Human cells
Studies with human cells were performed after obtaining informed consent from the participants
and were approved by the University of Michigan Medical School Institutional Review Board.
Peripheral blood from healthy volunteers was used to isolate DCs and T cells17 by sedimentation
using the Ficoll-Hypaque technique (Pharmacia Biotech, Piscataway, NJ). Immature DCs were
prepared from the T-cell−depleted fraction by culturing cells in the presence of GM-CSF (1,000
U/ml) and IL-4 (500 U/ml) (PeproTech Inc., Rocky Hill, NJ) for 7 days. T-cell−enriched fraction
was processed for autoMACS separation after incubation with CD 90 microbeads to obtain T
cells with 95% purity. Cryopreserved adult dermal microvascular endothelial cells (HMVEC-D,
Cat.No.CC-2543) were cultured in Clonetics Endothelial Cell Basal Medium-2 supplemented
with EGM-2-MV growth factors (Cambrex Corp, Walkersville, MD Cat.No.CC-3202). Adult
skin fibroblasts were purchased from ATCC (Cat. No. CRL-1836) and grown in DMEM
supplemented with 10% FCS. Breast cancer cell line MCF7 and prostate cancer cell line PC-3
were maintained in Eagle's Minimum Essential Medium and F-12K Medium complemented with
10% FBS.
Exiqon microRNA arrays
Microarray experiments were conducted as double-channel Hy3/Hy5 in duplicate on Exiqon's
miRCURY™ LNA microRNA Array, v.10.0 (Exiqon Inc, Woburn, MA). The miRNeasy Mini
Kit (Qiagen) was used to purify total RNA, including miRNA and other small RNA molecules
from mouse DCs. RNA and spike-in miRNA were treated with CIP then mixed for labeling
using Exiqon miRCURY LNA microRNA Array Power Labeling kit. The denatured labeled
samples were hybridized to microRNA Array platforms at 56°C for 16 hours using an Agilent
SureHyb hybridization chamber and gasket slide followed by use of a stringency wash protocol.
Platforms were scanned using a GenePix 4000 microarray scanner. The images were captured
and analyzed by GAL-file (Exiqon Inc, Woburn, MA) which covers miRNA ID annotated by
version 10.0 of miRBase (http://microrna.sanger.ac.uk).18,19
Affymatrix microarrays
Mouse DCs were left untreated or treated with LPS (500 ng/ml) for 12 hours, tcRNA were
extracted with TRIzol reagent and cleaned over Qiagen RNeasy columns (Qiagen, Chatsworth,
CA). Cleaned tcRNA from each sample was reversed transcribed using Superscript Choice
System (Invitrogen) and T7-(dT)24 primer. Synthesis and labeling of cRNA and hybridization of
arrays was conducted as described previously.20 Stained arrays (430 2.0) were scanned on an
Agilent Gene Array Scanner (Affymetrix).
MicroRNA prediction tools
To identify miRNAs targeting IL-6, we integrated the output results of multiple prediction
programs; Miranda (http://www.microrna.org/microrna/), MicroCosm Targets
(http://microrna.sanger.ac.uk), and PITA TOP
[http://genie.weizmann.ac.il/pubs/miR07/miR07_data.html].18,21,22 Miranda computes optimal
sequence complementarity between a set of mature miRNAs and a given mRNA using a
weighted dynamic programming algorithm. MicroCosm Targets defines sets of conserved and
non-conserved human, mouse, and rat pre-miRNAs using bidirectional BLAST and synteny
analysis. PITA TOP emphasizes the role of target-site accessibility. We imported the various
output formats from each of the target prediction programs, and identified the miRNAs that are
expressed in DCs, and subsequently integrated the results to find common overlaps. The
candidate miRNAs were sorted based on the predefined rankings from each respective program.
