual-luciferase reporter system for studying recoding signals. Rna 4, 479-486.
Heurgue-Hamard, V., Karimi, R., Mora, L., MacDougall, J., Leboeuf, C., Grentzmann,
G., Ehrenberg, M., and Buckingham, R. H. (1998). Ribosome release factor RF4 and
termination factor RF3 are involved in dissociation of peptidyl-tRNA from the ribosome.
Embo J 17, 808-816.
Hutvagner, G., and Zamore, P. D. (2002). A microRNA in a multiple-turnover RNAi
enzyme complex. Science 297, 2056-2060.
Jorgensen, F., and Kurland, C. G. (1990). Processivity errors of gene expression in
Escherichia coli. J Mol Biol 215, 511-521.
Karimi, R., Pavlov, M. Y., Heurgue-Hamard, V., Buckingham, R. H., and Ehrenberg, M.
(1998). Initiation factors IF1 and IF2 synergistically remove peptidyl-tRNAs with short
polypeptides from the P-site of translating Escherichia coli ribosomes. J Mol Biol 281,
241-252.
Kaspar, R. L., and Gehrke, L. (1994). Peripheral blood mononuclear cells stimulated with
C5a or lipopolysaccharide to synthesize equivalent levels of IL-1 beta mRNA show
unequal IL-1 beta protein accumulation but similar polyribosome profiles. J Immunol
153, 277-286.
Kieft, J. S., Grech, A., Adams, P., and Doudna, J. A. (2001). Mechanisms of internal
ribosome entry in translation initiation. Cold Spring Harb Symp Quant Biol 66, 277-283.
Kim, J., Krichevsky, A., Grad, Y., Hayes, G. D., Kosik, K. S., Church, G. M., and
Ruvkun, G. (2004). Identification of many microRNAs that copurify with polyribosomes
in mammalian neurons. Proc Natl Acad Sci U S A 101, 360-365.
Kloosterman, W. P., Wienholds, E., Ketting, R. F., and Plasterk, R. H. (2004). Substrate
requirements for let-7 function in the developing zebrafish embryo. Nucleic Acids Res
32, 6284-6291.
Lewis, B. P., Burge, C. B., and Bartel, D. P. (2005). Conserved seed pairing, often
flanked by adenosines, indicates that thousands of human genes are microRNA targets.
Cell 120, 15-20.
103
Lewis, B. P., Shih, I. H., Jones-Rhoades, M. W., Bartel, D. P., and Burge, C. B. (2003).
Prediction of mammalian microRNA targets. Cell 115, 787-798.
Liu, J., Carmell, M. A., Rivas, F. V., Marsden, C. G., Thomson, J. M., Song, J. J.,
Hammond, S. M., Joshua-Tor, L., and Hannon, G. J. (2004). Argonaute2 is the catalytic
engine of mammalian RNAi. Science 305, 1437-1441.
Liu, J., Valencia-Sanchez, M. A., Hannon, G. J., and Parker, R. (2005). MicroRNA-
dependent localization of targeted mRNAs to mammalian P-bodies. Nat Cell Biol 7, 719723.
Manley, J. L. (1978). Synthesis and degradation of termination and prematuretermination fragments of beta-galactosidase in vitro and in vivo. J Mol Biol 125, 407-
432.
Nelson, P. T., Hatzigeorgiou, A. G., and Mourelatos, Z. (2004). miRNP:mRNA
association in polyribosomes in a human neuronal cell line. RNA 10, 387-394.
Neu-Yilik, G., Gehring, N. H., Hentze, M. W., and Kulozik, A. E. (2004). Nonsensemediated mRNA decay: from vacuum cleaner to Swiss army knife. Genome Biol 5, 218.
O'Donnell, K. A., Wentzel, E. A., Zeller, K. I., Dang, C. V., and Mendell, J. T. (2005). c-
Myc-regulated microRNAs modulate E2F1 expression. Nature 435, 839-843.
Olsen, P. H., and Ambros, V. (1999). The lin-4 regulatory RNA controls developmental
timing in Caenorhabditis elegans by blocking LIN-14 protein synthesis after the initiation
of translation. Dev Biol 216, 671-680.
