Chapter 20: DNA Technology Genetic Engineering Manipulation of DNA Recombinant DNA DNA from two different sources Biotechnology Manipulation of organisms to make useful products AP Biology http://highered.mcgrawhill.com/sites/0072556781/student_view0/chapte r14/animation_quiz_6.html How can plasmids help us? A way to get genes into bacteria easily insert new gene into plasmid (recombinant DNA) insert plasmid into bacteria = vector bacteria now expresses new gene Production of many copies of inserted gene transformed bacteria make “new” protein gene from other organism cut DNA plasmid AP Biology recombinant plasmid + vector glue DNA bacteria Grow bacteria…make clones gene from other organism recombinant plasmid + vector plasmid grow bacteria harvest (purify) protein AP Biology transformed bacteria Bacterium Cell containing gene of interest 1 Gene inserted into plasmid Overview of gene cloning with a bacterial plasmid, showing various uses of cloned genes Figure 20.2 AP Biology Plasmid Bacterial chromosome Gene of interest DNA of chromosome Recombinant DNA (plasmid) Recombinate bacterium 2 Plasmid put into bacterial cell Gene of interest Protein expressed by gene of interest Copies of gene Basic research on gene Gene for pest resistance inserted into plants 3 Host cell grown in culture, 3 form a clone of cells to containing the “cloned” gene of interest Protein harvested Basic research on protein 4 Basic research and various applications Gene used to alter bacteria for cleaning up toxic waste Protein dissolves blood clots in heart attack therapy Human growth hormone treats stunted growth cut DNA at specific sequences CTGAATTCCG restriction site GACTTAAGGC Restriction enzymes Action of enzyme produces restriction fragments produces protruding ends sticky ends CTG|AATTCCG GACTTAA|GGC will bind to any complementary DNA DNA ligase is an enzyme Seals the bonds between restriction fragments AP Biology Restriction enzymes Cut DNA at specific sites leave “sticky ends” restriction enzyme cut site GTAACGAATTCACGCTT CATTGCTTAAGTGCGAA restriction enzyme cut site GTAACG AATTCACGCTT CATTGCTTAA GTGCGAA AP Biology Sticky ends Cut other DNA with same enzymes leave “sticky ends” on both can glue DNA together at “sticky ends” GTAACG AATTCACGCTT CATTGCTTAA GTGCGAA AP Biology gene you want GGACCTG AATTCCGGATA CCTGGACTTAA GGCCTAT chromosome want to add gene to GGACCTG AATTCACGCTT CCTGGACTTAA GTGCGAA combined DNA Sticky ends help glue genes together cut sites gene you want cut sites TTGTAACGAATTCTACGAATGGTTACATCGCCGAATTCACGCTT AACATTGCTTAAGATGCTTACCAATGTAGCGGCTTAAGTGCGAA sticky ends AATTCTACGAATGGTTACATCGCCG GATGCTTACCAATGTAGCGGCTTAA isolated gene cut sites AATTCTACGATCGCCGATTCAACGCTT chromosome want to add gene to AATGGTTACTTGTAACG TTACCAATGAACATTGCTTAA GATGCTAGCGGCTAAGTTGCGAA DNA ligase joins the strands sticky ends stick together AP Biology Recombinant DNA molecule chromosome with new gene added TAACGAATTCTACGAATGGTTACATCGCCGAATTCTACGATC CATTGCTTAAGATGCTTACCAATGTAGCGGCTTAAGATGCTAGC Many uses of restriction enzymes… Now that we can cut DNA with restriction enzymes… we can cut up DNA from different people… or different organisms… and compare it why? forensics medical diagnostics paternity evolutionary relationships and more… AP Biology Uses of genetic engineering Genetically modified organisms (GMO) enabling plants to produce new proteins Protect crops from insects: BT corn corn produces a bacterial toxin that kills corn borer (caterpillar pest of corn) Extend growing season: fishberries strawberries with an anti-freezing gene from flounder Improve quality of food: golden rice rice producing vitamin A improves nutritional value AP Biology Jelly fish “GFP” AP Biology Transformed vertebrates Copy DNA without