Drosophila TRPAl Controls Thennotactic Behavior
BY
Mark Rosenzweig
B. A., Biology
Northwestern University, 2000
Submitted to the Department of Biology on May 25,2006, in partial Mfillment of the
requirements for the Degree of Doctor of Philosophy in Biology
at the
Massachusetts Institute of Technology
June 2006
8 2006 Massachusetts Institute of Technology
All rights reserved
(
i
Signature of Author:
7
Certified By:
I
I
v V -
#I
AA
-
v
I JUN 0 2 2006 1 (
LIBRARIES
l
Department of Biology
May 5,2006
\
e
.,
A
Y
r
Paul A. Garrity
Assistant Professor of Biology
Thesis Advisor
Accepted By:
Stephen P. Bell
Professor of Biology
Chairman, Committee for Graduate students
I
Drosophila TRPAl Controls Thermotactic Behavior
Mark Rosenzweig
Submitted to the Department of Biology on May 25,2006, in partial fulfillment of
the requirements for the Degree of Doctor of Philosophy in Biology
ABSTRACT
Temperature perception is an intricate process, essential for survival of many
organisms. Temperatures far outside of the preferred range are usually harmful
and are perceived as noxious (or painful), thus encouraging the animal to change its
location or behavior. However, animals also have mechanisms to perceive more
moderate, innocuous temperatures. Some animals exhibit clear directed movements
in response to changes in temperature, a behavior known as thermotaxis.
Thermotactic behavior has been most intensely studied in the nematode elegans,
and a number of neurons and molecules that mediate thermotaxis in C. elegans have
been identified. However, molecular mechanisms of temperature perception in
general, and thermotaxis in particular, are still poorly understood. Drosophila
melanogaster also exhibits strong temperature preferences and robust thermotactic
behaviors, although the molecular mechanisms that mediate thermotaxis in
Drosophila were unknown. We used a reverse genetic RNA interference (RNAi)based strategy to identify Drosophila TRPAl as a key regulator of thermotaxis.
Larvae in which dTRPAl expression has been knocked down with RNAi fail to
avoid regions of moderately elevated temperature (-31°C--350C). In heterologous
cells, dTRPAl protein is activated by warming (Viswanath, et al., 2003, Nature,
423:6942), suggesting that the role dTRPAl plays in thermotaxis might be to sense
the environmental temperature. We generated mutants in dTRPAl using
homologous recombination-mediated insertional mutagenesis. As expected, dtrpAl
mutants were defective for thermotaxis at elevated temperatures, and surprisingly
were also defective for thermotaxis at cold temperatures. Interestingly, dtrpAl
mutants were not defective for avoidance of all cold temperatures, but the
thermotactic defects of dtrpAl mutants were more pronounced at colder
temperatures than at more moderate temperatures, suggesting that other
mechanisms might compensate for the loss of dTRPAl at more moderate
temperatures. Temperature sensors were traditionally thought to be activated by
and to mediate behavioral responses to restricted ranges of temperatures, either hot
or cold temperatures, but not both. However, dTRPAl appears to be required for
thermotaxis behavior at both elevated and cold temperatures, raising an exciting
possibility that dTRPAl protein might mediate thermotaxis by sewing as a sensor
of both hot and cold temperatures. We also identified dTRPAl-expressing cells and
implicated a subset of these cells in mediating thermotactic response to elevated
temperatures. Surprisingly, our results suggest that the cells required for
thermotaxis at elevated temperatures (dtrpAl-promoter-Gal4-expressingcells) are
located in the lawal central brain and not in the peripheral nervous system (PNS)
where most thermal sensors are thought to function for mediating thermosensory
behaviors. We further demonstrated that neither PAINLESS, a TRP channel
required for proper lawal responses to a high-temperature (-38°C--520C)
nociceptive stimulus, nor the peripherally located neurons that mediatepainless
behavior, were required for thermotaxis at elevated temperatures. On the other
hand, dTRPAl and the dtrpA1-promoter-Gal4-expressingcentral brain neurons that
mediate thermotactic response to elevated temperatures appeared dispensable for
lawal responses to a high-temperature nociceptive stimulus. These fiidings suggest
that different TRP channels and different neurons are used to mediate different
thermosensory behaviors in Drosophila.
Thesis Advisor: Paul Garrity
Title: Assistant Professor of Biology
TABLE OF CONTENTS
Abstract----------------------------------------------------------------------------------------------2
Chapter 1:Introduction: Mechanisms of temperature sensation------------------------------ 5
Chapter 2: The Drosophila ortholog of vertebrate TRPAl regulates thennotaxis-------- 58
Chapter 3: TRPAl mediates both heat- and cold-avoidance behaviors in Drosophila--87
Conclusion and future directions------------------------------------------..
--------------------- 128
Acknowledgements-------------------------------- -----------------------------------------------135
Chapter 1.
INTRODUCTION: Mechanisms of temperature sensation
Abstract.
Animals rely on thermal sensors to perceive temperature information within their
environment. These thermal sensors are located throughout the body and contain
mechanisms necessary to sense the temperature stimulus and to pass that information
onto downstream target cells, providing the animal with data useful (and sometimes
indispensable) for making decisions regarding the safety or attractiveness of its current
environment. Over the past decade, members of Transient Receptor Potential (TRP)
family of ion channels have emerged as excellent candidates for mediating the initial step
of temperature sensation. In mammals, these "thermoTRPs" can be gated by
temperatures perceived as noxious hot (TRPV1 and TRPV2), innocuous/warm (TRPV3,
TRPV4, TRPM4 and TRPMS), cool (TRPM4, TRPMS and TRPM8) and noxious cold
(TRPAI). However, the temperature ranges thermoTRPs can be gated by in cultured
neurons and heterologous cells don't tell the whole story. The activity of thermoTRPs,
including their gating by temperature, can be influenced by numerous cellular
mechanisms, including other ligands, lipids, phosphorylation and de-phosphorylation,
localization, oligomerization and membrane potential. In addition, other proteins such as
background two-pore potassium channels and members of the DegenerinEpithelial
Sodium Channel (DEGIENaC) family have been demonstrated to be temperatureresponsive. Thus, there can be quite a bit of overlap between the temperature ranges
capable of being sensed by different thermosensory molecules. This overlap might
explain why mouse knockouts lacking individual thermoTRPs exhibit fairly subtle and
restricted thermosensory behavioral phenotypes. Here I review the mechanisms of
temperature perception, including how modulation of thermoTRPs might affect
temperature sensation. Much work remains to be done before we have a complete list of
6
molecules and a thorough map of the circuits that allow an animal to perceive
temperature stimulus and to translate that perception into a behavioral response.
All organisms must possess mechanisms for detecting temperature changes in their
environment. Temperature dictates and regulates many physiological processes, from
diffusion of molecules within and between cells, to changes in gene expression,
developmental timing and sex determination [I]. From bacteria to humans, organisms
function best within certain cognate temperature ranges, function less robustly at
temperatures somewhat outside of their optimal ranges and cease functioning, often
dying, at temperatures even farther outside of their preferred temperatures. Furthermore,
local temperature fluctuations can also cause tissue damage. Organisms have developed
a multitude of strategies to meet the challenges presented by different temperatures.
Certain species of plants, bacteria, insects and vertebrates can survive while frozen, and
others can supercool to survive the cold, adjusting their physiology to remain unfrozen in
sub-zero temperatures [2]. Another common strategy used by many organisms, including
mammals and some insects such as Drosophila melanogaster, is to attempt to avoid
unfavorable environments, rather than succumbing to them. In order to avoid
unfavorable temperatures, an animal must sense the temperature and then translate that
sensation into a behavioral response. In organisms that try to avoid unfavorable
temperatures, extreme heat and cold are often perceived as painful (noxious), or at least
uncomfortable, leading to movement away from the noxious environment.
Temperature sensing cells.
Animals that prefer to avoid unfavorable thermal environments are able to sense
and respond to changes in temperature. The periphery of such animals contains
projections of the thermosensory and nociceptive (pain sensing) neurons, which possess
mechanisms to sense temperature and to relay the sensory information to the CNS. In
8
mammals, the cell bodies of such neurons are located in the Dorsal Root Ganglia (DRG)
or the Trigerminal Ganglia (TG) and their axons are either small-diameter unmyelinated
C-fibers or larger thinly myelinated A6 fibers [3]. Subsets of C- and A6 fibers are
activated at noxious thermal temperatures, leading to a perception of pain, while other
subsets are activated by more innocuous temperatures, perhaps involved in the sensation
of comfort [4,5]. The importance of proper perception of noxious temperatures and pain
is underscored by the pathologies of people unable to properly sense temperature or pain.
Patients suffering from certain types of Hereditary Sensory and Autonomic Neuropathies
(HSAN) exhibit a reduction or deficiency in, and/or progressive degeneration (depending
on the type and expressivity of the disease) of sensory neurons, including C- and A6
fibers [6]. These patients are usually impaired for sensing (and in some cases are entirely
insensitive to) temperature and pain, in some cases leading to self-mutilationlamputation;
painless fractures that, due to repeated trauma, heal slowly and incorrectly (when
undetected andlor untreated); and decreased lifespan [6]. Interestingly, in addition to
temperature sensing neurons, keratinocytes (a type of skin cell) appear to possess
thermosensory mechanisms in mice [7,8] although how keratinocytes communicate the
perceived thermal information to the CNS is unclear.
In addition to peripheral temperature sensors, mammals possess internal, more
central thermal sensors. The preoptic-anterior hypothalamus, a structure involved in
regulation of body temperature, contains many neurons that are responsive to temperature
[9]. In cats and dogs, localized heating of the preoptic region of the hypothalamus can
initiate panting and suppresses shivering, while cooling of this region initiates shivering
[9]. The brainstem and the spinal cord are also capable of sensing temperature [101.
Furthermore, the activity of many neurons in the sensorimotor cortex of a cat were found
9
to be significantly sensitive to changes in local brain temperature [l 11, although the
significance of this activity for the animals' temperature perception or thermal regulation
is unclear.
Non-mammals are also sensitive and responsive to temperature. Nematode C.
elegans exhibits a fascinating thermosensory behavior: the worms don't seem to have an
innate temperature preference per se, but they are attracted to temperatures at which they
were raised with food, and avoid temperatures at which they were starved [12]. In C.
elegans, peripherally located AFD neurons are responsive to warming [13] and mediate
the worm's thermosensory behavior through AIY and AIZ interneurons [12, 141. Insects
also exhibit behavioral responses to temperature. For instance, Drosophila adults prefer
temperatures around 24OC when placed onto a thermal gradient [15]. Heat can also be
used as a negative reinforcer in Drosophila learning assays [I 61 and can be used to
entrain the circadian clock [17]. In the adult fly, at least a fraction of thermal sensors are
located peripherally, in a section of the antennae (the third antenna1 segment) [15, 181.
Drosophila larvae also exhibit a variety of temperature-dependent behaviors focused on
avoiding noxious thermal environments and stimuli [19-211. Certain neurons in the
peripheral nervous system (PNS) of the Drosophila larvae are heat- and cold-responsive
[19]. Some of these neurons (multi-dendritic (md) neurons located within the body wall)
have been implicated in avoidance of a high-temperature nociceptive stimulus (38 OC52OC) [20] and others (the terminal organ in the larval nose) in avoidance of cold
temperatures [19]. The terminal organ appears dispensable for larval heat avoidance
([I91 and M.R. and P.G. unpublished data). Like mammals, insects also possess central
neurons that can respond to changes in temperature. For instance, neurons in the
prothoracic ganglion of the cockroach are temperature-sensitive [22]. Also, our data
10
implicate neurons within the central brain of the Drosophila larvae in mediating
themotactic behavior [211. In our thermotaxis assays, larvae are challenged with lower
temperatures (but still well above the fly's preferred temperature) than during the hightemperature nociception assays. Wild-type larvae, but not larvae in which a subset of
central brain neurons are killed or inhibited, robustly avoid the aversive temperatures.
The peripherally located md neurons that mediate larval responses to a high-temperature
nociceptive stimulation, however, appear dispensable for themotaxis. Inhibition of the
themotaxis-mediating subset of central brain neurons, on the other hand, does not impair
the response to a high-temperature nociceptive stimulus. Furthermore, the molecules that
mediate these two different thermosensory behaviors appear to be distinct ([20,21] and
see below). Thus, similar to mammals, Drosophila appears to possess distinct
mechanisms for sensing different temperatures.
Temperature sensing molecules.
Identifxation of TRPVl as a candidate temperature sensor in mammals.
The presence of specialized temperature-sensing neurons that rapidly (on a scale
of milliseconds to seconds) change their activity in response to changes in temperature
suggests the existence of specific, likely post-translational, mechanisms in these neurons
for sensing temperature. A breakthrough in this field came with the expression cloning
of the capsaicin receptor, vanilloid receptor 1 (VR-I), now known as TRPVl ('V' for
vanilloid) (reviewed in [5,23]). When TRPVI, a member of a large family of Transient
Receptor Potential (TRP) family of ion channels, was expressed in heterologous cells,
TRPVl allowed influx of cations into the cell following stimulation with capsaicin or
with heating (P-42*C) [24]. TRPV 1 temperature- and capsaicin-evoked currents were
11
detected even in excised membrane patches, leading to a proposal that the TRPVl
channel is able to sense these stimuli directly, rather than being activated downstream of
a receptor-mediated second messenger cascade [25]. TRPV 1 is expressed in many
tissues, including a subset of DRG neurons that are capsaicin and heat responsive [26291. TRPVl knockout mice were reported to exhibit significant defects in neuronal
responsiveness to heat. These mice exhibited profound defects in the number of cultured
DRG and skin-nerve preparation neurons responding to 43OC heat [26,27] and the
neurons that did respond to 43OC heat exhibited 45% reduction in heat-evoked discharge
[26]. Activation of down-stream spinal chord neurons was also impaired in TRPV 1
knockout mice [26]. Furthermore, TRPVl knockout mice were impaired for the latency
of response to noxious heat stimuli, (P-50°C) and failed to develop thermal
hyperalgesia (hypersensitivity to temperature) in response to multiple inflammatory
agents [26,27]. However, TRPVl knockout mice still retained significant behavioral
responses to noxious heat stimuli and contained some heat-responsive sensory neurons, in
particular, the neurons with higher thresholds of temperature-dependent activation
(P-50°C) than the temperatures typically activating TRPVl in heterologous cells [26,
271. These findings are consistent with the observed presence of multiple populations of
heat-responsive cultured DRG neurons, which exhibit distinct temperature activation
thresholds [28,30]. The largely intact abilities of TRPVl knockout mice to respond to
noxious heat stimuli, as well as the continued presence of heat-responsive neurons in
those animals, indicated that while TRPVl is important for temperature perception and
for mediating temperature-dependent behaviors, other, TRPV1-independent mechanisms
for temperature sensation must also exist [26,27].
Overview of TRP channels.
Members of the TRP family of proteins are diverse in terms of sequence,
activating stimuli, expression patterns and cellular processes mediated by its members
[3 11. There are 27-28 members in mammals, 16 in Drosophila, and 17 in C. elegans
[32]. Based on homology, TRP proteins cluster into seven subfamilies; A (Anktml), C
(Classical), M (Melastatin), ML (Mycolipin), N (NompC), P (Polycystin) and V
(Vanilloid), named after the founding member of each subfamily [32]. All TRP channels
are predicted to feature six transmembrane domains (TM), with a putative ion pore region
between TM five and six, cytoplasmic N- and C-termini and are thought to function as
tetramers [33]. Most TRPs are non-selective or poorly selective cation channels,
although some TRPs do exhibit ion preferences and a few display marked selectivity in
their ionic permeability [34].
ThermoTRPs as candidatesfor mediating the initial step of temperature sensation.
Following the identification of TRPVl as a heat-activated ion channel ( M 3 O C )
[24,25,35], other TRPs were examined for the ability to be activated by temperature. Of
the mammalian TRPs, TRPV2 can be activated by heat (W53OC) [35], TRPV3 and
TRPV4 by innocuous warm, as well as by higher temperatures (P-33OC) [36-391,
TRPM4 and TRPM5 by cool to innocuous temperatures (15OC<T<-35OC) [40], TRPM8
by still cooler temperatures between -8OC and -28OC [41,42], and TRPAl by noxious
cold temperatures (T<-15OC) [43,44]. Considered together, the temperatures capable of
activating known thermoTRPs account for almost the whole temperature spectnun that
mammals are capable of sensing [5].
Figure 1. Alignment of mammalian and Drosophila TRP-family proteins. TRPs that are
known to be temperature-responsive (thermoTRPs) are boxed. Drosophila TRPs are
highlighted in blue. Dm - Drosophila melanogaster; Hu - Human; A - TRPA; V TRPV; ML - TRPML; PKD - TRPP; M - TRPM; C - TRPC. For the Drosophila
proteins, CG designation or a name of the protein are provided. Alignment courtesy of
Paul Garrity.
FIGURE 1
TRP family proteins
-
r
Drosophlla melanogaster
i Tamperature-activated In culture
In addition to temperature, a number of thermoTRPs can be activated by
compounds perceived by humans as hot (vanilloid compounds activate TRPVl [24]),
burning (cinnamaldehyde, main constituent of cinnamon oil; isothiocyanates, pungent
ingredients in wasabi, horseradish and mustard oils; allicin and diallyl disulfide, pungent
ingredients in garlic, all activate TRPAl [44-48]), warming (oregano and thyme, which
elicit warming sensation, and camphor, which sensitizes skin to warmth, activate TRPV3
[8,49]; camphor also activates TRPV 1, although with lower potency than TRPV3 [50]
and oregano, which is also perceived as pungent, can activate TRPAl [49]), or cooling
(cooling agent menthol and synthetic cooling agent icilin activate TRPM8 [41,42, 5 11
and icilin also activates TRPAl with lower potency [43]). The ability of these chemical
activators of thermoTRPs to elicit powerful temperature-involving sensations in humans
is consistent with the proposed roles of thermoTRPs as thermal sensors.
In mammals, these "ThermoTRPs" are expressed in temperature responsive
tissues such as the brain, the tongue and the skin, including subsets of DRG and TG
neurons that send projections to temperature-responsive tissues, in addition to
thermoTRPs' expression in many other tissues not thought to participate in temperature
sensation or thermal regulation [5]. For instance, TRPM4 and TRPM5 are expressed in
the taste receptor neurons in the tongue, where the activation of TRPM5 by temperature
potentiates G-protein coupled receptor (GPCR)-mediated sweet sensation [40, 52,531.
Furthermore, in addition to their expression in DRG neurons, TRPV3 and TRPV4 are
also expressed in non-neuronal keratinocytes which are known to be temperatureresponsive [7, 81.
Further supporting the critical role for thermoTRPs in temperature sensation,
mouse knockouts lacking individual therrnoTRPs exhibit defects in some thermosensory
16
behaviors [8,26,40,54,55]. The findings reporting temperature activation of
thermoTRPs, their expression in temperature-responsive tissues, and their requirement
for thermosensory behaviors lead to the development of models in which the combination
of thermoTRPs provides a mechanism for the initial step of mammalian temperature
perception [5].
However, temperature sensation appears to be more complicated than could be
construed simply from the model above. One complication is the controversy regarding
the mechanisms of noxious cold perception. The crux of the issue is that the sensory
neurons responsive to strong cooling exhibit different pharmacology than would be
expected if TRPAl were mediating the cold sensation in those neurons, leading some to
question whether TRPA1 is the molecule that mediates the sensation of noxious cold
([45,56]; reviewed in [57,58]). There are clearly multiple populations of coldresponsive neurons, with some activated by moderate cooling (and most of these neurons
are also responsive to menthol, which activates TRPM8) and others by stronger cooling
(and most of these neurons are not sensitive to menthol) [56,59]. However, Jordt, et al.,
[45] and Nagata, et al., [60] could not reproduce earlier finding by Ardem Patapoutian's
group [43] that TRPAl was activated by noxious cold in heterologous cells. And while
at least two other groups have since reproduced TRPAl activation by cold in
heterologous cells (in [57], cited as unpublished data; in [61], cited as personal
communication), if TRPAl is a cold sensor in vivo, why the pharmacological properties
of TRPAl don't match the pharmacological properties of noxious cold-sensing sensory
neurons [45, 56-58] still remains to be explained. In particular, TRPAl agonist mustard
oil does not stimulate most cold-sensitive neurons and mustard oil sensitive neurons are
mostly cold-insensitive [45,56-581. Furthermore, TRPAl knockout mice were reported
17
to possess normal numbers and fractions of cold sensitive (both menthol-sensitive and
menthol-insensitive) sensory neurons and to respond normally to challenges with cold
stimuli despite being completely insensitive to mustard oil [48].
However, other studies have suggested a role for TRPAl in cold sensation.
Independently derived TRPAl knockout mice have been reported to be defective in
responding to a noxious cold stimulus (withdrawal from a cold plate set at O°C) and to
exhibit a less distressed behavior compared to wild-type mice following evaporative
cooling caused by application of a drop of acetone, while being very defective for, but
not insensitive to, the responses to mustard oil [55]. Bautista, et al., [48] examined both
acetone evaporative-cooling responsiveness and the responsiveness to O°C cold plate
during the characterization of their TRPAl knockout mice without detecting any defects.
The reason for the discrepancy between the findings of these two studies is not clear
(discussed in [62]) but might be due to the differences in scoring the behavioral responses
and to the use of only male mice by Bautista, et al., [48]. The later point might be
especially significant because while Kwan, et al., [55] observed significant defects in
cold-evoked behavioral responses in both male and female mice, the defects were more
pronounced in female mice. Another factor potentially contributing to the differences
between the two studies above [48,55] is difference in genetic backgrounds of the
knockout mice analyzed in these studies.
Additional evidence for the involvement of TRPAl in cold sensation includes a
study reporting that teeth-innervating dental afferent neurons express combinations of
TRPV 1, TRPM8 and TRPAl mRNAs, and that icilin-responsive menthol-insensitive
dental afferent neurons (that presumably therefore express TRPAl but not TRPM8) are
activated by strong cold (threshold for activation -1 7°C) [63], although this study did not
18
examine whether the observed neuronal responses to strong cold were dependent on
TRPAl . Furthermore, short interfering RNA (siRNA)-mediated knockdown of TRPA 1
alleviates cold hyperalgesia in rats after inflammation or spinal nerve injury [64,65].
These findings argue that TRPAl may play a role in thermosensory processes. So
how can these findings be reconciled with the studies arguing that TRPAl is not required
for cold sensation? It is possible that TRPAl mediates cold sensation in a very restricted
context. It is also possible that TRPAl activity and responsiveness to mustard oil andlor
cinnamon oil (the primary agents used to assess TRPAl presence/responsiveness in a
given cell) are regulated in vivo, perhaps by oligomerization with another protein andlor
a different TRPAl splice isoform, or by post-translational modifications. Thus,
responsiveness to mustard oil and to cinnamon oil might not represent all TRPAl expressing neuronal populations. Finally, keeping in mind the possibility that some
TRPAl -expressing cells may not be responsive to mustard oil, TRPAl could be acting
partially redundantly with another cold-sensing molecule to mediate cold perception.
While the mechanisms for sensing noxious cold temperatures are not yet clear,
sensation of noxious heat might also not be as simple as suggested by a parsimonious
model predicting TRPVl mediating responses to heat (42OC<T<-50°C) and TRPV2
mediating responses to higher temperatures. In a recent re-examination of heat sensation
in TRPVl knockout mice, it was found that contrary to previous reports [26,27], TRPVl
knockout mice do not exhibit either the reduction in numbers of heat-responsive neurons
or alterations in the responses of these neurons to heat [66]. The difference between this
study and previous studies may be due to the use by Woodbury, et al., [66] of a more "in
vivo" preparation involving explanting the spinal cord along with intact afferents rather
than employing skin preparations and cultured (dissociated) DRG neuron preparations for
19
analysis [26,27]. By using cell labeling followed by electrophysiologicalrecordings and
irnrnunostaining analysis, Woodbury, et al., [66] further found that most neurons
responding to high heat (T=52OC) in TRPVl knockout mice did not express TRPV2. The
mechanisms that mediate responses to heat in cells lacking TRPVl or TRPV2 are
unknown.
Behavioral studies in TRPVl [26], TRPV3 [8], TRPV4 [54], TRPM5 [40] and
TRPAl [55] knockout mice support the involvement of these thermoTRPs in some types
of temperature-dependent behaviors. With the exception of TRPM5's requirement for
temperature modulation of taste perception, none of the thermosensory behavioral assays
performed on thermoTRP knockout mice revealed complete loss of responsiveness to any
given temperature or temperature-dependent stimuli. These findings may reflect overlap
or redundancy in temperature responsiveness andlor expression among thermoTRPs.
Such redundancies and overlaps may be quite complex because the temperature ranges
thermoTRPs are sensitive to can be expanded in response to modulation by endogenous
or exogenous factors (see below). In addition, mechanisms that do not involve TRP
channels might also contribute to temperature sensation.
Non-TRP ion channels that mayfunction in temperature sensation.
In addition to thermoTRPs, other ion channels have been implicated in
temperature sensation andlor mediating responses to temperature in vivo. Reid and
Flonta discovered that cooling a subset of DRG neurons from 32OC to 20°C resulted in
their depolarization due to inhibition of background K+ conductance (which is involved
in setting the membrane potential) and proposed that a member of a two-pore-domain K+
channel family could be a target of cooling-mediated inhibition [67]. Members of a two20
pore-domain K+ channel family have indeed been demonstrated to be temperatureresponsive. A background two-pore-domain K+ channel, TREK- 1, is expressed in DRG
neurons and in preoptic anterior hypothalamus, and when transfected into heterologous
cells, TREK- 1 can be activated by heat (T>27"C) and inactivated by cold (12°C) [68].
Since intracellular K' concentration is higher inside the DRG and preoptic anterior
hypothalamic neurons than outside of the cells, activation of TREK-1 is predicted to
hyperpolarize the cell while its inhibition should cause depolarization. Thus, heatactivation and cold-inactivation of TREK-1 might contribute to temperature responses
[68]. Mice lacking TREK-1 are hypersensitive to heat (between 30°C and 45°C as
assessed in neuronal responses and between 46°C and 50°C as assessed in behavioral
assays) but exhibit largely normal responses to cold [69]. However, following injury
(sciatic nerve ligation), TREK-1 knockout mice exhibit decreased responses to acetoneinduced cooling, suggesting that TREK- 1 might participate in responses to cold [69].
Because heat-activation of TREK-1 is lost when the channel is excised fiom the cell in a
membrane patch, Maingret, et al., suggested that a cytosolic factor might be required for
TREK- 1's temperature responsiveness [68]. In fact, it is also possible that TREK- 1
might act as a down-stream effector of a trans-acting temperature sensor(s).
