powerpoint slides from this talk.
advertisement
Policy Opportunities Related to the Engineering of Biology Drew Endy endy@mit.edu http://mit.edu/endy/www/talks/ file here [.ppt] http://parts.mit.edu/ Registry of Standard Biological Parts April 11, 2005 MIT Endy, MIT April 2005 1 Endy, MIT April 2005 2 Endy, MIT April 2005 3 Previous Page Sequence (BNL) Dunn & Studier, J. Mol. Bio. 166:477 (1983) Endy, MIT April 2005 4 Wild-Type T7 Genes 2.8-3 ----------------2.8-----------------> acgcaaagggaggcgacatggcaggttacggcgctaaaggaatccgaaa <--3-RBS---><----------------3-------------- Endy, MIT April 2005 5 Wild-Type T7 Genes 2.8-3 ----------------2.8-----------------> acgcaaagggaggcgacatggcaggttacggcgctaaaggaatccgaaa <--3-RBS---><----------------3-------------T7.1 Parts 28 & 29 acgcaaGgggagAcgacaCggcaggttacggcgctaaggatccggccgcaaagggaggcgacatggcaggttacggcgctaaa ----------------2.8-----------------><D28R|D29L><--3RBS------><---------------3---- Endy, MIT April 2005 6 NsiI TR/ SRL A0 Endy, MIT April 2005 øOL A1 A2 A2 BoxA B R0.30.30.4R0.5 0.5 0.6A/B PciI C 0.7 R1 MfeI 1 SpeI ø1.1A R1.1 ø1.1B ø1.3 1.1 1.2 R1.3 BclI ø1.6 ø1.5 1.3 TE 1.4 1.5 1.61.7 7 NsiI 210 TR/ SRL 63 A0 35 88 316 øOL A1 A2 A2 BoxA Endy, MIT April 2005 370 R0.3 0.3 183 52 158 0.4 R0.5 0.5 355 0.6A/B PciI 1102 0.7 MfeI 91 C R1 SpeI 2708 1 139 ø1.1A R1.1 148 ø1.1B 1.1 275 80 ø1.3 1.2 R1.3 1099 65 1.3 TE 173 1.4 BclI 35 ø1.5 110 1.5 35 ø1.6 279 1.6 164 443 1.7 8 D1L BstEII D1R D2L SphI D3L D4L BspDI HindIII D2R D3R 35 88 D5L D6L BssHII SexAI D4R D5R D7L MluI D6R D7R SacI 210 TR/ SRL 63 A0 316 øOL A1 A2 A2 BoxA Endy, MIT April 2005 370 R0.3 0.3 183 D8L BsiWI D9L RsrII D8R NheI 52 158 0.4 R0.5 0.5 D9.5L SacII D9R D10L EagI D9.5R NsiI PciI 355 0.6A/B 1102 0.7 D10.5L PacI D11L EcoRI D10R D12L PfoI D10.5R D11R MfeI 91 C R1 D12R D15L ApaI D13R D14R D15R 80 1099 65 ApaLI 2708 1 D13L D14L EcoO1091 XmaI 139 ø1.1A R1.1 148 ø1.1B 1.1 275 D16L NcoI D17L KasI D18L AvrII D16R D17R SpeI ø1.3 1.2 R1.3 1.3 TE 173 1.4 D20L D21L XbaI AgeI D19L AatII D18R D19R D20R 35 279 SapI 35 ø1.5 110 1.5 D21R BclI ø1.6 1.6 164 443 1.7 9 D2L SphI D1L BstEII D1R D3L D4L BspDI HindIII D2R D3R 35 88 D5L D6L BssHII SexAI D4R D5R D7L MluI D6R TR/ SRL 63 A0 370 316 øOL A1 A2 A2 BoxA D9R D10L EagI D9.5R 355 1102 0.6A/B 0.7 D24L D25L D23R EcoRI D24R XmaI D10.5L PacI D11L EcoRI D10R NsiI PciI 158 0.4 R0.5 0.5 D23L D22R AvrII D22L BstEII 52 D9.5L SacII D8R NheI 183 R0.3 0.3 D9L RsrII D7R SacI 210 D8L BsiWI D12L PfoI D10.5R D11R D12R MfeI 91 C 1 D26L D25R BamHI D15L ApaI D16L NcoI D13R D14R D15R 139 ø1.1A R1.1 D27L D26R EagI 148 80 1099 65 ø1.1B ø1.3 1.2 R1.3 D28L D27R SacII D18L AvrII D29L D28R PciI D19R D20R 35 279 D21R SapI 173 1.3 TE D20L D21L XbaI AgeI D19L AatII D18R SpeI 275 1.1 D17L KasI D16R D17R ApaLI 2708 R1 D13L D14L EcoO1091 XmaI ø1.5 1.4 BclI 110 35 1.5 D30L D29R SalI ø1.6 164 443 1.6 1.7 D30R BglII 175 209 1.8 D31L BsiWI D31R XbaI D50L BsiWI 438 2.5 2.8 ø2.5 2 35 Ø4c 723 464 478 3 75 ø3.8 3.5 D32L D33L D34L D35L D36L D37L D38L D39L D40L D41L D42L D43L D44L EagID32R AscID33R SgrID34R HindIII D35R PfoI D36R NheI SphI NcoI BamHI SacIID41R ApaI XmaI SacI D37R D38R D39R D40R D42R D43R AauI BglI EciI ScaI AvaI SpeI 1762 4A/4B/4.1/4.2 35 Ø4.3 213 270 4.3 4.5 D51L D52L D50R PvuI D51R EcoRI DraI BspHI 69 Ø4.7 R4.7 D53L D52R SacII D53R NsiI 408 RsrII 2115 4.7 D54L BamHI XbaI 5 357 464 478 464 5.3 5.5 5.7 5.9 D55L FspI D54R XmaI AseI