Genotyping and phylogenetic analysis of Acanthamoeba isolates
associated with keratitis.
Arnaud Risler, Bénédicte Coupat-Goutaland, and Michel Pélandakis*
Université de Lyon, CNRS UMR 5240, Université Lyon1 F-69622 Villeurbanne, France
*Corresponding author
Michel Pélandakis
Phone : 33 478 777 108
E-mail: michel.pelandakis@univ-lyon1.fr
1
Abstract. We examined a partial SSU-rDNA sequence of twenty Acanthamoeba isolates associated with keratitis
infections. The phylogenetic tree inferred from this partial sequence allowed to assign isolates to genotypes.
Among the 20 isolates examined, 16 were found to be the T4 genotype, 2 belonged to the T3, one isolate was a
T5 and one was a T2, confirming the predominance of T4 in the infections. However, the study highlights other
genotypes more rarely associated with infections, particularly the T2 genotype. Our study is the second one to
detect this genotype associated with keratitis. Additionally, the phylogenetic analyses showed that five main
clusters T4/T3/T11, T2/T6, T10/T12/T14, T13/T16, and T7/T8/T9/T17 emerged and were regularly obtained
whatever the method used. A similar branching pattern was found when the full rDNA sequence was
investigated.
2
Introduction
The free living amoeba (FLA) belonging to the genus Acanthamoeba is are among the most prevalent protozoa
found in the environment (Marciano-Cabral and Cabral 2003). It is commonly found worldwide, and like other
FLA was isolated from anthropogenic systems such as water networks and from air conditioning systems. Some
strains of Acanthamoeba is are known to be opportunistic pathogen of humans responsible for granulomatous
encephalitis, a fatal disease of the central nervous system (Marciano-Cabral and Cabral 2003; Visvesvara et al.
2007). Acanthamoebae are also recognized to be non opportunistic human pathogens causing keratitis, a corneal
infection. This infection is rare but the number of cases is on the increase, due to the increasing number of
contact lens wearers and to better ophthalmic diagnosis and surveys.
Ocular infections due to Acanthamoeba remain difficult to identify, since clinical features are similar to those of
atypical herpes, bacterial or fungal infections (Marciano-Cabral and Cabral 2003). Molecular techniques based
on the SSU-rDNA analyses were developed to correctly diagnose Acanthamoeba infections while minimizing
false negative results (comparing to the culture method)(ref?), and the specific PCR are useful to detect
Acanthamoeba (Schroeder et al. 2001; Rivière et al. 2006; Qvarnstrom et al. 2006). In addition, the SSU- rDNA
sequencing of Acanthamoeba spp. showed a high diversity within the genus with 17 genotypes so far identified
(Stothard et al. 1998; Horn et al. 1999; Gast 2001; Hewett et al. 2003; Nuprasert et al. 2010; Corsaro and Venditti
2010). To date, isolates belonging to seven genotypes (T2, T3, T4, T5, T6, T11 and T15) are found to be
associated with Acanthamoeba keratitis (AK) (Stothard et al. 1998; Booton et al. 2005; Maghsood et al. 2005;
Spanakos et al. 2006). However, the most prevalent genotype in AK is the T4 genotype.
In this study, corneal scraps and contact lenses from 261 patients were examined by cultivation from May 2003
to December 2012, in order to detect the presence of Acanthamoeba sp.. Sixteen cases were positive for
Acanthamoeba and eleven could be maintained in culture. The genotypes of these eleven twenty isolates with 9
additional ones were determined by sequencing a partial SSU-rDNA region that we named genotypic extended
fragment (GEF), and compared to the strains examined in other studies. Additionally, full sequence analyses
representative of the 17 genotypes were carried out to investigate the phylogenetic relationships of
Acanthamoeba.