Additional two-pore-domain K+ channels have been demonstrated to be capable
of exhibiting temperature-responsiveness [70]. Both TREK-2 and TRAAK are activated
by warming (24"C<T<42"C) in heterologous cells and in cultured neurons [70].
Interestingly, temperature activation of TREK-2 and of TRAAK is modulated by
membrane potential [70], an effect also observed for a number of thermoTRPs (see
below). Another two-pore-domain K+ channel implicated in mediating temperaturedependent responses is the C. elegans TWK-18. When transfected into Xenopus oocytes,
TWK- 18-mediated K+ currents increase dramatically as temperature is increased from
25OC to 35OC [71]. Consistent with its proposed role as a thermo-responsive channel,
twk-18(cnll O), a semi-dominant gain-of-function allele, exhibits temperature-sensitive
paralysis at temperatures above 30°C [72]. The 4.7 fold higher K+ current in the mutant
TWK-18(cnl10) than in the wild-type channels led Kunkel, et al., [71] to propose that an
additional increase in K+ current at elevated temperatures is the basis of temperaturedependent paralysis in the twk-l8(cnll0) worms. Null twk-18 alleles have been
generated but have not been examined for thermotaxis, perhaps because twk-18 promoter
drives GFP expression in the body wall muscles [711.
Besides two-pore-domain K+ channels, the ATP-gated cation channel P2X3 has
been implicated in regulating responses to warm temperatures in mice [73]. P2X3
knockout mice are impaired for electrophysiological responses elicited by non-noxious
heat (32OC<T<42OC) in wild-type mice [73,74]. Interestingly, mice lacking P2X3
exhibited enhanced preference for 30°C-35°C temperature range over higher or lower
temperatures when placed onto a thermal gradient [74]. Behavioral responses to noxious
heat stimuli, however, were normal [73, 741. As is the case for thermoTRPs, P2X3 is
expressed in a subset of DRG neurons [73]. Thus, P2X3 might also contribute to
temperature perception.
Members of the DegenerinIEpithelial Sodium Channel (DEGENaC) family have
also been demonstrated to exhibit temperature-dependent responses. When expressed in
+
is substantially stimulated by cooling and appears to
Xenopus oocytes, ENaC ~ a current
be inhibited by warming (the current was maximal at 6OC and minimal above 40°C) [75].
Other members of DEGENaC family, BNC1, ASIC and DRASIC did not respond to
temperature changes on their own, but cooling strongly potentiated the currents induced
by their agonist, acid (protons) [75]. DEGIENaC family members are expressed in DRG
neurons, TG neurons and in taste-receptor cells in the tongue, and the DEGIENaC
inhibitor amiloride attenuates cold activation of cultured TG neurons, raising their
threshold of activation (requiring stronger cold stimulus for activation) [59]. The twopore-domain K+ channels, DEGlENaC family members and P2X3 channel are thus
additional temperature-responsive proteins that may help temperature-sensing cells to
integrate thermal stimuli and transduce the temperature information to downstream
targets. Likely the types of neurons activated, as well as the levels of their activation,
contribute to our conscious perception of temperature.
Drosophila thermoTRPs.
Drosophila genome contains sixteen putative TRP channels, 24 members of the
DEGIENaC family and eleven two-pore-domain K+ channels [76-791. There are no
known P2X3 channel homologs. Thus far, only members of the TRP family have been
implicated in mediating thermosensation and thermosensory behaviors in flies.
Drosophila TRPs include four TRPAs, three TRPCs, two TRPVs, one TRPM, one
TRPML, one TRPN, one TRPP and three TRPP-like proteins ([76] and Fig. 1). Of these,
three have been implicated in mediating thermosensory behaviors. TRPA painless is
required for larval responses to a high-temperature nociceptive stimulus (38OC<T<52OC)
[20]. Alleles of a different TRPA, pyrexia (pyx), slightly shift distributions of adult flies
on a thermal gradient, although R N A - ~ pyx3
U ~ ~flies are distributed statistically similarly
to wild-type [80]. However, pyx mutants are strongly defective for resisting paralysis at
high temperature (40°C) [go]. Finally, RNAi against dTRPAl (ortholog of the
mammalian TRPAI) disrupts larval thermotactic behavior [2 11. Both dTRPAl and PYX
23
proteins can be activated by elevated temperatures when expressed in heterologous cells,
at D-27'C for dTRPAl [81] and T>-3540°C for PYX [80]. PAINLESS has not been
reported to be temperature-activatable in heterologous cells. However,
electrophysiological recordings from the abdominal nerves of wild-type larvae
(abdominal nerves contain axons of PAINLESS-expressing md neurons, among others)
demonstrate increasing activity in response to elevations in temperature (42'C), and this
temperature-dependent activity increase is not detected in painless mutant larvae [20].
Thus, while it's unclear whether PAINLESS is a temperature-activated ion channel,
PAINLESS is required for mediating behavioral responses to temperature in flies. It is
possible that PAINLESS must oligomerize with another TRP channel to exhibit
activation by temperature. Alternatively, PAINLESS might not function in Drosophila
thermosensation as a thermal sensor but might regulate temperature-dependent behavioral
responses downstream of a temperature sensation step.
Thermotmis in C. elegans.
The nematode C. elegans exhibits remarkably precise temperature discrimination
behavior. When placed on a thermal gradient, the worms thermotax to the temperature
they were cultivated on in the presence of food and can travel within that temperature
zone straying less than 0.05'C from it [82]. Acclimating the worms to a different
temperature for 2-4 hours in the presence of food switches the thermal preference
towards the new temperature [82, 831. Starving the worms at their cultivation
temperature for 1-3 hours also changes their thermal preference as the worms now avoid
their cultivation temperature [83]. Thus, C. elegans can remember temperature
information and these memories can be intimately tied to the presence of food.
24
Genetic analysis of C. elegans thermotaxis identified a number of molecules
essential for aspects of this behavior. These molecules include transcription factors TTX1 and CEH- 14, which are required for the development and/or function of thermosensory neurons AFD [84, 851, and transcription factors TTX-3 and LIN- 11, which are
required for the development and/or function of interneurons AIY and AIZ respectively
[86, 871. Worms lacking either TTX-1 or CEH-14 are athermotactic, while the loss of
TTX-3 makes the worms cryophilic and the loss of LIN-11 makes the worms
thermophilic. This supports a model in which AFD neurons are responsible for
temperature sensation while AIY and AIZ interneurons function downstream of AFD by
counterbalancing the response to perceived temperature input [12]. Other factors
required for thermotaxis include a cyclic nucleotide-gated channel TAX-214 [88, 891 and
its upstream regulators guanylyl cyclases GCY-8, GCY- 18 and GCY-23 [90],
~a~+/calmodulin-dependent
protein kinase I (CaMKI) CMK- 1 [911, neuronal calcium
sensor-1 NCS- 1 [92], calcineurin AITAX-6 [93], diacylglycerol (DAG) kinase DGK- 1
[94] and protein kinase C (PKC)/TTX4 [94]. Modulation of thermotaxis by food is
further mediated by the neurotransmitters serotonin and octopamine [83], by the secretory
protein HEN- 1 [95], by insulin/insulin-like growth factor-1 (IGF- 1) receptor DAF-2, by
the transforming growth factor P (TGFP) DAF-7 pathways [96] as well as by other, as yet
uncloned, mutants affecting food modulation of thermotaxis [83]. The C. elegans
thermal sensors that mediate thermotaxis, however, have not yet been described.
Mechanisms of temperature sensation: Regulation of thermoTRPs.
Temperature perception can exhibit profound adaptations, as anyone who ever
dove into a cold pool or got out of a hot shower can attest to. These adaptations can be
25
fairly rapid, or take years (such as, for instance, acclimating to a particular climate).
Members of same species are often able to inhabit diverse thermal environments. C.
elegans, for instance, can prefer any of a range of temperatures within its cognate
functional range, depending on the worm's prior experiences [82,83,97]. In mammals,
the sensation of temperature can often be sensitized or desensitized by factors such as
prolonged exposure to a particular temperature or by inflammation. While some of the
plasticity in sensation of, and responses to, temperature might be accounted for by
changes in neuronal connectivity accompanying such temperature shifts, the regulation of
neuronal signaling, including modulation of the activity of the temperature-regulated ion
channels likely plays a major role. Such modulations may also underlie in vivo
adjustments to temperature thresholds and activation of various thermoTRPs and
probably contribute to the apparently overlapping roles for therrnoTRPs in temperature
perception.
The molecular mechanisms of temperature sensor regulation are potentially
complex, with multiple pathways involved. Potential modulation of temperature
sensation and perception might include sensitization or desensitization of temperature
receptors by various signaling pathways and by endogenous and/or exogenous ligands.
Furthermore, thermosensory properties of thermoTRPs are sometimes altered by
interacting proteins, including other TRP channels through changes in subunit
composition, and by membrane potential. Over a longer time scale, for instance during
injury or inflammation, regulation of temperature perception might also include
regulation of thermoTRP expression, perhaps at the level of transcription andlor
translation a d o r by controlling thermoTRPs' delivery to the cell surface.
Mechanisms for modulation of TRPVl activity.
TRPVl is thought to play a central role in temperature sensation and pain
perception [23] and this has made TRPVl and the regulation of its activity a target of
intense investigation. TRPVl is activated by natural exogenous ligands such as the hot
chili pepper "hot" ingredient capsaicin [24,26,27] and the warm temperature sensitizer
camphor [50]. Endogenous ligands that can activate TRPVl currents (reviewed in [98,
991) include inflammation-upregulated molecules such as protons [24,25, 100, 1011,
polyamines such as spermine [102, 1031, endovanilloids such as anandamide [99, 1041,
certain lipoxygenase products [105-1071, and some N-acyl dopamines [108, 1091. Other
endogenous lipids can also activate TRPV 1 [109].
A number of molecules released during inflammation, including protons [25, 100,
101, 110, 1111, ATP [112-1141, Bradykinin [28, 115-1171, prostaglandins [ll8, 1191,
certain chemokines (CCL3) [ 1201, certain proteases (such as trypsin and tryptase) [ 121,
1221 and nerve growth factor (NGF) [115, 123, 1241 cause thermal hyperalgesia in part
by increasing temperature sensitivity of TRPVl through their cognate receptors, thus
sensitizing TRPV 1. Protons can gate TRPV 1 directly and lower the threshold of TRPV 1
activation evoked by heat and by other ligands [24,25]. Bradykinin sensitizes TRPVl
currents in part by stimulating production of arachidonic acid, which is a substrate of
lypoxygenases [125], and ATP potentiates TRPV 1 by stimulating the production of
anandamide in a ca2+-dependentmanner [104]. On the other hand, pro-analgesic
adenosine, released upon TRPVl activation, binds to and inhibits TRPVl [126].
TRPVl activity can be modulated by phosphatidylinositol4,5-bisphosphate
(PIP2) and by the enzymes that regulate PIP2 metabolism. PIPz inhibits TRPVl activity
and activation of enzymes that reduce PIP2 quantities in the membrane, such as
27
phospholipase C (PLC) and phosphatidylinositol3-kinase (PI3K), potentiates TRPV 1
currents elicited by capsaicin, heat or protons [115]. PUK, which converts PIP2 into PIP3
[127], mediates Insulin- [I281 and NGF-induced [123, 129, 1301 potentiation of TRPVl
currents and NGF-induced thermal hyperalgesia [123], although a major role of PI3K in
potentiation of TRPV 1 activity might be the stimulation of TRPV1 delivery to the cell
surface [129]. Inhibition of PLC attenuates TRPVl currents [I151 and potentiation of
TRPVl currents by inflammatory factors Bradykinin [1311, NGF [115], prostaglandins
[118], proinflamrnatory chemokine CCL3 [I201 and proteases [1211 requires PLC
activity. Despite the generation of IP3 and DAG following PLC cleavage of PIP2, and the
ability of DAG to activate protein kinase C (PKC), a known enhancer of TRPVl currents
(see below), Chuang, et al., [I151 found that potentiation of TRPVl currents required
PLC but not PKC, consistent with the hypothesis that the loss of PIPz can facilitate
TRPV 1 activity.
In addition to modulation by lipids, TRPVl activity is regulated by
phosporylation. For instance, prostaglandins E2 and I2 cause thermal hyperalgesia in
part through sensitization of TRPV1 by PKC [I181 and protein kinase A (PKA)
phosphorylation [118, 119, 132, 1331. PKC also potentiates heat-evoked currents in
sensory neurons and heterologous cells [28, 134-1361 and mediates TRPVl currents
potentiated by Bradykinin [134, 1371, ATP [113], anandamide [135, 1381, NGF [129,
1301, chemokine CCL3 [ 1201, insulin [128] and trypsidtryptase [121, 1221. Sensitization
of TRPVl and potentiation of TRPV1 currents might also be mediated by ca2+calmodulin kinase I1 (CaMKII) [139, 1401 and by the cytoplasmic tyrosine kinase Src
[ 1411. Furthermore, NGF-induced thermal hyperalgesia involves phosphorylation-
dependent sensitization of TRPV1 currents and this phosphorylation is mediated by
PI3K, Erk, PLC, PKC, Src and CaMKII [123,129, 1301. PKC, PI3K and Src are also
required for the delivery of TRPV 1 to the plasma membrane [128, 129, 1421.
Activation of TRPVl by heat or agonists, such as capsaicin, in sensory neurons or
in heterologous cells, is followed by TRPVl desensitization [24,25, 143, 1441. At least
for the capsaicin-induced activation of TRPV1, this desensitization is mediated by ca2+
[24, 139, 143, 1441 and involves PIP2 [115], ~a~+/calmodulin
[145, 1461 and TRPVl
dephosphorylation mediated by ~a~+/calmodulin-dependent
phosphatase calcineurin
[139, 143, 1471. ca2+-dependentdesensitization of TRPV 1 is antagonized by activation
of PKA [133, 147, 1481 and by CaMKII [I 391. Activation of PKC has also been
demonstrated to potentiate currents of desensitized TRPV 1 [149, 1501. Interestingly,
activation of PKC doesn't potentiate capsaicin-evoked TRPVl currents in ca2+-free
media, consistent with de-phosphorylation of TRPV 1 being an important mechanism of
ca2+-dependentdesensitization [1351. Liu, et al., however, found that activation or
inhibition of PKA or PKC did not affect the inability of capsaicin to elicit currents from
the desensitized TRPV 1 [15 11. Instead, the authors found that PIP2 synthesis was critical
for the recovery of TRPVl from desensitization. As assessed by the activity of PIP2sensitive K' channel Kir2.1, PIP2 levels were high when TRPVl was responsive to
capsaicin, low when TRPVl was desensitized and high again once TRPVl recovered
fiom desensitization. Removal of PIP2 from the membrane by activation of PLC or
inhibition of phosphatidylinositol4-kinase (PI4K) strongly inhibited recovery of TRPVl
fiom desensitization [1511. The authors explain the discrepancies between their report
and other studies of TRPVl desensitization by suggesting that the use of a prolonged
capsaicin application at a high concentration by Liu, et al., [15 11 ensured a more
complete desensitization of TRPV 1 than accomplished in the studies using short repeated
pulses of capsaicin. It is worth noting that inhibition of calcineurin attenuated
desensitization of TRPVl even during a prolonged capsaicin application [I471 while
activation of PKA was able to inhibit desensitization of TRPVl following short repeated
pulses of capsaicin, but not following prolonged capsaicin stimulation [148]. In contrast
to the capsaicin-evoked currents, desensitization of heat-evoked TRPV 1 currents seems
to be largely ca2+-independed[25, 1351.
As mentioned above, NGF and insulin can stimulate surface delivery of T V l
[128, 129,1421. In addition to cell surface expression being a potential mechanism of
TRPV 1 regulation, injury, inflammation and growth factors released during inflammation
(such as NGF) can increase expression of TRPVl in part by increasing the number of
neurons that express TRPV 1 [152-1571.
Additional levels of TRPVl regulation may be provided by TRPVl interactions
with other signaling molecules. Immunoprecipitation experiments demonstrated that in
heterologous cells TRPV 1 can bind to PLC and receptor-tyrosine kinase TRKA [115].
This or similar signaling complex in sensory neurons may couple TRKA activation (for
instance by NGF) to TRPV 1 stimulation by removing TRPV 1 inhibitor PIP2 [l 151. Other
TRPV 1-interacting proteins include Fas-associated factor 1 (FAFI), which binds to
TRPV 1 in DRG neurons and negatively regulates TRPV 1 activation by agonists such as
heat, capsaicin and acid [1581. Eferin (EF-hands-containing Rab 11125-interacting
protein) is a putative vesicle trafficking protein of unknown function. Eferin can bind to
TRPVl in vitro but does not dramatically affect TRPVl activation by capsaicin [159].
TRPV 1 can also bind tubulin dimers and polymerized microtubules [I601 and TRPV 1
activation induces microtubule depolymerization, providing a potential link between
TRPV 1 activation and cytoskeleton dynamics [1611. However, the effect of
TRPV 1:tubdin interaction on TRPV 1 activity remains to be examined.
Mechanisms for modulation of other thermoTRPs.
Mechanisms that regulate activation of other thermoTRPs have not been reported
in as voluminous manner as they have been for TRPVI. The information that has been
gathered thus far, however, implicates some of the same signaling pathways and similar
regulatory mechanisms in controlling the activity of other thermoTRPs as are thought to
modulate the activity of TRPV 1.
For TRPV2, a high-heat (W52OC) activated ion channel [35, 1621, the
endogenous agonists are unknown. However, the activity of TRPV2 is strongly
potentiated by a number of growth factors such as IGF- 1 and PDGF [I621 and by
neuropeptide Head Activator [163]. TRPV2 protein levels can be increased by injury and
inflammation [157, 1641. Growth factor binding to their cognate receptors also
stimulates delivery of TRPV2 to the cell membrane from the cytoplasmic vesicles
TRPV2 occupies prior to growth factor stimulation [162, 1631 and both the potentiation
of TRPV2 activity, and its delivery to the cell surface following stimulation, requires
PI3K [162,163] and CaMKII [163]. In mast cells TRPV2 currents can be enhanced by
the elevation of cyclic AMP levels and by the four-transmembrane domain intracellular
protein RGA (Recombinase Gene Activator Protein) [I 651. Furthermore, TRPV2 is
phosphorylated by, and is found in a complex with, PKA and an A-kinase adapter protein
(AKAP) ACBD3 [166].
TRPV3 is activated by warm temperatures and noxious heat (W33OC) [8,36-38,
1671, by warm sensation-inducing oregano, savory and thyme [49] and by the warm
31
temperature perception-sensitizing compound camphor [8,50]. Interestingly, rather than
desensitizing, warming sensitizes TRPV3 responsiveness to further increases in
temperature [8,36-38, 1671, and TRPV3 currents are rapidly attenuated by even
relatively small decreases in temperature [37]. TRPV3 currents can also be potentiated
by inflammation-induced arachidonic acid and other unsaturated fatty acids [168], PKC
activation [168], G-protein coupled receptor (GPCR)-stimulated PLC activation [49] and
by increases in membrane potential [167, 1681. Heat-evoked TRPV3 currents are also
partially inhibited by ca2+via an unknown mechanism [36, 1671.
TRPV4 is activated by innocuous temperatures and by heat (-27OC<T<-42OC) [7,
39,169,170], epoxygenase (cytochrome P450) products of arachidonic acid metabolism
[171, 1721, by phorbol esters [171, 173-1761 (in part through PKC activation [174, 1751)
and by hypo-osmolarity [39, 177- 1801. In mice, besides mediating thermosensation [54,
181, 1821, TRPV4 is required for osmotic regulation [I831 and also mediates
development of multiple types of hyperalgesia, including thermal, osmotic and
mechanical [I8 1, 182, 184, 1851. The heat-evoked currents of TRPV4 are potentiated by
hypo-osmolarity [7,391 and inhibited by hypertonic solutions [391. Hypo-osmolarity
activation of TRPV4 is potentiated by prostaglandin E2 [185]. TRPV4 currents are
enhanced by Src-family kinase phosphorylation [186, 1871, and are regulated by ca2+and
~a~+/calmodulin
binding to TRPV4 [176, 1881. The amount of TRPV4 on the cell
membrane is increased by the interaction of TRPV4 with microtubule-associated protein
7 (MAP7) [I891 and in renal cells is decreased by serinelthreonine kinases WNK1 and
WNK4 [190].
TRPM8 is activated by cooling (T>-2S°C), by the cooling compound menthol
and by the synthetic super-cooling compound icilin [41,42,5 1, 1911. Menthol and icilin
32
sensitize TRPM8 to cold, allowing the channel to be activated at higher temperature
thresholds [41,51, 191, 1921. The application of menthol onto human skin results in cold
hyperalgesia [193]. TRPM8 can be negatively regulated by PKC phosphorylation [194,
1951, which can facilitate ca2+-dependentdesensitization of the channel [195], and
TRPM8 can be positively regulated by androgen [196]. TRPM8 rnRNA is also
upregulated in prostate cancer cells [196]. Furthermore, TRPMS activity is intimately
tied to the levels of PIP2 [19 1, 1921. Unlike PIP2's role in inhibition of TRPV 1, PIP2
activates TRPM8, with high concentrations of PIP2 activating the channel at -32-37OC,
around the regular body temperature. PIP2 also potentiates TRPM8 activation by cold,
menthol and icilin [191, 1921. ca2+-dependentdesensitization of TRPM8 activity [42,
5 1, 1911 is mediated by the depletion of PIP2 levels: Activation of TRPMS allows ca2+
influx into the cell, which causes ca2+-dependentPLC to translocate to the membrane,
via its pleckstrin homology (PH) domain, where it reduces local PIP2 concentration,
causing loss of TRPM8 activity [191]. Another study, however, reported that inhibition
of PLC attenuated cold- and menthol-evoked TRPM8 currents [47], which appears at
odds with the above findings suggesting positive regulation of TRPM8 activity by PIP2.
The different consequences of PLC inhibition may be due to the difference in cellular
models used in these studies (Xenopus oocytes, COS cells and HEK.293 cells by Rohacs,
et al., [I911 and by Liu and Qin [I921 versus CHO cells used by Bandell, et al., [47]). It
is also possible that in different cellular contexts PLC signaling could modulate TRPM8
activity in either positive or inhibitory manner.
TRPM4 and TRPM5 are also activated by temperature, and the magnitude of this
activation is modulated by membrane potential [40, 1971. At resting potentials, TRPM4
and TRPM5 are activated above -1 5OC, and the magnitude of activation by temperature
increases with membrane potential [40, 1971. TRPM4 is a ca2+-actviatedcation channel
[198-2001, impermeable to divalent cations [199,201], and intracellular ca2+is
absolutely required for TRPM4 activity, including for the potentiation of TRPM4 by
modulators [202,203], temperature [40] and membrane potential [202,203]. Activation
of TRPM4 by intracellular ca2+is followed by the channel's desensitization [198,2022061, accompanied by the progressive loss of ca2+sensitivity by TRPM4 [198,202]. At
least in part, the regulation of TRPM4 activation by ca2+is mediated by calmodulin, as
TRPM4 activity correlates with the amount of functional calmodulin present. In the
presence of ca2+,calmodulin can bind to TRPM4 and interfering with this binding
abolishes most, though not all, ca2+-dependentactivation of TRPM4 [202]. Similar to its
regulation of TRPM8, PIP2 antagonizes TRPM4 desensitization. PIP2 appears to increase
ca2+sensitivity of TRPM4 [198,204], perhaps by slowing the rate of ca2+dissociation
fiom TRPM4, because removal of ca2+fiom the medium results in a much slower rate of
TRPM4 desensitization when PIP2 levels are elevated [198]. Increases in PIP2 levels
shifts activation of TRPM4 by membrane potential to more negative potentials,
increasing the "open state" probability (Po) of TRPM4. ATP can also antagonize
TRPM4 desensitization, perhaps by promoting PIP2replenishment during desensitization
andlor by increasing of association of ca2+with TRPM4 [198,202]. However, ATP can
also inhibit TRPM4 activity under certain conditions [203,207,208]. In addition to
ATP, PIP2 and calmodulin, PKC activity enhances ca2+sensitivity of TRPM4 [197,202]
while the polyamine spermine can block TRPM4 [208].
TRPM5 is closely related to TRPM4 (-45% identity for human proteins [206])
and is also a ca2+-actviated,monovalent cation-permeable (but divalent cation
impermeable) channel that requires intracellular ca2+for its activity [206,209-2111. As
is the case for TRPM4, membrane potential can modulate TRPMS activity, including its
activation by temperature, and this regulation also requires ca2+[40,206,209,210].
Activation of TRPMS by intracellular ca2+is followed by the channel's desensitization
[209,2 101, and PIP2 can re-sensitize TRPMS [19 1,2091. TRPMS can be activated
downstream of GPCR stimulation [206,209,210,212], as, for example, is thought to be
the case for the mechanism of taste sensation [212,2131. GPCR stimulation is thought to
activate TRPMS currents through the action of PLC, which cleaves PIP2 into DAG and
IP3,with the later releasing ca2+from the intracellular stores [209]. However, while
some groups reported TRPMS activation upon ca2+release from the intracellular stores
[206,210,2 11,2141, other groups have failed to observe this [209,2 121. The
explanation for this apparent discrepancy may be a finding that fast increase in ca2+
levels is much more effective at evoking TRPMS currents then slow ca2+increase [2101.
Similar to TRPM4, TRPMS currents are blocked by spermine [208]. Unlike TRPM4,
however, TRPMS does not appear to be inhibited by ATP [208], but is inhibited by
protons, while TRPM4 is not [2151.
TRPAl channel can be activated by cooling below -17OC [43,44,47,57],
although not all groups have been able to reproduce this finding [45,57,60]. Pungent
compounds found in mustard oil (isothiocyanate), garlic (allicin), cinnamon oil
(cinnamaldehyde) and tear gas (acrolein) can activate TRPAl currents and produce pain
and thermal and mechanical hyperalgesia [44-481. Carvacrol, an ingredient of warm
sensation-evoking oregano, which is also perceived as pungent, can activate and rapidly
desensitize TRPA 1 [49]. The cooling compound icilin can also activate TRPA 1 currents
[43] while the warmth-sensitizing compound camphor inhibits TRPAl [SO]. TRPAl can
also be activated by Bradykinin-responsive signaling pathway [47,48] through activation
35
of PLC and perhaps DAG and arachidonic acid synthesis [47], and TRPAl knockout
mice do not develop thermal or mechanical hyperalgesia in response to Bradykinin [48].