D56L D55R ApaI BssHII 903 114 AatII 3.8 D45L D46L D47L D48L D49L EcoRI PvuI RsrII PstI D44R XhoI D45R D46R D47R D48R AatI XcaI NsiI 73 Ø6.5 D57R 75 R3.8 6.3 R6.5 6 D57L D56R HindIII EciI 306 255 267 6.5 6.7 D57L HindIII 402 7 BstEII 223 172 7.7 7.3 D59L AvrII D58R EcoRI D58L D57R PfoI AvaI PacI 300 D49R PacI NdeI 1611 35 ø9 8 D60L D61L D59R BsiWI D60R PvuI 14 AvaI 2244 15 Endy, MIT April 2005 35 464 ø10 9 D62L D61R EagI NciI 591 1038 10A D64L D63L D62RSacII D63R HindIII ScaI BstBI ApaLI 3520 16 437 ø17 591 Tø 1662 17 KasI BglI 2382 D67L D68L D66R ApaI D67R EcoRI BlpI 204 17.5 270 18 2382 53 460 E 3 12 D69L D68R BsiWI BspDI R18.5 3 12 11 D65L D66L D64R BamHI D65R XmaI FspI 35 73 D70L D69R PstI DraIII AcvI 62 R13 417 ø13 D71L D70R SalI 13 D71R AciI 1761 18.5/18.7 19/19.2/19.3 KpnI 35 øOR 150 19.5 160 SRR/TR 10 Section alpha (1 8,311 bp) Endy, MIT April 2005 Section beta (8,311 12,179 bp) 11 Wild-Type T7 (T7+) Endy, MIT April 2005 Refactor[1-12,179]:T7+ 12 Kuroda-Kawaguchi et al., Nature Genetics 29:279 (2001) Endy, MIT April 2005 13 Nature & Form - Pre-existing - Immutable Nature & Change - Pre-existing - Immutable - Changing - Evolution Human & Engineer - Pre-existing - Immutable - Changing - Evolution - Rational design - New - Decoupled [e.g., disposable] Endy, MIT April 2005 14 Carlson, Pace & Proliferation of Biological Technologies, Biosec. & Bioterror. 1(3):1 (2003) Endy, MIT April 2005 15 Goto Parts Goto NCBI. Goto BH Goto Cinnagen Endy, MIT April 2005 16 Enabling Biological Engineering • Standardization of Components – Predictable performance – Off-the-shelf – ME, 1800s • Abstraction – Insulate relevant characteristics from overwhelming detail – Simple artifacts that can be used in combination – From Physics to EE, 1900s • Decoupling Design & Fabrication – Rules insulating design process from details of fabrication – Enable parts, device, and system designers to work together – VLSI electronics, 1970s Endy, MIT April 2005 17 Biological Risk (1) Past and ongoing work - Breeding - Animal release - Recombinant DNA technology (2) Liberal democracy in context of living world Endy, MIT April 2005 18 Biological Risk: Background Technology Classes Relevant to Biological Risk (current relative capabilities) Manipulation Detection Analysis Risk Response Endy, MIT April 2005 19 Biological Risk: Background Technology Classes Relevant to Biological Risk (current relative capabilities) Manipulation Detection Analysis Risk Response Endy, MIT April 2005 20 Biological Risk: Tactics as “Strategy” Anthrax vaccine Maginot Line France, 1940 SARS assay Ciprofloxacin VHF therapy (under construction) Plague vaccine (under construction) Endy, MIT April 2005 Smallpox vaccine 21 Biological Risk: Background Technology Classes Relevant to Biological Risk (current relative capabilities) Manipulation Detection Analysis Risk Response Endy, MIT April 2005 22 Biological Risk: Future Strategy Technology Classes Relevant to Future Biological Risk (needed capabilities) Manipulation Detection Risk Analysis Response Endy, MIT April 2005 23 Biological Risk: Suite of Solutions Number of Individuals Basic Researcher Garage Bio-Hacker Disgruntled Researcher Bin Laden Genetics, Inc. honorable Endy, MIT April 2005 Individual’s Intent dishonorable 24 Biological Risk: Hack the Living World? Endy, MIT April 2005 25 Endy, MIT April 2005 26 Endy, MIT April 2005 27 From: XXXX Subject: Endy