Genetics - Mr. McCabe

Daily Question #19

1.

Your parents “came together”  to create you. List 5 specific “traits” that people say have and specifically who (parent/ grandparent) they say it comes from.

2. Define Genetics (in your own words).

3.

What are the “gametes” (sex cells) that came together to form the fertilized egg that become you?

4. What is a fertilized egg called?

5. Think of genetics, write down at least 5 words that you think have anything to do with genetics…

6. Look back in your notebook, find either the 5 characteristics of life, or the 3 parts of the cell theory.

(or if you can remember them off the top of your head) 

Genetics Standard 2

Mutation and sexual reproduction lead to genetic variation in a population. As a basis for understanding this concept:

E. Students know why approximately half of an individuals DNA sequence comes from each parent.

F. Students know the role of chromosomes in determining an individual’s sex.

(NEW open entry) Left hand side on the very top, label it

“46=23”

CHROMOSOMES

Open your notebook to the page where you wrote 46=23

• DO NOT COPY YOUR HOMEWORK. If I see anyone copying or “sharing” work, you and they will receive a zero on the assignment. Do it on your own. It is NOT a group assignment.

• If you are not done with the worksheet, finish it now and turn it in. If you are done….

• Use the whole page (so draw big!) to draw the chromosomes found in your body. Try to be accurate with the colors.

DNA pairs – please draw and color on left side of notebook. This is not a DQ.

Try to be accurate with coloring

Daily Question #20

1. DNA coils in the nucleus to form _______.

2. The shape of a DNA molecule is a ______

________.

3. 1 set of chromosomes is called a ________.

4. How many pairs of chromosomes do you have in your body?

5. What are the two different sex chromosomes?

6. Nucleotides make up DNA. A typical human chromosome contains _____ billion nucleotides.

7. How much DNA information do you get from each parent?

6. A certain genetic condition occurs when a human has 47 chromosomes instead of 46. It causes problems in the way the body and brain develop and is the most common birth defect. It is also known as trisomy 21. What is this condition called?

Daily Question #20

Common physical signs include:

• Decreased muscle tone at birth

• Excess skin at the nape of the neck

• Flattened nose

• Separated joints between the bones of the skull

(sutures)

• Single crease in the palm of the hand

• Small ears

• Small mouth

• Upward slanting eyes

• Wide, short hands with short fingers

• White spots on the colored part of the eye (Brushfield spots)

Daily Question #21

1. What is a gamete?

2. What is haploid?

3. What is a diploid?

4.

If a trait from your father is “stronger” than the same trait from your mother, what is the genetic term to describe that?

5. What is on the inside of the chromosomes?

6. Where are the chromosomes located?

7. There are 3,000,000,000 nucleotides in your DNA strand, write that number in scientific notation.

REMEMBER YOUR STEPS!

8. What is a 3D printer ? How could it benefit biotechnology?

•Why do cells need to reproduce?

Chromosomes

• You produce roughly 2 trillion cells per day.

2,000,000,000,000!

• Cells, like all things have a LIFE CYCLE .

•As you grow your body NEEDS more “stuff”

•To get bigger, more complex, provide nutrients.

• Reproduction (mitosis) is needed for

• CELL GROWTH

• INJURY

• REPLACEMENT (DEATH) of other cells.

Chromosomes

•Why is understanding cell reproduction important to know?

•Biotechnology is an amazing field.

–Here are some things happening right now…

– Cell gun

– Printing body parts

•Because we know cells can replicate themselves so quickly and efficiently we can also learn more about our potential .

–Write down 5 WORDS you did not know the meaning…

–Write down 5 CONCEPTS/IDEAS, you thought were interesting.

•We know that life is amazing. Among all the

TRILLIONS of things that could go wrong, we still end up with beautiful people despite imperfections. Trisomy 13 and 18 are often fatal.

Trisomy 21 is the most common birth defect.

Here is 1 story of trisomy 13 (warning)

Mitosis with Allium (onion root tip)

• Cut out the 5 boxes (A,B,C,D,E). Grab one of the papers on the little desk next to my desk.

• When I give you the command you will go around the room, find a matching letter and draw the ONE cell that the pointer is on. DO

NOT CHANGE ANYTHING ON THE

MICROSCOPE! (except perhaps the eyepiece)

• Draw the cell ACCURATELY in your box, then move on. When you have them completed, return to your seat.

• QUIZ TOMORROW ON MITOSIS PHASES!

•Describe the structure and function of chromosomes…

Chromosomes

•Chromosomes are like Google…TONS of information stored in one convenient place.

Google has ONE site to search for everything.

• There are 46 chromosomes (in pairs) in almost every cell in your body.

• Each “pair” is almost identical, containing the same genes in the same order.

• Connected in the middle at the

“centromere”

SEX chromosome

XX=female

XY = Male


Chromosomes

• Chromosomes are like Google…TONS of information stored in one convenient place.

