Genetics Laboratory Study Questions.
1. Please name and describe two different classes of mutagens. Which of these
did we mutagenize yeast with?
2. Upon exposing yeast to UV irradiation, we ran both control plates that were
not exposed as well as plates that were exposed to UV irradiation. What was
the purpose of the controls? Compared to the controls, would you expect to
see more or less yeast on the irradiated plates? Why?
3. When doing a bacterial transformation, please explain the purpose of the
following steps.
a. Incubating your reaction on ice for 20-30 minutes
b. Incubating your reaction at 37 C for 1 minute
c. Incubating your bacterial cells in LB at 37 C for 30 minutes to 1 hour
4. When doing a yeast transformation, please explain the purpose of the
following steps.
a. Incubating your reaction at room temperature for 20-30 minutes
b. Incubating reaction at 42 C for 25 minutes
5. Please explain why we plate our bacterial transformations of LB plates
containing ampicillin?
6. Please explain why we plate our yeast transformations on plates lacking
uracil (-ura plates).
7. When doing transformations, we used plasmid DNA. What is the purpose of
the amp resistance gene on the bacterial plasmid? What is the purpose of the
ura gene on the yeast plasmid?
8. Pls. explain why one would see the following results following bacterial
transformation.
a. Control transformation (no DNA): 156 colonies on LB plates
b. Transformation (containing plasmid DNA): 158 colonies on LB plates
9. Which type of cells were used for isolating DNA? How were these cells
obtained?
10. When isolating cheek cell DNA, please explain the function of each of the
following reagents?
a. Cold Isopropanol
b. lysis buffer
c. protease
d. water
11. When doing DNA isolation, please explain how you were able to visualize
your DNA? What did your DNA look like?
12. Please explain the purpose of the following reagents in a PCR reaction?
a. Primers
b. Nucleotides
c. Taq DNA polymerase
d Template DNA
e. Taq Buffer
13. What is the purpose of doing a PCR reaction?
14. Please state the purpose of each of these steps in the PCR reaction.
a. 95 C for 45 sec
b. 55-60 C for 45 sec
c. 72 C for 1 minute
d. Repeating the above steps for 30 cycles
15. What is the purpose of running an agarose gel?
16. Pls. briefly explain why we stain our gels with ethidium bromide.
17. If you are making a 40 ml gel of 1% agarose, how much agarose will you
weigh out?
18. Be sure to know how to use a standard curve to figure out band sizes.
19. Below is a sequence with an EcoRI site, please diagram the products you
will get if you cut with EcoRI.
5’ AAACCCGGGTTTGAATTCCTGGTCAGTTGCAGT 3’
3’ TTTGGGCCCAAACTTAAGGACCAGTCAACGTCA 5’
20. Please write out the recognition sequence for PstI and HindIII. (Be sure it
is double stranded. After writing out the sequence, please note the axis of
symmetry, as well as where the enzyme cuts (be careful, your site is double
stranded). When you study each strand of the recognition sequence for one of
the given enzymes, what do you notice?
21. You are studying gene X in three individuals by RFLP. Gene X is 1000 base
pairs long. For gene X, there are three different variations in that one can
have. The first variation has no EcoRI site. The second variation has EcoRI
sites at base pairs 200 and 300. The third variation has EcoRI sites at base
pairs 100, 200 and 500. For each of the individuals below, what will you see
on the gel after cutting each patient’s gene X with EcoRI.
Individual 1 has two copies of gene X, both copies are of variation 1
Individual 2 has two copies of gene X, 1 copy of variation 1 and 1 copy of
variation 2
Individual 3 has two copies of gene X, 1 copy of variation 1 and 1 copy of
variation 3