Material and Methods
Isolates. 261 patient samples coming from the Lyon hospitals (France) were examined from may 2003 to
December 2012. The samples were deposited on non nutrient agar plates (NNA) with a lawn of non-pathogenic
Escherichia coli and incubated at 30°C for 12 days. The emerging growth fronts of Acanthamoeba trophozoïtes
were first observed by microscope and then sub-cultured for molecular analyses by transferring an agar square
with amoeba cells on fresh NNA+E. coli plate. Among the 261 patient samples 16 cases were positive for
Acanthamoeba and 11/16 could be maintained in culture. Nine strains from cases of AK isolated prior to 2003
(but for which the date of isolation is unknown) were also included. In all, twenty patient isolates were examined
(Table 1).
3
Axenisation. Fourteen Acanthamoebae islolates were axenised as follows: an agar square was cut from the
emerging front of the plate and deposited in a 25 cm2 cell flask containing 10 mL culture medium which was
composed of Casein enzymatic digest 10g/L, NA2HPO4 1.325 g/L, KH2PO4 0.8g/L, Glucose 5g/L, Yeast
extract 5g/L, MEM-aminoacids 100X 1% MEM-Vitamins 50X 2%, Penicillin-Streptomycin 100X 1%, Fœtal
calf serum 10%, pH 7. Trophozoite growth was daily observed under an inverted microscope. Penicillinstreptomycin concentration can be increased to 4% in case of significant bacterial growth.
Amplification and sequencing. The trophozoites were centrifuged at 4000g for 10 min. and the pellet was
recovered for DNA extraction treatment. Total DNA was extracted with the Nucleospin Tissue Kit (MachereyNagel, France)
PCR was performed by using primers located in the SSU-rDNA: the forward primer SSU2F from (Atlan et al.
2012)
(5’-gccagcagccgcggtaattc)
and
the
reverse
primer
JDP2
from
(Booton,
2002)
(5’-
tctcacaagctgctaggggagtca). The PCR program was as follows : 95°C for 2 min, followed by 40 cycles of
denaturation at 94°C for 20 s, primer annealing at 60°C for 30s, extension at 72°C for 30 s and a final step at
72°C for 3 min. Amplification reactions were carried out in 35µL containing 1x Taq DNA polymerase buffer
(Euromedex France), 0,2 µM of each DNTP (Euromedex 02-31-05020), 0,4 µM of each primer, 1 U of Taq DNA
polymerase (Econo Taq Euromedex France).
The JDP2 primer is correctly given in Booton et al. (2002) whereas the original sequence given by Schroeder et
al. (2001) is incorrect (one missing G). However, we tested both, and in agreement with Seal (2003), both
versions worked equally. Sequencing was performed by Biofidal (Lyon, France).
Phylogenetic analysis. For the placement of the patient isolates, the phylogenetic analysis was carried out on the
GEF fragment SSU-rDNA (SSU2F–JDP2), positioned to 651-1395 according to the coordinate sequence of A.
triangularis SH621 (AF316547). The length varying from 737 to 1019 bp. GEF shared approximately the same
region with the Ami fragment (Thomas et al. 2006). The twenty new isolates were submitted to a dataset of 47
sequences representative of the various Acanthamoebae genotypes with 963 selected sites for 1102 aligned sites.
The full sequence of the SSU-rDNA was used to reconstruct the general tree, with 63 Acanthamoebae sequences
(table 2). The introns were removed from the analyses. The sequences were aligned automatically by MUSCLE
program (Edgar 2004) with the Seaview editor (vers. 4.4.0, Gouy et al. 2010) and manually improved. The
nucleotide sites were selected by using the Gblocks program (Castresana 2000) under Seaview with all the
options for less stringent selection enabled. The highly variable domain of DF3 within Acanthamoeba (stem 29-1
of SSU-rDNA) was discarded from the phylogenetic analysis. In this case, 1467 sites were retained for 2916
aligned sites.
Phylogenetic reconstruction. Maximum-likelihood reconstructions were performed using the phylogenetic
program MEGA version 5 (Tamura et al. 2011) using the GTR model of evolution G+I with 6 rate categories
across sites, with 100 bootstrap replicates. The pairwise distance (Tr+Tv) was used. The BioNJ program was
used from the Seaview package with 2000 bootstrap replicates using the Juke-Cantor model.