Orlova, M., Yueh, A., Leung, J., and Goff, S. P. (2003). Reverse transcriptase of
Moloney murine leukemia virus binds to eukaryotic release factor 1 to modulate
suppression of translational termination. Cell 115, 319-331.
Pestova, T. V., Shatsky, I. N., Fletcher, S. P., Jackson, R. J., and Hellen, C. U. (1998). A
prokaryotic-like mode of cytoplasmic eukaryotic ribosome binding to the initiation codon
during internal translation initiation of hepatitis C and classical swine fever virus RNAs.
Genes Dev 12, 67-83.
Petersen, C. P., Doench, J. G., Grishok, A., and Sharp, P. A. (2005). The Biology of
Short RNAs. In The RNA World, Third Edition, R. F. Gesteland, J. F. Atkins, and T. R.
Cech, eds. (Cold Spring Harbor, CSHL Press).
Pillai, R. S., Artus, C. G., and Filipowicz, W. (2004). Tethering of human Ago proteins to
mRNA mimics the miRNA-mediated repression of protein synthesis. RNA 10, 15181525.
104
Pillai, R. S., Bhattacharyya,
S. N., Artus, C. G., Zoller, T., Cougot, N., Basyuk, E.,
Bertrand, E., and Filipowicz, W. (2005). Inhibition of Translational Initiation by let-7
MicroRNA in Human Cells. Science.
Seggerson, K., Tang, L., and Moss, E. G. (2002). Two genetic circuits repress the
Caenorhabditis elegans heterochronic gene lin-28 after translation initiation. Dev Biol
243, 215-225.
Sen, G. L., and Blau, H. M. (2005). Argonaute 2/RISC resides in sites of mammalian
mRNA decay known as cytoplasmic bodies. Nat Cell Biol 7, 633-636.
Shen, W., Willis, D., Zhang, Y., and Molloy, G. R. (2003). Expression of creatine kinase
isoenzyme genes during postnatal development of rat brain cerebrum: evidence for
posttranscriptional regulation. Dev Neurosci 25, 421-435.
Singh, N. S., and Varshney, U. (2004). A physiological connection between tmRNA and
peptidyl-tRNA hydrolase functions in Escherichia coli. Nucleic Acids Res 32, 60286037.
von Hippel, . H., and Yager, T. D. (1991). Transcript elongation and termination are
competitive kinetic processes. Proc Natl Acad Sci U S A 88, 2307-2311.
Wilson, J. E., Pestova, T. V., Hellen, C. U., and Sarnow, P. (2000). Initiation of protein
synthesis fromnthe A site of the ribosome. Cell 102, 511-520.
Xie, X., Lu, J., Kulbokas, E. J., Golub, T. R., Mootha, V., Lindblad-Toh, K., Lander, E.
S., and Kellis, M. (2005). Systematic discovery of regulatory motifs in human promoters
and 3' UTRs by comparison of several mammals. Nature 434, 338-345.
Yekta, S., Shih, I. H., and Bartel, D. P. (2004). MicroRNA-directed cleavage of HOXB8
mRNA. Science 304, 594-596.
Zeng, Y., Yi, R., and Cullen, B. R. (2003). MicroRNAs and small interfering RNAs can
inhibit mRNA expression by similar mechanisms. Proc Natl Acad Sci U S A 100, 9779-
9784.
105
Conclusions
106
We have developed a cell culture system in which the CXCR4 short RNA causes
translational silencing of a heterologous reporter gene. This system has provided, and
continues to provide, important insights into the mechanism of microRNA silencing.
We showed for the first time, in Chapter 2, that the nature of interaction between
short RNA and target mRNA, not the origin of the short RNA, dictates the outcome of
silencing (Doench et al. 2003). Perfect or near-perfect basepairing results in
predominately RNAi cleavage of a target mRNA whereas imperfect basepairing results in
translational repression, a result that has been confirmed by others (Zeng et al. 2003).
Subsequent work has shown that while siRNA and microRNA pathways share protein
components in the initiator phase (e.g. Dicer), other components are not shared (e.g.
R2D2 versus Pasha). However, because siRNAs and microRNAs are functionally
redundant in their action, we hypothesize that the effecter complexes mediating
translational repression may possess a redundant protein composition.