TRPA1 expression is increased in response to injury or inflammation, such as that
induced by NGF [64], and reduction of TRPAl levels alleviates cold hyperalgesia
induced by spinal nerve injury or NGF injection [64,65]. TRPAl levels have also been
reported to be deregulated in many human cancers [2 16-2 181. TRPA 1 is ubiquitinated
following activation with icilin and its ubiquitination is regulated in part by a tumor
suppressor de-ubiquitinating enzyme (ubiquitin hydrolase) CYLD [2171. CYLD
physically interacts with and is able to de-ubiquitinate TRPAl, increasing its levels in
cultured cells. Thus, TRPAl activity may be regulated by ubiquitination. ca2+might
also regulate TRPA1, as release of ca2+from the internal ca2+stores has also been
reported to activate TRPAl currents [45], although another group could not replicate this
finding [47].
For the three putative Drosophila thermoTRPs (see above), no agonists other than
temperature, antagonists or interacting proteins are known. However, dTRPAl currents
in heterologous cells exhibit strong outward rectification, indicating that dTRPAl
currents can be potentiated by the increases in membrane potential (see below) [811.
pyrexia locus is differentially transcribed to produce two PYREXIA proteins [80]. These
proteins feature the same transmembrane domains and C-terminal sequences but PYX-PB
lacks much of the N-terminus found in PYX-PA. In heterologous cells, heating above
35OC activates both PYX-PA and PYX-PB currents, although the PYX-PA currents
exhibit larger amplitude. Interestingly, when PYX-PA and PYX-PB are co-transfected
together into cells, the current profile following activation by heat is different than that of
cells in which either channel is transfected alone. Furthermore, the ion permeabilities of
36
the PYX-PA and PYX-PB co-transfected cells following heat activation were different
than those of cells in which either channel was transfected alone [go]. Thus, PYREXIA
channel activity appears to be regulated by differential subunit composition [go], just as
the activity of some mammalian thennoTRPs (see below).
Regulation of thermoTRP activity by membrane potential.
Recent work indicates that membrane potential can regulate TRP activity
(reviewed in [197]). Currents of a number of thermoTRPs (and some TRPs not
demonstrated to be activated by temperature) exhibit outward rectification as a function
of membrane potential. These thermoTRPs include TRPV 1 [197,2 191, TRPV3 [37,
1671, TRPM4 [197, 198,201-2051, TRPM5 [40,206,208-2101, TRPM8 [197,219],
TRPAl [43,45] and dTRPAl [811. Positive membrane potentials act to sensitize
thermoTRPs to agonists, including temperature, allowing warming- or heat-activated
thermoTRPs to open at lower temperatures than at lower potentials and allowing TRPM8
to be activated at higher temperatures than at lower potentials [197,2 191. In fact, at
extremely high positive potentials (+100mV) TRPM8 can be activated at 32OC, while at
-80mV TRPM8 current is only detectable after cooling below 25OC [219]. Similarly,
TRPVl currents can be elicited by a 17OC stimulus at potentials above +1OOmV, while at
-100mV TRPVl currents are detectable only above 35OC and are significant above 40°C
[219].
Biophysical analysis of thermoTRP membrane potential-gating mechanisms
suggest that positive potentials increase Po (the probability that a channel is open at given
conditions) while temperature and other agonists affect gating of the channels by
potentially different, and sometimes separable mechanisms [197,219-22 11. One of the
37
best examples of the differences in mechanisms of thermoTRP activation employed by
membrane potential and agonist gating is exhibited by TRPM4. As mentioned above,
TRPM4 requires ca2+for its activity - without intracellular ca2+even the most positive
potentials can't elicit TRPM4 currents - and modulation of TRPM4 currents by
membrane potentials does not affect ca2+dependence of the channel, suggesting that
ca2+sensitivity of TRPM4 current is independent of the voltage sensitivity of TRPM4
[205]. Further evidence for the independence of membrane potential and agonist gating
of TRPM4 can be gleamed fiom the effects of decavanadate, a synthetic agonist of
TRPM4 thought to interact with the ATP-binding sites of TRPM4. Decavanadate elicits
TRPM4 currents at -1 00mV but not at +100mV holding potentials [203]. In a protocol
where a pre-pulse to +100mV is followed by voltage clamping to negative potentials,
decavanadate does not enhance the amplitude of TRPM4 current at any potential [203].
Also, decavanadate potentiates the inhibition of TRPM4 by ATP and this inhibition of
TRPM4 currents by ATP in the presence of decavanadate is voltage-independent. Thus,
gating of TRPM4 by ca2+(and its modulation by effector molecules) can be separated
fiom the effects of membrane potential on gating [203]. While the cell is unlikely to
reach membrane potentials of +100mV or -1 OOmV, modulators of thermoTRP activation,
such as temperature, lipids or protein kinases may shift voltage-dependence enough, i.e.
increase the Po enough, so that even the more modest voltage-dependent Po increases
observed at the physiological potentials (compared to those at very positive potentials)
may be sufficient to produce a cellular response [197,2 191.
How does the modulation of current by membrane potential interact with the
temperature activation of the channel? In one model, rise in membrane potential
increases the Po of the channel while the temperature affects opening or closing rates of
the channel [197,2 19,2201. For TRPV 1, if the opening rate is temperature-sensitive
while the closing rate is not, an increase in temperature will activate the channel and will
require less positive potential to activate it [220]. In other words, membrane potential
and temperature are acting fairly independently of each other to modulate Po of the
channel. This "two-state" (opened-closed) model can approximate behavior of
thermoTRPs relatively well [197,219,220], although the kinetics of TRPM8 activation
appear to be more complex [197,2 191 and might be more accurately described by an
"allosteric" model, where temperature and membrane potential induce interacting
changes in the channel's structure [22 11.
Regulation of thermoTRPs by subunit composition.
One additional mechanism for altering the properties of the thermal sensors is the
use of alternative subunit compositions by thermoTRPs. TRP channels function as
tetramers and different subunits have been shown to associate with each other [33]. For
example, TRPV 1 can hetero-oligomerize with TRPV2 [222-2241 and with TRPV3 [381.
When TRPVl is co-transfected with TRPV3 into heterologous cells, TRPVl currents
elicited by protons or capsaicin are enhanced, suggesting that hetero-oligomerization can
alter properties of thermoTRPs [38]. TRP family members can also homo-oligomerize
[199,222,223]. Further increasing the diversity of TRP channels, different isoforms of
individual thermoTRP have been identified. Mouse TRPVI RNA is spliced into at least
two different isoforms, a (which appears to encode a full-length "canonical" channel)
and f3, with mTRPV 1f3 lacking 1Oaa within the N-terminal cytoplasmic domain [225].
mTRPVl f3 does not appear to form a functional channel, although it can be trdficked to
the cell membrane and can interfere with the activation of mTRPVla by agonists, acting
39
as a dominant negative [225]. mTRPVl is expressed in sensory neurons and in tongue,
tissues where TRPVl is known to function [225]. Human TRPV1 also exhibits
alternative splicing, with hTRPVlb identical to the canonical TRPVl except for a 60aa
deletion in the N-terminal domain of hTRPV 1b [226]. hTRPV 1b can be activated
essentially normally by heat (threshold of -47OC), but unlike canonical TRPV 1,
hTRPVlb can't be activated by capsaicin or protons. Analysis of TG neurons identified
a subpopulation of neurons that respond to heating (-47OC) but not to capsaicin, and RTPCR analysis revealed that hTRPVl b isoform is present in these neurons [226]. An
isoform of rat TRPV 1, TRPVlvARencodes only a 253a.a cytoplasmic portion of the
TRPVl N-terminal region, lacking the rest of the protein, including the transmembrane
domains [227]. TRPVlvARpotentiates currents of the canonical TRPV 1 in HEK253 cells
but inhibits TRPVl currents in COS-7 cells, suggesting context-specific regulation of
TRPV 1 activity by TRPV 1vAR[227]. TRPV 1vARdoes not seem to regulate expression or
cell surface delivery of TRPV1, and while the mechanism of its regulation of TRPVl is
unclear, TRPVl vARprotein can bind to TRPVl and is expressed in sensory neurons
[227]. A different isoform of rat TRPV 1 lacks almost the entire N-terminal domain.
This isoform, VR.S1sv,is not activated by TRPVl agonists, and while its interactions
with the canonical TRPVl protein have not been reported, VR.5'sv is expressed in DRG
and brain neurons [228]. For human TRPV4, five splicing isoforms have been reported:
TRPVB4-B, C and E lack portions of the N-terminal ankyrin repeats present in the
canonical TRPV4-A, while TRPV4-D lacks 34 amino acids more N-terminal of the
ankyrin repeats. TRPV4-D responds to tested stimuli as canonical TRPV4-A while B, C
and E isoforms are unresponsive [229]. B, C and E isoforms are improperly glycosylated
and appear to be retained in the ER [229]. Interestingly, stimuli-responsive A and D
40
isoforms form both homo-oligomers and hetero-oligomers when transfected into
heterologous cells [229]. These findings suggest that regulation of expression andlor
modulation of various TRPs and TRP isoforms allows for further plasticity in neuronal
mechanisms for detection of temperature.
Conclusions and future directions.
During the last decade, several candidate ion channels for mediating the initial
step of temperature sensation have been identified. These thermoTRPs respond to a
broad spectra of temperatures, and various examples of regulating thermoTRPs'
temperature responsiveness have been reported and are detailed above. In addition,
temperature-activatable non-TRP proteins have been identified, increasing the potential
diversity of the thermal sensors and the mechanisms for the cells and for the organism to
sense temperature.
With this apparent complexity of thermosensory mechanisms and interactions
between them, the thermal sensors might be expected to exhibit quite a bit of redundancy
and compensation. Indeed, mice lacking individual thermoTRPs are still capable of
sensing temperatures, even within the ranges the knocked-out channels were predicted to
sense. While this redundancy is likely very beneficial to the animal, given the
importance of temperature perception, the redundancy among thermosensory
mechanisms also makes it difficult to assess the relative contributions of the individual
genes to thermal sensation. In that regard, invertebrate model systems, with their
powerfid genetics and likely smaller redundancy may provide an avenue for identifying
and studying molecules required for temperature perception and the mechanisms of
modulation of these thermal sensors.
While much has been learned about the mechanisms of temperature sensation, the
story is far fiom complete. Even though under controlled conditions thermoTRPs can
exhibit a remarkable expansion of the temperature ranges that can activate them, how
large of a contribution to temperature sensation do such expansions make in the animal?
How much do different non-TRP thermosensitive molecules contribute to the perception
of the temperature stimulus? For noxious heat perception, for instance, what are the
mechanisms that mediate responses to high heat in neurons lacking TRPVl and TRPV2?
How do the neurons sense noxious cold in the absence of TRPMS and TRPAl? Do other
thermoTRPs pick up the temperature slack or do other, perhaps as yet unidentified,
molecules shoulder most of the burden? Stay tuned. The answers to these questions, as
well as to other key questions such as how does temperature actually gate an ion channel
on a structural level and how the modulation of the temperature gating is accomplished
by interacting factors are coming.
Using Drosophila thermotaxis to study molecular mechanisms of temperature
sensation.
The perception of temperature is a complex process requiring multiple proteins.
The sensation of temperature stimuli is thought to be mediated by temperature-responsive
proteins, the thermal sensors. In mammals, multiple temperature-responsive proteins
have been identified. These putative thermal sensors include members of the Transient
Receptor Potential (TRP) family, members of the DegeneridEpithelial Sodium Channel
(DEGIENaC) family, certain two-pore potassium channels and the ATP receptor P2X3.
TRP channels in particular are excellent candidates for serving as thermal sensors for
mediating temperature sensation because different temperature-responsive TRPs
(thermoTRPs) can be activated by different temperature spectra [ 5 ] . Furthermore, mouse
knockout studies of some thermoTRPs support the involvement of thermoTRPs in
temperature sensation (see above). It is interesting to note, however, that both
temperature responsiveness and mouse knockouts of discrete thermoTRPs support the
requirement of different thermoTRPs in the perception of discrete and relatively narrow
temperatures.
The putative thermal sensors are all expressed in tissues and cells known to be
temperature-responsive, such as the subsets of sensory neurons in the skin and tongue.
Similar to the thermals sensors, subsets of temperature-responsive cells can be activated
by different temperatures ( [ 5 ] ; see above).
Temperature-responsiveness of temperature-activatable proteins and of
temperature-sensitive cells can be further modulated by mechanisms such as the
endogenous and exogenous agonists, phosphorylatiodde-phosphorylation, different
subunit composition of the thermal sensors and by membrane voltage potential. These
43
modifications of the thermal sensors' temperature responsiveness likely expand the
temperatures capable of activating a given thermal sensor. The modifications of
temperature-responsiveness of thermal sensors, as well as overlaps and redundancies
among the thermal sensors likely contribute to animals' temperature perception.
However, such redundancies and potential overlaps between the activities of thermal
sensors also make it difficult to assess the relative contributions of individual proteins,
and the interactions between these proteins and the modulators of their activity to thermal
sensation and temperature perception.
The mechanisms of temperature perception are still poorly understood. It is likely
that both as yet unidentified genes and unappreciated interactions between known genes
are required for temperature sensation. To better define molecular mechanisms of
temperature sensation we initiated the study of thermotaxis (directed movements in
response to changes in temperature) in a higher genetically tractable organism,
Drosophila melanogaster. Drosophila adults and larvae exhibit a variety of robust
thermosensory behaviors [15, 19-2 1, 801 including thermotaxis.
The molecular mechanisms that underlie thermotactic behavior were most
thoroughly investigated in the nematode C. elegans (reviewed in [12]; see above).
However, while the neurons and some of the molecules required for therrnotaxis in C.
elegans have been identified, the molecular mechanisms by which the worm senses
temperature and translates that sensation into a behavioral response are still not well
understood. When we began our studies of thermotaxis, nothing was known regarding
the molecular mechanisms of thermotaxis in Drosophila, virtually nothing was known
about the cells that mediate thermotaxis, and overall, very little was known about the
neurons and molecules that mediate thermosensation and thermosensory behaviors in
Drosophila.
As a first step towards elucidating the molecular mechanisms of thermotaxis, we
wished to identify the thermal sensors that mediate thermotactic behavior. We used RNA
interference (RNAi)-based reverse genetic approach to knock down levels of various
Drosophila relatives of mammalian thermoTRPs (since most evidence at the time
suggested that thennoTRPs were excellent candidates to be thermal sensors to mediate
thermotaxis). Through this approach, we identified dTRPA1, a Drosophila ortholog of
mammalian thermoTRP TRPA 1, as a critical regulator of thermotaxis ([2 11; see below).
Subsequent analysis of dhpA1 mutants that we have generated confirmed that dTRPAl is
required for thennotaxis. Interestingly, dtrpAl mutants exhibited defects for thermotaxis
at both elevated and cold temperatures, suggesting that unlike most known thermoTRPs,
dTRPAl is required for behavioral responses to broad ranges of temperatures. We also
identified dTRPAl -expressing cells and implicated a subset of these cells in mediating
thermotaxis at elevated temperatures. How dTRPAl mediates thermotaxis is currently
unclear. dTRPAl might mediate thermotaxis by serving as a temperature sensor andlor
by functioning in thermotaxis downstream of the temperature-sensation step. Work from
Tim Jegla's and Ardem Patapoutian's labs suggests that dTRPAl protein can be activated
by warming [8 11, suggesting that dTRPAl might function as a temperature sensor at least
during thermotaxis at elevated temperatures. The temperature responsiveness of
dTRPAl in animals, however, has not yet been assessed. Our findings provide important
initial characterization of themotaxis in Drosophila and implicate novel neurons and
molecules in mediating thermotactic behavior.
References.
Gilbert, S.F., Developmental Biology. 5 ed. 1997, Sunderland: Sinauer Associates,
Inc .
Margesin, R., F. Schinner, and (Eds.), Cold-Adapted Organisms: Ecology,
Physiology, Enzymology and Molecular Biology. 1 ed. 1999: Springer. 4 16.
Purves, D., et al., Chapter 10: Pain, in Neuroscience. 200 1, Sinauer Associates,
Inc. p. 209-222.
Nomoto S, S.M., Iriki M, Riedel W, Role of afferentpathways of heat and cold in
body temperature regulation. Int J Biometeorol., 2004.49: p. 67-85.
Patapoutian, A., et al., ThermoTRP channels and beyond: mechanisms of
temperature sensation. Nat Rev Neurosci, 2003.4(7): p. 529-39.
Axelrod, F.B. and M.J. Hilz, Inherited autonomic neuropathies. Semin Neurol,
2003.23(4): p. 381-90.
Chung, M.K., et al., TRPV3 and TRPV4 mediate warmth-evoked currents in
primary mouse keratinocytes. J Biol Chem, 2004.279(20): p. 2 1569-75.
Moqrich, A., et al., Impaired thermosensation in mice lacking TRPV3, a heat and
camphor sensor in the skin. Science, 2005.307(5714): p. 1468-72.
Boulant, J.A., Role of the preoptic-anterior hypothalamus in thermoregulation
andfever. Clin Infect Dis, 2000.31 Suppl5: p. S 157-61.
Boulant, J.A., Hypothalamic control of thermoregulation: Neurophysiological
basis, in Handbook of the Hypothalamus: Behavioral Studies of the
Hypothalamus, P.J. Morgane and J. Panksepp, Editors. 1980, Marcel Dekker:
New York. p. 1-82.
Barker, J.L. and D.O. Carpenter, Thermosensitivity of neurons in the sensorimotor
cortex of the cat. Science, 1970.169(945): p. 597-8.
Mori, I., Genetics of chemotaxis and thermotaxis in the nematode Caenorhabditis
elegans. Annu Rev Genet, 1999.33: p. 399-422.
Kimura, K.D., et al., The C. elegans thermosensory neuron AFD responds to
warming. Curr Biol, 2004. 14(14): p. 1291-5.
Mori, I. and Y. Ohshima, Neural regulation of thermotaxis in Caenorhabditis
elegans. Nature, 1995.376(6538): p. 344-8.
Sayeed, 0 . and S. Benzer, Behavioral genetics of thermosensation and
hygrosensation in Drosophila. Proc Natl Acad Sci U S A, 1996.93(12): p. 607984.
Wustmann, G., et al., A new paradigm for operant conditioning of Drosophila
melanogaster. J Comp Physiol [A], 1996. 179(3): p. 429-36.
Glaser, F.T. and R. Stanewsky, Temperature synchronization of the Drosophila
circadian clock. Curr Biol, 2005. 15(15): p. 1352-63.
Zars, T., Two thermosensors in Drosophila have dverent behavioral functions. J
Comp Physiol [A], 2001. 187(3): p. 235-42.
Liu, L., et al., IdentzBcation andfunction of thermosensory neurons in Drosophila
larvae. Nat Neurosci, 2003.6(3): p. 267-73.
Tracey, W.D., Jr., et al., painless, a Drosophila gene essentialfor nociception.
Cell, 2003. 113(2): p. 261-73.
Rosenzweig, M., et al., The Drosophila ortholog of vertebrate TRPAI regulates
thermotaxis. Genes Dev, 2005. 19(4): p. 4 19-24.
Murphy Jr., B.F. and J.E. Heath, Temperature sensitivity in the prothoracic
ganglion of the cockroach, Periplaneta americana, and its relationship to
thermoregulation. J. Exp. Biol., 1983.105: p. 305-3 15.
Tominaga, M. and M.J. Caterina, Thermosensation and pain. J Neurobiol, 2004.
61(1): p. 3-12.
Caterina, M.J., et al., The capsaicin receptor: a heat-activated ion channel in the
pain pathway. Nature, 1997.389(6653): p. 816-24.
Tominaga, M., et al., The cloned capsaicin receptor integrates multiple painproducing stimuli. Neuron, 1998.2 l(3): p. 53 1-43.
Caterina, M.J., et al., Impaired nociception andpain sensation in mice lacking the
capsaicin receptor. Science, 2000.288(5464): p. 306-13.
Davis, J.B., et al., Vanilloid receptor-1 is essentialfor inflammatory thermal
hyperalgesia. Nature, 2000.405(6783): p. 183-7.
Cesare, P. and P. McNaughton, A novel heat-activated current in nociceptive
neurons and its sensitization by bradykinin. Proc Natl Acad Sci U S A, 1996.
93(26): p. 15435-9.
Nagy, I. and H. Rang, Noxious heat activates all capsaicin-sensitive and also a
su b-population of capsaicin-insensitive dorsal root ganglion neurons.
Neuroscience, 1999. 88(4): p. 995-7.
Reichling, D.B. and J.D. Levine, Heat transduction in rat sensory neurons by
calcium-dependent activation of a cation channel. Proc Natl Acad Sci U S A,
1997.94(13): p. 7006- 11.
Montell, C., L. Birnbaumer, and V. Flockerzi, The TRP channels, a remarkably
functional family. Cell, 2002. 108(5): p. 595-8.
Montell, C., The TRP superfamily of cation channels. Sci STKE, 2005.
2005(272): p. re3.
Schaefer, M., Homo- and heteromeric assembly of TRP channel subunits.
Pflugers Arch, 2005.451(1): p. 35-42.
Owsianik, G., et al., Permeation and selectivity of trp channels. Annu Rev
Physiol, 2006. 68: p. 685-717.
Caterina, M.J., et al., A capsaicin-receptor homologue with a high thresholdfor
noxious heat. Nature, 1999. 398(6726): p. 436-4 1.
Peier, A.M., et al., A heat-sensitive TRP channel expressed in keratinocytes.
Science, 2002.296(5575): p. 2046-9.
Xu, H., et al., TRPV3 is a calcium-permeable temperature-sensitive cation
channel. Nature, 2002. 418(6894): p. 181-6.
Smith, G.D., et al., TRPV3 is a temperature-sensitive vanilloid receptor-like
protein. Nature, 2002. 418(6894): p. 186-90.
Guler, A.D., et al., Heat-evoked activation of the ion channel, TRPV4. J Neurosci,
2002.22(15): p. 6408-14.
Talavera, K., et al., Heat activation of T M M 5 underlies thermal sensitivity of
sweet taste. Nature, 2005. 438(7070): p. 1022-5.
Peier, A.M., et al., A TRP channel that senses cold stimuli and menthol. Cell,
2002. 108(5): p. 705-15.
McKemy, D.D., W.M. Neuhausser, and D. Julius, Identzfication of a cold receptor
reveals a general role for TRP channels in thermosensation. Nature, 2002.
416(6876): p. 52-8.
Story, G.M., et al., ANKTMl, a TRP-like channel expressed in nociceptive
neurons, is activated by cold temperatures. Cell, 2003.112(6): p. 819-29.
Macpherson, L.J., et al., The pungency of garlic: activation of TRPAl and TRPVl
in response to allicin. Curr Biol, 2005. 15(10): p. 929-34.
Jordt, S.E., et al., Mustard oils and cannabinoids excite sensory nerve fibres
through the TRP channel ANKTMl. Nature, 2004.427(6971): p. 260-5.
Bautista, D.M., et al., Pungent productsflorn garlic activate the sensory ion
channel TRPAl. Proc Natl Acad Sci U S A, 2005.102(34): p. 12248-52.
Bandell, M., et al., Noxious cold ion channel TRPAl is activated by pungent
compounds and bradyknin. Neuron, 2004.41(6): p. 849-57.
Bautista, D.M., et al., TRPAl mediates the inflammatory actions of environmental
irritants andproalgesic agents. Cell, 2006.124(6): p. 1269-82.
Xu, H., et al., Oregano, thyme and clove-derivedflavors and skin sensitizers
activate specific TRP channels. Nat Neurosci, 2006.9(5): p. 628-635.
Xu, H., N.T. Blair, and D.E. Clapham, Camphor activates and strongly
desensitizes the transient receptor potential vanilloid subtype 1 channel in a
vanillid-independent mechanism. J Neurosci, 2005.25(39): p. 8924-37.
Chuang, H.H., W.M. Neuhausser, and D. Julius, The super-cooling agent icilin
reveals a mechanism of coincidence detection by a temperature-sensitive TRP
channel. Neuron, 2004.43(6): p. 859-69.
Cruz, A. and B.G. Green, Thermal stimulation of taste. Nature, 2000.403(6772):
p. 889-92.
Temussi, P., The history of sweet taste: not exactZy a piece of cake. J Mol
Recognit, 2006.
Lee, H., et al., Altered thermal selection behavior in mice lacking transient
receptor potential vanilloid 4. J Neurosci, 2005.25(5): p. 1304-10.
Kwan, K.Y., et al., TRPAl contributes to cold, mechanical, and chemical
nociception but Is not essentialfor hair-cell transduction. Neuron, 2006.50: p.
277-289.
Babes, A., D. Zorzon, and G. Reid, Twopopulations of cold-sensitive neurons in
rat dorsal root ganglia and their modulation by nerve growthfactor. Eur J
Neurosci, 2004.20(9): p. 2276-82.
Reid, G., ThermoTRP channels and cold sensing: what are they really up to?
Pflugers Arch, 2005.451(1): p. 250-63.
McKemy, D.D., How cold is it? TRPM8 and TRPAl in the molecular logic of
cold sensation. Mol Pain, 2005. l(1): p. 16.
Thut, P.D., D. Wrigley, and M.S. Gold, Cold transduction in rat trigeminal
ganglia neurons in vitro. Neuroscience, 2003.119(4): p. 1071-83.
Nagata, K ., et al., Nociceptor and hair cell transducerproperties of TRPAI, a
channelfor pain and hearing. J Neurosci, 2005.25(16): p. 4052-6 1.
Dhaka, A*,V. Viswanath, and A. Patapoutian, TRP Ion Channels and
Temperature Sensation. Annu Rev Neurosci, 2006.
Story, G.M. and R.W.t. Gereau, Numbing the senses: role of TRPAl in
mechanical and cold sensation. Neuron, 2006.50(2): p. 177-80.
Park, C.K., et al., Functional expression of thermo-transient receptor potential
channels in dental primary afferent neurons: Implication for toothpain. J Biol
Chem, 2006.
Obata, K., et al., TRPAl induced in sensory neurons contributes to cold
hyperalgesia a f t r inflammation and nerve injury. J Clin Invest, 2005.115(9): p.
2393-401.
Katsura, H., et al., Antisense knock down of TRPAI, but not TRPM8, alleviates
cold hyperalgesia after spinal nerve ligation in rats. Exp Neurol, 2006.
Woodbury, C.J., et al., Nociceptors lacking TRPVl and TRPV2 have normal heat
responses. J Neurosci, 2004.24(28): p. 64 10-5.
Reid, G. and M. Flonta, Cold transduction by inhibition of a background
potassium conductance in rat primary sensory neurones. Neurosci Lett, 2001.