Plasmid reporters, oligonucleotides, and transfection
psiCHECK-2 vector, a dual-luciferase plasmid containing both firefly luciferase gene and
Renilla luciferase gene, was obtained from Promega (Catalog No. C8021). miRNA target
sequences (Fig. 2A) were inserted between the XhoI–Not I restriction sites in the multiple
cloning region in the 3′UTR of the hRluc gene. Cleavage target sites are reverse complements of
their respective predicted mature miRNAs. The fragments of IL-6 3′UTR were cloned from the
mouse small intestine DNA library by PCR using specific primer pairs (Table S7) The reporter
constructs were transfected into DCs using N-[1-(2,3-dioleoyloxy)propyl]-N,N,Ntrimethylammonium methyl sulfate, DOTAP) as described previously.17 After 24 or 48 hours of
transfection, cells were left untreated or treated with 500 ng/ml LPS for the indicated time. Cells
were harvested and processed with Dual–Luciferase Reporter Assay Reagents (Promega)
according to the technical manual and the plates were read with the GloMax®-96 Microplate
Luminometer (Promega). LNA-modified knockdown probes for miR-142-3p, miR-223, and the
non-specific scrambled control were purchased from Exiqon and Pre–miR-142 and scramblepre-miR from Ambion (Applied Biosystem/Ambion, Austin TX), and transfected into DCs using
DOTAP. LNA-modified in vivo knockdown anti-miRs for miR-142-3p and scrambled control
were purchased from Exiqon, and delivered by IP administration (Table S7).
MicroRNA and mRNA quantitative real-time PCR assays
For miRNA quantitative PCR, total RNA including small RNA was isolated using miRNeasy
Mini Kit (Qiagen) from mouse DCs (including CD11c+DCs that were treated with diluent or
with LPS 500 ng/ml, for 12 hours), CD11c+/CD8+ DCs, and CD11c+/CD8− DCs, mouse
splenocytes treated with in vivo scramble or knockdown probes, CD11c+ DCs (from spleen or
lymphoid nodes), T cells, B cells, kidney, and brain tissues), and human samples (including DCs,
T cells, endothelial cells, fibroblast cells, and MCF7 and PC3 cells). RT was processed using10
ng RNA, 0.15 µl 100 mM dNTPs, 1.00 µl MultiScribe™ Reverse Transcriptase (50 U/µl), 1.50
µl 10× RT Buffer, 0.188 µl RNase Inhibitor (20 U/µl), 4.2 µl nuclease-free water, 3 µl 5×
specific RT primers for miR142-3p, miR-142-5p, miR-155, miR-223, miR-7a, miR-27a, miR744, miR-668, miR-720, miR-146a and miR-146b and snoRNA135 (Applied Biosystems, Foster
City, CA) respectively and incubated at 16°C for 30 minutes, 42°C for 30minutes and 85°C for 5
minutes. Q-PCR was performed on an Eppendorf Mastercycler® RealPlex2 (Eppendorf,
Westbury, NY) and programmed as 95°C for 10 minutes, 40 cycles of 95°C for 15 seconds and
60°C for 60 seconds. Each PCR reaction mix contained 10 µl of TaqMan 2× Universal PCR
Master Mix (No AmpErase UNG), 7.67 µl nuclease-free water, 1.33 µl RT product, and 1 µl 20×
specific PCR primers for miR142-3p, miR-142-5p, miR-223, miR-7a, miR-27a, miR-744, miR668, miR-720, and snoRNA135 (Applied Biosystems, Foster City, CA) respectively. All samples
were triplicated and snoRNA135 was used to normalize the expression levels of target miRNA
by correcting differences in the amount of RNA loaded into qPCR reactions. Threshold levels for
each experiment were set during the exponential phase of the reaction. For mRNA Q-PCR, total
RNA was isolated using TRIzol reagent (Invitrogen) from DCs that were transfected with
knockdown or scrambled probes, or with pre-miRNA or scrambled–pre-miR, and spleens that
were treated with in vivo knockdown or scrambled control plus LPS (35 mg/kg for 2 hr, IP) or
diluent. Q-PCR was performed using SYBR Green dye. Briefly, 2 μg of total RNA was reverse
transcribed into cDNA using SuperScript® III (Invitrogen, Carlsbad, CA) in the presence of
random hexamers (Invitrogen). All reactions were performed in triplicate with SYBR Green
PCR Master Mix (Applied Biosystems) plus 25 ng of both the forward and reverse primer
according to the manufacturer’s recommended thermocycling conditions, and then subjected to
melt curve analysis. Threshold levels for each experiment were set during the exponential phase
of the reaction. The DNA in each sample was quantified by interpolation of its threshold cycle
(Ct) value from a standard curve of Ct values. The calculated quantity of the target gene for each
sample was divided by the average sample quantity of the housekeeping genes, glyceraldehyde3-phosphate dehydrogenase (GAPDH) to obtain the relative gene expression. All oligonucleotide
primers were synthesized by Integrated DNA Technologies (Coralville, IA). The primer
sequences are provided in Table S7.