plasmids? PCR! Polymerase Chain Reaction method for making many, many copies of a specific segment of DNA What do you need? template strand DNA polymerase enzyme nucleotides ATP, GTP, CTP, TTP AP Biology primer PCR process What do you need to do? in tube: DNA, DNA polymerase enzyme, primer, nucleotides denature DNA: heat (90°C) DNA to separate strands anneal DNA: cool to hybridize with primers (H-bonds) & build DNA 5’3’ (extension) What does 90°C do to our DNA polymerase? AP Biology play DNAi movie The polymerase problem Heat DNA to denature (unwind) it 90°C destroys DNA polymerase have to add new enzyme every cycle almost impractical! Need enzyme that can withstand 90°C… Taq polymerase from hot springs bacteria Thermus aquaticus AP Biology Comparing cut up DNA How do we compare DNA fragments? separate fragments by size How do we separate DNA fragments? run it through a gelatin agarose made from algae AP Biology gel electrophoresis Gel electrophoresis A method of separating DNA in a gelatin-like material using an electrical field DNA is negatively charged when it’s in an electrical field it moves toward the positive side – AP Biology DNA + “swimming through Jello” Gel electrophoresis DNA moves in an electrical field… so how does that help you compare DNA fragments? size of DNA fragment affects how far it travels small pieces travel farther large pieces travel slower & lag behind – DNA + “swimming through Jello” AP Biology fragments of DNA separate out based on size Running a gel cut DNA with restriction enzymes 1 2 Stain DNA AP Biology ethidium bromide binds to DNA fluoresces under UV light 3 Uses: Evolutionary relationships Comparing DNA samples from different organisms to measure evolutionary relationships turtle snake rat squirrel fruitfly – DNA + AP Biology 1 2 3 4 5 1 2 3 4 5 Uses: Medical diagnostic Comparing normal allele to disease allele chromosome with normal allele 1 chromosome with disease-causing allele 2 – DNA Example: test for Huntington’s disease + AP Biology Uses: Forensics Comparing DNA sample from crime scene with suspects & victim suspects S1 S2 S3 crime scene V sample – DNA AP Biology + Differences at the DNA level Why is each person’s DNA pattern different? sections of “junk” DNA doesn’t code for proteins made up of repeated patterns CAT, GCC, and others each person may have different number of repeats many sites on our 23 chromosomes with different repeat patterns GCTTGTAACGGCCTCATCATCATTCGCCGGCCTACGCTT CGAACATTGCCGGAGTAGTAGTAAGCGGCCGGATGCGAA GCTTGTAACGGCATCATCATCATCATCATCCGGCCTACGCTT AP Biology CGAACATTGCCGTAGTAGTAGTAGTAGTAGGCCGGATGCGAA Human Genome Project On June 26, 2001, HGP published the “working draft” of the DNA sequence of the human genome. Historic Event! blueprint of a human the potential to change science & medicine AP Biology TACGCACATTTACGTACGCGGATGCCGCGACTATGATC ACATAGACATGCTGTCAGCTCTAGTAGACTAGCTGACT human genome (2003) CGACTAGCATGATCGATCAGCTACATGCTAGCACACYC GTACATCGATCCTGACATCGACCTGCTCGTACATGCTA 3.2 billion bases CTAGCTACTGACTCATGATCCAGATCACTGAAACCCTA GATCGGGTACCTATTACAGTACGATCATCCGATCAGAT CATGCTAGTACATCGATCGATACTGCTACTGATCTAGC TCAATCAAACTCTTTTTGCATCATGATACTAGACTAGC TGACTGATCATGACTCTGATCCCGTAGATCGGGTACCT ATTACAGTACGATCATCCGATCAGATCATGCTAGTACA TCGATCGATACTGCTACTGATCTAGCTCAATCAAACTC TTTTTGCATCATGATACTAGACTAGCTGACTGATCATG ACTCTGATCCCGTAGATCGGGTACCTATTACAGTACGA TCATCCGATCAGATCATGCTAGTACATCGATCGATACT AP Biology Advancements to sequencing Fluorescent tagging sequence data Computer read & analyzed AP Biology An alternative approach to sequencing whole genomes starts with the sequencing of random DNA fragments Powerful computer programs would then assemble the resulting very large number of overlapping short sequences into a single continuous sequence AP Biology