Google has ONE site to search for everything.

• There are 46 chromosomes (in pairs) in almost every cell in your body.

• Each “pair” is almost identical, containing the same genes in the same order.

•Down syndrome (called trisomy 21) is where you have an extra chromosome in the 21 st “pair.

•Trisomy 18

• trisomy 13

• Homework Left hand side chapter 10.2 mitosis.

Words (include page numbers, do NOT use the glossary!) – cell cycle, interphase, cytokinesis, spindle, centrosome.

• Questions 1, 2, 3, 4 (include page numbers!

•Down Syndrome has 3 main characteristics

•Physical, medical, and cognitive (developmental).

· A flattened appearance to the face

· A high, broad forehead

· A smaller head, proportionately

· An upward slant to the eyes

· A narrow slit to the eyes

· Pronounced bags or folds under the eyes

· A small, depressed nose

· Small ears

· Ears set quite low to the face

· A small mouth

· A large or protruding tongue

· A short neck

· Short arms and legs

· Short fingers and toes

· Large space between the first and second toe

· A single, deep crease in the center of the palm

· Poor muscle tone (hypotonia)

· Loose joints (hyperflexability)

· Weak reflexes

Chromosomes 6.1

•Describe the structure and

Google has ONE site to search for everything.

function of chromosomes… every cell in your body. tiny little sperm and 1 tiny little egg that

• Each “pair” is almost identical, containing became you: hair color, eye color, pair.

• A haploid cell contains only 1 CHROMATID of the chromosomes in order to be ½ of the genes of an offspring.

• A gamete is a haploid cell that contains the genetic info you got from your parents.

Sperm (haploid) + egg (haploid) = diploid..you

!


Chromosomes

• Chromosomes are located in a cells nucleus.

• Each chromosome contains one long thread of DNA (if spread out would be about 5cm long) that is wound around proteins

(hairdryer!)

•DNA has 2 strands wound together that contains all the info necessary for that cell.

• Each DNA strand has its own order of nucleotides bonded together. Its like having a combination lock…hundreds of combinations.

•But DNA has 3,000,000,000 nucleotides so that would be 4x10 3,000,000,000 combinations.

•Its like having a lock with 3,000,000,000 numbers on it.

• Turn in your worksheet from yesterday on the table next to the desk (on the left, near the sink). Have your homework ready for me to check.

• You will have your mitosis quiz after daily questions.

Daily Question #22

1.

** Which of the following BEST describes meiosis?

a.

It is carried out in all tissues that require cell replacement b.

It occurs only in cells in the reproductive structures of the organism c.

It happens in all tissues except the brain and spinal cord d.

It is the first stage of mitosis.

2.

Which element from the periodic table is essential for building amino acids/proteins?

3.

What is the difference between a scientific theory and a hypothesis?

4.

During which phase of mitosis does the cell split into 2 identical cells.

5.

Which “phase” does a cell spend most of its lifetime in?

6.

In order starting, with mitosis, what is the lifecycle of a cell?

•Describe the process of mitosis

Mitosis 6.2

•In order to survive and reproduce cells must divide.

•When cells get to be a certain size it either stops growing or divides.

•Eukaryotic cells divide to form

2 nuclei to make 2 identical copies.

•This process is called

MITOSIS. (MI-TWO-SIS)

Animation

• (interphase)

• Prophase

• Metaphase

• Anaphase

• Telophase

• cytokinesis

Mitosis

•Describe the 5 stages of mitosis

Mitosis

•Cells spend most of their lives in

“interphase”. Interphase is the time between each cell division.

•“inter” comes from latin meaning

“between” so interphase really means the “between” phase. Interphase can be minutes, days, or years for some cells. Nerve cells and some muscle cells never complete a cycle.

•Right before mitosis the DNA copies itself so that each cell will be identical.

•“INTERPHASE” is sometimes considered the first stage of mitosis…

•PROPHASE

Mitosis

•Prophase is the first phase of mitosis.

•Chromosomes coil, the nuclear env. Breaks apart, and protein spindle fibers (called microtubules) from the centrosomes assemble across the cell directing the chromosomes where to go.

•METAPHASE

Mitosis

•Metaphase is the second stage of Mitosis.

• (some call it the third stage only when they count “interphase” as the 1 st phase)

•Chromosomes line up in the center of the cell and attach themselves to the microtubules.

•ANAPHASE

Mitosis

•Anaphase is the 3 rd stage of mitosis.

•Each chromosome separates in half (into chromatids) and they are “reeled” in like a fish on a fishing pole towards the opposite sides of the cell.

•Microtubules begin to break down.

•TELOPHASE

Mitosis

•Telophase is the 4 th stage of

Mitosis.

•In Telophase each cell now has a complete set of chromosomes, the nuclear envelope forms around them and they uncoil so proteins can be built.

•Microtubules dissapear

•CYTOKINESIS

Mitosis

•Cytokinesis is the final stage of Mitosis.