4
Nucleotide differences between the genotypes and clusters were calculated on the basis of the total SSU-rDNA
with MEGA program. The calculation was based on the p-distance with pairwise deletions and without selected
sites.
Nucleotide sequence accession numbers
The 20 new nucleotide sequences are available in GenBank under the following reference numbers HF930492 to
HF930511
Results
Assignment of the patient isolates to the genotypes with GEF. In order to identify the genotypes, the 20
isolates originated from patients were examined by sequencing the GEF fragment defined by the partial SSUrDNA region amplified here (SSU2F-JDP2). A phylogenetic tree was reconstructed from a sample encompassing
the 17 different genotypes of Acanthamoeba including the twenty new isolate sequences.
The phylogenetic tree inferred from this partial region showed that each of the 17 genotypes was well
individualized with high bootstrap signification (Fig. 1), whatever the phylogenetic methods used. The 20
sequence isolates of this study were positioned within the genotype cluster T4, T3, T2 and T5 with 71%, 89%,
100% and 100% bootstrap support, respectively. Sixteen among the 20 isolates (80%) were assigned to genotype
T4; two isolates (10%) belonged to genotype T3; one isolate was found to be genotype T5 (5%) and one
belonged to the genotype T2 (5%). The T4 isolates were distributed within the diversified cluster of T4.
Phylogeny of the various genotypes. The phylogenetic analyses based on a partial GEF region also showed that
some genotypes were found to be frequently clustered, i.e T4/T3/T11, T2/T6, T10/T12/T14, and T7/T8/T9/T17,
whereas T1 and T5 were placed alone in the tree (Fig. 1). The cluster T13/T15/T16 was not robust as reflected by
a weak bootstrap support (BS) BS (35%). Except for T4/T3/T11 giving a bootstrap support (BS) BS of 57%, the
other clusters appeared with BS spanning between 92% and 100%. However, the phylogenetic relationships
between the clusters were more difficult to establish: the placement of the cluster T2/T6 as well as the cluster
T13/T15/T16 remained unsolved (Fig. 1).
In order to confirm the existence of the different clusters and in an attempt to clarify the phylogenetic
relationships between them, the full sequence of SSU-rDNA was analyzed using a sample of 63 sequences
representative to the 17 genotypes. In this case, because only partial sequence was available for the T15
genotype, this genotype was excluded from the analysis.
Both BioNJ and ML phylogenetic trees displayed the main clusters observed with the partial tree, with higher
value of BS (Fig. 2). The BS of these clusters was between 74% and 100% with T4/T3/T11 and T13/T16 giving
a BS of 81% and 85% respectively. At the higher level, the inter-cluster relationships were more accurate with
the full sequence than the partial one. Therefore, the clusters T2/T6 and T3/T4/T11 were grouped together with
BS of 87%, and this grouping was the sister group of T13/T16 and T10/T12/T14 with a BS of 92%. A similar
branching pattern was obtained without selection of sites and discarding all the sites with gaps (complete
deletion). With this option, more sites were retained (1937 instead of 1467).
5
The variability within the clusters. The percentage of dissimilarity was calculated based on our alignment
using the full sequence. The percentage of dissimilarity within the clusters was less than 5% for the three clusters
T3/T4/T11, T2/T6 and T13/T16 while on average it was of 7.7% and 8.3%, within T7/T9/T8/T17 and
T10/T12/T14, respectively. A further examination was carried out within the T2/T6 cluster encompassing the
three different groups of the T2 genotype, “OX-1”, “Reich” and “Pol” (Corsaro et al & Venditti. 2010). The
percentage of dissimilarity between the T6 genotype and each of the T2 groups ranged from 3.7% to 3.9%.
Within T2, the rate value between “Reich” and “Pol” was 3.4%, and decreased by 2.7% when comparing
“Reich” and “OX-1”or “Pol” and “OX-1”.