Cytokine ELISAs
Concentrations of TNF-α, IL-12, IL-6, and IL-10 were measured in culture supernatants or
mouse sera by enzyme-linked immunosorbent assay (ELISA) with specific anti-mouse mAb for
capture and detection. The appropriate standards were purchased from BD Systems (TNF-α and
IL-6) or BD OptEIA™ (IL-12p70 and IL-10). Assays were performed according to the
manufacturer's protocol and read at 450 nm using a microplate reader (Bio-Rad).17
Mixed lymphocyte cultures
Splenic T cells from naive B6 or BALB/c mice or CD11c+ DC derived B6 mice bone marrow
were isolated by autoMACS using CD90.2 or CD11c microbeads . DCs were transfected with 50
nm miR-142-3p-LNA KD or scramble control probes using DOTAP as described above. After
24 hours of transfection, a total of 2 × 105 BALB/c or B6 T cells were cultured with 5 × 103
transfected B6 DCs for 96 hours. Incorporation of 3H-thymidine (1 µCi/well) by proliferating T
cells during the final 18 hours of culture was measured by a Betaplate reader.
Immunoblot analyses
Post 48 hours of transfection, cells lysates were prepared and proteinase inhibitor mixture was
added (Roche, Indianapolis, IN). 50 µg of each protein extract was boiled in sample buffer,
separated by SDS-PAGE, and transferred onto polyvinylidene difluoride (PVDF) membrane (GE
Healthcare, Piscataway, NJ). The membrane was incubated for 30 min with 5% nonfat dry milk
and incubated overnight at 4°C with the following: anti-TGFBR1 rabbit polyclonal (1:250,
ABGENT, San Diego, CA), anti-PCAF mouse monoclonal (1:100, Santa Cruz, CA), anti-TIRAP
rabbit polyclonal (1:250, IMGENEX, San Diego, CA), anti-IRAK1 rabbit polyclonal antibodies
(1:500, Proteintech Group, Inc., Chicago, IL), and anti-actin mouse monoclonal antibody
(1:1000, Abcam). Following a wash with TBS-T, the blot was incubated with horseradish
peroxidase-conjugated secondary antibody and the signals visualized by an enhanced
chemiluminescence system (Thermo Scientific, Rockford IL).
