Cell Cycle Analysis
Cells were trypsinized and collected. After three washes with PBS, cells were fixed in 75% ethanol at 4

C overnight. The fixed cells were stained with propidium iodide (Sigma-Aldrich) and DNA content was analyzed by flowcytometry (FACSCcalibus ， Beckman Coulter, Fullerton, CA, USA, ).
Glutathione Analysis
The intracellular glutathione level was determined by total glutathione quantification kit (Dojindo Molecular Technologies, Kumamoto, Japan) by following the manufacturer
’s manual. Buthionine sulfoximine (BSO,
Sigma-Aldrich) was added at indicated concentrations.
ROS Analysis
To measure intracellular ROS levels, cells grown at 70% confluence were collected and suspended in PBS. The oxidation-sensitive fluorescent probe dihydroethidium (DHE, Invitrogen, Carlsbad, CA, USA ) was added at 5μM.
After 30min of incubation under protection from light, the cell suspension was subjected to flow cytometry analysis.
Luciferase Reporter Assay

Cells were plated to form 60 to 80% confluent cultures in 96-well dishes in triplicates and transfected with LEF/TCF luciferase reporter plasmids (From
Prof. Ningzhi Xu), TOP-FLASH and FOP-FLASH, which contain three optimal copies of the TCF/LEF-binding site (TOP-FLASH) or mutated copies of the
TCF/LEF-binding site (FOP-FLASH) upstream of a minimal thymidine kinase
(TK) promoter directing transcription of a luciferase gene. The pRL-TK plasmid
(Promega, Madison, WI, USA) was co-transfected to normalize for transfection efficiency using Lipofectamine 2000 (Invitrogen). Luciferase activity was assayed 48 hours after transfection, using a dual-luciferase reporter assay system (Promega). Overexpression of xCT was accomplished by transfecting the pcDNA3-xCT plasmid ， which was constructed by cloning the full-length xCT cDNA into pcDNA3 (Invitrogen).
Immunofluorescence and Confocal Examinations
Cells grown on glass coverslips were fixed in methanol at room temperature for 10min, and subsequently in cold methanol at -20

C. After block in PBS buffer (containing 3% bovine serum albumin, 0.05% Tween-20) at room temperature for 1h, cells were incubated with primary antibody at 4

C overnight, and subsequently fluorescein isothiocyanate (FITC)- or rhodamine
(TRITC)-labeled anti-mouse or rabbit IgG (ZSGB-BIO, Beijing, Chian). After
DAPI staining, cells were examined under fluorescence microscopy (Zeiss,

Oberkochen, Germany) and Laser Scanning Confocal Microscope (Leica,
Solms Germany) (Wang and Zhan, 2007).
Reverse Transcription-Polymerase Chain Reaction (RT-PCR) and
Real-Time PCR
Total RNA was extracted from cells using Trizol reagent (Invitrogen), and
2μg was subjected to reverse transcription under MMLV reverse transcriptase
(Promega). RT-PCR and real-time PCR were used to quantify mRNA. The sequences of primers are listed in Supplementary Table 1. 80ng cDNA was used for real-time PCR quantification with Quantitect SYBR Green PCR kit
(Qiagen, Hilden, Germany). GeneAmp 7700 Sequence Detection system
(Applied Biosystems, Foster City, CA, USA) was used, and xCT expression was evaluated after normalization to β-actin.
Reference:
Wang Y, Zhan Q (2007). Cell cycle-dependent expression of centrosomal ninein-like protein in human cells is regulated by the anaphase-promoting complex. J Biol Chem 282: 17712-9.

Supplementary Table 1.
Primer Sequences Used in This Study
Gene Forward Primer (5’→3’)
Size of
Reverse Primer (5’→3’) Amplicon
(bp) human β-catenin ATGGAGTTGGACATGGCCAT mouse β-catenin human caveolin-1
(Wang et al ., 2008) mouse caveolin-1 human β-actin
(Hu et al ., 2006) mouse β-actin
ATGGAGTTGGACATGGCCAT
CGTAGACTCGGAGGGACATC
CGTAGAC-TCCGAGGGACATC
GGCGGCACCACCATGTACCCT
GGTGGTACCACCATGTACCCA
CGAGCTGTCTCTACATCATT
CGAGCTGTTTCTACATCATT
TTTCGTCACAGTGAAGGTGG
TTTTGTCACAGTGAAGGTGG
AGGGGCCGGACTCGTCATACT
AGTACGATGAGTCCGGCCCCT
614
614
271
271
202
202 human xCT TGCTGGGCTGATTTATCTTCG GAAAGGGCAACCATGAAGAGG 114
References:
Hu D, Ran YL, Zhong X, Hu H, Yu L, Lou JN et al (2006). Overexpressed Derlin-1 inhibits ER expansion in the endothelial cells derived from human hepatic cavernous hemangioma. J Biochem Mol Biol 39: 677-85.
Wang Y, Yu J, Zhan Q (2008). BRCA1 regulates caveolin-1 expression and inhibits cell invasiveness. Biochem Biophys Res
Commun .

