Longterm Estuary Assessment Group LaFleur Lab Developing biomarkers of reproductive health in fish and amphibians of the Barataria-Terrebonne Estuary LaFleur, Pitre, Lasseigne, and Nelson nicholls state university NOAA '07 Eco Impacts of Hypoxia The Barataria-Terrebonne Estuary is impaired • lack of flow • saltwater intrusion • land-loss Graphic from Restore or Retreat: www.restoreorretreat.org Having been isolated from freshwater inputs it is lacks flushing, sheet flow, and an ecological flood pulse NOAA '07 Eco Impacts of Hypoxia USACE Butte La Rose Gage 03120 ('59-'04) The 46-year mean stage of the Atchafalaya still reflects an ecological flood pulse Dissolved Oxygen (mg/L) 8 6 4 2 0 4/7/06 5/27/06 7/16/06 9/4/06 10/24/06 12/13/06 2/1/07 from Estay and Fontenot (thesis) In the Upper Barataria basin, Hypoxia can occur But it is usually associated with Rainwater events, rather than flood stage Our estuary is slated for largescale hydrologic modifications: Graphic from Restore or Retreat: www.restoreorretreat.org one project proposes diverting 300,000 cfs water into the BTE; NOAA '07 up to 6 sq mi / year; at a cost of $25 / cubic yard Eco Impacts of Hypoxia Pipeline Slurry System A more recently presented scenario would utilize a sediment pipeline slurry system to build land even quicker: NOAA '07 up to15 sq mi / year; at a cost of $4 /cubic yard Eco Impacts of Hypoxia MY OBJECTIVES In preparation for hydrologic changes due to further deterioration or restoration activities in our estuary, my lab has begun a survey •to monitor behavioral indicators of reproduction in amphibians of the estuary •to monitor anatomical indicators of reproduction in amphibians of the estuary •to monitor molecular indicators of reproduction in amphibians of the estuary NOAA '07 Eco Impacts of Hypoxia 1 2 3 4 5 Site 1 Choctaw swamp; Site 2 Chacahoula swamp Site 3 Nicholls’ Environmental Ag Facility Site 4 Falgout Canal fw / brackish marsh NOAA '07 Impacts Site 5 fish only at Isle Dernieres Barrier Islands Eco of Hypoxia Reproductive behavior is being surveyed in three LAMP survey routes: spanning Lafourche and Terrebonne Parishes NOAA '07 Eco Impacts of Hypoxia Northern Cricket frogs peaked in Jan, but are still calling 15 10 5 0 23Jan 7Feb 6Mar 20Mar temp calls 20 Call Density Score/ Temperature In 2007, Spring Peepers reached peak calling in Feb Call Density Score/ Temperature 20 15 10 5 temp calls 0 23-Jan 7-Feb 6-Mar 20-Mar Confirmed Hyla avivoca Choctaw Swamp, Lafourche Parish Proposed Expansion of Geographic Range to the BTES, south of the Mississippi River Conant and Collins.1991 liver ovary Selected species are collected, dissected, and anatomical indicators are examined NOAA '07 Eco Impacts of Hypoxia Species Repro Behavior Preserved Repro Anatomy Molec. Biomarker Bufo valliceps X X X X Acris gryllus X X Hyla cinerea X X Hyla squirella X X Hyla versicolor/ chrysoscelis X X Hyla avivoca* X X Pseudacris crucifer X X Gastrophryne carolinensis X X Rana catesbeiana X X X Rana grylio X Rana clamitans X X X X Rana utricularia X X X X Amphiuma tridactylum Notophthalmus viridescens X X X X X X X Amphibian Survey Matrix Approach to designing biomarkers for estrogen-induction • Injection of estradiol into males • Isolation of liver RNA • RT-PCR for Vtg, Chg from homogenates using degenerate and heterologous primers NOAA '07 Eco Impacts of Hypoxia vitellogenins and choriogenins vitelline envelope precursor to the chorion Estrogen induced Liver synthesis of teleost choriogenins and vitellogenins follicle cells HETEROSYNTHETIC ORIGIN OF TELEOSTEAN EGG PROTEINS yolk of oocyte micropyle NOAA '07 Eco Impacts of Hypoxia Choriogenin Primers Row 78 TTCAGGTTCCAGAATTCTGAC Row 81 CATTGGTTCATATCGCTGTCT Vitellogenin Primers Row 8 CGATATTGACATGTTTCCAA Row 24 TACCAGCTTGGTTTCTACCT Choriogenin and Vitellogenin primers derived from F. heteroclitus, the mummichog. Row 78 and Row 81 produce a 450 bp product while Row 8 and Row 24 produce a 729 bp product NOAA '07 Eco Impacts of Hypoxia RT-PCR inchoriogenin Fundulus chrysotus F.g. F.c. G.a. A.t. RT-PCR in Fundulus grandis liver Preliminary liver liver ovary Results in Gambu 450 bp Chg in female Vtg in female and male a b c d FemIM Male Male IM Fem IM IMFem Fem Choriogenin Vitellogenin Choriogenin Vitellogenin Choriogenin cDNAs indicating normal female reproductive activity. NOAA '07 Eco Impacts of Hypoxia (Estrogen-injected males) vitellogenin RT-PCR in Fundulus chrysotus CR in Fundulus grandis 729 bp a Male IM Fem Male b c IM a= Fundulus IM Fem grandis IM liver, Fem b= Fundulus chrysotus liver, Choriogenin Vitellogenin c= Amphiuma tridactylum liver oriogenin Vitellogenin NOAA '07 Eco Impacts of Hypoxia (Non-injected males) vitellogenin Preliminary Results in Gambusia affinis 729 bp Chg in female Vtg a in female b c and male Vtg in female Three wild-caught males showing the presence of female specific RNA a= Bufo valliceps liver, b= Amphiuma tridactylum liver c= Gambusia affinis NOAA '07 Eco Impacts of Hypoxia Fish and Amphibians Through collaborations between the labs of LaFleur, Ferrara and Fontenot we have established overlapping projects of the estuarine fauna, including NOAA '07 monitoring of finfish, larval fish, and amphibians. Eco Impacts of Hypoxia Summary LaFleur Lab • Documented reproductive behavior through calls of 12 local Anuran species. • Established herpetology collection. • Tracking reproductive seasons by measuring GSI on 4 Anurans, 1 Salamander, 3 fish. • Molecular biomarkers were amplified using RT-PCR on 3 anurans, 1 Salamander, 3 fish. • Poised to implement reproductive survey to include water quality and expanded sampling regime. • Proposed range extension for Hyla avivoca to include wetlands of the BTES. Post Katrina Directions Amphibian and Fish reproduction will be utilized as a longterm assessment tool for environmental health of the estuary Nicholls has been awarded a grant for restoration planting by NOAA Nicholls has signed an MOU with NRCS for restoration plant propagation at Nicholls Farm LaFleur, Boopathy, and Zou are committed to longterm monitoring programs that will offer consistency over time NOAA '07 Eco Impacts of Hypoxia