In this regard, a significant pair of discoveries have shown that Argonaute 2, the
catalytic core of RNAi, is not required for translational repression, yet any of Argonautes
2-4 are sufficient to cause translational repression (Liu et al. 2004; Pillai et al. 2004). It is
not known whether all Argonautes function redundantly to cause translational repression
in mammals or whether they each possess unique functions other than RNase H cleavage
by Argonaute 2. Genetic studies of each Argonaute will be useful for addressing this
question, as will in vitro reconstitution of microRNA-dependent translational repression.
P-body localization of mRNAs is a compelling general hypothesis which may
prove to be a unifying theory of many diverse types of known post-transcriptional and
107
translational repression pathways. However, the evidence is not currently strong enough
for P-body localization to be declared causative of silencing mediated by microRNAs
(Liu et al. 2005; Pillai et al. 2005). Although a compelling notion, the studies upon
which the hypothesis is based show that only a fraction of the repressed mRNA is
localized to cytoplasmic foci (R. Pillai, personal communication).
Such observations
suggest that P-body localization is not the only process involved in the silencing, unless
the remaining mRNA were associated with P-body components but not located within
discrete loci (R. Parker, personal communication). Careful quantitation of the extent of
association (for example by immunoprecipitation)
between repressed mRNA and P body
components (GW184 or Dhhlp, for example) could possibly resolve this issue. On the
other hand, since it is known that a variable degree of mRNA degradation is inevitably
associated with translational repression by microRNAs, this limited amount of P-body
localization could be the product of cleavage products caused either directly or indirectly
by translational repression. Additionally, genetic studies of translational repression by
microRNAs could also resolve this issue once it is clear which P-body components are
necessary for regulation.
Studies on the CXCR4 reporter experimentally discovered the seed hypothesis of
microRNA/mRNA
interactions, another general property of miRNAs which has been
validated in other systems (Doench and Sharp 2004). Computational studies which
independently derived and employed the seed hypothesis have shown that the biology
regulated by microRNAs is vast. Indeed, 22% of all mammalian 3' UTRs contain
conserved microRNA binding sites, and microRNA interaction sites account for the
majority of conservation in 3' UTRs, so each microRNA potentially regulates numerous
108
targets (Lewis et al. 2005; Xie et al. 2005). This observation supports the
"micromanager" model in which each microRNA is responsible for fine-tuning
expression of many genes. On the other hand, genetic data would suggest that the major
function of lin-4 microRNA in C. elegans, timing the L4 to adult transition in
hypodermal cells, requires the regulation of only lin-14. This is concluded because lossof-function mutations in lin-14 alone can suppress the heterochronic defect caused by
loss of function mutations in lin-4 (Ambros 1989). However, lin-4 may be an exceptional
microRNA in this degree of specificity. Indeed, loss of function of the majority of
individual microRNAs in C. elegans produces no phenotype (E. Alvarez-Saavedra,
personal communication).
Regardless, it will be important to provide genetic evidence in
support of the micromanager model. With growing examples of microRNAs required for
mammalian developmental processes, and better power to predict relevant targets, it will
be interesting to determine, for a given microRNA and a given process, how many targets
are necessary to confer microRNA-dependent
phenotypes. Likewise, it will be very
informative to employ similar computational strategies to determine how many C.
elegans genes possess conserved lin-4 regulatory sites, and thus directly compare
computation with genetic data.
Our model system has also provided insights into the mechanism of microRNA
repression (Chapter 3). Like the lin-4 endogenous microRNA in C. elegans, the CXCR4
engineered short RNA in mammalian cells inhibits translation after initiation, pointing to
a broadly conserved mechanism for gene regulation. With the knowledge of the overall
physical model of the repression, ribosome drop-off, it will now be possible to take
directed genetic approaches to identify the genes necessary for translational repression by
109
microRNAs.
In particular, future work should attempt to knockdown the elongation
factors, termination factors, and related proteins to see whether any are required for
repression. Alternatively, undirected genetic screens could be performed using
knockdown libraries, preferably in Drosophila S2 cells because of their apparent lower
redundancy in RNA interference genes (for example, they have two Argonautes versus
four in mammals and one FMRP versus three in mammals). Additionally, it should be
much more feasible now to develop in vitro systems which recapitulate translational
repression by microRNAs, now that it is known what functions such an assay should
reproduce. In addition, the relationship between translational repression and mRNA
decay by microRNAs should be investigated further. In particular, genetic and
biochemical methods will be useful in determining whether mRNA degradation and
translational repression are dependent processes, and if so, which is the primary event
caused by microRNA. In general, the stability of a mRNA may be intimately linked to its
translational capacity.