297(3): p. 171-4.
Maingret, F., et al., TREK-1 is a heat-activated background K(+) channel. Embo
J,2000.19(11): p. 2483-9 1.
Alloui, A., et al., TREK-1, a K(+) channel involved in polymodal pain perception.
Embo J , 2006.
Kang, D., C. Choe, and D. Kim, Thermosensitivityof the two-pore domain K+
channels TREK-2 and TRAAK J Physiol, 2005.564(Pt 1): p. 103-16.
Kunkel, M.T., et al., Mutants of a temperature-sensitivetwo-P domainpotassium
channel. J Neurosci, 2000.20(20): p. 75 17-24.
Hosono, R., S. Kuno, and M. Midsukami, Temperature-sensitive mutations
causing reversible paralysis in Caenorhabditis elegans. J Exp 2001, 1985.235(3):
p. 409-21.
Souslova, V., et al., Warm-coding deficits and aberrant inflammatorypain in
mice lacking P2X3 receptors. Nature, 2000.407(6807):p. 1015-7.
Shimizu, I., et al., Enhanced thermal avoidance in mice lacking the ATP receptor
P2X3. Pain, 2005.116(1-2):p. 96-108.
Askwith, C.C., et al., DEG/ENaC ion channels involved in sensory transduction
are modulated by cold temperature. Proc Natl Acad Sci U S A, 2001.98(11): p.
6459-63.
Montell, C., Drosophila TRP channels. Pflugers Arch, 2005.451(1): p. 19-28.
Kellenberger, S. and L. Schild, Epithelial sodium channevdegenerinfamily of ion
channels: a variety offunctions for a shared structure. Physiol Rev, 2002.82(3):
p. 735-67.
Buckingharn, S.D., et al., Structure andfunction of two-pore-domain K+
channels: contributionsfrom genetic model organisms. Trends Pharmacol Sci,
2005.26(7): p. 361-7.
Littleton, J.T. and B. Ganetzky, Ion channels and synaptic organization: analysis
of the Drosophila genome. Neuron, 2000.26(1): p. 35-43.
Lee, Y., et al., Pyrexia is a new thermal transient receptor potential channel
endowing tolerance to high temperatures in Drosophila melanogaster. Nat Genet,
2005.37(3): p. 305-10.
Viswanath, V., et al., Opposite thermosensor infiuitjly and mouse. Nature, 2003.
423(6942): p. 822-3.
Hedgecock, E.M. and R.L. Russell, Normal and mutant thermotaxis in the
nematode Caenorhabditis elegans. Proc Natl Acad Sci U S A, 1975.72(10):p.
4061-5.
Mohri, A., et al., Genetic control of temperature preference in the nematode
Caenorhabditiselegans. Genetics, 2005.169(3): p. 1437-50.
Satterlee, J.S., et al., Specification of thermosensory neuronfate in C. elegans
requires ttx-1, a homolog of otd/Otx. Neuron, 200 1.31(6): p. 943-56.
Cassata, G., et al., The LIM homeobox gene ceh-14 confers thermosensory
finction to the AFD neurons in Caenorhabditis elegans. Neuron, 2000.25(3): p.
587-97.
Hobert, O., et al., Regulation of interneuronfunction in the C. elegans
thermoregulatory pathway by the tbc-3 LIM homeobox gene. Neuron, 1997.19(2):
p. 345-57.
Hobert, O., et al., Control of neural development andfinction in a
thermoregulatory network by the LIM homeobox gene lin-11. J Neurosci, 1998.
18(6): p. 2084-96.
Coburn, C.M., et al., A cyclic nucleotide-gated channel inhibits sensory axon
outgrowth in larval and adult Caenorhabditis elegans: a distinct pathway for
maintenance of sensory axon structure. Development, 1998.125(2): p. 249-58.
Komatsu, H., et al., Mutations in a cyclic nucleotide-gated channel lead to
abnormal thermosensationand chemosensation in C. elegans. Neuron, 1996.
17(4): p. 707- 18.
Inada, H., et al., Identification of guanylyl cyclases thatfinction in thermosensory
neurons of Caenorhabditis elegans. Genetics, 2006.
Satterlee, J.S., W.S. Ryu, and P. Sengupta, The CMK-1 CaMKland the TAX-4
Cyclic nucleotide-gated channel regulate thermosensory neuron gene expression
andfinction in C. elegans. Curr Biol, 2004. 14(1): p. 62-8.
Gomez, M., et al., Ca2+ signaling via the neuronal calcium sensor-1 regulates
associative learning and memory in C. elegans. Neuron, 2001.30(1): p. 24 1-8.
Kuhara, A., et al., Negative regulation and gain control of sensory neurons by the
C. elegans calcineurin TAX-6. Neuron, 2002.33(5): p. 75 1-63.
Okochi, Y., et al., Diverse regulation of sensory signaling by C. elegans nPKCepsilodeta TTX-4. Embo J, 2005.24(12): p. 2 127-37.
Ishihara, T., et al., HEN-1, a secretory protein with an LDL receptor mot$
regulates sensory integration and learning in Caenorhabditis elegans. Cell, 2002.
109(5): p. 639-49.
Murakami, Hayet al., Aging-dependent and -independent modulation of
associative learning behavior by insulirdinsulin-like growthfactor-1 signal in
Caenorhabditis elegans. J Neurosci, 2005.25(47): p. 10894-904.
Ito, H., H. Inada, and I. Mori, Quantitative analysis of thermotaxis in the
nematode Caenorhabditiselegans. J Neurosci Methods, 2006.
De Petrocellis, L. and V. Di Marzo, Lipids as regulators of the activity of
transient receptor potential type Vl (TRPVl) channels. Life Sci, 2005. 77(14): p.
165 1-66.
Van Der Stelt, M. and V. Di Marzo, Endovanilloids. Putative endogenous ligands
of transient receptor potential vanilloid 1 channels. Eur J Biochem, 2004.
271(10): p. 1827-34.
Bevan, S. and P. Geppetti, Protons: small stimulants of capsaicin-sensitive
sensory nerves. Trends Neurosci, 1994.17(12):p. 509- 12.
Jones, N.G., et al., Acid-inducedpain and its modulation in humans. J Neurosci,
2004.24(48): p. 10974-9.
Ahern, G.P., X. Wang, and R.L. Miyares, Polyamines Are Potent Ligands for the
Capsaicin Receptor TRPVI. J Biol Chem, 2006.281(13): p. 899 1-5.
Zhang, M., H. Wang, and K.J. Tracey, Regulation of macrophage activation and
inflammation by spermine: a new chapter in an old story. Crit Care Med, 2000.
28(4 Suppl): p. N60-6.
Van Der Stelt, M., et al., Anandamide acts as an intracellular messenger
amplzjjing Ca2+ influx via TRPVl channels. Embo J, 2005.24(17): p. 3026-37.
Shin, J., et al., BradyRnin-12-lipoxygenase-VRI signaling pathway for
inflammatory hyperalgesia. Proc Natl Acad Sci U S A, 2002.99(15): p. 10150-5.
Hwang, S.W., et al., Direct activation of capsaicin receptors by products of
lipoxygenases: endogenous capsaicin-like substances. Proc Natl Acad Sci U S A,
2000.97(11): p. 6155-60.
Levine, J.D., et al., Hyperalgesic properties of 15-lipoxygenaseproducts of
arachidonic acid Proc Natl Acad Sci U S A, 1986.83(14):p. 533 1-4.
Chu, C.J., et al., N-oleoyldopamine, a novel endogenous capsaicin-like lipid that
produces hyperalgesia. J Biol Chem, 2003.278(16): p. 13633-9.
Movahed, P., et al., Endogenous unsaturated C18 N-acylethanolamines are
vanilloid receptor (TRPVI) agonists. J Biol Chem, 2005.280(46): p. 38496-504.
Khasar, S.G., et al., A novel nociceptor signalingpathway revealed in protein
kinase C epsilon mutant mice. Neuron, 1999.24(1):p. 253-60.
Leffler, A., B. Monter, and M. Koltzenburg, The role of the capsaicin receptor
TRPVl and acid-sensing ion channels (ASICS) in proton sensitivity of
subpopulations ofprimary nociceptive neurons in rats and mice. Neuroscience,
2006.139(2): p. 699-709.
Moriyama, T., et al., Possible involvement of P2Y2 metabotropic receptors in
ATP-induced transient receptor potential vanilloid receptor 1-mediated thermal
hypersensitivity. J Neurosci, 2003.23(14): p. 6058-62.
Tominaga, M., M. Wada, and M. Masu, Potentiation of capsaicin receptor
activity by metabotropic ATP receptors as a possible mechanismfor ATP-evoked
pain and hyperalgesia. Proc Natl Acad Sci U S A, 2001.98(12): p. 695 1-6.
Hamilton, S.G., A. Wade, and S.B. McMahon, The effects of inflammation and
inflammatory mediators on nociceptive behaviour induced by ATP analogues in
the rat. Br J Pharrnacol, 1999.126(1):p. 326-32.
Chuang, H.H., et al., Bradykinin and nerve growthfactor release the capsaicin
receptor @om PtdIm(4,5)P2-mediated inhibition. Nature, 200 1 . 41l(6840): p.
957-62.
Manning, D.C., et al., Pain and hyperalgesia afleer intradermal injection of
bradyknin in humans. Clin Pharmacol Ther, 1991.50(6): p. 721-9.
Sugiura, T., et al., Bradykinin lowers the threshold temperaturefor heat
activation of vanilloid receptor I. J Neurophysiol, 2002.88(1): p. 544-8.
Moriyama, T., et al., Sensitization of TRPVl by EPI and IP reveals peripheral
nociceptive mechanism ofprostaglandins. Mol Pain, 2005. l(1): p. 3.
Rathee, P.K., et al., PWAKAPNR-I module: A common link of Gs-mediated
signaling to thermal hyperalgesia. J Neurosci, 2002.22(11): p. 4740-5.
Zhang, N., et al., A proinflammatory chemokine, CCL;1,sensitizes the heat- and
capsaicin-gated ion channel TRPVI. Proc Natl Acad Sci U S A, 2005.102(12): p.
4536-41.
Amadesi, S., et al., Protease-activated receptor 2 sensitizes the capsaicin receptor
transient receptor potential vanilloid receptor 1 to induce hyperalgesia. J
Neurosci, 2004.24(18): p. 4300- 12.
Dai, Y., et al., Proteinase-activated receptor 2-mediatedpotentiation of transient
receptor potential vanilloid subfamily 1 activity reveals a mechanismfor
proteinme-induced inflammatorypain. J Neurosci, 2004.24(18): p. 4293-9.
Zhuang, Z.Y., et al., Phosphatidylinositol3-kinaseactivates ERK in primary
sensory neurons and mediates inJammatory heat hyperalgesia through TRPVl
sensitization. J Neurosci, 2004.24(38): p. 8300-9.
Julius, D. and A.I. Basbaum, Molecular mechanisms of nociception. Nature, 2001.
413(6852): p. 203-10.
Thayer, S.A., T.M. Pemey, and R.J. Miller, Regulation of calcium homeostasis in
sensory neurons by bradyknin. J Neurosci, 1988.8(11): p. 4089-97.
Puntambekar, P., et al., Direct interaction of adenosine with the TRPVl channel
protein. J Neurosci, 2004.24(14): p. 3663-71.
Cantley, L.C., The phosphoinositide 3-kinase pathway. Science, 2002.296(5573):
p. 1655-7.
Van Buren, J.J., et al., Sensitization and translocation of TRPVl by insulin and
IGF-I. Mol Pain, 2005. l(1): p. 17.
Zhang, X., J. Huang, and P.A. McNaughton, NGF rapidly increases membrane
expression of TRPVl heat-gated ion channels. Embo J, 2005.24(24): p. 42 1 1 -23.
Bonnington, J.K. and P.A. McNaughton, SignaNingpathways involved in the
sensitisation of mouse nociceptive neurones by nerve growth factor. J Physiol,
2003.551(Pt 2): p. 433-46.
Tang, H.B., et al., Sensitization of vanilloid receptor 1 induced by bradykinin via
the activation of second messenger signaling cascades in rat primary afferent
neurons. Eur J Pharmacol, 2004.498(1-3): p. 37-43.
Lopshire, J.C. and G.D. Nicol, The CAMPtransduction cascade mediates the
prostaglandin E2 enhancement of the capsaicin-elicited current in rat sensory
neurons: whole-cell and single-channel studies. J Neurosci, 1998.18(16):p.
608 1-92.
Bhave, G., et al., CAMP-dependentprotein kinase regulates desensitization of the
capsaicin receptor (VRl) by direct phosphorylation. Neuron, 2002.35(4): p. 72 131.
Cesare, P., et al., Specifc involvement of PKC-epsilon in sensitization of the
neuronal response to painful heat. Neuron, 1999.23(3):p. 6 1 7-24.
Vellani, V., et al., Protein kinase C activationpotentiates gating of the vanilloid
receptor VRl by capsaicin, protons, heat and anandamide. J Physiol, 2001.
534(Pt 3): p. 813-25.
Numazaki, M., et al., Direct phosphorylation of capsaicin receptor VRl by
protein kinase Cepsilon and identifcation of two target serine residues. J Biol
Chem, 2002.277(16): p. 13375-8.
Premkumar, L.S. and G.P. Ahem, Induction of vanilloid receptor channel activity
by protein kinase C. Nature, 2000.408(6815):p. 985-90.
Lee, S.Y., et al., Sensitization of vanilloid receptor involves an increase in the
phosphorylated form of the channel. Arch Pharm Res, 2005.28(4): p. 405-12.
Jung, J., et al., Phosphorylation of vanilloid receptor I by Ca2+/calmodulindependent kinase 11regulates its vanilloid binding. J Biol Chem, 2004.279(8): p.
7048-54.
Price, T.J., et al., Pharmacological interactions between calciudcalmodulindependent kinase 11alpha and TRPVI receptors in rat trigeminal sensory
neurons. Neurosci Lett, 2005.389(2): p. 94-8.
Jin, X., et al., Modulation of TRPVI by nonreceptor tyrosine kinase, c-Src kinase.
Am J Physiol Cell Physiol, 2004.287(2): p. C558-63.
Morenilla-Palao, C., et al., Regulated exocytosis contributes to protein kinase C
potentiation ofvanilloid receptor activity. J Biol Chem, 2004.279(24): p. 2566572.
Docherty, R.J., et al., Inhibition of calcineurin inhibits the desensitization of
capsaicin-evoked currents in cultured dorsal root ganglion neuronesfrom adult
rats. Pflugers Arch, 1996.431(6): p. 828-37.
Koplas, P.A., R.L. Rosenberg, and G.S. Oxford, m e role of calcium in the
desensitization of capsaicin responses in rat dorsal root ganglion neurons. J
Neurosci, 1997.17(10):p. 3525-37.
Rosenbaum, T., et al., Ca2+/calmodulin modulates TRPVI activation by
capsaicin. J Gen Physiol, 2004.123(1):p. 53-62.
Numazaki, M., et al., Structural determinant of TRPVI desensitization interacts
with calmodulin. Proc Natl Acad Sci U S A, 2003. lOO(13):p. 8002-6.
Mohapatra, D .P. and C. Nau, Regulation of Ca2+-dependent desensitization in
the vanilloid receptor TRPVI by calcineurin and CAMP-dependentprotein kinase.
J Biol Chem, 2005.280(14):p. 13424-32.
Mohapatra, D.P. and C. N a yDesensitization of capsaicin-activated currents in
the vanilloid receptor TRPVI is decreased by the cyclic AMP-dependent protein
kinase pathway. J Biol Chem, 2003.278(50):p. 50080-90.
Mandadi, S., et al., Increased sensitivity of desensitized TRPVI by PU4 occurs
through PKCepsilon-mediatedphosphorylationat S800. Pain, 2006.
Mandadi, S., et al., Activation ofprotein kinase C reverses capsaicin-induced
calcium-dependent desensitization of TRPVI ion channels. Cell Calcium, 2004.
35(5):p. 47 1-8.
Liu, B., C. Zhang, and F. Qin, Functional recoveryfrom desensitization of
vanilloid receptor TRPVI requires resynthesis of phosphatidylinositol4,5bisphosphate. J Neurosci, 2005.25(19): p. 4835-43.
Ji, R.R., et al.,p38 M P K activation by NGF in primary sensory neurons afrer
inflammation increases TRPV. levels and maintains heat hyperalgesia. Neuron,
2002.36(1): p. 57-68.
Amaya, F., et al., NGF and GDNF d$ierentially regulate TRP VI expression that
contributes to development of inflammatory thermal hyperalgesia. Eur J Neurosci,
2004.20(9): p. 2303-10.
Price, T.J., et al., Treatment of trigeminal ganglion neurons in vitro with NGF,
GDNF or BDNF: efects on neuronal survival, neurochemicalproperties and
TRPVI-mediated neuropeptide secretion. BMC Neurosci, 2005.6(1): p. 4.
Matthews, P.J., et al., Increased capsaicin receptor TRPVl nerve fibres in the
infamed human oesophagus. Eur J Gastroenterol Hepatol, 2004.16(9): p. 897902.
Biggs, J.E., et al., Changes in vanilloid receptor 1 (TRPVl) expressionfollowing
lingual nerve injury. Eur J Pain, 2006.
Shimosato, G., et al., Peripheral inflammation induces up-regulation of TRPV2
expression in rat DRG. Pain, 2005.119(1-3):p. 225-32.
Kim, S., et al., TRPVl recapitulates native capsaicin receptor in sensory neurons
in association with Fas-associatedfactor I. J Neurosci, 2006.26(9): p. 2403- 12.
Lee, S.Y., Identification of a protein that interacts with the vanilloid receptor.
Biochem Biophys Res Commun, 2005.331(4): p. 1445-51.
Goswami, C., et al., IdentiJication and characterization of a Ca2+ -sensitive
interaction of the vanilloid receptor TRPVl with tubulin. J Neurochem, 2004.
91(5):p. 1092-103.
Goswami, C., et al., Rapid disassembly of dynamic microtubules upon activation
of the capsaicin receptor TRPVl. J Neurochem, 2006.96(1): p. 254-66.
Kanzaki, M., et al., Translocation of a calcium-permeable cation channel induced
by insulin-like growth factor-I. Nat Cell Biol, 1999. l(3):p. 165-70.
Boels, K., et al., The neuropeptide head activator induces activation and
translocation of the growth-factor-regulated Ca(2+)-permeable channel GRC. J
Cell Sci, 2001.114(Pt 20):p. 3599-606.
Gaudet, A.D., et al., Regulation of TRPV2 by axotomy in sympathetic, but not
sensory neurons. Brain Res, 2004.1017(1-2): p. 1 55-62.
Stokes, A.J., et al., Formation of a physiological complex between TRPV2 and
RGA protein promotes cell surface expression of TRP V2. J Cell Biochem, 2005.
94(4):p. 669-83.
Stokes, A.J., et al., A TRPV2-PKA signaling modulefor transduction ofphysical
stimuli in mast cells. J Exp Med, 2004.200(2): p. 137-47.
Chung, M.K., A.D. Guler, and M.J. Caterina, Biphasic currents evoked by
chemical or thermal activation of the heat-gated ion channel, TRPV3. J Biol
Chem, 2005.280(16): p. 15928-41.
Hu, H.Z., et al., Potentiation of TRPV3 channelfunction by unsaturatedfatty
acids. J Cell Physiol, 2006.
Watanabe, H., et al., Heat-evoked activation of TRPV4 channels in a HEK293 cell
expression system and in native mouse aorta endothelial cells. J Biol Chem, 2002.
277(49):p. 47044-5 1.
Chung, M.K., H. Lee, and M.J. Caterina, Warm temperatures activate TRPV4 in
mouse 308 keratinocytes. J Biol Chem, 2003.278(34):p. 32037-46.
Watanabe, H., et al., Anandamide and arachidonic acid use epoxyeicosatrienoic
acids to activate TRPV4 channels. Nature, 2003.424(6947): p. 434-8.
Vriens, J., et al., Modulation of the Ca2permeable cation channel TRPV4 by
cytochrome P450 epoxygenases in vascular endothelium. Circ Res, 2005.97(9):
p. 908-15.
Watanabe, H., et al., Activation of TRPV4 channels FVRL-2/mTRP12) byphorbol
derivatives. J Biol Chem, 2002.277(16): p. 13569-77.
Xu, F., E. Satoh, and T. Iijima, Protein kinase C-mediated Ca2+ entry in HEK
293 cells transiently expressing human TRPV4. Br J Pharmacol, 2003. 140(2):p.
413-21.
Gao, X., L. Wu, and R.G. O'Neil, Temperature-modulated diversity of TRPV4
channel gating: activation by physical stresses and phorbol ester derivatives
throughprotein kinase C-dependent and -independent pathways. J Biol Chem,
2003.278(29): p. 27 129-37.
Watanabe, H., et al., Modulation of TRPV4 gating by intra- and extracellular
Ca2+. Cell Calcium, 2003.33(5-6): p. 489-95.
Liedtke, W., et al., Vanilloid receptor-related osmotically activated channel (VROAC), a candidate vertebrate osmoreceptor. Cell, 2000.103(3): p. 525-35.
Strotmann, R., et al., OTRPC4, a nonselective cation channel that confers
sensitivity to extracellular osmolarity. Nat Cell Biol, 2000.2(10): p. 695-702.
Wissenbach, U., et al., Trp12, a novel Trp relatedprotein fLom kidney. FEBS
Lett, 2000.485(2-3): p. 127-34.
Delany, N.S., et al., Identijication and characterization of a novel human
vanilloid recepror-likeprotein, VRL-2. Physiol Genomics, 200 1.4(3): p. 165-74.
Todaka, H., et al., Warm temperature-sensitive transient receptor potential
vanilloid 4 (TRPV4)plays an essential role in thermal hyperalgesia. J Biol Chem,
2004.279(34): p. 35133-8.
Suzuki, M., et al., Impairedpressure sensation in mice lacking TRPV4. J Biol
Chem, 2003.278(25): p. 22664-8.
Liedtke, W. and J.M. Friedman, Abnormal osmotic regulation in trpv4-/- mice.
Proc Natl Acad Sci U S A, 2003. lOO(23): p. 13698-703.
Alessandri-Haber, N., et al., A transient receptor potential vanifloid 4-dependent
mechanism of hyperalgesia is engaged by concerted action of inflammatory
mediators. J Neurosci, 2006.26(14): p. 3864-74.
Alessandri-Haber, N., et al., Hypotonicity induces TRPV4-mediated nociception
in rat. Neuron, 2003.39(3): p. 497-5 11.
Xu, H., et al., Regulation of a transient receptor potential (TRP) channel by
tyrosinephosphorylation. SRC family kinase-dependent tyrosine phosphorylation
of TRPV4 on TYR-253 mediates its response to hypotonic stress. J Biol Chem,
2003.278(13): p. 11520-7.
Alessandri-Haber, N., et al., Transient receptor potential vanilloid 4 is essential in
chemotherapy-induced neuropathic pain in the rat. J Neurosci, 2004.24(18): p.
4444-52.
Strotmann, ReyG. Schultz, and T.D. Plant, Ca2+-dependentpotentiationof the
nonselective cation channel TRPV4 is mediated by a C-terminal calmodulin
binding site. J Biol Chem, 2003.278(29): p. 2654 1-9.
Suzuki, M., A. Hirao, and A. Mizuno, Microtubule-associated [correctedlprotein
7 increases the membrane expression of transient receptor potential vanilloid 4
(TRPV4). J Biol Chem, 2003.278(5 1): p. 5 1448-53.
Fu, Y., et al., WNK kinases influence TRPV4 channeljiknction and localization.
Am J Physiol Renal Physiol, 2006.
Rohacs, T., et al., PI(4,5)P2 regulates the activation and desensitization of
TRPM8 channels through the TRP domain. Nat Neurosci, 2005. 8(5): p. 626-34.
Liu, B. and F. Qin, Functional control of cold- and menthol-sensitive TRPM8 ion
channels by phosphatidylinositol 4,5-bisphosphate. J Neurosci, 2005.25(7) :p.
1674-81.
Narner, B., et al., TRPAl and TRPM8 activation in humans: effects of
cinnamaldehyde and menthol. Neuroreport, 2005.16(9): p. 955-9.
Premkumar, L. S., et al., Downregulation of transient receptor potential
melastatin 8 by protein Rinase C-mediated dephosphorylation. J Neurosci, 2005.
25(49): p. 1 1322-9.
Abe, J., et al., Ca2+-dependent PKC activation mediates menthol-induced
desensitization of transient receptor potential M8. Neurosci Lett, 2006.397(1-2):
p. 140-4.
Zhang, L. and G.J. Barritt, Evidence that TRPM8 is an androgen-dependent Ca2+
channel requiredfor the survival ofprostate cancer cells. Cancer Res, 2004.
64(22): p. 8365-73.
Nilius, B., et al., Gating of TRP channels: a voltage connection? J Physiol, 2005.
567(Pt 1): p. 35-44.
Nilius, B., et al., The Ca2+-activated cation channel TRPM4 is regulated by
phosphatidylinositol4,5-biphosphate.Embo J, 2006.25(3): p. 467-78.
Launay, P., et al., TRPM4 is a Ca2+-activated nonselective cation channel
mediating cell membrane depolarization. Cell, 2002.109(3): p. 397-407.
Xu, X.Z ., et at., Regulation of melastatin, a TRP-relatedprotein, through
interaction with a cytopZasmic isoform. Proc Natl Acad Sci U S A, 200 1.98(19):
p. 10692-7.
Nilius, B., et al., The selectivityfiller of the cation channel TRPM4. J Biol Chem,
2005.280(24): p. 22899-906.
Nilius, B., et al., Regulation of the Ca2+ sensitivity of the nonselective cation
channel TWM4. J Biol Chem, 2005.280(8): p. 6423-33.
Nilius, B., et al., Decavanadate modulates gating of TRPM4 cation channels. J
Physiol, 2004.560(Pt 3): p. 753-65.
Zhang, Z., et al., Phosphatidylinositol4,5-bisphosphaterescues TRPM4 channels
from desensitization. J Biol Chem, 2005.280(47): p. 391 85-92.
Nilius, B., et al., Voltage dependence of the Ca2+-activated cation channel
TRPM4. J Biol Chem, 2003.278(33): p. 308 13-20.
Hofinann, T., et al., TRPM5 is a voltage-modulated and Ca(2+)-activated
monovalent selective cation channel. Curr Biol, 2003.13(13): p. 1 153-8.