Extended analysis of the isolates with GEF. Two major variable regions V4 and V5 (Neefs and De Wachter
1990; Lee and Gutell 2012), located within the GEF fragment, were further examined for typing the isolates. The
V5 variable region includes the highly variable DF3 region and show differences within the Acanthamoeba
genotypes. Hence, the genotype T4 is currently subdivided into 30 sub-genotypes. By examining the DF3 region,
we have found additional T4 sub-genotypes already described by various authors but not referenced (Fig.3). Our
results showed that the 16 T4 sequence isolates could be divided into 9 different sub-genotypes (table 1, Fig. 3).
Although the second variable region (V4 region) displayed fewer variable sites than DF3, differences were also
found within the different genotypes. However, the sequence types obtained with the V4 region did not fit with
those of the DF3. Furthermore, sequences belonging to a given type with DF3 could be split when V4 was
analyzed (Fig. 3). For example, our sequence isolate AcL-ES7 was identical to the T2 AM408799 when
compared to DF3 but both were different with V4; the four sequence isolates belonging to T4/7 with DF3 did not
fit with V4. They were rather identical to T4/31 (see sequence AY 702999); the T4/8 sequences displayed two
different types with V4; the three isolates “T4/22b” displayed numerous differences within V4. The same was
true for most of the other types (Fig. 3).
Discussion
Genotyping and phylogeny. The analysis of the GEF fragment allowed to correctly assign the isolates to the
Acanthamoeba genotypes. Additionally, 6 clusters regularly appeared in our analyses: T4/T3/T11, T2/T6,
T10/T12/T14, T7/T8/T9/T17, and T13/T16. The T15 genotype was often grouped with T13/T16. On the whole,
we are in agreement with the previous studies based on the 1450 bp GTSA.B1 region, but their topology is less
supported (Schroeder et al. 2001; Corsaro and Venditti 2010, 2011). On the other hand, the present study as well
as other ones showed that partial sequences were not able to determine the deepest node in the phylogenetic tree
of Acanthamoeba since the relationships between the different clusters remained unsolved. The numerous
hypervariable sites located in the DF3 and V4 regions were informative at the genotype and the sub-genotype
levels, but were not appropriate for resolving higher level relationships. In addition, the conserved sites present
in the partial sequence were not sufficient to resolve the deep nodes. The full sequence analysis allowed to
precise the relationships at the higher level, by selecting more conserved sites while removing the hypervariable
sites from the analyses. The main clusters were also found with good confidence in the full sequence analysis,
whatever the method used (distance method or ML), or by varying several parameters: i.e., the set of species, the
selected sites or the outgroups. This indicates that the choice of the sites and their alignment are essential for
6
establishing the phylogenetic relationships. However, our SSU-rDNA analyses like other ones evidenced the
difficulty to obtain clear phylogenic relationships for certain nodes. (Stothard et al. 1998; Nuprasert et al. 2010;
Corsaro and Venditti 2010). For instance, the placement of T1 and T5 remained to be clarified. This indicates
that the informative sites are not sufficient to resolve the phylogeny between clusters. In addition, a complete
sequence of the T15 genotype is needed to precise its phylogenetic position.
Tracking of the Acanthamoeba isolates. The variable region DF3 had also been examined to discriminate
within a single genotype in order to establish a relation between the sequence type and pathogenicity. In all, 30
T4 sub-genotypes were identified but 28 were referenced from T4/1 to T4/28 (Booton et al. 2002; Ledee and
Byers et al. 2009; Abe and Kimata 2010; Zhao et al. 2010). This is due to the fact that 2 authors gave the same
designation to T4/22 and T4/23 independaently (Abe and Kimata 2010; Zhao et al. 2010). To avoid this
confusion, the T4/22 and T4/23 identified by Abe and Kimata (2010) could then be named T4/29 and T4/30.
However, we noticed that the T4/22 published by Zhao et al. (2010) is identical to T4/8. Anyway, we compared
most of the DF3 sequences available in GenBank and more than 70 T4 sub-genotypes have been identified
reflecting the highly variable region (see supplementary data). It is therefore unlikely to find any relationship
with pathogenicity, i.e., most of them were found to be either environmental or associated with AK. Another
reason to examine DF3 was the tracking of isolates owing to its high variability (Booton et al. 2002). By
comparing the V4 and DF3 variable regions, our results evidenced that two Acanthamoeba isolates with the
same sequence DF3 are not necessarily identical, as mentioned by Nuprasert et al (2010). Consequently, several
variable regions were required for correctly typing the isolates.
