Biology
End of Quarter 3 Quiz
Name_______Key__________
Consider the following Diagram of DNA replication:
1. What function does the structure labeled 1 do?
DNA Helicase- Unwind and untwist DNA
2. What role does the structure labeled 4 serve in DNA replication?
RNA Primer-Allow for DNA nucleotides to be added for the new strand of DNA
3. What role does the structure labeled 2 serve in DNA replication?
DNA polymerase- Adds DNA nucleotides to growing DNA strand
4. The structure labeled 5 is most likely:
a. Adding new DNA nucleotides
b. Connecting the DNA fragments
c. Unwinding the DNA
d. Making hydrogen bond to connect the bases of DNA
5. Chromatin is best described as:
a. Condensed Chromosomes that appear in prophase
b. Sister chromatids that are outside of the nucleus
c. A condensed form of RNA wrapped around proteins
d. A condensed form of DNA wrapped around proteins
6. The percent of cytosine in a double-stranded DNA is 21. What is the percent of
thymine in that DNA?
a. 21%
b. 58%
c. 42%
d. 29%
e. The correct answer is not shown
7. Okazaki fragments are used to elongate:
a. The leading strand toward the replication fork
b. The lagging strand toward the replication fork
c. Both strands in both directions
d. The leading strand away from the replication fork
e. The lagging strand away from the replication fork
8. Consider the DNA strand:
a. Write the complimentary DNA strand.
b. Be sure to correctly label the 3’ and 5’ ends on the original strand and the new strand.
5’AGCCCTTTACGTAAAGGGGGCGCGTAATATAATGCGCGCAGAG3’
3’TCGGGAAATGCATTTCCCCCGCGCATTATATTACGCGCGTCTC5’
9. During interphase, what form is DNA in?
a. Chromosomes
b. There is no DNA during interphase
c. Chromatin
d. Chromatids
10. Consider the following diagram:
What is Y? SUGAR RING
What is Z? PHOSPHATE GROUP
W and X are most likely which bases? G&C
Please circle an entire nucleotide.
11. An isotope is best described as:
a. An atom that loses or gains an ion
b. An atom that loses or gains a proton
c. An atom that loses or gains a neutron
d. An atom that loses or gains an electron
12. Radioactivity refers to:
a. A ion that has an unstable electron shell and emits energy
b. An atom that has a stable nucleus and emits energy
c. An ion that has an a stable electron shell, but periodically emits radiation
d. An atom that has an unstable nucleus and emits energy
13. In replication of DNA, the helix is opened and untwisted by
a. DNA ligase
b. b. DNA deoxase
c. c. DNA helicase
d. d. DNA polymerase
14. Where does DNA replication take place?
a. Ribosomes of the cytoplasm
b. Ribosomes of the er
c. Nucleus
d. Just the cytoplasm
15. Please describe the difference between the lagging and leading strands.
The lagging strand is made discontinuously and ends up with Okazaki fragments that need to
eventually be connected by ligase. The lagging strand is synthesized away from the fork.
The leading strand is made continuously toward the replication fork.
16. Describe why cylins and cdk’s might be good potential drug targets for cancer.