Translational regulation has historically been viewed as less important than
transcriptional regulation. Many systems in which translational regulation is studied are
special cases in which transcriptional regulation is not possible, such as early embryo
development before transcription begins, in mature erythrocytes which lack a nucleus, or
during mitosis when transcription does not occur. The observation that a large number of
mammalian mRNAs are potential targets of microRNAs calls into question the
assumption that transcriptional regulation alone dictates most important gene regulatory
events throughout the organism. Indeed, it may be the case that multiple levels of
110
regulation are employed in the regulation of most genes under most circumstances in
order to provide the most robust maintenance and rapid control of expression.
In summary, we continue to be surprised at the depth and breadth of biology
controlled by molecules containing only 21nt of RNA. Further analysis of gene
regulation by short RNAs and the implementation of short RNA based silencing as a
research tool and a potential therapeutic will certainly direct our increasing understanding
of developmental disorders, cancer and infectious diseases, and enhance our ability to
reduce suffering caused by those ailments.
111
References
Ambros, V. 1989. A hierarchy of regulatory genes controls a larva-to-adult
developmental switch in C. elegans. Cell 57: 49-57.
Doench, J.G., C.P. Petersen, and P.A. Sharp. 2003. siRNAs can function as miRNAs.
Genes Dev 17: 438-442.
Doench, J.G. and P.A. Sharp. 2004. Specificity of microRNA target selection in
translational repression. Genes Dev 18: 504-511.
Lewis, B.P., C.B. Burge, and D.P. Bartel. 2005. Conserved seed pairing, often flanked by
adenosines, indicates that thousands of human genes are microRNA targets. Cell
120: 15-20.
Liu, J., M.A. Carmell, F.V. Rivas, C.G. Marsden, J.M. Thomson, J.J. Song, S.M.
Hammond, L. Joshua-Tor, and G.J. Hannon. 2004. Argonaute2 is the catalytic
engine of mammalian RNAi. Science 305: 1437-1441.
Liu, J., M.A. Valencia-Sanchez, G.J. Hannon, and R. Parker. 2005. MicroRNA-
dependent localization of targeted mRNAs to mammalian P-bodies. Nat Cell Biol
7: 719-723.
Pillai, R.S., C.G. Artus, and W. Filipowicz. 2004. Tethering of human Ago proteins to
mRNA mimics the miRNA-mediated repression of protein synthesis. RNA 10:
1518-1525.
Pillai, R.S., S.N. Bhattacharyya, C.G. Artus, T. Zoller, N. Cougot, E. Basyuk, E.
Bertrand, and W. Filipowicz. 2005. Inhibition of Translational Initiation by let-7
MicroRNA in Human Cells. Science.
Xie, X., J. Lu, E.J. Kulbokas, T.R. Golub, V. Mootha, K. Lindblad-Toh, E.S. Lander, and
M. Kellis. 2005. Systematic discovery of regulatory motifs in human promoters
and 3' UTRs by comparison of several mammals. Nature 434: 338-345.
Zeng, Y., R. Yi, and B.R. Cullen. 2003. MicroRNAs and small interfering RNAs can
inhibit mRNA expression by similar mechanisms. Proc Natl Acad Sci U S A 100:
9779-9784.
112
Christian Paul Petersen
Biographical Note
EDUCATION
Ph.D., Biology, 2000-2006
Massachusetts Institute of Technology, Cambridge MA
B.A. Chemistry and B.A. History. 2000
Grinnell College, Grinnell IA
AWARDS/HONORS
National Science Foundation Graduate Fellowship (Fall 2000 to Spring 2003)
Graduation with honors, Grinnell College (Spring 2000)
Phi Beta Kappa (Inducted 1999)
Charles Payne Scholarship for oustanding historical research (1999 to 2000)
Barry Goldwater Scholarship in Physical Sciences (Fall 1998 to Spring 2000)
Dow Chemical Scholarship (Fall 1996 to Spring 2000)
SCIENTIFIC EXPERIENCE
Ph.D. Research MIT Department of Biology, 2000-2005
Advisor: Phillip A. Sharp
Doctoral Thesis: Translational Regulation by Short RNAs in Mammalian Cells
Research Assistant Astrazeneca Pharmaceuticals, Summer 2000
Advisor: Stewart Fisher
Project: Enzyme kinetic studies to determine the mechanism of action of a
potential antibiotic inhibitor of cell wall synthesis in E. coli
Research Assistant Grinnell College, 1998-2000
Advisor: Dr. Elaine Marzluff
Project: Development of a method to measure protein folding and formation of
protein-protein complexes by electrospray mass spectrometry.