Pathogenicity . In accordance with other studies, we also observed the predominance of the T4 genotype in the
AK infections (Schroeder et al. 2001; Booton et al. 2005; Ledee et al. 2009) with the 16 cases of T4 (80% of the
total isolates).T4 dominante environt The T5 genotype was the second most prevalent genotype in the
environment and represented only 7% of the all genotypes, followed by the T3 genotype (4%) (Booton et al.
2005). However, the T3 genotype was most prevalent in the clinical cases since it was more found in AK.
Including ours, 6 cases causing AK were identified with T3, whereas only three cases were described with T5
(Booton et al. 2005; Maghsood et al. 2005; Spanakos et al. 2006; Ledee et al. 2009). More unexpected in our
analysis was the identification of T2 genotype. The present study is the second one to identify the T2 genotype
related to AK. This genotype was previously found in Iran in clinical and environmental isolates at various sites
(Maghsood et al. 2005). It was also found from the environment in the USA and in Europe (France, Austria)
(Stothard et al. 1998; Walochnik et al. 2008) indicating a relative worldwide distribution. Its underrepresentation
in the clinical cases could be explained by the fact that this genotype is rare in the environment despite its wide
geographical range. In contrast to other findings, those of Maghsood et al. (2005) showed that T2 was most
prevalent in the environment than T4 whereas more AK cases with T4 were identified. An explanation could
come from the studies which showed that a T2 isolate (CCAP 1501/3c) was considered as a weak or nonpathogen (Khan et al. 2002; Alsam et al. 2003). However, only one T2 isolate was examined for a genotype
found to be highly diversified. In any case, the studies that focused on the correlation between the genotypes and
pathogenicity remained inconclusive. Those based on the level of pathogenicity showed, that T3, T4 and T5
genotypes are all highly pathogenic (Walochnik et al. 2000; Alsam et al. 2003). Other studies based on
7
multipurpose resistance indicated that the T3 genotype was more resistant than T4 to the lens cleaning solutions
(Shoff et al. 2007). Furthermore, the interpretation of studies was complexified by the fact that Acanthmaoeba
sp. was a host for many micro-organisms, particularly pathogenic bacteria such as legionella or the bacterial
keratitis agent pseudomonas Pseudomonas (Greub and Raoult 2004; Iovieno et al. 2010).
Environmental analyzes associated with clinical cases would be greatly useful where the T4 genotype is not
prevalent in the environment. In this purpose, recent findings seem to indicate that other genotypes like T15 or
T5 were found to be prevalent in environmental sites (Rivera and Adao 2009; Kao et al. 2012). The fact to
observe the T4 genotype in most of the AK cases remains a matter of debate. The observed overrepresentation of
T4 may be due either to its higher virulence and/or to its greater prevalence in the environment. However,
additional analyses, both environmental and clinical are required to accurately answer the point this.