Nilius, B., et al., Intracellular nucleotides andpolyamines inhibit the Ca2+activated cation channel TRPM4b. Pflugers Arch, 2004.448(1): p. 70-5.
Ullrich, N.D., et al., Comparison offinctional properties of the Ca2+-activated
cation channels TWM4 and TRPMSfrom mice. Cell Calcium, 2005.37(3): p.
267-78.
Liu, D. and E.R. Liman, Intracellular Ca2+ and the phospholipid PIP2 regulate
the taste transduction ion channel TRPM5. Proc Natl Acad Sci U S A, 2003.
lOO(25): p. 15 160-5.
Prawitt, D., et al., TRPM5 is a transient Ca2+-activated cation channel
responding to rapid changes in [Ca2+]i. Proc Natl Acad Sci U S A, 2003.
lOO(25): p. 15 166-71.
Perez, C.A., et al., A transient receptor potential channel expressed in taste
receptor cells. Nat Neurosci, 2002.5(11): p. 1 169-76.
Zhang, Y., et al., Coding of sweet, bitter, and umami tastes: dgerent receptor
cells sharing similar signalingpathways. Cell, 2003. 112(3): p. 293-301.
Damak, S., et al., Trpm5 null mice respond to bitter, sweet, and umami
compounds. Chem Senses, 2006.31(3): p. 253-64.
Perez, C.A., et al., Making sense with TRP channels: store-operated calcium
entry and the ion channel Trpm5 in taste receptor cells. Cell Calcium, 2003.33(56): p. 541-9.
Liu, D., Z. Zhang, and E.R. Liman, Extracellular acid block and acid-enhanced
inactivation of the Ca2+-activated cation channel TRPMS involve residues in the
S3-S4 and SJ-St5 extracellular domains. J Biol Chem, 2005.280(21): p. 20691 -9.
Jaquemar, D., T. Schenker, and B. Trueb, An ankyrin-like protein with
transmembrane domains is specifcally lost afer oncogenic transformation of
humanfibroblasts. J Biol Chem, 1999.274(11):p. 7325-33.
Stokes, A., et al., TRPAl is a substrate for de-ubiquitination by the tumor
suppressor CYLD. Cell Signal, 2006.
Schenker, T. and B. Trueb, Down-regulated proteins of mesenchymal tumor cells.
Exp Cell Res, 1998.239(1):p. 161-8.
Voets, T., et al., The principle of temperature-dependentgating in cold- and heatsensitive TRP channels. Nature, 2004.430(7001):p. 748-54.
Liman, E.R., Thermal gating of TRP ion channels: food for thought? Sci STKEY
2006.2006(326):p. pe12.
Brauchi, S., P. Orio, and R. Latorre, Clues to understanding cold sensation:
thermodynamics and electrophysiologicalanalysis of the cold receptor TRPM8.
Proc Natl Acad Sci U S A, 2004. lOl(43): p. 15494-9.
Liapi, A. and J.N. Wood, Extensive co-localization and heteromultimer formation
of the vanilloid receptor-like protein TRPV2 and the capsaicin receptor TRPVl in
the adult rat cerebral cortex. Eur J Neurosci, 2005.22(4): p. 825-34.
Hellwig, N., et al., Homo- and heteromeric assembly of TRPV channel subunits. J
Cell Sci, 2005.118(Pt 5): p. 9 17-28.
Rutter, A.R., et al., Heteromerization and colocalization of TrpVl and TrpV2 in
mammalian cell lines and rat dorsal root ganglia. Neuroreport, 2005.16(16): p.
1735-9.
Wang, C., et al., An alternative splicingproduct of the murine trpvl gene
dominant negatively modulates the activity of TRPVl channels. J Biol Chem,
2004.279(36): p. 37423-30.
Lu, G., et al., TRPVlb, a@nctional human vanilloid receptor splice variant. Mol
Pharmacol, 2005.67(4): p. 1 1 19-27.
Tian, W., et al., Regulation of TRPVl by a novel renal& expressed rat TRPVl
splice variant. Am J Physiol Renal Physiol, 2006.290(1): p. F117-26.
Schumacher, M.A., et al., Molecular cloning of an N-terminal splice variant of
the capsaicin receptor. Loss of N-terminal domain suggestsfunctional divergence
among capsaicin receptor subtypes. J Biol Chem, 2000.275(4): p. 2756-62.
Amiges, Meyet al., Human TRPV4 channel splice variants revealed a key role of
ankyrin domains in multimerization and traflcking. J Biol Chem, 2006.281(3): p.
1 580-6.
Chapter 2.
The Drosophila ortholog of vertebrate TRPAl regulates thermotaxis.
Rosenzweig, M., Brennan, K.M., Tayler, T.D., Phelps, P.O., Patapoutian, A., and P.A.
Garrity.
As published in Genes & Development (2005) Feb 15; 19(4):419-24. Epub 2005 Jan 28.
Karen Breman generated the dTRPAl antibody, optimized the dTRPA 1 antibody
conditions and provided technical assistance with the dsRNA injections. Tim Tayler
helped to optimize the dTRPAl antibody conditions, acquired the images in Figure 4, AF, and provided assistance with the dsRNA injections during the early phases of the
project. Paul Phelps provided technical assistance with the dsRNA injections and
generated the antibody stainings and the Western blot for the Supplementary Figure 1.
Paul Garrity performed the high-temperature nociception experiments in Figure 3B and C
and Figure 4H and directed the Supplementary movies.
ABSTRACT.
Thennotaxis is important for animal survival, but the molecular identities of temperature
sensors controlling this behavior have not been determined. We demonstrate dTRPA1, a
heat-activated Transient Receptor Potential (TRP) family ion channel, is essential for
thermotaxis in Drosophila. dTrpAI knockdown eliminates avoidance of elevated
temperatures along a thermal gradient. We observe dTRPAl expression in cells without
previously ascribed roles in thermosensation and implicate dTRPAl -expressing neurons
in mediating thermotaxis. Our data suggest that thennotaxis relies upon neurons and
molecules distinct from those required for high-temperature nociception. We propose
dTRPAl may control thermotaxis by sensing environmental temperature.
INTRODUCTION
Animals exhibit strong behavioral responses to temperature, and many are able to
thermotax, undergoing directed migration guided by differences in temperature. Central
to thennotaxis are the abilities to sense environmental temperature and to execute the
appropriate behavioral response. Animal thennotaxis has been studied most extensively
in the nematode Caenorhabditis elegans, where ablation studies have defined the
neuronal circuitry involved in thermotactic behavior and molecular genetic studies have
identified several molecules required for the development and function of the
thermosensory system [I]. However, the molecular identity of the thermal sensors
themselves has remained unknown. Larvae and adults of the f f i t fly Drosophila
melanogaster also exhibit strong thermotactic behaviors ([2-41). No regulators of
Drosophila thennotaxis have been identified at the molecular level, and little is known of
the neural circuitry that controls thermotaxis, aside fiom a small group of terminal organ
neurons involved in larval cold avoidance [4].
Several classes of molecules have been implicated in potentially mediating
temperature sensation and could be involved in thermotaxis. The two-pore-domain K+channel TREK-1 [5] and members of the DEGIEnaC-family of Na+ channels [6] are
regulated by temperature in cultured cells, while mice lacking the ATP-gated cation
channel P2X3 are defective for electrophysiological responses to moderate warmth
(32OC-45"C) [7]. In addition, several members of the Transient Receptor Potential (TRP)
family of ion channels have been shown to act as temperature-responsiveion channels in
heterologous cells [8,9], and mice lacking one of these proteins, the heat-activated
TRPV I, have been shown to be defective in a withdrawal response to noxious high
temperature as well as thermal hyperalgesia upon inflammation [lo, 111. While the
mouse, C. elegans, and Drosophila melanogaster genomes all encode two-pore-domain
K+ channels, DEGlEnaC proteins, and TRP proteins, it has not been established whether
any of these molecules play important roles in thermotaxis.
The temperature-responsiveTRPs (TRPV1-V4, TRPM8, and TRPA1) have been
dubbed thermoTRPs and include members of three distinct families of TRP channels:
TRPV, TRPM, and TRPA [8,9]. The Drosophila genome encodes two TRPV family
members, one TRPM, and four TRPAs. Of these proteins, f'unctions have been described
for the TRPVs Inactive and Nanchung, which act together in hearing [12,13], and the
TRPA Painless, which mediates larval nociceptive responses to high-temperature
mechanical stimulation [14]. One Drosophila TRP protein has been shown to function as
a temperature-responsiveion channel in heterologous cells (i.e., is a thermoTRP),
dTRPA 1 (formerly dANKTM1) [I 51. dTRPA1 is the Drosophila ortholog of the single
mammalian TRPA protein TRPA 1, and dTRPA1 opens in response to warming [151.
However, the in vivo function of dTRPAl (and of its mammalian ortholog) in
thermosensory behavior has not been explored. Here we develop a novel RNAi-based
strategy for studying thermotactic behavior and use this approach to demonstrate that the
warmth-activated ion channel dTRPAl is essential for thermotaxis. We proceed to
identify a novel group of dTRPAl-expressing neurons in the CNS that appear important
for thermotactic behavior, and find that the proteins and neurons essential for thermotaxis
differ from those previously implicated in high-temperature nociceptive behavior. This
work identifies a candidate environmental temperature sensor for themotaxis and
provides a cellular and molecular starting point for the dissection of thermoTRP signaling
and thermotaxis in Drosophila. In addition, the RNAi-based strategy described here
should be applicable to the study of other behaviors in Drosophila.
RESULTS AND DISCUSSION
Drosophila larvae exhibit robust thermotactic behavior
We examined Drosophila thermotactic behavior by using a thermal preference
assay, placing larvae on a gradient of temperatures warmer than their optimal growth
temperature (24OC) [16] and allowing the larvae to migrate from the release zone of
3 1OC-35OC into a region of even higher temperature or a region of lower temperature
(Fig. 1A). Wild-type late-first/early-second instar larvae rapidly migrated down the
thermal gradient into the cooler zone (Fig. 1C; Supplementary Movie S1). Some larvae
explored the warmer zone but rapidly reoriented and headed down the gradient. Larval
thermotactic behavior in this thermal preference assay was quantified with an avoidance
index (AI) (Fig. 1B; [4]). Wild-type larvae achieved A1 scores >0.9 within 2 min (Fig.
1B), demonstrating strong heat avoidance.
dTrpA1 is requiredfor thermotaxis
We devised a simple RNA interference (RNAi) strategy to survey whether any
Drosophila TRPA, TRPV, or TRPM family members might contribute to larval
thermotactic behavior. In this approach, embryos were injected with double-stranded
RNAs (dsRNAs) corresponding to the genes of interest, and the resulting larvae were
analyzed for their ability to thermotax. The injected animals contained a neuronally
expressed green fluorescent protein (GFP) transgene, and dsRNA targeting GFP
expression was included in all injections, serving as an internal control for a successful
injection (Fig. 2A). Injection of a mixture of dsRNAs corresponding to the four TRPA
family members strongly altered thermotaxis (A1 scores of c0.3) (Fig. 2B). In contrast,
injection of dsRNAs corresponding to the TRPVs Inactive and Nanchung or the TRPM
CG30078 had no detectable effect on thermotaxis (Fig. 2B). These latter experiments
served as controls demonstrating that the dsRNA injection procedure itself did not affect
thermotaxis. Taken together, our data suggest that one or more Drosophila TRPA family
members is required for thermotaxis.
Strikingly, RNAi of dTrpAl alone strongly disrupted avoidance of elevated
temperature. Unlike wild-type larvae, similar numbers of dTrpA1(RNAi) larvae migrated
into both warmer and cooler zones, yielding A1 scores near zero (Fig. 2D), and many
dTrpA1(RNAi) larvae traveled deep into the warmer area (Fig. 2C; Supplementary Movie
Figure 1. Thermal preference assay. (A) Larvae are placed in the middle of the therrnal
gradient on an agarose-covered plate, within the release zone. Agar surface temperatures
are as indicated. (B) Larval behavior on gradient quantified by an avoidance index (AI)
[4] as indicated. Graph depicts behavior of uninjected wild-type (elav-Gal4; UAS-
mCD8:GFP) late-first instarlearly-second instar larvae (n = 9 assays). (C) Still images
from thermal preference assay of uninjected wild-type larvae. Red dotted lines demarcate
the release zone, with heated zone at lefr and unheated zone at right. In all figures, data
are mean k SEM. More than 39 larvaelassay.
FIGURE 1:
A
=2 mln
S2). Injection of dsRNA against a second, nonoverlapping region of dTrpAl also
generated A1 scores near zero (Fig. 2D). dTrpA1 knockdown disrupted thennotactic
behavior throughout larval life, as third instar dTrpA1(RNAi) larvae also exhibited
thermotaxis defects (Fig. 2E). Injection of dsRNAs against the three other TrpAs had no
effect on thermotaxis (Fig. 2D). We further examined the TRPA Painless, which
mediates responses to high-temperature mechanical stimulation [14], a thermosensory
behavior potentially distinct from thermotaxis. Neither late-first instarlearly-second instar
nor third instar painless mutant larvae (pain' andpain3) were defective for thennotaxis in
our assay (Fig. 2D,E). Our data demonstrate that dTrpAl is absolutely required for proper
behavior in the thermal preference assay, providing strong genetic evidence for dTrpA1
involvement in thermotaxis. Furthermore, these data also suggest that the TRPA proteins
Painless and dTRPAl have distinct roles in temperature-regulated behavior.
dTrpA1(RNA i) larvae are selectively defective for thermotactic behavior
We next tested how specific the behavioral defect of dTrpA1(RNAi) animals was
for thennotaxis. First, we determined that the motility indices (MIS) of wild-type and
dTrpA1(RNAi) larvae in the thermal gradient were indistinguishable. (The MI represents
the fraction of larvae no longer in the release zone at a given time point [see Materials
and Methods].) Late-first instarlearly-second instar wild-type larvae had MIS of 0.56
*
0.08 and 0.64 0.08 at 2 and 5 min after release (n = 9 assays, GEM), while
*
dTrpAI(RNAi) larvae had MIS of 0.60 0.06 and 0.69 0.04 at these time points (n = 11
s
(RNAi) animals were specifically defective in thermotaxis rather
assays). ~ h u dTrpA1
than in their ability to migrate at elevated temperature. Second, we examined lanal
Figure 2. dTrpA1 is required for therrnosensory behavior. (A) RNAi strategy (methods).
GFP-negative (asterisk), but not GFP-positive (circles), RNAi animals were retained for
analysis. (B) Late-first/early-second instar behavior. Uninjected (n = 9 assays);
TrpVs:dsRNA, injected with Gal4, Inactive, and Nanchung dsRNAs (Gal4 + Inactive +
Nanchung) (n = 4); TrpM:dsRNA:Gal4 + CG30078 (n = 4); TrpAs:dsRNA:Gal4 +
dTrpAl + Painless + CG17142 + CG3 1284 (n = 6). (C) Preference assay (orientation as
in Fig. 1C). (D) As in B except dTrpA1(RNAOregion I : Gal4 + dTrpAl (region 1) (n = 7).
dTrpA1(RNAOregion 2:Gal4 + dTrpAl(region 2) (n = 4); TrpAs-dTrpAl :dsRNA:Gal4 +
Painless + CG 17142 + CG3 1284 (n = 4); painless1 (n = 5); painless3 (n = 4);
atonal(RNAO (n = 4). (I?) Third instar behavior. Uninjected (n = 9); dTrpA1(RNAi)region
1 (n = 13);painless1 (n = 7); painles? (n = 4); md-Gal4: UAS-TeTxLC (n = 12). (**) p <
0.000 1 (versus uninjected). Slight md-Gal4: UAS-TeTxLC effect was not statistically
significant ( p = 0.09,2 min; p = 0.27,5 min) and may reflect their noted uncoordination
[14]. Nineteen to 75 larvaelassay.
M min
-0s
A
2nrln
a min
chemotaxis in response to an olfactory repellent (n-octyl acetate) [17], and found
dTrpA1(RNAi) larvae responded similarly to wild type (Fig. 3A), indicating that
dTrpAI(RNAi) larvae were not defective for all avoidance behavior. Finally, we
examined responsiveness of dTrpA1(RNAi)larvae to higher temperatures (55°C).
Because larvae rapidly died when exposed to gradients of higher temperature (data not
shown), larvae were tested by using a previously described temperature-dependent
nociceptive assay [14]. Crawling third instar larvae rapidly and dramatically curl when
touched with a hot (55OC) probe (Fig. 3B) but not when touched with a 25OC or 36OC
probe. dTrpA1 (RNAi) larvae responded indistinguishably from wild-type larvae in this
assay (Fig. 3B,C). As a negative control for the assay, we examined larvae expressing
tetanus toxin light chain (TeTxLC), an inhibitor of synaptic vesicle release [18], under
md-Gal4 [19] control (md-Gal4 is expressed in multiple-dendritic neurons and 100 CNS
neurons) [14]. As previously reported [14], md-Gal4:UAS-TeTxLC larvae were defective
in response to contact with the hot probe (Fig. 3C). The ability of dTrpAI(RNAi)larvae to
chemotax and respond to other thermal stimuli suggests a specific requirement for
dTrpA1 in therrnotaxis.
dTRPAl expression and the role of dTrpA1-Gal4-expressing cells in thermosensation
Antisera raised against dTRPAl detected strong dTRPAl protein expression in a
small number of central brain neurons (Fig. 4A,B) and in neuroendocrine cells of the
corpus cardiacum (Fig. 4A). dTrpA1(RNAi) larvae had no detectable dTRPAl expression
in these regions, demonstrating that our antisera was specific for dTRPAl and that the
dTrpA1 dsRNA effectively reduced dTRPAl protein expression (Fig. 4C). Specific
Figure 3. dTrpA1(RNAi) animals respond to other stimuli. (A) n-Octyl acetate avoidance
of late-first/early-second instar elm-Gal#; UAS-mCD8:GFPlarvae, uninjected, or
dTrpA1 (RNAi) (region 1 ) (n = 6 assays for each). Odor avoidance = [(number of larvae in
no odorant zone) - (number of larvae in odorant zone)]l[(number of larvae in no odorant
zone) + (number of larvae in odorant zone)]. (B) Response to contact with 55OC probe of
third instar uninjected and dTrpA1(RNAi) larvae. (C) Time between probe contact and
initiation of curling. Uninjected (n = 4 1 larvae); dTrpAI(RNAi)region 1 (n = 24); md-
Gal4 (n = 23); UAS-TeTxLC (n = 30); md-Gal#: UAS-TeTxLC (n = 23). Most larvae not
responding within 3 sec never exhibited detectable curling.
FIGURE 3:
N-octyl acetate avoidance
55'C probe
uninjected
dTrpAf(RNA
uninjected
dTpA f(RNAi)
t=O sec
c
t=0.4 sec
Response to contact with 55'C probe
<I sec
u
1- 2 sec
2-3sec
~ s e c
dTRPAl expression was also detected in two pairs of cells adjacent to the
mouthhooks and in the developing gut (data not shown). Interestingly, we did not detect
dTRPAl expression in either multiple-dendritic neurons (implicated in temperaturedependent nociceptive responses) [14] or chordotonal neurons, both of which show
temperature-dependent calcium changes [4]. We explored the role of multiple-dendritic
neurons using md-Gal4: UAS-TeTxLC larvae. Consistent with no significant role of
multiple-dendritic neurons in our thermotaxis assay, significant thermotaxis defects were
not detected in md-Gal4: UAS-TeTxLC larvae (Fig. 2E). In addition, significant
thermotaxis defects were not detected in atonal(RNAi) larvae, which lack chordotonal
neurons (Fig. 2D; [20]; see Materials and Methods). These data suggest that there may be
differences in the neuronal circuitry required for thermotaxis in response to elevated
temperature and withdrawal fiom a high-temperature nociceptive stimulus.
The role of dTRPAl -expressing cells in thermotaxis was further examined by
expressing TeTxLC or the cell death-promoting gene Hid under control of putative
dTrpA I promoter sequences. dTrpA I -Gal4 drove GFP expression in most dTRPA 1expressing central brain neurons (Fig. 4D-F), but not in the other dTRPAl-expressing
cell populations (data not shown). dTrpA1-Gal4: UAS-Hid animals had reduced numbers
of dTRPAl -expressing brain neurons (e.g., only one of the three dTPRAl -expressing
cells in Fig. 4D-F was present), while the corpus caridiaca appeared unaffected (see
Materials and Methods). Consistent with the participation of dTrpAI-Gal4-expressing
cells in thermosensory behavior, dTrpA1-Gal4: UAS-Hid as well as dTrpAI-Gal4: UASTeTxLC third instar larvae were partially, but significantly (p < 0.005), compromised in
thermotactic behavior (Fig. 4G).
Figure 4. dTRPAl expression. (A) dTRPAl expression in anterior (arrowhead) and
posterior (bracket) groups of neurons within the brain and in neuroendocrine cells of
corpus cardiacum (asterisk). (B) Posterior group of dTRPAl-expressing neurons. (C)
dTrpA1(RNAi) animals lack dTRPA1 staining. Asterisk denotes corpus cardiacum. (D-F)
dTrpA-Gal4: UAS-mCD8:GFP (green) expression. dTrpA1-Gal4 drives GFP expression
in dTRPA1-expressing (purple) neurons and 100-1 50 additional cells within the brain.
(IT)GFP. (0Anti-dTRPAl. (G) Thermal preference behavior. Wild type (n = 9 assays);
UAS-TeTxLC (n = 8); dTrpAl-Gal4(n = 9); dTrpAl-Gal4: UAS-InactiveTeTxLC (n = 6);
UAS-Hid (n = 6); dTrpA1-Gal4: UAS-TeTxLC (n = 10); dTrpA1-Gal4: UAS-Hid (n = 10).
(*)p < 0.005. (H) Response to 55OC probe contact. dTrpA1-Gal4: UAS-TeTxLC (n = 19);
dTrpA1-Gal4: UAS-Hid (n = 20).
"
Thermal Prhrence Behavior (third instar)
1
I.
~ V.
P .
c
d l l-GaW:
UA n~ctiveTeTxLC
UT?
8 0.4
T<
= 'r
UASJIM
1-08M:
UA TeTxlC
dr 14M:
UAGid
0.2
0
Time (min)
Response to W'C probe
Interestingly, both dTrpA1-Gal4: UAS-Te TxLC and dTrpA1-Gal4: UAS-Hid larvae
exhibited normal withdrawal from a high-temperature nociceptive stimulus (Fig. 4H),
indicating that these animals were not defective for all thermosensory responses. Similar
effects were also obtained using a second, independent dTrpAl -Gal4 insertion (data not
shown). These data further support the notion that there may be differences in the
neuronal circuitry required for thermotaxis and high-temperature nociception.
dTRPA1 is an essential regulator of thermotaxis
The ability to move toward favorable environmental temperatures and away from
unfavorable environmental temperatures is critical for animal survival. While
thermotactic behavior has been observed in many animals, the underlying thermal sensors
have not been identified. Here we have used the heat-avoidance response of Drosophila
larvae to identify dTrpA1 as a key mediator of thermotaxis. The failure of animals
lacking dTRPAl expression to avoid elevated temperatures mirrors the ability of
dTRPAl to function as a heat-activated ion channel in vitro. Taken together, these data
make dTRPAl an attractive candidate for an environmental temperature sensor
controlling thermotaxis. It will be of interest to explore how the temperature-sensing
properties of dTRPAl observed in cultured cells relate to the physiological and
behavioral responses of the intact animal. As closely related dTRPAl orthologs are
present in the Drosophila pseudoobscura, Bombyx morii, and Anopheles gambiae
genomes, as well as the C. elegans genome, TRPAl s could regulate thermotaxis in other
insects as well as in C. elegans.
Thermotaxis and high-temperature nociception involve distinct mechanisms
Another Drosophila TRPA protein, Painless, also modulates thermosensory
behavior [14]. However, dTRPAl and Painless appear to have distinct thermosensory
hctions. While painless mutant larvae are strongly defective in responding to noxious
high-temperature mechanical stimulation [14], painless mutants are normal in our
thermotaxis assays. Further emphasizing the apparent differences between these different
thermosensory behaviors, inhibition of the md-Gal4-expressing neurons disrupts
responses to noxious high-temperature mechanical stimulation but has no significant
effect on thermotaxis, while inhibition of dTrpAl-Gal4 cells has the opposite effect. Thus
the migration of larvae away fkom moderately elevated temperatures (thermotaxis) and
the high-temperature nociceptive response appear to rely upon distinct TRPA-family
members and potentially distinct neural circuits.
Determining the neuronal circuitry required for dTrpAl-dependent thermotaxis is
an important goal for the future. Our dTrpAl-Gal4-mediated inhibition and ablation
studies are consistent with a role for dTRPAl -expressing CNS neurons in dTrpAI dependent thermotaxis. CNS thermal sensors have been proposed within the head and
thoracic ganglia of adult bees and cockroaches [21-231 and are found in the vertebrate
preoptic-anterior hypothalamus [24]. As small insects (Drosophila larvae are <5 mg)
have limited heat capacity [22,25], internal sensors of elevated temperature could be
quite effective. Most importantly, identification of dTRPAl -expressing cells provides an
entry point into defining the neuronal circuitry controlling thermotaxis in flies. It will be
of interest to determine how dTRPAl-expressing cells participate in the sensation of
environmental temperature, either as primary thermosensory cells or as higher-order
neurons involved in processing thermosensory input.
dTRPAl could have functions in addition to therrnotaxis. The strong expression
of dTRPAl in the corpus cardiacum is intriguing as this neuroendocrine gland is involved
in temperature-dependent developmental phenomena in some insects, including seasonal
polyphenism in butterfly wings, where corpus cardiacum ablation prevents establishment
of the summer wing pattern [26]. Furthermore, vertebrate TRPAl has been proposed as a
candidate mechanotransduction channel for hearing [27]. Whether dTRPAl responds to
mechanical stimulation is unknown, but future analysis of dTRPAl function in flies
could potentially yield insights into mechanosensation as well as thermosensation.
MATERIALS AND METHODS
Molecular genetics and RNAi
Fly strains were obtained from Bloomington, except for painless1 and painless3
from the EP collection (Exelixis) [28], md-Gal4 [19] from Y. Jan (University of
California, San Francisco, San Francisco, CA), UAS-TeTxLC (UAS-TNT-C)[18] from
Troy Littleton (Massachusetts Institute of Technology, Cambridge, MA), and UASHid(#14) fiom Hermann Steller (Rockefeller University, New York, NY). RNAi was
performed as described 1291, except the concentration of each dsRNA in injection
mixtures was fkom 1.3 m g l d for mixtures of five dsRNAs up to 5 mg/mL for mixtures
of two dsRNAs. Injections were into elav-Gal4;UAS-mCD8:GFPanimals, and Gal4
dsRNA was included in each injection mix. Thirteen to 24 h after injection, animals with
unaltered (Fig. 2A, open circle) or partially diminished GFP expression (Fig. 2A, closed
circle) were eliminated (they comprised 2%-3%
and QO%
of total injected animals,
respectively). Animals lacking GFP expression were grown on molasses plates at 25OC.
