Using Synthetic Biology and pClone Red for Authentic Research on Promoter Function: Introductory Biology (identifying new promoters) A. Malcolm Campbell and Todd T. Eckdahl Teacher Directions 1. Print out copies for students. Color is not required, but is helpful. 2. Have students cut out all the shapes with dashed lines around them. The box in the middle with red letters is a “cheat sheet” to remind students the Bsa I cut sites and resulting sticky ends. 3. Students should anneal the two DNA strands so that they generate the appropriate sticky ends (5’CGAC 3’ on top left and 5’CCGC 3’ on the bottom right). Use tape to keep the assembled promoter (called P5) double stranded DNA intact. 4. Students use scissors to cut out the existing blue, left-facing promoter from pClone. Be sure to leave the two sticky ends intact. 5. Students should align the sticky ends of the plasmid with the promoter and tape the two together (ligate them). 6. Students should be able to see how the new construct will lead to transcription of RFP instead of GFP. They should also be able to predict what the phenotype of cells would be if they promoter was functional or nonfunctional. 7. Have the students connect this paper activity to what is happening in the GGA tube that is cycling between 37° C and 16° C. Note that this file contains both pClone Red and the optional pClone Blue. Print only the version your students will use. RBS CGAC BsaI BsaI BsaI 5’ GGTCTCN 3’ CCAGAGNNNNN BsaI 5’ N 3’ NNNNN GCGG RBS RFP NNNNN 3’ NNNNNGAGACC 3’ NCTCTGG 5’ ACGACTGAGACCCCGGG-----------------GCCGCTGGTCTCTGCGGG TGCTGACTCTGGGGCCC-----------------CGGCGACCAGAGACGCCC pClone Red 5’ CGACGAGCTGTTGACAATTAATCATCGGCTCGTATAATGTGTGGA 3’ 3‘ CTCGACAACTGTTAATTAGTAGCCGAGCATATTACACACCTCGCC 5’ GFP RBS CGAC BsaI BsaI BsaI 5’ GGTCTCN 3’ CCAGAGNNNNN BsaI 5’ N 3’ NNNNN GCGG RBS Blue NNNNN 3’ NNNNNGAGACC 3’ NCTCTGG 5’ ACGACTGAGACCCCGGG-----------------GCCGCTGGTCTCTGCGGG TGCTGACTCTGGGGCCC-----------------CGGCGACCAGAGACGCCC pClone Blue 5’ CGACGAGCTGTTGACAATTAATCATCGGCTCGTATAATGTGTGGA 3’ 3‘ CTCGACAACTGTTAATTAGTAGCCGAGCATATTACACACCTCGCC 5’ GFP