8
References
Abe N, Kimata I (2010) Genotyping of Acanthamoeba isolates from corneal scrapings and contact lens cases of
Acanthamoeba keratitis patients in Osaka, Japan. Jpn J Infect Dis:2–4
Adl SM, Simpson AGB, Farmer MA, Andersen RA, Anderson OR, Barta JR, Bowser SS, Brugerolle G,
Fensome RA, Fredericq S, James TY, Karpov S, Kugrens P, Krug J, Lane CE, Lewis LA, Lodge J, Lynn
DH, Mann DG, McCourt RM, Mendoza L, Moestrup O, Mozley-Standridge SE, Nerad TA, Shearer CA,
Smirnov AV, Spiegel FW, Taylor MFJR (2005) The new higher level classification of eukaryotes with
emphasis on the taxonomy of protists. J Eukaryot Microbiol 52:399–451. doi:10.1111/j.15507408.2005.00053.x
Alsam S, Sik K, Stins M, Ortega A, Sissons J, Ahmed N (2003) Acanthamoeba interactions with human brain
microvascular endothelial cells. Microb Pathog 35:235–241. doi:10.1016/j.micpath.2003.07.001
Atlan D, Coupat-Goutaland B, Risler A, Reyrolle M, Souchon M, Briolay J, Jarraud S, Doublet P, Pélandakis M
(2012) Micriamoeba tesseris nov. gen. nov. sp.: a new taxon of free-living small-sized Amoebae nonpermissive to virulent Legionellae. Protist 163:888–902. doi:10.1016/j.protis.2012.04.006
Booton GC, Kelly DJ, Chu Y, Seal D V, Houang E, Lam DSC, Byers TJ, Fuerst PA (2002) 18S Ribosomal
DNA Typing and tracking of Acanthamoeba species isolates from corneal scrape specimens, contact
lenses, Lens cases, and home water supplies of Acanthamoeba keratitis patients in Hong Kong. J Clin
Microbiol 40:1621–1625. doi:10.1128/JCM.40.5.1621
Booton GC, Visvesvara GS, Byers TJ, Kelly DJ, Fuerst PA (2005) Identification and distribution of
Acanthamoeba species genotypes associated with nonkeratitis infections. J Clin Microbiol 43:1689–1693
Castresana J (2000) Selection of conserved blocks from multiple alignments for their use in phylogenetic
analysis. Mol Biol Evol 17:540–52
Corsaro D, Venditti D (2010) Phylogenetic evidence for a new genotype of Acanthamoeba (Amoebozoa,
Acanthamoebida). Parasitol Res 107:233–8. doi:10.1007/s00436-010-1870-6
Corsaro D, Venditti D (2011) More Acanthamoeba Genotypes: Limits to the use of rDNA fragments to describe
new genotypes. Acta Protozool 1:49–54
Edgar RC (2004) MUSCLE: multiple sequence alignment with high accuracy and high throughput. Nucleic
Acids Res 32:1792–1797. doi:10.1093/nar/gkh340
Gast RJ (2001) Development of an Acanthamoeba-specific reverse Dot-Blot and the discovery of a new
ribotype. J Eukaryot Microbiol 48:609–615
Gouy M, Guindon S, Gascuel O (2010) SeaView version 4: A multiplatform graphical user interface for
sequence alignment and phylogenetic tree building. Mol Biol Evol 27:221–4. doi:10.1093/molbev/msp259
Greub G, Raoult D (2004) Microorganisms Resistant to Free-Living Amoebae. Clin Microbiol Rev 17:413–433.
doi:10.1128/CMR.17.2.413
Hewett MK, Robinson BS, Monis PT, Saint CP (2003) Identification of a new Acanthamoeba 18S rRNA gene
sequence type, corresponding to the species Acanthamoeba jacobsi Sawyer, Nerad and Visvesvara, 1992
(Lobosea: Acanthamoebidae). Acta Protozool 1992:325 – 329
Horn M, Fritsche TR, Gautom RK, Schleifer KH, Wagner M (1999) Novel bacterial endosymbionts of
Acanthamoeba spp. related to the Paramecium caudatum symbiont Caedibacter caryophilus. Environ
Microbiol 1:357–367
Iovieno A, Ledee DR, Miller D, Eduardo C (2010) Detection of bacterial endosymbionts in clinical
Acanthamoeba isolates. Ophthalmology 117:445–452. doi:10.1016/j.ophtha.2009.08.033.
Kao PM, Hsu BM, Chen NH, Huang KH, Huang SW, King KL, Chiu YC (2012) Isolation and identification of
Acanthamoeba species from thermal spring environments in southern Taiwan. Exp Parasitol 130:354–8.
doi:10.1016/j.exppara.2012.02.008
Khan NA, Jarroll EL, Paget TA (2002) Molecular and physiological differentiation between pathogenic and
nonpathogenic Acanthamoeba. Cur Microbiol 45:197–202. doi:10.1007/s00284-001-0108-3
9
Ledee DR, Iovieno A, Miller D, Mandal N, Diaz M, Fell J, Fini ME, Alfonso EC (2009) Molecular identification
of T4 and T5 genotypes in isolates from Acanthamoeba keratitis patients. J Clin Microbiol 47:1458–62.