Letter Date: January 6, 2005 9:45:17 AM EST To: endy@mit.edu Dr. Endy, I am a sophomore at XXXXX High School in Connecticut and have recently taken an interest in Synthetic Biology.I am writing to ask for your help because i am having difficulty in obtaining information,and understanding some of the information i already have. Anything you can send my way would be greatly appreciated… …I will soon begin working on a proposal to create a BioBrick, any information you can send me on their creation would be excellent. -Sincerely, XXXX XXXX XXXX High School -Grade 10 Endy, MIT April 2005 28 A Constructive Society Endy, MIT April 2005 29 A Constructive Society Endy, MIT April 2005 30 UT SB Competition Team c/o Jeff Tabor Endy, MIT April 2005 31 UT SB Competition Team Photons BBa_I15010 Light PoPS BBa_R0082 Receiver PoPS BBa_B0034 PoPS Color BBa_E0033 Converter BBa_B0015 c/o Jeff Tabor Endy, MIT April 2005 32 UT SB Competition Team Lens ripped off of overhead projector Casserole dish Thermostable chassis Pile of cells/agar c/o Jeff Tabor Endy, MIT April 2005 33 UT SB Competition Team c/o Jeff Tabor Endy, MIT April 2005 34 iGEM 2005, 2006, … 2003 - MIT IAP (Blinkers) 2004 - MIT IAP (Polkadots) 2004 - BU, Caltech, MIT, Princeton, UT Austin (FSMs) 2005 - Intercollegiate Genetically Engineered Machine (iGEM) Competition Caltech Davidson Harvard MIT Toronto UCSF/SFSU UT Austin Oklahoma Princeton Cambridge ETH Zurich Penn State UC Berkeley 2006 - Intercollegiate Genetically Engineering Machine (iGEM) Competition Endy, MIT April 2005 35 • Technology Opportunities – General Infrastructure Supporting the Engineering of Biology • Built from early days with foresight – Detection, Analysis, Response • Students running a bio-detector on the corner of Ames & Main • Education Opportunities – Undergraduate Program in Biological Engineering – Code of Ethics & Standards of Practice for Biological Engineers • Would likely need to be backstopped by a professional society(s) • Policy Opportunities – Coherent (?!) organization of federal funding – Integration of research and policy – Broad societal acceptance of responsibility for manipulating genetic information – International transparency? – Transition from “threat specific” to “capabilities-based” strategy – Distribution of technology? Open or closed? Endy, MIT April 2005 36 Acknowledgements I would like to acknowledge Adam Arkin, Frances Arnold, Ralph Baric, Roger Brent, Jehoshua Bruck, Carlos Bustamante, Barry Canton, Rob Carlson, Leon Chan, Austin Che, Jim Collins, Lynn Conway, Ron Davis, Mita Desai, John Doyle, Eric Eisenstadt, Michael Elowitz, Stephanie Forrest, Timothy Gardner, Seth Goldstein, Homme Hellinga, George Homsy, Joe Jacobsen, Tom Kalil, Jay Keasling, Heather Keller, Doug Kirkpatrick, Tom Knight, Sri Kosuri, Patrick Lincoln, John Mulligan, Richard Murray, Radhika Nagpal, Richard Newton, Carl Pabo, Randy Rettberg, Pamela Silver, Brad Smith, Christina Smolke, Gerry Sussman, Samantha Sutton, Claire Tomlin, Jeffrey Way, Chris Webb, Ron Weiss, Scot Wolfe, Aarne Vesilind, other members of the lab and the MIT Synthetic Biology Working Group, and the students and instructors of the 2003/4 MIT IAP Synthetic Biology Labs and the 2004 Synthetic Biology Competition for their direct contributions to the material presented here and to my current thinking about how to best engineer biology. Endy, MIT April 2005 37