On day 3 (injected day O), late-first/early-second instar larvae (approximately the size of
48-h-old uninjected elav-Gal#;UAS-mCD8:GFPlarvae) were used in analyses.
Following the assay, larvae were allowed to recover on molasses plates overnight at
25OC; larvae significantly larger than 48-h elav-Gal4;UAS-mCD8:GFP larvae were
removed and the rest assayed once more. Larvae were then allowed to develop to third
instar for further analysis. dTrpAl dsRNAs corresponded to bases 1241-1787 (region 1)
and 2872-3605 (region 2) of dTrpA1 cDNA (AY302598) [15]. Details of all dsRNAs are
provided in the Supplemental Material. Chordotonal neuron loss in atonal(RNAi) larvae
was confirmed by examining elav-Gal4;UAS-mCD8:GFP in animals injected with only
Atonal dsRNA. dTrpAl-Gal4 was created by cloning 33-1301 bp upstream of the
dTRPA1 translational start into pGATB [301. dTrpA1-Gal#: UAS-mCD8:GFP expression
in both lines used did not overlap with dTRPAl protein expression in the larval anterior,
gut, or corpus cardiaca. Both dTrpA1-Gal4 lines drove expression in small but
nonoverlapping populations of peripheral neurons.
Antibody production and histology
Rat polyclonal dTRPAl antiserum was raised (Covance) against the 178 Cterminal amino acids of dTRPAl fused to 6XHis. dTRPAl staining of neurons in larval
brain and corpus cardiacum was initially detected at first instar and persisted until third
instar. Expression of a dTrpAl cDNA in the retina resulted in robust ectopic staining and
permitted detection of dTRPAl protein by Western blot (Supplementary Fig. 1). Images
were obtained using a Nikon PCM2000 confocal microscope and Zeiss Axioplan2 with
Nikon DXM1200 camera.
Behavioral assays
Thermal gradient assay was similar in design to that of [4], but with different
temperatures. Thermal gradient assay was performed on 2% agarose (25 mL) in a 150 x
15 mm Petri dish (VWR 25384-139) placed so that the release zone was at the interface
of two metal slide warmers (one heated to 47OC, one unheated) 4 mm apart. Agarose
surface was allowed to equilibrate for 50 min prior to each assay (with dish lid in place).
Surface temperatures were determined using a Fluke 5211 thermometer with dual K-type
flat surface probes. Larvae were washed in distilled water and lined up in the release zone
with a paint brush. Plate was immediately covered with a lid (t = 0). Larvae were raised
on molasses plates or in bottles and vials with food. Larvae expressing TeTxLC or Hid
were examined at third instar to permit maximum TeTxLC or Hid accumulation. Hid
ablation of dTRPAl cells was quantified using the three large dTRPAl -expressing CNS
neurons bracketed in Figure 4. Three cells were observed in all 10 dTrpA1-Gal#:UASGFP hemispheres and all eight UAS-Hid hemispheres examined, while one cell was
observed in all 20 dTrpA1-Gal#:UAS-Hidhemispheres examined. The MI represented
the fraction of larvae no longer in the release zone at a given time point. MI = (number of
larvae in cooler zone + number of larvae in warmer zone)/(total number of larvae). All
statistical comparisons used two-tailed unpaired t-test versus uninjected.
Animals expressing active toxins exhibited modest reductions in MI. MI of third
instar dTrpAl-Gal#;UAS-TeTxLC larvae were 0.57 % 0.04 and 0.69 A 0.03 at 2 and 5 min
(n = 10 assays) and those of dTrpAI -Gal#:UAS-Hid larvae were 0.70 A 0.05 and 0.78
*
0.04 (n = 1O), while those of wild-type larvae were 0.86 0.03 and 0.89
0.02 (n = 10).
However, the value of the MI did not correlate with thermotaxis defects, suggesting the
reduced MI is not the source of the thermotaxis defect. dTrpAl -Gal#:UAS-Hid animals
had a higher MI than did dTrpAl-Gal#:UAS-TeTxLC animals, but were more defective
for thermotaxis. Furthermore, the dTrpA1-Gal#:UAS-Hid MI was not significantly
*
different from that of md-Gal4:UAS-TeTxLC (0.75 0.05 and 0.85 0.03; n = 12), but
thermotaxis in dTrpAl -Gal#:UAS-Hid was substantially reduced compared with that in
md-Gal#:UAS-TeTxLC ( p < 0.002). In addition, third instar dTrpAl-Gal4 and dTrpAIGal4:UAS-Hid larvae performed indistinguishably for chemotaxis, with n-octyl acetate
AIs of 0.67
* 0.07 and 0.66 * 0.09, respectively (n = 6 assays for each, 60-min time
point), suggesting a specific defect in thermotaxis.
Probe assay was performed using a Sears Craftsman Soldering Iron (1 13.540410)
controlled by a Statco Variac (3PlV221B). Probe temperature was monitored with
Physitemp BAT- 12 thermometer equipped with K-type flat surface probe and varied
between 55°C and 57OC during assays. The Supplementary Movies were made with a
Sony TRV38 and edited with Apple iMovie. Odor avoidance assays were performed as
described [17], except 2.5 pL of undiluted n-octyl acetate (Sigma) was presented in
microcentrifbge tube cap opposite an empty cap, and late-first/early-second instar larvae
were assayed for uninjected and dTrpA1(RNA0.
Acknowledgments
We thank Y. Jan and T. Littleton for fly strains; T. Jegla, G. Story, and V. Viswanath for
helpful discussions and communicating results prior to publication; L. Guarente, H.R.
Horvitz, R. Huey, R. Hynes, T. Orr-Weaver, C. Quinn, W. Rhyu, R. Stevenson, D.
Tracey, B. Wold, and Garrity lab members for helpful discussions; S. Gilbert, F. Nijhout,
and R. Stevenson for reprints; and A. Chess, L. Huang, R. Huey, R. Khodosh, J. Whited,
and B. Wold for comments on the manuscript. This work was supported by a grant to
P.A.G. fiom the Raymond and Beverly Sackler Foundation and a Whitehead Family
Career Development Professorship. M.R. was supported by an NSF Graduate Research
Fellowship and an NIH Predoctoral Training Grant, and T.D.T. was supported by an NIH
Predoctoral Training Grant.
FOOTNOTES
Supplemental material is available at http://www.genesdev.org.
Article published online ahead of print. Article and publication date are at
REFERENCES
I. Mori, Annu Rev Genet 33,399-422 (1999).
0. Sayeed, S. Benzer, Proc Nail Acad Sci U S A 93,6079-84 (Jun 11,1996).
T. Zars, J Comp Physiol [A] 187,235-42 (Apr, 2001).
L. Liu, 0. Yermolaieva, W. A. Johnson, F. M. Abboud, M. J. Welsh, Nut
Neurosci 6,267-73 (Mar, 2003).
F. Maingret et al., Embo J 19,2483-91 (Jun 1,2000).
C. C. Askwith, C. J. Benson, M. J. Welsh, P. M. Snyder, Proc Natl Acad Sci U S
A 98,6459-63 (May 22,2001).
V. Souslova et al., Nature 407, 1015-7 (Oct 26,2000).
S. E. Jordt, D. D. McKemy, D. Julius, Curr Opin Neurobiol13,487-92 (Aug,
2003).
A. Patapoutian, A. M. Peier, G. M. Story, V. Viswanath, Nat Rev Neurosci 4,
529-39 (Jul, 2003).
M. J. Caterina et al., Science 288,306-13 (Apr 14,2000).
J. B. Davis et al., Nature 405, 183-7 (May 11,2000).
J. Kim et al., Nature 424,8 1-4 (Jul3,2003).
Z. Gong et al., J Neurosci 24,9059-66 (Oct 13,2004).
W. D. Tracey, Jr., R. 1. Wilson, G. Laurent, S. Benzer, CeN 113,261-73 (Apr 18,
2003).
V. Viswanath et al., Nature 423,822-3 (Jun 19,2003).
W. H. a. B. Siddiqui, C.A., Ann. Entomol. Soc. Am. 65,993-1 001 (1972).
G. Heimbeck, V. Bugnon, N. Gendre, C. Haberlin, R. F. Stocker, JNeurosci 19,
6599-609 ( A u ~1,1999).
S. T. Sweeney, K. Broadie, J. Keane, H. Niemann, C. J. OtKane,Neuron 14,34151 (Feb, 1995).
F. B. Gao, J. E. Brenman, L. Y. Jan, Y. N. Jan, Genes Dev 13,2549-61 (Oct 1,
1999).
M. L. Huang, C. H. Hsu, C. T. Chien, Neuron 25,57-67 (Jan, 2000).
B. Heinrich, .
I
Exp. Biol. 85,6 1-72 (1980).
B. Heinrich, m e hot-blooded insects: Strategies and mechanisms of
thermoregulation. (Harvard University Press, Boston, MA., 1993).
B. F. a. H. Murphy Jr., J.E., J: Exp. Biol. 105,305-315 (1983).
J. A. Boulant, Clin Infect Dis 31 Suppl5, S157-61 (Oct, 2000).
R. D. Stevenson, Am. Nat. 125, 102- 117 (1985).
S. a. E. Fukuda, K., Proc. Japan. Acad 42,1082-1087 (1966).
D. P. Corey et al., Nature 432,723-30 (Dec 9,2004).
P. Rorth et al., Development 125, 1049-57 (Mar, 1998).
H. C. Sears, C. J. Kennedy, P. A. Garrity, Development 130,3557-65 (Aug,
2003).
A. H. Brand, N. Perrimon, Development 118,401-15 (Jun, 1993).
N. H. Patel, in Methods in Cell Biology E. A. Fyrberg, Ed. (Academic Press, San
Diego, 1994), vol. 44, pp. 445-487.
SUPPLEMENTARY INFORMATION:
Supplementary Movie 1:
This movie shows the behavior of wild-type late firstlearly second instar larvae on the
thermal gradient. This time lapse begins with the lining up of wild-type larvae in the
release zone, followed by the assay. The portion of the movie containing the assay is
speeded up 8X and covers from 30 seconds to 6 minutes of the assay. (QuickTime, 4
MB).
Supplementary Movie 2:
This movie shows the behavior of dTrpA1 (MA0 late fust/early second instar larvae on
the thermal gradient. The video is speeded up 8X and covers from 30 seconds to 6
minutes of the assay. (QuickTime, 2.5 MB).
Supplementary Methods
Histology
Anti-dTrpAl was used at 1500-1:1000, mouse Mab 2 2 ~ 1 0(DSHB) at 150. Cy-3conjugated goat-anti-rat secondary antibody (Jackson) was used at 1500 and FITCconjugated goat-anti-mouse secondary antibody (Jackson) at 1500. Sonicated first instar
larvae and dissected third instar nervous systems were prepared as described [3 11.
RNAi
Sequences of primers used for generation of templates for dsRNA synthesis were as
follows. T7 polymerase binding site sequence is underlined.
Inactive (CG4536)
Supplementary Figure 1: Additional controls for specificity of anti-dTRPAl antisera.
a, Anti-dTRPAl staining in wild type animal. dTRPAlexpression is observed in the
brain (bracket), but not in the retina (open mowhead). b, Ectopic dTRPAl expression
in the retina is detected by anti-dTRPAl antisera (arrowhead). These animals express a
dTrpAl cDNA under the control of the retina-specific GMR promoter. Endogenous
dTRPAl expression in the brain (bracket) is barely visible as this image is underexposed
to permit clear visualization of retinal staining. c) Western blots containing protein from
wild type and GMR-Gal4; UAS-dTRPA1 larvae probed with anti-dTRPAl. Anti-dTRPAl
detects overexpressed dTRPA1 in GMR-Gal4; UAS-dTRPA1,recognizing a protein
species whose mobility is consistent with the predicted dTRPAl molecular weight of 135
kD. Blots were reprobed with anti-ELAV as a loading control.
5'- TAATACGACTCACTATAGGGAGACAGGTGATAAACCGTGCTGAG -3'
5'- TAATACGACTCACTATAGGGAGATCCCGTCTGGTTGACAATGC -3'
Nanchung (CG5842)
5'- TAATACGACTCACTATAGGGAGACTTCGACAACCCATCGTCAC-3'
5'- TAATACGACTCACTATAGGGAGATTCTGCCATCCGACATCGAC-3'
dTrpAl (CG5751) region 1
5'- TAATACGACTCACTATAGGGAGACGTGCATTAGTGTCAAGGACG -3'
5'-TAATACGACTCACTATAGGGAGATCCACCTGATCGAGCAGATG-3'
dTrpAl (CG5751) region 2
5'-TAATACGACTCACTATAGGGAGATCGTGGTTCCGATTGCTACTG-3'
5'-TAATACGACTCACTATAGGGAGAAACTTTCGCCTCTGCCGTTC-3'
Painless (CG15860)
5'- TAATACGACTCACTATAGGGAGAGATGAAAATGCCCCAGACGTG-3'
5'- TAATACGACTCACTATAGGGAGAATCAGCTTCGTTGATGTCTACGC-3'
CG31284
5'- TAATACGACTCACTATAGGGAGAGAGGGTCAGAAGGAGATACTG-3'
5'-TAATACGACTCACTATAGGGAGACCAATCATCATCACCAGCACTG-3'
CG17142
5'-TAATACGACTCACTATAGGGAGAACATATCCAGTGGCGGATCAG-3'
5'- TAATACGACTCACTATAGGGAGAGCACGTTCTCCATCTTAACGC -3'
Atonal
5'-T7-CAGCAGCAGCAACTACTTGTCG-3'
5'-T7-TTGGAGGGTCTCGTGTTTGGAC-3
'
All PCR were performed on fly genomic DNA (CI55-Gal4;
UAS-mCD8:GFPor WCS)
except for dTrpM (GH22805)and dTrpAl region2 (AY302598)
Chapter 3.
TRPAl mediates both heat- and cold-avoidance behaviors in
Drosophila.
Generation of d t r p ~ pd, t r p l~Aeqd t r p ~Ae8,
l and of dtrpA1Cre-Out(nO~) 1ines by allelic
reduction of corresponding d t r p ~Ins l lines, as well as some PCR analysis of these lines,
was accomplished by Caitlin Rex, a technical assistant in the Gamty lab.
ABSTRACT.
Temperature-gated members of the Transient Receptor Potential (TRP) ion channel
family, dubbed thermoTRPs, help mediate temperature sensation in animals. Different
thermoTRPs can be activated by specific ranges of temperatures, and loss of individual
thermoTRPs leads to defective behavioral responses over narrow ranges of temperatures.
No examples of individual thermoTRPs mediating animals' responses to diverse
temperature ranges, such as responses to both hot and cold temperatures, are known.
Here we report generation of strong loss of function mutations in the Drosophila TRPAI.
It has been previously demonstrated that dTRPAl can be activated by elevated
temperatures (-27OC) in heterologous cells and that dTRPAl is required for larval
thermotaxis in response to elevated temperatures. The new dtrpA1 mutants were
defective not only for the avoidance of elevated temperatures but also for the avoidance
of cold temperatures, suggesting that dTRPAl can mediate responses to a wide range of
temperatures. One interpretation consistent with our findings is that dTRPAl is a bimodal ion channel, capable of being activated by, and mediating animals' responses to,
both hot and cold temperatures.
INTRODUCTION.
Proper responses to temperature are critical for animal survival. To sense
temperature, animals appear to employ temperature-responsive ion channels [I]. The
sensed temperature information is then processed and if necessary a behavioral
adjustment is initiated. Temperature-responsive ion channels include members of the
transient receptor potential (TRP) family [2]. These "thermoTRPs" are expressed in
tissues known to be temperature responsive, such as sensory neurons innervating the skin
and the tongue, and can be activated by specific ranges of temperatures in cultured
neurons or in heterologous cells [I]. Distinct thermoTRPs are activated by noxious heat
(TRPV 1 and TRPV2) [3,4], by moderately warm/innocuous temperatures (TRPV3,
TRPV4, TRPM4 and TPM5) [5-91, by moderate cooling (TRPM8) [lo, 111 and possibly
by noxious cold (TRPAI) [12, 131. Similarly, mouse knockouts lacking individual
thermoTRPs exhibit defects in responses to relatively narrow ranges of temperatures [9,
14-171. These studies have led to the development of current models in which animals
are proposed to sense temperature using a series of thermoTRPs to detect the broad
spectrum of temperatures that animals sense, with each thermoTRP mediating responses
to a limited portion of the temperature spectrum [I]. In particular, current models suggest
that thermoTRPs are activated by, and mediate behavioral responses to, only fairly
narrow ranges of temperatures. For an individual thermoTRP such a range could include
hot or cold temperatures, but not both.
Fruit fly Drosophila melanogaster larvae and adults can sense and avoid hot and
cold temperatures, and Drosophila adults exhibit strong preferences for -24OC [18-201.
Similar to mammals, temperature sensation in flies is mediated by multiple molecules
and multiple neuronal mechanisms. Thus far, three putative Drosophila thermoTRPs
have been identified. PYREXIA (PYX) is a thermoTRP activated by temperatures above
-35OC-40°C and is required to prevent heat-induced paralysis at high temperatures (40°C)
[21]. PYX has thus been proposed to protect flies from high-temperature stress.
PAINLESS is required for larval response to high-temperature (-38OC<T<-52OC)
mechanical stimulation [22]. While the ability of temperature to gate PAINLESS has not
been reported, the abdominal nerves ofpainless mutants fail to exhibit proper increases in
activity following temperature elevation to 42OC, suggesting that PAINLESS does
regulate temperature-dependent neuronal activity [22]. Finally, dTRPAl has been
demonstrated to be activated by warming (-27OC) in heterologous cells [23]. We have
previously shown that RNA interference (RNAi)-mediated knockdown of dTRPAl
expression disrupts larval thermotaxis (defined as directed migration in response to
changes in temperature) at elevated temperatures (-3 1OC--3 5°C) [19]. As in mammals, it
appears that Drosophila TRP channels exhibit specific temperature ranges and specific
thermosensory behaviors for which they are required. For example, PAINLESS was
dispensable in our elevated temperature thermotaxis assay, while dTRPAl appeared
dispensable for larval responses to high temperature mechanical stimulation [19]. While
several molecules have now been implicated in mediating thermosensory behaviors in
Drosophila, molecules that regulate cold sensation and cold-dependent behaviors in
Drosophila have not been identified.
To facilitate further analysis of the role dTRPA1 plays in mediating Drosophila
thermosensory behaviors we generated loss of function dtrpAlmutants. Consistent with
our previous RNAi-based analysis [19], dtrpAl mutants were defective for avoidance of
elevated temperatures. Surprisingly, dtrpA1 mutants were also defective for the
avoidance of cold temperatures. dTRPAl is the first protein implicated in mediating
behavioral responses to cold temperatures in insects. Furthermore, dTRPAl is the first
thermoTRP involved in responses to both elevated and cold temperatures. Therefore, in
contrast to previous models of thermoTRP function, which propose that an individual
thermoTRP mediates responses to either heating or cooling, but not to both, dTRPA1
appears to control animals' responses to both increases and decreases in temperature.
RESULTS.
Generation of dtrpA1 alleles.
We have previously shown that RNA interference (RNAi)-mediated knockdown
of dTRPAl expression causes thermotaxis defects in the Drosophila larvae [19]. The
dtrpA1(RNAi) larvae were defective for avoiding elevated temperatures. To facilitate
further study of the role dTRPAl plays in thermosensory behaviors, we wanted to
generate mutants in dtrpA1. To generate a lesion in dtrpAl, we used homologous
recombination-mediated ends-in insertional strategy [24] to target the dtrpAl locus (Fig.
1A; See Materials and Methods). From this targeting screen we recovered 33 putative
targeting events (at least 27 independent). PCR analysis (Fig. 1B and data not shown)
revealed that 29 events (at least 24 independent) were insertions in the dTRPAl locus
( d t r p ~Insl alleles). The targeting construct was engineered to contain a frameshift
mutation early in the coding sequence (predicted Dl 83->A, 27aa, STOP) and truncations
at the 5' end (removing the first exon, including the putative endogenous start site, first
intron and a portion of exon 2) and the 3' end (removing a portion of the predicted ionpore region, the sixth transmembrane domain and the C-terminal cytoplasmic tail). The
left side of d t r p ~ l tandem duplication is then predicted to encode a non-functional
protein lacking the final transmembrane domain and the C-terminal cytoplasmic tail. The
right side of the duplication lacks the putative endogenous start site and any regulatory
Figure 1. Generation of dtrpAl mutant alleles. (A) Strategy for targeting the dtrpAl
locus using homologous recombination-mediated insertional targeting [24] and
subsequent reduction of the dtrpA1Ins duplication to a single copy (Cre-out generation;
[25]). Locations of the engineered fiameshift mutation, 5' and 3' end truncations, and of
the lesions in the d t r p ~ l
dtrp~l
and dtrpAlinSlines are indicated. (B) Examples
lines. Primers 2 and 3 anneal to the
of the PCR analysis of the putative dtrpAlznS
sequences of the white mini-gene, while primers 1 and 4 anneal to the sequences outside
of the duplicated region. (C) Examples of the PCR analysis of the putative dtrpAlfSlines.
The frameshift mutation was engineered by filling in a ClaI restriction enzyme site,
creating an NruI restriction site in the process. PCR products of the chromosomes that
bear the engineered frameshift mutation can be cut with NruI but not with ClaI, while the
PCR products of the chromosomes lacking the engineered fiameshift mutation can be cut
with ClaI but not with NruI.
Figure 1.
A
Donor
I FLP
---A
dTRPA1
genomic locus
m
MCM?
l a ~exon
t
--
Right side
3+4
Left side
1+2
--
yL
-
Nrul
elements within the first intron and should not make functional protein because of the
engineered frameshift mutation.
Two of the 27 independent insertion lines contained not only the engineered
frameshift mutation but also additional lesions within the dtrpA1 tandem duplication.
d t r p ~iNde6
l contained a 205bp deletion within the right side of the tandem duplication,
removing almost the entire exon 6 and 16bp of the intronic sequence 3' of exon 6 (the
deletion resulted in the first two nucleotides of exon 6 being directly followed by the
intronic sequence). It is unclear whether during splicing the two remaining base pairs of
exon 6 would be included into the spliced mRNA or whether this lesion would result in
skipping of the remaining two base pairs during splicing. If the remainder of exon 6 were
skipped, this lesion would not be expected to shift the reading frame of the resulting
contained a 307bp deletion on the left side of the duplication. That
protein. dtrpAlimAe8
lesion consisted of a substitution of 320bp 5' of the I-SceI insertion site within the
targeting construct with 13 unrelated nucleotides. This resulted in an internal deletion
within exon 8, where the 5' 28bp of exon 8 were followed by 13 unrelated nucleotides
and then by the remainder of exon 8. This lesion is predicted to shift the reading frame of
the protein (predicted I4 16->N, 15aa, STOP).
We used a Cre-out strategy [25] to reduce the tandem duplication in dlrp~l
d t r p ~imAe6,
l and dtrpA1
lAe8, and
lines to a single copy, generating dhp~lf:dtrp~l
1Cre-outtno-fs)lines. Presence or absence of the fs, Ae6 and Ae8
mutations in the DNA of the Cre-out lines was determined by PCR, and in the case of the
engineered fiameshift mutation, also by restriction digest (Fig. 1C and data not shown).
The presence of the engineered frameshift mutation in the context of the otherwise wild-
type dtrpAl gene in the dtrpAlfilines is predicted to shift the reading frame of the
dTRPAl protein and the putative longest open reading fiame (ORF) in dtrpAlfilines is
predicted to be out of fixme with the original dTRPAl-coding ORF.
The d h p 1~cre-~'t(no-fs)
lines generated during the reduction of tandem duplications
in dtrpAlimlines to a single copy (the Cre-out strategy) did not contain either the
engineered frameshift mutation, or the Ae6 or the Ae8 mutations. However, some of the
lines originated from the
DNA in the regenerated dtrpAl locus in the dtrp~lCreeo't(no-fs)
targeting construct DNA. Thus, while the dtrpA1 locus in the dtrp~lCre4Ut(no~)
lines is
predicted to be wild-type, if the targeting construct DNA contained mutations in dtrpA.2
other than the engineered frameshift, these mutations could become part of the
l
lines during the Cre-out process.
regenerated dtrpAl locus in the d t r p ~Cre-ou*(no-fs~
dTRPAl protein expression is absent in dhpAl mutants.
In wild-type third instar larvae dTRPA1 protein is detected in a small group of
neurons in the central brain and in the neurosecretory cells of Corpus Cardiaca (CC) [19].
We previously found that inhibition or ablation of the dTRPAl -expressing neurons in the
central brain significantly attenuated larva1 thermotactic behavior [191. dTRPA 1 protein
was undetectable in the brains or in the CCs of dtrpAlim3rdinstar larvae (Fig. 2),
suggesting that dtrpAlimallele disrupts normal dTRPAl protein expression.
dTRPAl is requiredfor larval avoidance of elevated temperatures.
We next tested d r r p ~ l " mutant larvae for thermotactic behavior in response to
elevated temperatures. When placed onto a thermal gradient within a -3 1°C--350C
Figure 2. dTRPAl protein expression is absent in d t r p ~ l i nmutants.
s
(A)In third larval
instar eye-brain complexes dTRPAl antibody detects expression in the Corpus Cardiaca
neurosecretory cells (*) and in a subset of central brain neurons (brackets). (B) In the
d t r p1~insU3#2-4 mutant animals, the dTRPAl irnmunoreactivity is absent.
Figure 2.
Figure 3. dtrpAl mutants are defective for themotaxis at elevated temperatures. (A)
Thennotaxis assays at elevated temperatures on independent d t r p ~ l i lines
m assayed as
either homozygous mutant larvae or over a Df(dtrpA1). Behavior of all genotypes exhibit
statistically significant differences from wild-type (P<0.0001). Wild type (n=l 1 assays);
dWA
insU3#2-2
homozygous (n=8); dtrpA1insU3#2-2lDf(dtrpA1) (n=5); d t r p ~insU3#2-4
l
homozygous (n=9); dtrpAl insU3#2-4lDf(dtrpA1) (n=8); dtrgA1insUI-9 homozygous (n=5);
d t r p ~insUz-9/~f(dtrp~l)
l
(n=5); d t r p ~insU3#22iz
l
homozygous (n=7); d t r p ~insU3#2l
4/~f(dtrp~
(n=4).
