miRNA Profiling to
Distinguish Bodily
Fluids
Rachel Markert
(http://4.bp.blogspot.com/XQlCMNOapwI/TjZo_XTWemI/AAAAAAAABVI/yPhPQyjOqDY/s1600/blood.jpg)
(http://3.bp.blogspot.com/_hVwPMMFDypI/TDNojHnNzlI/AAAAAAAAAJI/AGLt4p6EyRc/s1600
/Forensics+front.jpg)
Purpose of Experiment
• Use miRNA in forensic applications by recovering miRNA from
samples obtained for forensics and identifying the bodily fluid it
came from.
• Prove that miRNA assaying can be cheaper, easier, and overall
capable in forensic labs.
(http://www.kenoshapolice.com/UserFiles/image/crime%20scene.jpg)
Forensic Background
• Forensic investigations often involve body fluids, such as blood and
saliva
• These fluids contain mRNAs and more stable miRNAs
• Fluids can connect suspects to crime scenes or victims and miRNAs
is easier and faster than other methods
(http://www.leelofland.com/wordpress/wp-content/uploads/2011/07/New-Picture-67.jpg)
Micro-RNA Background
•
•
•
•
Small noncoding RNA
Used in cellular processes, posttranslational
miRNA regulation used for controlling gene expression.
Binds to mRNA
(http://cnx.org/content/m36053/latest/mirna.png)
Experiment: Step 1
• Fluids were obtained through buccal swabs for saliva and
vacutainer tubes for blood.
• The microarray method used fluids from 4 females and 1 male
• Verification by PCR used samples from 3 females and 2 males
• Aged blood was made from one sample over one year
(http://www.dnares.in/images/header/buccal-swab-collection.jpg)
(http://anotherstudentdoctor.files.wordpress.com/2010/09/vacutainer.jpg)
Experiment: Step 2
•
•
•
•
Extraction of RNA from all samples
Enriched for miRNAs with kits
Buffer used to remove erythrocytes from blood
RNA concentration was found using RNA integrity number
(RIN) from fluorometer and bioanalyzer
Experiment: Step 3
• Microarrays were used
• Probes were created as
reverse complements of
miRNAs from known
human sequences
• Positive results for blood
and saliva were selected
for from respective arrays
http://www.biolab.cn/uploads/1/Image/20090606110818709.gif
Experiment: Step 4
• RT-PCR was done on each selected sample for both blood and
saliva
• From before, miRNA was extracted again
• cDNA was created by reverse transcriptase after
polyadenylation by poly (A) polymerase
• Oligo-dT primers were used to tag the 5’ end for quantitative
PCR
Courts et al. (2011)
TABLE 1—Body-fluid identification assay panels.
Body-Fluid ⁄ Task
Blood
Saliva
Normalization
Assay Name
Sequence
References
miR-126
miR-150
miR-451
miR-200c
miR-203
miR-205
RNU6b
UCGUACCGUGAGUAAUAAUGCG
UCUCCCAACCCUUGUACCAGUG
AAACCGUUACCAUUACUGAGUU
UAAUACUGCCGGGUAAUGAUGGA
GUGAAAUGUUUAGGACCACUAG
UCCUUCAUUCCACCGGAGUCUG
CTGCGCAAGGATGACACGCAAATTCGTG
AAGCGTTCCATATTTTT
(4,13)
(4,13)
(4,14,15)
(4,16–18)
(4,19,20)
(4,18,19,21)
(22,23
Experiment: Step 5
• Mathematical equations were carried out for hierarchical
clustering
S (t ) 
var(t )
g
 var(t , i)
i 1
Var(t) is sample variance
Var (t,i) is variance in group i, calculated already
Normalization for qPCR
Ct  Ct (miRNA)  Ct ( RNU 6b)
C  Ct (miRNAbody  fluid  1)  Ct (miRNAbody  fluid  2)
Courts et al. (2011)
Courts et al. (2011)
Courts et al. (2011)
FIG. 4—qPCR validation of candidate miRNAs for blood and saliva.
Upper panel: relative expression of blood candidate miRNAs in blood compared
to saliva, for which expression has been arbitrarily set to 0; Central
panel: relative expression of blood candidate miRNAs in aged blood compared
to saliva for which expression has been arbitrarily set to 0; Lower
panel: relative expression of saliva candidate miRNAs in saliva compared
to blood for which expression has been arbitrarily set to 0.
FIG. 5—Expression of candidate miRNAs in different kinds of tissue.
Upper panel: Normalized median expression of the three blood-miRNAs
(miR-126, miR-150, miR-451) in blood, saliva, liver, muscle and brain
Lower panel: Normalized median expression of the three saliva-miRNAs
(miR-200c, miR-203, miR-205) in blood, saliva, liver, muscle and brain.
Results
• As seen previously, 3 candidates from both blood and saliva
contained specific miRNAs
• Aged blood also resulted in miRNA assay, proving that miRNA
could withstand some degradation
• A mixed sample of blood and saliva resulted in distinguishing
between the two types of samples
Future Applications
• Hopefully, widespread use in forensic labs
• Standardization of the procedure for validation and optimal
processes for distinction
• More research into other body fluids, such as semen, vaginal
secretions, and menstrual blood
• Use especially in rape cases
http://www.fresnosheriff.org/images/Forensic-Lab-Technologist.jpg
References
• Courts, C; Madea, B. “Specific micro-RNA signatures for the
detection of saliva and blood in forensic body-fluid identification.” J
Forensic Sci. v.56 no. 6 p. 1464-1470. 2011.
• Landgraf , P; Rusu , M; Sheridan , R; et al. “A mammalian microRNA
expression atlas based on small RNA library sequencing.” Cell. v. 129
no. 7 p. 1401–14. 2007.