Research Assistant, Max Planck Institute for Polymer Research, Germany, 1998
Advisor: Dr. Diethelm Johannsmann
Project: Development of an assay to measure stresses in thin polymer films.
Research Assistant, Ames Laboratory, Iowa State University, summer 1997
Advisor: Dr. Mark Gordon
Project: Computational modeling to determine the number of water molecules
necessary to solvate a single molecule of NaCI
113
TEACHING EXPERIENCE
Teaching Assistant, Graduate Cell Biology (7.60), Spring 2004
Instructors Phillip Sharp and Richard Young, MIT
Teaching Assistant, Introduction to Molecular Biology (7.012), Fall 2001
Instructors Bob Weinberg and Eric Lander, MIT
Teaching Assistant, Organic Chemistry and Intro Chemistry, 1997-1999
Grinnell College
PUBLICATIONS
Christian P. Petersen and Phillip A. Sharp. "Short RNAs repress translation after
initiation in mammalian cells." Submitted.
Christian P. Petersen, John G. Doench, Alla Grishok, Phillip A. Sharp. "The
biology of short RNAs." Ch. 19 of "The RNA World" 3rd edition. 2006, CSHLP.
Cold Spring Harbor, NY. pp. 535-567.
John G. Doench*, Christian P. Petersen*, and Phillip A. Sharp. "siRNAs can
function as miRNAs." Genes and Development. 2003 Feb 15;17(4):438-42.
Michael T. McManus, Christian P. Petersen, Brian B. Haines, Jianzu Chen,
Phillip A. Sharp. "Gene silencing using micro-RNA designed hairpins." RNA
2002 Jun;8(6):842-50.
Stephen Marmor, Christian P. Petersen, Folkert Reck, Wei Yang, Ning Gao, and
Stewart L. Fisher, "Biochemical Characterization of a Phosphinate Inhibitor of
Escherichia coli MurC." Biochemistry, 40(40), pp. 12207-12214, 2000.
Christian Petersen, Carsten Heldmann, and Diethelm Johannsmann. "Internal
Stresses during Film Formation of Polymer Latices." Langmuir, vol 15(22)
pp.7745-7751, 1999.
Christian P. Petersen and Mark S. Gordon. "Solvation of Sodium Chloride: An
Effective Fragment Study of NaCl(H20)n." The Journal of Physical Chemistry
A, vol 103(21), pp. 4162-4166, 1999.
*
denotes co-first authorship
114
PRESENTATIONS
Oral Presentation: "Short RNAs repress translation after initiation in mammalian
cells." EMBO Conference on Protein Synthesis an d Translational Control.
EMBL Heidelberg Germany, Sept. 2005
Oral presentation: "The mechanism of microRNA silencing in mammalian cells."
Diverse Roles of RNA in Gene Regulation (Keystone Symposium) in
Breckenridge, CO, January 8-14, 2005.
Poster: "The mechanism of microRNA silencing in mammalian cells." SiRNAs
and MiRNAs (Keystone Symposium) in Keystone CO, April 2004.
Oral Presentation: "siRNAs can function as miRNAs." Eighth Annual Meeting
of the RNA Society (RNA 2003) in Vienna Austria, July 2003.
Poster: "Determination of Binding Sites of Noncovalently Bound Complexes by
Electrospray Ionization Ion Trap Mass Spectrometry." American Chemical
Society national meeting in San Francisco, CA, April 2000.
Poster: "Solvation of Sodium Chloride: An Effective Fragment Study of
NaCl(H20)n."
American Chemical Society national meeting in Dallas, TX March
1998.
115