I ) (B) dtrp~lCre-Out
mutant animals that contain the engineered
fiarneshift, the dtrpAlfiH8and dtrpAlfiG7animals, are significantly defective for
thermotaxis at elevated temperatures #(P<0.05); * (P<0.0 1); * * (Pi0.00 1); * * * (P<0.000 1).
Wild type (n=6); dtrpAI insU3#2-4 homozygous (n=7); dtrp~lfSHB~f(dtrp~l)
(n=4);
dtrPAlw homozygous (n=4); dtrPAlfsG7
homozygous (n=4) d t r p I~cre-0Ut(n0-fs)F6
homozygous (n=4) ;dtrpAl Cre-out(no-jkJF6lDfldtrpA1) (n=5).
Figure 3.
wild type
d t r p1~ins#2-2
dtrpAIinm-2/Df(dtrpAI )
dtrpAIinm4
dtrpAIin*%f(dtrpA I )
dtrpAljn=#'"
dtpAIins#7-g/Df(dtrpA
I)
1indf2-11
d t w Iinmm7
I/Df(dtrpAI )
Time (min)
wild type
dtrpAIinm4
dtrpA1fSH8/Df(dtrpA
I)
dtrpAIfSH8
d t p AIbG7
d t r pI~Cm-out(no-fs)F6
dtrpAI C"+OM(no-fs)F6/Df(dtrpA
I)
Time (min)
release zone, dtrpAli* larvae were significantly defective for avoidance of the highertemperature environment (Fig. 3A). Severe thennotaxis defects were observed in both
the dtrpAlimhomozygous mutant larvae and in the larvae containing the dtrpAli* lesion
in trans over a deficiency uncovering the dtrpAl locus (Df(dtrpA1)) Different d t r p ~'*
l
lines exhibited varying degrees of thermotactic behavioral defects (Fig. 3A) but the
phenotypes of dtrp~l
im/~f(dtrp~l)
larvae varied less among the different dtrPAlimlines,
suggesting that recessive modifiers were partially suppressing the thermotactic defects of
)ldtrpAICreeout(no-fs)F6larvae
some d t r p I~im lines. Df(dtrpAl)lTM3 and ~f(dtrpA1
exhibited normal thennotaxis in response to elevated temperatures (Fig. 3B and data not
shown), suggesting that Df(dtrpA1) is recessive for heat avoidance thennotactic behavior.
Furthermore, some of the d t r p ~ l mutant lines exhibited virtually identical avoidance
indexes (AI) at elevated temperatures when assayed as homozygotes or as heterozygotes
over Df(dhp1). While formally this data can be considered an indication of the
d t r p ~iml mutation being a null allele, the effects of genetic background on thermotactic
behavior make it difficult to draw that conclusion. The behavior of dtrpAI mutants on
l
the thermal gradient was also somewhat variable over time, even for the d ~ Amutants
in trans with Df(dtrpAl), suggesting that some uncontrolled environmental factors can
influence thennotactic behavior of dtrpA1 mutant animals. However, since a number of
independent insertions into the dtrpA1 locus caused defects in larval thennotaxis at
elevated temperatures, and since these insertions were defective for thennotaxis in trans
over an independent dtrpA1 allele (Df(dtrpAI)), these results suggest that it is the
mutation of the d ~ p Agene
l
in dtrp~lim
mutant animals that was responsible for the
observed thermotaxis defects.
For subsequent analysis we focused on a single d t r p ~ l line, dtrpA1ins U3#2-4 since
d t v p1~insU3#2-4 larvae exhibited similar thermotactic defects as homozygotes or as
heterozygotes over Df(dtrpA1). We used this line to generate allelic substitutions of
dtrpA1 (reduction of the d t r p ~ l to a single copy [25];see above and see Materials and
l
) lines. The behavior of
Methods), producing dtrPAlCre-Out (dtrpAlfSand d t r p ~cre-Out(nO$)
dtrpAlfSmutants on the elevated temperature thermal gradient was similar to that of the
dtrpAlinSanimals (Fig. 3B). However, animals from a Cre-out line without the
engineered frameshift mutation in dTRPAl (dtrpA1Cre-out(n0-f)F6) exhibited wild-type
avoidance of elevated temperatures, either as homozygotes or as heterozygotes over
Df(dtrpA1) (Fig. 3B). Our preliminary data suggest that the Cre-out lines dtrpAlAe6and
dtrpAlAe8are also defective for avoidance of elevated temperatures (data not shown).
Taken together, the above results suggest that dTRPAl is required for larval thermotaxis
at elevated temperatures.
dTRPA1 is requiredfor larval avoidance of cold temperatures.
When placed on a thermal gradient generated by cooling a portion of an agarosecovered plate by a cold generator set to 10°C (within -17OC -20°C release zone; Fig. 4A),
wild-type larvae robustly avoided the colder half of the plate (cooled zone), rapidly
migrating into the warmer (not cooled) zone (Fig. 4B). dtrpAl insU3#2-4 mutant larvae,
however, migrated out of the release zone into both the cooled and warmer halves of the
plate (Fig. 4B), gradually accumulating within the cooled zone. The observed
accumulation of dtrpAl insU3#2-4 larvae on the cooled side with time might reflect the
inability of the larvae to leave the cooled area once they migrate into sufficiently cold
Figure 4. dtrpAl mutants are defective for thermotaxis at cold temperatures. (A)
Diagram of the behavioral apparatus used to test thermotaxis at cold temperatures. The
cold generator was set to the indicated temperature (Set T) while the slide warmer
remained at room temperature. Points c and d on the diagram correspond to the
temperature borders of the release zone. Temperatures for various points on the thermal
gradients used in this study are provided in the table above the diagram. For the
behavioral assays, larvae were placed within the release zone at t=O and their distribution
on the plate was monitored with time. (B) Thermotaxis assays in response to the gradient
generated by setting cold generator to 10°C. dtrpAl insU3#2-4 homozygous animals
exhibited statistically significant behavioral differences from wild-type (P<0.000 1). Wild
type (n=15); dtrpAl insU3#2-4 (n=15). (C) Thermotaxis assays in which the gradient was
generated by a 17OC cold plate. dtrpAl insU3#2-4 homozygous animals exhibited no
l
statistically significant differences from wild-type. Wild type (n=3); d t r p ~insu3#2-4
(n=3). (D) Thermotaxis assays in which the gradient was generated by a 15OC cold plate.
l
(n=6 ) .
Statistical differences are as described in Fig. 3. Wild type (n=4); d t r p ~insu3#2-4
(23) Thermotaxis assays in which the gradient was generated by a 13S°C cold plate.
Statistical significance are as described in Fig. 3. Wild type (n=7); dtrpAl insU3#2-4 (n=9).
(0Thermotaxis assays in which the gradient was generated by a 12OC cold plate.
Statistical differences are as in Fig. 3. Wild type (n=3); dtrpAl insU3#2-4 (n=3).
Figure 4.
wild type
Slide Warmer
Cold Generator
2
6
10
20
Time (rnin)
16
16
20
Time (min)
26
30
40
2
6
10
2
6
1
16
20
Ttme (mln)
0
1
6
2
Time (min)
26
0
2
40
30
5
5
0
4
0
environment. Indeed, larval motility was noticeably slower within the cooled zone than
insU3#2-4
within the wanner zone (data not shown). However, the dtrpA1
mutant larvae
were able to move within the cooled zone and the larvae gradually migrated farther and
faaher down the thermal gradient (towards even colder temperatures) during the course
of the assay (data not shown). After the last time point (40 minutes) dtrpA1insU3#2-4 larvae
typically were not found at temperatures lower than 10.4OC. Neither wild-type nor
d t r p1~insU3#2-4 mutant animals exhibited significant preferences for either half of the plate
in the absence of the cold stimulus (release zone -22.5OC--22.5OC; data not shown).
These findings suggest that dTRPAl is required for thermotaxis at not only elevated
temperatures, but also for thermotaxis at cold temperatures.
dwA 1imU3#2-4 mutation exhibited strong defects in cold avoidance either when
homozygous or when heterozygous over Df(dtrpA1) (Fig. 5A). Interestingly, Df(dtrpA1)
and d t r p1~insU3#2-4 alleles exhibited partially dominant cold avoidance phenotypes (Fig.
5A). The cold avoidance defects exhibited by the Df(dtrpAl)/TM3,actin-GFPand by the
d h p 1~imU3#2-4ITM3,actin-GFP animals appeared milder than the defects exhibited by the
dwA 1insU3#2-4 homozygous mutant animals or by the dtrpA1insU3#2-4lDf(dtrpA1) larvae
and only became pronounced 15-20 minutes into the assay. Neither Df(dtrpA1) nor
dtrpA1insU3#2-4 alleles exhibited dominant thermotaxis phenotypes in response to elevated
temperatures (Fig. 3B and data not shown). While at this point we can't rule out that
TM3,actin-GFP balancer itself causes partially dominant cold avoidance phenotypes, the
identical cold avoidance defects exhibited by d t r p ~imu3#224
l
homozygous larvae and by
the d t r p1~insU3#2-4lDf(dtrpA1) animals suggest that it is the mutation of dTRPAl that is
the underlying cause of the observed thermotaxis defects. Additionally, if future
Figure 5. Thermotaxis of dtrpA1 mutants at cold temperatures (lO°C cold generator).
(A) Wild-type and dtrpA1insU3#2-4 homozygous animals re-graphed from Fig. 4B.
d l r p1~i~U3#2-4lDf(dtrpA1) (n=8); dtrpA1u 3 ' 2 - 4 / ~ ~ 3 , a c t i(TM3,act-GFP)
n-~~~
(n=3);
Df(dtrpAl)/TM3,actin-GFP(n=9). NS = not statistically signifcant. (B) Wild-type and
d t r p ~im"#2"'lof(dtrp~l)
l
animals re-graphed from Fig. 5A. dtrp~lXH8/~f(dtrp~l)
(n=5);
d t r p ~Cre-out(no-fs)F6 lDf(dtrpA1) (n=8); d h g ~ l ~ lTM3
~ ~ ,actin-GFP
- ~ ~ ~(n=3);
( ~ ~ ~ ) ~ ~
d t r p ~Cre-out(no$s)E5 lDf(dtrpA1) (n=5).
Figure 5.
wild type
15
20
Time (min)
experiments determine that TM3,actin-GFP balancer does not cause a partially dominant
cold avoidance phenotype, these data may suggest that proper levels of dTRPAl are
essential for larval cold avoidance behavior.
Interestingly, the dtrpAl insU3#2-4 mutant larvae were not equally defective for
thermotaxis on all cold gradients tested. When the cold generator was set to 17OC
(-2 1OC--22OC release zone), dtrpAl insU3#2-4 larvae avoided the cooled zone as well as
wild-type larvae (Fig. 4C). As the temperature of the cooled zone was decreased, the
thermotactic defect of dtrpAl insU3#2-4 larvae became more pronounced. At 15OC (-20°C-
-2 1OC release zone), dtrpAl insU3#2-4 larvae initially avoided the cooled zone in an
essentially wild-type manner (Fig. 4D). However, as the assay progressed, more
dwA 1imU3#2-4 larvae began to migrate into the cooled zone, and by 40 minutes into the
assay almost as many larvae were located in the cooled zone as in the wanner zone. In
contrast, wild-type larvae possessed mechanisms to avoid the cooled zone both during the
initial stages of the assay and as the assay progressed. As seen in Fig. 4 (E and F),
progressive decrease in the temperature of the cooled zone resulted in more pronounced
defects at earlier time points.
These findings are consistent with two interpretations, which are not mutually
exclusive. In the first possibility dTRPAl would be required for larval avoidance of
stronger cold but not of more moderate cold temperatures. The animals would therefore
possess multiple mechanisms for sensing and avoiding cool temperatures, but as the
temperatures decrease, they increasingly rely on dTRPAl signaling in order to sense
andlor properly respond to the aversive cold stimulus. Alternatively, d t r p ~ ~ i m U 3 # 2 -may
4
not be a null allele. Thus, there may be sufficient functional dTRPAl protein in
d t r p1~insU3#2-4 larvae to signal avoidance of more moderate cold temperatures (17OC cold
plate) and signal initial avoidance at colder temperatures (15OC, 13S°C and 12OC cold
plates). At even colder temperatures, though, the residual level of functional dTRPAl in
d t r p1~insU3#2-4 animals may be below the threshold necessary to mediate the appropriate
thermotactic behavior and dtrpA1insU3#2-4 animals are therefore unable to avoid the cold
stimulus either initially or later.
Potential identijication of mutations that disrupt thermotaxis at cold temperatures but not
at elevated temperatures.
To further test whether lesions within the dtrpA1 locus disrupt cold avoidance
lines for thermotaxis at cold temperatures. We used
behavior, we examined dtrp~lCre~Out
10°C temperature for these assays in order to quantitatively compare the behavior of the
larvae at early time points (the initial responses to temperature challenge). To avoid
possible effects of recessive genetic modifiers on the behavior of the dtrp~lCreeoUt
animals, we instead assessed the behavior of d t r p ~CreeOutl~f(dtrp~l)
l
animals.
p ~ l ) exhibited identical defects in
As shown in Fig. 5B, d t r p ~ l P H 8 / ~ f ( d t rlarvae
cold avoidance behavior as those of the dtrpA1ins U3#2-4lDf(dtrpA1) animals, consistent
with the predicted disruptive effect of the engineered fiameshift on the dTRPAl function.
However, we were surprised to discover that dtrp~lCre-OM
lines that did not contain the
engineered frameshift mutation, dtrp~lCree0ut(n0fS)F6
and dhpAl ere-OU~(~O-~S)E~
,also exhibited
significantly defective cold avoidance behavior when assayed over Df(dtrpA1) (Fig. 5B).
The cold avoidance defects of dtrp~lCree0ut~n0~F6
lDf(dtrpA1) and dtrp~lCre-Out~nO~
P J E 5 1 ~ f ( d t ranimals
p ~ ~ ) were not as severe as those exhibited by the d t r p ~insU3#2l
4 / ~ f ( d t rI)por
~ by the d t r p ~ l f s H 8 / ~ f ( d tanimals
r p ~ l ) (that retained the frameshift
mutation), but were more severe than the phenotypes of Df(dtrpAI)/TM3,actin=GFP
animals. Furthermore, larvae homozygous for the dtrpAl Cre-out(no-f)F6 chromosome also
exhibited cold avoidance defects (data not shown), arguing that dtrpAI Cre-out(no-fs)F6
chromosome contains a mutation that affects larval thennotaxis at cold temperatures.
dtrpAlere-OU~(~O-~S)F~
1ine was derived from the dtrpA1insU3#2-4 insertion. We also generated
d t r p ~Cre-Out
l
lines fiom the d t r p ~"
l targeted insertions obtained independently from the
d h p ~insU3#2-4 insertion in our targeting screen. We have performed preliminary
line (assayed as a homozygous mutant), one dtrp~lAe8
characterizations of one dtrp~lAe6
line (assayed in trans over Df(dtrpA1)) and one dtrp~lCre-Out(nO~)
line derived from the
d t r p ~jNde6
l insertion (assayed as a homozygous mutant). All three of these lines
exhibited defects in cold-avoidance behavior (data not shown), arguing that thermotactic
defects in response to cold temperatures exhibited by the dtrpAI Cre-out(n0-f) animals were
not specific for the dtrpAl insU3#2-4 insertion line.
There are several potential explanations for the behavioral defects observed in the
larvae, the animals that do not contain the
responses to cold by the dtrp~lCre~OUt(nO-fs~
intended engineered fiameshift mutation in the dtrpA1 locus. One is that the thermotactic
behavior in response to cold is very sensitive to perturbations of the genome and virtually
any mutation will cause a cold avoidance phenotype. The thermotaxis phenotype of
dtrpAI larvae in response to cold would thus be fairly nonspecific. While we have not
yet ruled out this explanation, we have examined other fly lines that exhibited either no
defects for cold avoidance over the whole time course of the assay or exhibited defects in
cold avoidance only at later time points (1O°C cold plate; data not shown). In contrast,
the animals with lesions in the dhpA1 locus were significantly defective for thermotaxis
to cold temperatures from the beginning of the assay on. Another possible explanation
lines contain additional unexpected mutations.
for our results is that the dtrp~lCre-oUt(nO-fs)
These mutations may have been introduced during the I-SceI-mediated integration of the
donor DNA into dTRPAl locus. We know that this integration process can create
unintended lesions as we have recovered two relatively large deletions resulting from
targeted integration events into the dtrpA1 locus (dtrpal
and dppal
Alternatively, perhaps a more likely explanation for the observed results, is that the
mutation(s) affecting cold avoidance behavior of the dtrp~lCre-OUt(nO~
animals may have
originated within the targeting construct DNA. Thus far we have only assayed three
d h p ~Cre-out(n0-f~)lines generated from two independent d t r p ~iml stocks. Especially in the
case of mutations existing within the original targeting construct DNA, it is certainly
l
lines we have thus far assayed contain these
possible that all three of the d t r p ~cre-Out(nO-fs)
mutation(s). We are currently sequencing the targeting construct that we have employed
for targeted insertional mutagenesis of the dhpAl locus. We will then analyze existing
d k P lcre+ut(no-fs)
~
lines for the presence of any mutations discovered within the targeting
construct and determine whether any of the mutations discovered correlate with the cold
avoidance defect exhibited by dtrpAl Cre-out(no-fs) animals.
l
animals did not exhibit thermotaxis
It is interesting to note that d t r p ~Cre-out(n0-fs)F6
defects in response to elevated temperature (Fig. 3B). Thus, if the unknown mutation(s)
were responsible for the cold avoidance defects of the dtrp~lCre~0Ut(n0~F6
animals, these
mutation(s) might be selectively disrupting the role dTRPAl plays in cold avoidance but
not in heat avoidance. Thus, these mutation(s) might provide valuable insights into the
mechanisms by which dTRPAl mediates temperature sensation.
dTRPAl is requiredfor select larval behaviors.
It is apparent from our cold avoidance experiments that d v A l mutant larvae
retain some capacities for responding to select temperatures, indicating that global
execution of sensory behaviors is not disrupted in the dtrpAl mutant larvae. To
determine whether the behavioral defects exhibited by d w A l mutant animals might be
specific for themotaxis we examined the responses of dhpA1insU3#2-4 mutant larvae to
other sensory stimuli. dtrpA1insU3#2-4 larvae avoided the repellent odor n-octyl acetate
[26] at least as well as wild-type (Fig. 5A). Similarly, there were no significant defects in
the responses of dtrpAl insU3#2-4 mutant animals to the attractant odor propionic acid [26]
(Fig. 5B). Furthermore, phototaxis of late lSt/early2ndinstar [27] d@Al
insU3#2-4
larvae
was indistinguishable from that of wild-type larvae (Fig. 5C). These findings suggest
that while dTRPAl is required for a subset of temperature-driven behaviors, dTRPAl
appears dispensable for other sensory modalities such as chemosensation and vision.
DISCUSSION.
Drosophila melanogaster exhibits strong temperature preferences and robust
avoidance of unfavorable thermal environments [18-20,281. We have previously
implicated dTRPAl in mediating larval responses to elevated temperature using RNAi
[19]. Here, we continued our examination of the molecular mechanisms that mediate
themotaxis in Drosophila.
Figure 6. dtrpA1 mutant animals respond normally to temperature-independent sensory
stimuli. (A) Wild-type (n=7) and dirpA1insU3#2-4 homozygous animals (n=7) robustly
avoid a repellent odor n-octyl acetate. #p<.05 (B) Wild-type (n=6) and dtrpAl insU3#2-4
mutant animals (n=6) are equally attracted to an attractive odor propionic acid. (C) Wildtype (n= 10) and dtrpAl insU3#2-4 mutant animals (n=lO) exhibit indistinguishable
phototactic behavior .
Figure 6.
Propionic acid
noctyl acetate
-1 J
20
30
Time (min)
wild type
dtrpAlina4
5
2
Time (min)
To facilitate further studies of thennotaxis in Drosophila, we generated loss of
h c t i o n alleles of dhpA1. As expected, we found that dhpA1 mutants were defective for
thermotaxis at elevated temperatures. Interestingly, however, the thermotaxis defects
exhibited by d h p A l mutant animals at elevated temperatures were less severe than the
thermotaxis defects of the larvae from embryos injected with double stranded RNA
(dsRNA) targeting dtrpA1, the dtrpA1(RNAi) larvae. The dtrpA1(RNAi) larvae exhibited
no preference between warmer and cooler zones when placed onto a thermal gradient
featuring a -3 1OC--3 5OC release zone (avoidance index (AI)=O) [19]. Those data were
collected following multiple dsRNA injections throughout the course of a year and the
behavior of the dtrpA1(RNAi) larvae was always consistent. The finding that dtrpA1
mutant larvae exhibited a slight preference for the cooler zone of the thermal gradient
(AI=-0.2-0.4;
A1 of 0.2 is equivalent to 60% of the larvae migrating away fiom the
warmer area and 40% of the larvae migrating into the warmer zone) suggests that dtrpAl
mutant larvae still possess some means to sense and appropriately respond to
temperature.
This difference between the thennotactic behavior of the dtrpA1(RNAi) larvae and
of the dtrpA1 mutant larvae might be due to the dsRNA employed in our initial RNAi
experiments causing off-target effects and altering expression of other genes in addition
to dtrpAl. Alternatively, the dtrpAl alleles we have generated might not be null alleles.
While the mutation we have engineered into the dtrpA1 locus should produce a truncated
and non-functional dtrpAl protein, it is possible that due to alternate splicing, alternate
transcriptional start site or due to the read-through of the frameshift mutation, some
functional dTRPAl protein can be produced in the dtrpAl mutants. Finally, other
mechanisms may compensate for the loss of dTRPAl in dtrpA1 mutants. Our finding
that different dtrpA1 mutant lines we have generated can exhibit quantitatively different
responses to elevated temperature (Fig. 3A) suggests that genetic modifiers can modulate
the behavioral responses of dtrpA1 mutant animals. In the future, it might be possible to
identify some of the genes that modulate thermotactic behavior of the dtrpA1 mutant
animals in response to elevated temperatures. These genes might include other TRPs,
potassium channels, and signaling molecules. One possibility is that in the dtrpA1
mutant background PYREXIA or PAINLESS can compensate for the loss of dTRPA1.
While neither painless nor pyrexia mutants exhibited thermotaxis defects in our elevated
temperature assay ([I 91 and data not shown), the temperature responsiveness of these
channels might permit some thermotaxis in the absence of dTRPA1. We are currently
generating pain1ess;dhpAI and pyrexia,dtrpAl double mutant animals to examine this
possibility.
Unexpectedly, we've discovered that dhpAI mutant animals were also defective
for thermotaxis at cold temperatures. Multiple dtrpA1 mutants failed to avoid the cooled
environment in our cold thermotaxis assay. While we need to further examine the nature
l
animals,
of the therrnotaxis defects at cold temperatures exhibited by the d t r p ~CreeOut(nO~)
our findngs that multiple dtrpA1 mutant lines exhibited strong cold avoidance defects
suggest that dTRPAl is required for thermotaxis at cold temperatures as well as for
themotaxis at elevated temperatures in Drosophila larvae.
It is interesting that dtrpAl mutant animals were not defective for avoidance of all
cold temperatures. Rather, the dtrpAl mutant animals exhibited more prominent and
faster developing thermotactic defects to colder temperatures than to temperatures that
were not as cold (Fig. 3). These findings suggest several possible models for how
dTRPAl may be regulating thermotaxis to heat and to cold temperatures. One possibility
is that dTRPAl is a temperature sensor that is activated by broad ranges of temperatures
in vivo. Another possibility is that dTRPAl is a bimodal ion channel that can be
activated by either hot or cold temperatures, but not by intermediate temperatures. A
third possibility is that dTRPAl does not function as a temperature sensor at either
elevated or cold temperatures, but instead plays another essential role in the function of
the thermosensory circuit(s). With the available data we currently can't distinguish
between these models. However, it has been reported that dTRPAl protein can be
activated by elevated temperatures when expressed in heterologous cells [23], with a
threshold of -27OC. This suggests that dTRPAl mediates thermotaxis to elevated
temperatures by acting as a temperature sensor and that more moderate temperatures do
not activate TRPAl. However, there is currently no direct evidence that dTRPAl is
capable of being activated by temperature in Drosophila neurons. In addition to
reporting that dTRPAl can be activated by elevated temperatures in heterologous cells,
Ardem Patapoutian's and Tim Jegla's laboratories [23] also reported that dTRPAl was
not activated by cold temperatures. We are currently re-examining the ability of dTRPAl
to be activated by cold temperatures in collaboration with Tim Jegla's laboratory.
Furthermore, because our dtrpAl mutants may be hypomorphic alleles, and since the
threshold levels of dTRPA1 required for mediating avoidance of cold and heat and
moderate temperatures may well vary, it is difficult to conclude from our behavioral data
that dTRPAl only mediates avoidance of hot and cold temperatures. Instead, another
mechanism could compensate for the loss of TRPAl at moderate temperatures. Future
experiments may shed light on the mechanisms by which dTRPAl mediates thennotaxis.
However, our results suggest that dTRPAl is the first thermoTRP that mediates animals'
behavioral responses to both hot and cold temperatures in vivo.
Previous models for temperature sensation in animals proposed that animals sense
temperature using a series of thermoTRPs to detect the broad spectra of temperatures,
with each thermoTRP mediating responses to a limited portion of the temperature
spectrum [I]. Mouse knockouts lacking a particular thermoTRP not only exhibit
behavioral defects in responses to only narrow ranges of temperatures but also exhibit
only partial thennosensory behavioral defects at those temperature ranges [9, 14-171.
The lack of strong thermosensory behavioral defects might be attributed to other
thermoTRPs and non-TRP temperature responsive molecules partially compensating for
the loss of a single thermoTRP. For instance, background K' channels TREK-1, TREK-2
and TRAAK, ATP receptor P2X3 and members of the DegenerinIEpithelial Sodium
Channel (DEGIENaC) family are all non-TRP molecules that can either be activated by
temperature or can regulate temperature-dependent responses in animals [29-331.
Furthermore, the partial nature of the thermosensory behavioral defects exhibited by the
animals lacking individual thermoTRPs might be due in part to the remaining
thermoTRPs exhibiting sufficient plasticity in their temperature responsiveness to
partially compensate for the loss of a particular individual thermoTRP. Indeed, numerous
molecules such as membrane lipids, calcium, phosphorylation/de-phosphorylation,and
membrane potential can dramatically alter temperature responsiveness of thermoTRPs in
heterologous cells and in cultured neurons [34-411. For instance, injury or inflammation
can decrease animals' thermal threshold, a phenomenon known as thermal hyperalgesia.