Supplementary Figure 1. xCT+/+ melanocytes exhibits similar morphology as xCT-/- melanocytes after treatment by SASP or BSO. xCT+/+ melanocytes were cultured and treated by 0.5mM SASP or 2mM BSO. Twenty-four hour after treatment, the morphology of melanocytes was assessed under light microscopy
(magnification, ×200).
Supplementary Figure 2.
xCT disruption leads to reduction of GSH level. (a)
Both xCT+/+ and xCT-/- melanocytes were plated and cultured. The GSH level was measured by total glutathione quantification kit. (b) KYSE150 cells seeded at 5 × 10 4 /cm 2 were treated by 0.5mM SASP for 72h and subjected to GSH quantitation. Buthionine sulfoximine (BSO), the inhibitor of GSH synthesis, served as positive control. (c) KYSE150 cells were transfected with xCT siRNA, namely S1, or control siRNA. Forty-eight hour after transfection, cells were harvested and GSH level was determined. The GSH level was presented as mean ± SD for triplicate wells (* p <0.05).
Supplementary Figure 3.
BSO treatment leads to reduction of the intracellular GSH level and subsequent increase of the intracellular ROS level in xCT+/+ melanocytes. (a) xCT+/+ melanocytes were treated by different doses of BSO as indicated. Seventy-two hour after treatment, the intracellular

GSH level was determined by total glutathione quantification kit and presented as mean
± SD for triplicates (* p <0.05). (b) Flow cytometry analysis of the intracellular ROS level in xCT+/+ melanocytes. Seventy-two hour after treatment by BSO, the melanocytes were stained by DHE and assayed by flow cytometry. (c) The intracellular ROS level in xCT+/+ melanocytes was presented as mean fluorescence density
± SD for triplicates (* p <0.05).
Supplementary Figure 4.
BSO treatment leads to reduction of the intracellular GSH level and subsequent increase of the intracellular ROS level in KYSE150 cells. (a) KYSE150 cells were treated by different doses of BSO as indicated. Seventy-two hour after treatment, the intracellular GSH level was determined by total glutathione quantification kit and presented as mean
± SD for triplicates (* p <0.05). (b) Flow cytometry analysis of the intracellular ROS level in KYSE150 cells. Seventy-two hour after treatment by BSO, KYSE150 cells were stained by DHE and assayed by flow cytometry. (c) The intracellular
ROS level in KYSE150 cells was presented as mean fluorescence density ±
SD for triplicates (* p <0.05).
Supplementary Figure 5. BSO treatment induces upregulation of phospho-p38 (P-p38) in xCT+/+ melanocytes and KYSE150 cells. xCT+/+ melanocytes (a) or KYSE150 cells (b) were treated by 0.5mM SASP or different doses of BSO as indicated. Seventy-two hour after treatment, cells

were harvested for immunoblotting analysis detecting the expression of P-p38, p38, and
β-actin. β-actin served as the loading control. The densities of P-p38 bands were quantitated, normalized to total p38, and the average ratios are shown underneath the P-p38 blots.
Supplementary Figure 6.
Suppression of xCT activity by SASP inhibits
KYSE150 cell growth. (a) SASP inhibited KYSE150 cell proliferation in a dose dependent manner. KYSE150 cells were treated by SASP at 0.25 and 0.5 mM for 4 days. CCK-8 was added and the absorbance at 450 nm was measured.
After normalization to control, the grow th inhibition was presented as mean ±
SD for triplicate wells (* p <0.01). (b) SASP inhibits clone formation of KYSE150 cells at a dose dependent manner. KYSE150 cells were seeded in six-well plate and treated by SASP at 0.25 and 0.5 mM for 9 days. Cells were fixed and the clones were counted after Giemsa staining. The number of clones was presented as mean ± SD for triplicate wells (* p <0.01).
Supplementary Figure 7. SASP inhibits KYSE150 cells proliferation in a density-dependent manner. KYSE150 cells were seeded at different numbers into 96-well plates and treated by 0.5mM SASP. Cell viability was determined by CCK-8 kit at 1d (a), 2d (b), 3d (c), and 4d (d), respectively. The absorbance at 450nm was presented as mean ± SD for triplicate wells (* p <0.05, • p >0.05).