Table S6. PCR primer pairs, knockdown probes and pre‐miR
Primer pairs for quantitative PCR
TGFBR1: Sense 5’-ggaccattgtgttacaagaaagc-3’ Antisense 5’-Ccatgctcatgataatctgacacc-3’
IRAK1: Sense 5’-ccaaatatcgtagactttgctggc-3’ Antisense 5’-ccaggccaaagtctcccagcttgg-3
TIRAP: Sense 5’-ggacagcagcagcagcagcagtgg-3’ Antisense 5’-cctgcagcatctggtacttgcacc-3’
PCAF: Sense 5’-g caaggccaatgaaacctgcaag-3’
IL-6: Sense 5’-cggagaggagacttcacagagg-3’
Antisense 5’-ggtagaaatagacttgtttggtg-3’
Antisense 5’-gcaaatttcctgattatatccag-3’
GAPDH: Sense, 5’-ccacagtccatgccatcactgc-3’ Antisense, 5’-gcccaagatgcccttcagtggg-3’
Primer pairs for mouse IL-6 3’UTR cloning
WT: Sense 5’-tcgctcgagtagtgcgttatgcctaagc-3’ Antisense 5’-Ccagcggccgccatatttaaattagc-3’
A: Sense 5’-tcgctcgag caggtatctgacttatg-3’ Antisense 5’-Ccagcggccgccatatttaaattagc-3’
B: Sense 5’-cgctcgagatatgaatgttgggacactat-3’ Antisense 5’-Ccagcggccgccatatttaaattagc-3’
C: Sense 5’-tcgctcgag gaagtgtcacttgaaatg-3’ Antisense 5’-Ccagcggccgccatatttaaattagc-3’
D: Sense 5’-tcgctcgagtttaattatttttaattt-3’ Antisense 5’-Ccagcggccgcgaaaccatctggctagg-3
LNA-modified knockdown probes and pre-miR-142
For miR-142-3p: Sequence: ccataaagtaggaaacact; Tm 73.9
For miR-223: Sequence: TGGGGTATTTGACAAACTGACA; Tm:74
Scramble-control: Sequence: gtgtaacacgtctatacgccca; Tm: 78C
miR-142-3p-antimiR Sequence: aagtaggaaacactac; Tm: 71.1 with a complete phosphorothioate backbone
scramble-antimiR Sequence: acgtctatacgccca; Tm:74.6 with a complete phosphorothioate backbone
Pre-miR-142 (Sequence: UGUAGUGUUUCCUACUUUAUGGA)
Figure S1. The miR binding sites
Location of miRNA binding sites and AREs in IL-6 3′-UTR downstream of stop codon. The potential ARE site tetramers (attt) are
shown in red and the potential ARE site pentamers (attta) are shown in green.
Figure S2. Dual luciferase assay
Schematic of psiCHECK™-2 vector ( promega) used to construct IL-6 3′-UTR based miRNA reporter plasmids. The dual luciferase
vector contains both modified firefly ( hluc+) and Renilla (hRluc) luciferase genes. The desired miRNA recognition elements were
cloned into the XhoI-NotI sites in the multiple cloning site (MCS) located in the 3′UTR of the hRluc gene.
Figure S3. Knock-down of endogenous miR-142-3p or miR-223 by miR-CURY™ LNA
knockdown probes
The endogenous expression levels of miR-142-3p ( A) or miR-223 (B) were measured by
TaqMan quantitative RT-PCR following tranfection of DCs with mir-142-3p or -223 specific
knock-down or scrambled control probes at indicated doses for 24 or 48 hours. The levels are
normalized to the expression value of snoRNA135 (Mean ± s.e.m). Data shown are were
combined results from three ( A) or four (B) experiments.
Figure S4. Impact of miR-142-3p expression immune related proteins
DCs were transfected with miR-142-3p knockdown or scrambled probes or pre-miR-142 duplex
or scrambled control for 48 hours and analyzed for the expression levels of TGFBR1, IRAK1,
PCAF and TIRAP proteins by Western blot. Data shown are from one of three representative
experiments.
Figure S5. Efficiency and specificity of the probe used for test for in vivo knockdown of
miR-142-3p
High-affinity LNA-antimiR with phosphorothioate modifications were used in designing miR142-3p-antimiR or scramble-antimiR probes. The probes were transfected into DCs at indicated
doses for 24 or 48 hours. The endogenous expression levels of miR-142-3p, miR-142-5p and
miR-146a were measured by TaqMan quantitative RT-PCR. They were to the expression value
of snoRNA135 ( Mean ± s.e.m). Data shown are results combined results from four experiments.
Figure S6. Schematic of miR-142 maturation
Schematic demonstrating the formation of mature miR-142-3p and miR-142-3p from miR-142stem loop (pre-miR-142).