Membrane potential in particular can shift the temperature activation threshold so
dramatically that a heat-activated channel such as TRPVl can be activated at cool
temperatures [40,41]. It is thought that membrane potential affects temperature
thresholds of thermoTRPs by regulating the probability of channel opening [40-421.
But while the temperature threshold of a thennoTRP can be shifted, other
properties of the channel appear to be unchangeable: Regardless of the membrane
potential or interactions with the channel modulators, higher temperatures are still more
effective than lower temperatures at activating TRPV1, eliciting larger currents.
Similarly, while the temperature threshold of cooling capable of activating TRPM8 can
be shifted so that some activity is detected at higher temperatures, even at conditions that
shift temperature threshold of TRPM8, TRPM8 is still more effectively activated at
colder temperatures. In other words, regardless of the membrane potential, TRPVl is
still activated by heating while TRPM8 is still activated by cooling. Our fndings that
dtrpAl mutants exhibit thermotaxis defects at both elevated and cold temperatures
suggest that dTRPAl controls animals' behavior at diverse temperature ranges and raises
the possibility that dTRPAl protein could potentially act as a bi-modal thennoTRP,
activated by both elevated temperatures and by cold.
In addition to demonstrating that dtrpA1 mutants exhibited defects in thennotactic
behavior at both elevated and cold temperatures, we also found that dtrpA1Cre-out(no-fs)F6
lines exhibited significant defects in thermotactic behavior at cold but not at elevated
temperatures. These animals were not predicted to contain the engineered frameshift
mutation or the he6 or the Ae8 mutations. While the molecular basis of the thermotaxis
l
animals is not yet clear, one exciting possibility is
defects exhibited by d r r p ~CreeOUt(nO-fsS)
that d t r p1'''-out(n0-f~)
~
mutation(s) selectively disrupts thermotactic response to cold
temperatures but not to heat. How thermoTRPs, or any ion channels, are gated by
temperature is unknown. The identification of the unintended mutation(s) in the
d t r p ~Cre-out(no-fs)lines might reveal regions of dTRPAl required for cold sensation.
Alternatively, these unintended mutation(s) in dtrpA1Cre-Out(nO-fs)lines may disrupt
interactions of dTRPA1 with other modulators/effectors. Identification of these
mutation(s) should significantly contribute to our understanding of the role dTRPAl
plays in thermotaxis.
What are the cells that mediate thermotaxis to cold temperatures? Liu, et al., [20]
reported that the terminal organ located in the nose of the larvae exhibits changes in
calcium transients in response to cooling and that expressing Tetanus Toxin Light Chain
(TNT; an inhibitor of synaptic vesicle release) in the terminal organ results in defects in
3rdinstar larvae cold avoidance. dTRPAl protein expression was not detected in the
terminal organ [19], however, suggesting that dTRPAl might be mediating thermotaxis
to cold by acting in cells other than the terminal organ. Liu, et al., [20] used the same
model cold generator we've employed, set at S°C which resulted in a thermal gradient of
-1 1°C to -1 8OC measured at approximately same positions as points a and fin Fig. 4A.
Thus, the temperatures they have used are significantly lower than the temperatures we
have used in our thermal gradients. To determine the relationship between dTRPAl and
the terminal organ neurons we will inhibit the function of the terminal organ neurons with
TNT and will determine at which temperatures the terminal organs is required for
thermotaxis on our gradients and at even lower temperatures. If the terminal organ is
required only for very low temperatures, we will also examine whether dtrpAl mutants
are defective for thennotaxis at those temperatures. We will also use the Gal4 drivers
that express in the dTRPAl -expressing cells in the central brain (that are required for
thennotaxis at elevated temperatures [19]) to express inhibitors of neuronal function,
such as TNT, in those neurons. This might allow us to determine which cells are required
for cold avoidance behavior, the relationship between dTRPAl and the terminal organ
and whether same dTRPAl -expressing cells mediate both themotaxis at elevated and
cold temperatures.
MATERIALS AND METHODS.
F& strains
Flies were maintained in a humidified 25OC incubator and fed standard fly food.
Fly strains used for generation of dtrp~lins
and dtrpAlCre-Out alleles were obtained fiom
the Bloomington Stock Center. Deficiencies uncovering the dtrpA1 locus (Df(dtrpA1):
Df(3L)ED4415 and Df(3L)ED4416) were obtained from the Szeged stock center. p$
flies [21] were kindly provided by Craig Montell. pain2 flies [22] were kindly provided
by Dan Tracey.
Molecular genetics
Mutants were balanced over balancers with larval markers (TM6B, SM6:TM6bY
CyO-actinGFP or TM3-actinGFP). For d t r p ~ l " alleles generation, protocol described in
[24,43] was followed with minor exceptions. Briefly, the targeting construct was
generated by cloning BglI-KpnI dTRPAl genomic DNA fiagment fiom BAC RP98-10P9
(Open Biosystems) into pBluescriptI1. I-SceI site was inserted into BamHI site in exon 8
of dTRPA1, ClaI site in exon 4 was filled in to generate NruI site (the engineered
fiameshift mutation), and the construct was cloned into NotIIKpnI digested pTV2. The
targeting construct had 3.1kb homology fiom the 5' end to the I-SceI insertion and 2.2kb
of homology from the I-SceI site towards the 3' end and the Not1 site in pTV2 faced the
5' end of the truncated dTRPAl gene. The targeting construct was introduced into
Drosophila germline to generate donor flies. Two different donor insertions on the
second chromosome were used for targeting. 2-4 males homozygous for the donor
insertion were crossed to 3 w; h s ~ l ~ , h s - ~ - ~ c e virgins.
~ , ~ c 0-3
o / day
~ ~ old
,~~~
embryos/larvae were heat shocked once at 38OC for 65 5 minutes. 3 Non-CyO virgins
were crossed to 1-4 w; eyFlp males and 394 crosses were set up for each donor (788 total,
2364 females). 33 putative targeting events, judged by presence of colored eyed flies (at
least 27 independent), were recovered and analyzed. 17 events were recovered fiom one
donor and 16 from the other. PCR analysis revealed that three of the events were donors,
one a non-homologous insertion onto the second chromosome and 29 (24 independent)
appeared to be insertions into the dTRPAl locus. Primer sequences are available upon
request. Cre-out lines ( d t r p ~ l
were generated as described [25] and analyzed by
PCR and restriction digests to identify the lines containing the engineered frameshift, Ae6
and Ae8 mutations.
Histology
Rat polyclonal dTRPAl antiserum was used at 1:1000 as described [19]. Images
were obtained using a Nikon PCM2000 confocal microscope and Zeiss Axioplan2 with
Nikon DXM1200 camera.
Behavioral assays
Larvae for the behavioral assays were raised on molasses plates. Heat avoidance
themotaxis assays were performed as described [19]. Generally 140 late lSt/early2nd
instar larvae were harvested for each assay. Cold avoidance assays were similar to those
of [20], but with different temperatures and 1" instar larvae used instead of 3rdinstar
larvae assayed in [20]. 240 1St instar larvae were harvested for each cold assay, washed
in distilled water, dried, and placed in the release zone with a paint brush. Cold avoidance
assays were performed on 2% agarose (25 mL) in flat lids from 150 x 15 rnm Petri dish
plates (VWR 25384-139) placed so that the release zone (-4mm) was in the middle of the
intedace of a metal slide warmer (at room temperature) and a cold plate (AHP-301CP,
TECA corporation, USA) -14 mm apart. Cold generator surface was covered with thin
black plastic cut fiom 34.3 pm thick RNW 4050 trash bags (Office Depot) to ease the
scoring of animals on the cooled surface. Agarose surface was allowed to equilibrate for
at least one hour prior to each assay (covered by a glass slab to avoid temperature
dissipation). For each time point, the number of larvae that migrated out of the release
zone to the cooled side and to the not-cooled (RT) side was counted. The avoidance
index (AI) = (number of larvae on the RT side - number of larvae on cooled
side)/(number of larvae on the RT side + number of larvae on cooled side). Surface
temperatures were determined using a Fluke 5211 thermometer with dual K-type flat
surface probes (VWR). Larvae were washed in distilled water and lined up in the release
zone with a paint brush as described [19]. Plate was immediately covered with a glass
slab (t = 0) and a cardboard box was then placed over the setup so that the assay was
performed in the dark.
Odor avoidance assays were performed and scored as described [19,26]. Briefly
2.5 pL of undiluted n-octyl acetate (Sigma) or 1.5pL of undiluted Propionic acid (J.T.
Baker) was presented in microcentrifuge tube cap opposite an empty cap in a standard 90
mm plastic Petri dish with 10 ml2% agarose. 60 late lst/early2ndinstar larvae were
harvested for each assay. For larval phototaxis assays we used a 90 mm plastic Petri dish
with four lighvdark quadrants, as described [27], except clear 2% agarose was used and
the quadrants were generated using light-impermeable black electrical tape to cover two
quarters on the bottom of the dish. Light was applied from underneath the behavioral
plate by TW-26 transilluminator (VWR). The behavioral plate was raised -1 2.5 cm
above the light source to avoid heating of the plate. Cardboard box was placed over the
setup at the start of each assay to minimize the influence of the external light. Late
lSt/early2ndinstar larvae were assayed. For each time point, the number of larvae that
migrated out of the release zone to the stimulus zone (odor or light) and to the no
stimulus zone (control: no odor or dark) side was counted. The A1 for odor or light was
calculated. A1 = (number of larvae on the control side - number of larvae on stimulus
side)/(number of larvae on the control side + number of larvae on stimulus side). All
statistical comparisons used two-tailed unpaired t-test versus wild-type.
ACKNOWLEDGEMENTS
We thank members of the Garrity lab for helpful discussions, Craig Monte11 for
pyrexia mutants and Dan Tracey for painless mutants. M.R. was supported by the
Centocor fellowship, an NSF predoctoral grant and an NIH training grant. This research
was also supported by a grant fiom the NIH to Paul Garrity.
REFERENCES:
Patapoutian, A., et al., ThermoTRP channels and beyond: mechanisms of
temperature sensation. Nat Rev Neurosci, 2003.4(7): p. 529-39.
Montell, C., The TRP superfamily of cation channels. Sci STKEY2005.
2005(272):p. re3.
Caterina, M.J., et al., The capsaicin receptor: a heat-activated ion channel in the
pain pathway. Nature, 1997.389(6653):p. 8 16-24.
Caterina, M.J., et al., A capsaicin-receptor homologue with a high thresholdfor
noxious heat. Nature, 1999.398(6726):p. 436-4 1.
Peier, A.M., et al., A heat-sensitive TRP channel expressed in keratinocytes.
Science, 2002.296(5575): p. 2046-9.
Xu, H., et al., TRPV3 is a calcium-permeable temperature-sensitivecation
channel. Nature, 2002.418(6894): p. 181-6.
Smith, G.D., et al., TRPV3 is a temperature-sensitive vanifloid receptor-like
protein. Nature, 2002.418(6894): p. 186-90.
Guler, A.D., et al., Heat-evoked activation of the ion channel, TRPV4. J Neurosci,
2002.22(15):p. 6408-14.
Talavera, K., et al., Heat activation of TRPM.5 underlies thermal sensitivity of
sweet taste. Nature, 2005.438(7070): p. 1022-5.
Peier, A.M., et al., A TRP channel that senses cold stimuli and menthol. Cell,
2002. 108(5):p. 705-15.
McKemy, D.D., W.M. Neuhausser, and D. Julius, Identification of a cold receptor
reveals a general role for TRP channels in thermosensation. Nature, 2002.
416(6876):p. 52-8.
Story, G.M., et al., ANKTMI, a TRP-like channel expressed in nociceptive
neurons, is activated by cold temperatures. Cell, 2003.1 12(6):p. 8 1 9-29.
Bandell, M., et al., Noxious cold ion channel TRPAl is activated bypungent
compounds and bradykinin. Neuron, 2004.41(6): p. 849-57.
Caterina, M.J., et al., Impaired nociception andpain sensation in mice lacking the
capsaicin receptor. Science, 2000.288(5464): p. 306- 13.
Moqrich, A., et al., Impaired thermosensation in mice lacking TRPV3, a heat and
camphor sensor in the skin. Science, 2005.307(5714): p. 1468-72.
Lee, Heyet al., Altered thermal selection behavior in mice lacking transient
receptor potential vaniNoid 4. J Neurosci, 2005.25(5): p. 1304-10.
Kwan, K.Y., et al., TRPAl contributes to cold, mechanical, and chemical
nociception but Is not essentialfor hair-cell transduction. Neuron, 2006.50: p.
277-289.
Sayeed, 0. and S. Benzer, Behavioral genetics of thermosensation and
hygrosensation in Drosophila. Proc Natl Acad Sci U S A, 1996.93(12):p. 607984.
Rosenzweig, M., et al., The Drosophila ortholog of vertebrate TRPAl regulates
thermotaxis. Genes Dev, 2005.19(4): p. 419-24.
Liu, L., et al., Identification andfunction of thermosensory neurons in Drosophila
larvae. Nat Neurosci, 2003.6(3):p. 267-73.
Lee, Y., et al., Pyrexia is a new thermal transient receptor potential channel
endowing tolerance to high temperatures in Drosophila melanogaster. Nat Genet,
2005.37(3): p. 305-10.
Tracey, W.D., Jr., et al., painless, a Drosophila gene essentialfor nociception.
Cell, 2003.113(2): p. 261-73.
Viswanath, V., et al., Opposite thermosensor inpuitfly and mouse. Nature, 2003.
423(6942): p. 822-3.
Rong, Y.S. and K.G. Golic, Gene targeting by homologous recombination in
Drosophila. Science, 2000.288(5473):p. 20 13-8.
Rong, Y.S., et al., Targeted mutagenesis by homologous recombination in D.
melanogaster. Genes Dev, 2002. 16(12): p. 1568-81.
Heimbeck, G., et al., Smell and taste perception in Drosophila melanogaster
larva: toxin expression studies in chemosensory neurons. J Neurosci, 1 999.
19(15): p. 6599-609.
Lilly, M. and J. Carlson, smellblind: a gene required for Drosophila olfaction.
Genetics, 1990.124(2):p. 293-302.
Zars, T., Two thermosensors in Drosophila have dzfferent behavioralfunctions. J
Comp Physiol [A], 200 1. 187(3): p. 235-42.
Maingret, Feyet al., TREK-1 is a heat-activated background K(+) channel. Embo
J,2000.19(11): p. 2483-91.
Kang, D., C. Choe, and D. Kim, Thermosensitivityof the two-pore domain K+
channels TREK-2 and T W K . J Physiol, 2005.564(Pt 1): p. 103-16.
Shimizu, I., et al., Enhanced thermal avoidance in mice lacking the ATP receptor
P2X3. Pain, 2005.116(1-2): p. 96-108.
Souslova, V., et al., Warm-coding deJcits and aberrant inflammatorypain in
mice lacking P2X3 receptors. Nature, 2000.407(6807):p. 1015-7.
Askwith, C.C., et al., DEGIENaC ion channels involved in sensory transduction
are modulated by cold temperature. Roc Natl Acad Sci U S A, 2001.98(11): p.
6459-63.
Van Der Stelt, M. and V. Di Marzo, Endovanilloids. Putative endogenous ligands
of transient receptor potential vanifloid 1 channels. Eur J Biochem, 2004.
271(10): p. 1827-34.
De Petrocellis, L. and V. Di Marzo, Lipids as regulators of the activity of
transient receptor potential type Vl (TRPVI) channels. Life Sci, 2005. 77(14): p.
165 1-66.
Nilius, B., et al., The Ca2+-activated cation channel TRPM4 is regulated by
phosphatidylinositol4,5-biphosphate.Embo J, 2006.25(3): p. 467-78.
Nilius, Be, et al., Regulation of the Ca2+ sensitivity of the nonselective cation
channel TRPM4.T. Biol Chem, 2005.280(8): p. 6423-33.
Rohacs, T., et al., PI(4,5)P2 regulates the activation and desensitization of
TRPM8 channels through the TRP domain. Nat Neurosci, 2005. 8(5): p. 626-34.
Bhave, G., et al., CAMP-dependent protein kinase regulates desensitization of the
capsaicin receptor (VRl) by direct phosphorylation. Neuron, 2002.35(4): p. 72 13 1.
Nilius, B., et al., Gating of TRP channels: a voltage connection? J Physiol, 2005.
567(Pt 1): p. 35-44.
41 .
42.
43.
Voets, T., et al., The principle of temperature-dependent gating in cold- and heatsensitive TRP channels. Nature, 2004.430(7001): p. 748-54.
Liman, E.R., Thermal gating of TRP ion channels:food for thought? Sci STKE,
2006.2006(326):p. pe12.
Sears, H.C., C.J. Kennedy, and P.A. Gmity,Macrophage-mediated corpse
engdjhent is requiredfor normal Drosophila C .morphogenesis. Development,
2003.130(15):p. 3557-65.
CONCLUSIONS AND FUTURE DIRECTIONS.
We have identified dTRPAl as an important mediator of thennotaxis in
Drosophila. Both the larvae in which dTRPAl expression was knocked down with RNA
interference (RNAi) and the dtrpAl loss of function mutants were strongly defective for
avoiding elevated temperatures (-3 1°C--3S°C). Furthermore, dtrpA1 mutants were also
defective for avoiding cold temperature environments. These findings raise an exciting
possibility that dTRPAl may be mediating thennosensory responses to both elevated and
cold temperatures.
For proper execution of a thermotactic behavior an animal must sense the
temperature stimulus and then properly translate the temperature sensation into a
behavioral response. dTRPAl has been demonstrated to be a warm temperatureactivated ion channel in heterologous cells [I]. This suggests that dTRPAl might control
thennotactic behavior at elevated temperatures by functioning as a sensor of elevated
temperatures. Viswanath, et al., [I] did not observe cold activation of dTRPA1, but that
certainly doesn't rule out a possibility that dTRPAl can be activated by cold
temperatures. Thus, cold-responsiveness of dTRPAl will be re-examined in cultured
cells. It is possible that dTRPAl controls thermotactic responses to both elevated
temperatures and to cold by directly sensing temperature. Alternatively, dTRPAl might
mediate cold-avoidance behavior by acting at a step downstream of the initial
temperature sensation step.
An important direction for the fbture is to investigate whether dTRPAl functions
as a temperature sensor for heat and/or cold in vivo. This may be accomplished by
performing electrophysiological recordings from the neurons that require dTRPAl for
thermotactic behavior in response to elevated temperatures andlor to cold. If dTRPA
mediates thermotaxis by acting as a thermal sensor, warming or cooling larval brain
might induce detectable changes in those neurons in the dTRPAl -dependent manner.
While larval neurons may be too small to be a good target for direct electrophysiological
recordings, it may be possible to perform these recordings in adults. However, while
these experiments might be extremely informative, prior to these experiments we must
identify the cells that mediate thermotaxis at cold temperatures and determine whether
dTRPAl functions in those cells to mediate thermotaxis at cold temperatures.
It will be also interesting to examine adult behavior of dtrpAl mutants. Adults
can tolerate exposure to higher temperatures than the larvae, and thus in addition to
potentially gaining a model system for physiological recordings, we might be able to
more thoroughly examine the contributions different TRP channels make for
thermosensation in the same assay. In our larval thermotaxis assay, we can't assess
thermotaxis at temperatures much higher than we are currently using because the larvae
rapidly die [2]. Therefore, to test whether a molecule mediates temperature sensation
andlor thermosensory behavior at higher temperatures than we can achieve in our assay,
we have to resort to different behavioral assays, such as a high-temperature (38OC-52OC)
nociceptive stimulus [3]. For instance, we used a high-temperature nociception paradigm
together with our lower temperature thermotaxis assay to test whether dTRPAl was
required for responses to higher temperatures than we could achieve in our assay [2].
Adult choice test [4] and adult thermal gradient assays [4,5] should allow us to compare
mutants' behavior at different temperatures while using the same behavioral paradigm.
In the larvae, dTRPAl is expressed in restricted populations of cells. We have
previously implicated one of these cell populations, dTRPAl -expressing cells in the
central brain, in mediating larval responses for avoidance of elevated temperatures. The
contribution of other dTRPAl -expressing cell populations is unknown and will need to
be investigated in the fbture.
Other important fbture directions include elucidating the dTRPAl thermosensory
circuit. To what cells do dTRPAl -expressing cells project to mediate thennotactic
behavior? In the case for thennotaxis at elevated temperatures, the dTRPAl -expressing
cells in the central brain, that are required for thermotaxis at high temperatures, appear to
project to the Kenyon cells of the mushroom body (Fig. 1). The mushroom body is
thought to be the fly's learning center, but it appears to be dispensable for learning assays
other than for the olfactory associated learning [6]. We ablated the mushroom bodies by
expressing cell-death inducing genes in the mushroom body neurons. And while the
mushroom body neurons in those larvae were undetectable, the afflicted larvae were still
able to therrnotax away fiom the heated area (although they were significantly
developmentally delayed and exhibited considerable delay in moving out of the release
zone) (data not shown). It is possible that instead of projecting to the mushroom body
neurons, dTRPAl -expressing cells instead make contacts with other neurons in the
vicinity of the Kenyon cells. Alternatively, it is possible that other groups of cells
transduce the signal from the dTRPAl -expressing cells in parallel with the mushroom
body neurons. It is interesting to note that temperature can be used as a reinforcer in fly
learning assays [7]. It will thus be very interesting to determine whether dTRPAl plays a
role in regulating temperature-mediated learning.
Figure 1. dTRPAl -expressing neurons project to the mushroom body. (A-C) dTRPAl
antibody specifically stains Corpus Cardiaca neurons (*) and a few central brain neurons
(brackets and arrowhead). (DOE) dTRPAl-expressing cells in the central brain appear to
project towards the Kenyon cells of the mushroom bodies (expressing OK107-Gal4
driving UAS-GFP). Images courtesy of Tim Tayler.
Figure 1.
Activation of thermoTRPs by temperature can be modulated by other intracellular
factors such as phospholipids, phosphorylationlde-phosphorylation,ca2+and membrane
potential. What are the factors that control dTRPAl activity? Viswanath, et al., [I]
reported that dTRPAl warming-evoked currents are outwardly rectifying, indicating that
dTRPAl may be modulated by membrane potential. Other regulators of dTRPAl,
however, are currently unknown. Since TRP channels are known to oligomerize [8], we
attempted to determine whether any other Drosophila TRPs might function together with
dTRPAl to mediate thermotaxis. We used RNAi to inhibit the other Drosophila TRP
subfamilies. We injected double stranded RNA (dsRNA) targeting the members of the
TRPA, TRPV, TRPM, TRPP, TRPN (NompC) and TRPML subfamilies. No dsRNAs
except for those targeting dTRPAl yielded thermotaxis phenotypes ([2] and data not
shown). RNAi-mediated targeting the members of the TRPC subfamily (TRP, TRP-like
and TRP-y), however, has not yet been done. In the fbture, the lab will conduct genetic
screens for thermotaxis mutants. These screens should yield regulators of dTRPAl
activity, other molecules required for temperature sensation in flies, and genes necessary
for the development and k c t i o n of the thermosensory circuit. Such screens could be
done for regulators of both thermotactic behavior at elevated temperatures and for
regulators of thermotaxis at cold temperatures. Other potentially useful screens that
might facilitate identification of other regulators of themotaxis can take advantage of the
partial thermotaxis defects exhibited by &pAl mutant animals at moderately cold
temperatures. Thus, it might be possible to conduct enhancer/suppressor screens
searching for modifiers of the partial dtrpAl mutant phenotype and such screens may
identify different molecules than would be identified by screens in a wild-type
background.
In conclusion, this thesis represents the first molecular analysis of thermotaxis
behavior in Drosophila. We have implicated a putative temperature sensor, dTRPA1, in
mediating larval behavioral responses to both elevated and cold temperatures. We have
also identified dTRPAl-expressing cells and implicated a subset of these cells in
mediating thermotactic behavior at elevated temperatures. Finally, our analysis of dtrpA1
and painless mutant animals, as well as of the cells in which they are required for
mediating the behavioral paradigms they were identified in, suggest that similar to
mammals, Drosophila utilizes different neurons and different molecules for mediating
different thennosensory responses.
REFERENCES.
Viswanath, V., et al., Opposite thermosensor i n h i t f l y and mouse. Nature, 2003.
423(6942): p. 822-3.
Rosenzweig, M., et al., The Drosophila ortholog of vertebrate TRPAI regulates
thermotaxis. Genes Dev, 2005.19(4): p. 4 19-24.
Tracey,W.D., Jr., et al., painless, a Drosophila gene essentialfor nociception.
Cell, 2003. 113(2): p. 261-73.
Sayeed, 0. and S. Benzer, Behavioral genetics of thermosensation and
hygrosensation in Drosophila. Proc Natl Acad Sci U S A, 1996.93(12): p. 607984.
Lee, Y., et al., Pyrexia is a new thermal transient receptor potential channel
endowing tolerance to high temperatures in Drosophila melanogaster. Nat Genet,
2005.37(3): p. 305-10.
Wolf, R., et al., Drosophila mushroom bodies are dispensablefor visual, tactile,
and motor learning. Learn Mem, 1998.5(1-2): p. 166-78.
Wustmann, G., et al., A new paradigm for operant conditioning of Drosophila
melanogaster. J Comp Physiol [A], 1996. 179(3): p. 429-36.
Schaefer, M., Homo- and heteromeric assembly of TRP channel subunits.
Pflugers Arch, 2005.451(1): p. 35-42.
ACKNOWLEDGEMENTS.
I would like to thank my advisor, Paul Garrity, for everything he has done to help
me to become a better scientist, for all his help, advise and guidance. I would also like to
thank my thesis committee members, Bob Horvitz, Terry Orr-Weaver and Chip Quinn for
truly helpful discussions and much encouragement. Furthermore, I'd like to thank my
family, friends and colleagues for their unwavering support. I further thank Karen
Brennan, Paul Phelps and Caitlin Rex for technical assistance with this project, Betsey
Walsh and Hilda Harris-Ransom for being there with answers to pretty much any
administrative questions, Jessica Whited for making the lab life much more entertaining
and for all the goods she baked for the lab over the years, Sunny Wong, Mandy Tarn and
Anna and Sujith Vijayen for being there for me over the years. Special
acknowledgements go to the NSF, NIH and the Centocor foundation for supporting this
research. And thank you for reading this to the end.