doi:10.1128/JCM.02365-08
Lee JC, Gutell RR (2012) A comparison of the crystal structures of eukaryotic and bacterial SSU ribosomal
RNAs reveals common structural features in the hypervariable regions. PloS one 7:e38203.
doi:10.1371/journal.pone.0038203
Maghsood AH, Sissons J, Rezaian M, Nolder D, Warhurst D, Khan NA (2005) Acanthamoeba genotype T4 from
the UK and Iran and isolation of the T2 genotype from clinical isolates. J Med Microbiol 54:755–759.
doi:10.1099/jmm.0.45970-0
Marciano-Cabral F, Cabral G (2003) Acanthamoeba spp. as agents of disease in humans. Clin Microbiol Rev
16:273–307. doi:10.1128/CMR.16.2.273
Neefs JM, De Wachter R (1990) A proposal for the secondary structure of a variable area of eukaryotic small
ribosomal subunit RNA involving the existence of a pseudoknot. Nucleic acids res 18:5695–704
Nuprasert W, Putaporntip C, Pariyakanok L, Jongwutiwes S (2010) Identification of a novel T17 genotype of
Acanthamoeba from environmental isolates and T10 genotype causing keratitis in Thailand. J Clin
Microbiol 48:4636–4640. doi:10.1128/JCM.01090-10
Qvarnstrom Y, Visvesvara GS, Sriram R, Da Silva AJ (2006) Multiplex real-time PCR assay for simultaneous
detection of Acanthamoeba spp., Balamuthia mandrillaris, and Naegleria fowleri. J Clin Microbiol
44:3589–95. doi:10.1128/JCM.00875-06
Rivera WL, Adao DE V (2009) 18S ribosomal DNA genotypes of Acanthamoeba species isolated from contact
lens cases in the Philippines. Parasitol Res 105:1119–1124. doi:10.1007/s00436-009-1531-9
Rivière D, Ménard F, Frère J, Héchard Y (2006) Development of a real-time PCR assay for quantification of
Acanthamoeba trophozoites and cysts. J Med Microbiol 64:78 – 83. doi:10.1016/j.mimet.2005.04.008
Schroeder JM, Booton GC, Hay J, Niszl IA, Seal DV, Markus MB, Fuerst PA, Byers TJ (2001) Use of subgenic
18S ribosomal DNA PCR and sequencing for genus and genotype identification of Acanthamoebae from
humans with keratitis and from sewage sludge. J Clin Microbiol 39:1903–1911.
doi:10.1128/JCM.39.5.1903
Seal DV (2003) Acanthamoeba keratitis molecular epidemiology and new drugs for treatment. Eye 17:893–905.
doi:10.1038/sj.eye.6700563
Shoff M, Rogerson A, Schatz S, Seal D (2007) Variable responses of Acanthamoeba strains to three
multipurpose lens cleaning solutions. Optom Vis Sci 84:202–207
Spanakos G, Tzanetou K, Miltsakakis D, Patsoula E (2006) Genotyping of pathogenic Acanthamoebae isolated
from clinical samples in Greece — Report of a clinical isolate presenting T5 genotype. Parasitol Int 55:147
– 149. doi:10.1016/j.parint.2005.12.001
Stothard DR, Schroeder-Diedrich JM, Awwad MH, Gast RJ, Ledee DR, Rodriguez-Zaragoza S, Dean CL, Fuerst
PA, Byers TJ (1998) The evolutionary history of the genus Acanthamoeba and the identification of eight
new 18s rRNA gene sequence types. J Eukaryot Microbiol 45:45–54
Tamura K, Peterson D, Peterson N, Stecher G, Nei M, Kumar S (2011) MEGA5: molecular evolutionary
genetics analysis using maximum likelihood, evolutionary distance, and maximum parsimony methods.
