NAME _________________________________________________________ DATE ___________________ Mutation Worksheet 1. List the two types of mutations: ________________________ and __________________________. 2. A point mutation usually involves a __________________________, which can be a nonsense or _______________________. 3. Frameshift mutations can either be an _______________________ or ________________________. In the chart below, transcribe the DNA sequence into mRNA. Then use your codon chart to indicate what amino acids are being coded for by the base sequences listed for the mRNA. Then, tell what type of gene mutation is being illustrated. Choose from point mutation or frameshift mutation. DNA sequence mRNA sequence Amino acid sequence DNA sequence mRNA sequence Amino acid sequence DNA sequence mRNA sequence Amino acid sequence TACGCCAGTGGT Original TACCCCAGTGGT TACCCAGTGGT Complete the protein synthesis for the following DNA strands and show how mutations can cause problems. Original DNA sequence Original mRNA sequence Original Amino acid sequence TACCCCGTCACCGCCTATATC Mutated DNA #1 Mutated mRNA #1 Mutated AA #1 Type of Mutation (circle) TACCCCGTCCACCGCCTATATC Kind of Mutation (circle) Mutated DNA #2 Mutated mRNA #2 Mutated AA #2 Type of Mutation (circle) Kind of Mutation (circle) Mutated DNA #3 Mutated mRNA #3 Mutated AA #3 Type of Mutation (circle) Kind of Mutation (circle) Point Insertion Frameshift Deletion Substitution T A C C C C G T ___ A C C G C C T A T A T C Point Insertion Frameshift Deletion Substitution TACCACGTCACCGCCTATATC Point Insertion Frameshift Deletion Substitution