Mol Biol Evol 28:2731–2739. doi:10.1093/molbev/msr121
Thomas V, Herrera-Rimann K, Blanc DS, Greub G (2006) Biodiversity of Amoebae and Amoeba-Resisting
Bacteria in a hospital water network. Appl Environ Microbiol 72:2428–2438. doi:10.1128/AEM.72.4.2428
Visvesvara GS, Moura H, Schuster FL (2007) Pathogenic and opportunistic free-living amoebae: Acanthamoeba
spp., Balamuthia mandrillaris, Naegleria fowleri, and Sappinia diploidea. FEMS Microbiology Reviews
50:1–26. doi:10.1111/j.1574-695X.2007.00232.x
Walochnik J, Aichelburg A, Assadian O, Steuer A, Visvesvara G, Vetter N, Aspöck H (2008) Granulomatous
amoebic encephalitis caused by Acanthamoeba amoebae of genotype T2 in a human immunodeficiency
virus-negative patient. J Clin Microbiol 46:338–40. doi:10.1128/JCM.01177-07
Walochnik J, Obwaller A, Aspöck H (2000) Correlations between morphological, molecular biological, and
physiological characteristics in clinical and nonclinical isolates of Acanthamoeba spp. J Clin Microbiol
66:4408–4413. doi:10.1128/AEM.66.10.4408-4413.2000.
10
Zhao G, Sun S, Zhao J, Xie L (2010) Genotyping of Acanthamoeba isolates and clinical characteristics of
patients with Acanthamoeba keratitis in China. J Med Microbiol 1:462–466. doi:10.1099/jmm.0.016667-0
11
Legends of figures
Fig. 1
Partial SSU-rDNA tree inferred from the maximum likelihood method (-ln L = 7768.92), showing the placement
of our Acanthamoeba isolates (in bold) within the genotypes. The bootstrap values for ML/BioNJ are shown in
the nodes. Only those higher than 50% are indicated. Some branch length was shortened to 25% of their initial
length (// in the branch). The isolates of this study are in bold.
Fig. 2
Full SSU-rDNA gene phylogeny of Acanthamoeba inferred from the maximum likelihood method (-ln L =
9847.29). The bootstrap values for ML/BioNJ are shown in the nodes. Only those higher than 50% are indicated.
Some branch length was shortened to 20% of their initial length (// in the branch).
Fig. 3
Sequence alignment of the two variable regions DF3 and V4. The DF3 region was positioned from 1303 to 1358
(coordinate of A. triangularis SH621 ). The second variable region (V4 sequence) was located between 7241077 (coordinates of A .triangularis) and was from ca. (T4) 350 bp to ca. (T7) 620 bp length. The additional T4
sub-genotypes described elsewhere but no referenced are designated here as T4/31 to T4/34. T4/22b
corresponded to T4/22 described by Abe and Kimata (2010) and differed from the T4/22 of Zaho et al. (2010)
(see discussion). T4/31 was represented by the isolate AY702999 in the figure. For the V4 region, only the parts
which exhibit differences with DF3 are shown in the figure. The numbers in bracket in the sequences are the
coordinate position of the respective parts (based on A. triangularis). The isolates of this study are in bold. Gaps
are represented by dashes.
Suplementary data 1
The 73 Acanthamoeba T4 sub-geneotypes based on the alignment of the variable region of DF3. Gap are
represented by dashes.
Supplementary data 2
Table 2
(b) Sequence AF019051 is associated in GenBank with strain "OX-1; CCAP:1501/3c".
However, two different sequences were linked for this strain although they belonged to the T2 genotype:
the full sequence AF019051 (Stothard et al 1998) and the partial sequence AF239298 deposited by Khan
et al (2001).
(c) AF019064 and AY026242 sequences correspond to the strains ATCC 30137 and 30901, respectively.
However, they are both referenced in the ATCC as "A. astronyxis (Ray & Hayes) Page." To avoid the
confusion, the strain ATCC30901 (T9) was identified as strain "Res20" (cf. ATCC website).
(d) In Stothard et al (1998), the strain associated with the accession number U07417 is A. rhysodes
Singh ATCC 30973 whereas the correct number accession of A. rhysodes Singh is AY351644.
12
13