•Cytokinesis is where the cytoplasm of the cell is pinched creating 2 identical cells.

•These 2 new cells are then free to divide again on their own etc…

•Describe the cell cycle.

Cell Cycle

•Each cell goes through its own cycle.

•Most of a cells life is spent in the 3 subphases of interphase.

•The M phase (mitosis phase), G1

(gap 1, growth) is the first phase of interphase, S phase (2 nd phase of interphase) is where DNA is synthesized (replicated), G2 (gap 2, growth and preparation for mitosis).

CO- Students will learn the distinct parts of interphase.

LO- Students will produce a graphic organizer of interphase.



•Cell cycle vs

No cell lives forever.

• Cell cycles can be triggered by genes or other proteins.

Cancer.

• Faulty cells (cancer cells) never stop replicating, spread throughout the body, shutting it down, killing the organism.

•Cancer cells break away from main cell, travel to other parts of the body and replicate there as well. This is called metastisizing.



•Most cancer cells have been found to have defects in the gene that regulates cell division.

• Mutations can cause cancer cells.

Factors can be environmental agents, and chemical agents (like cigarette smoke).

Standard 2a

a. Students know meiosis is an early step in sexual reproduction in which the pairs of chromosomes separate and segregate randomly during cell division to reproduce gametes containing one chromosome of each type.

b. Only certain cells in a multicellular organism undergo meiosis.

c. How random chromosome segregation explains the probability that a particular allele will be in a gamete.



Daily Question #38

After you finish DQ 38 you will need a separate piece of paper (1/2 sheet) to write some questions on.

Set the half sheet aside for now until you need it (follow the directions on

DQ 38)

Daily Question #38

1. Name the five stages of mitosis.

2. What stage does a cell spend most of its life in?

3. What is the main difference between the process of meiosis and mitosis?

4. What is the G1 phase of the cell cycle?

5.

What happens during the S phase of a cell’s cycle?

6. What is the G2 phase of the cell cycle?

7. What is a fertilized egg called?

8. What are sperm and egg cells called?

9. Next, get a half sheet out and write down the following questions…

Meiosis

1.

They ________ genetic information from ____ to ____ through the process of ____ and ____.

2.

Every cell in our body has ____ chromosomes.

3.

Homologous chromosomes are a pair of _____ chromosomes found in a ____ cell.

4.

Label all of the phases of meiosis.

5.

n + n = ___ (haploid + haploid = ______)

6.

What is “crossing over”?

7.

What is non disjunction?

8.

What is turners syndrome? Does it happen in men?

9.

If you are 40 what is the ratio or probability that you will have a chromosome disorder like downs syndrome.

10. What are some advantages in sexual reproduction?

11. What is a mutation?

Mitosis Worksheet

• Use your notebook (NO TEXTBOOKS YET!) to help you solve as many questions as you can. If you get stuck, use the book and the internet as a resource. Due Friday.

• Have your notebook on your desk so I can check your homework.

• Want extra credit? I will give you 15 points extra credit in your test category if you go to the following website http://tinyurl.com/cctdj35 follow the directions and complete the entire process (print out the pages so you can write on them, to turn in) due monday

Daily Questions # 39

(look in your notes!)

1. What is a gamete?

2. Are gametes haploid or diploid?

3. Meiosis is a two stage process. The first stage reduces the number of chromosomes by

_____. The second stage separates identical copies of _______.

4. What is crossing over?

5. Crossing over is important because it makes sure the no two sets of chromosomes are

_______.

6. Crossing over produces a wide array of genetic _______ in a population.

7. Mitosis produces how many identical cells?

8. Meiosis produces how many daughter cells?

Meiosis!

• Draw the following picture (on next slide) large on an open left hand side of your notebook.

• Homework!

– Meiosis Worksheet due tomorrow! (you will get it today)

– Meiosis Lab tomorrow

– Mitosis/Meiosis quiz on Wednesday (minimum day.)

• How fast we work will dictate how fast we get to IAL

CO- Students will compare the process of mitosis with meiosis

LO- Students will take practice quiz as refresher, and create graphic organizer for Meiosis.

MEIOSIS 1

Phases of meiosis draw LARGE on left hand side

Meiosis 1

Prophase 1

Metaphase 1

Anaphase 1

Telophase 1

Cytokinesis

MEIOSIS 2

Meiosis 2

Prophase 2

Metaphase 2

Anaphase 2

Telophase 2

Cytokinesis 2



•Describe Mieosis

Meiosis

•We learned a gamete is a reproductive cell (sperm/egg).

Human cells have 46 chromosomes (2 pair of 23), gametes are haploid and only contain 23.

•Two gametes give half of DNA to offspring totalling 46 chrom.

•Gametes are formed via meiosis.



•Describe Mieosis

Meiosis

• Meiosis is a type of nuclear division that takes place in 2 stages (meiosis 1 and meiosis2)

•The 2N (Diploid) Parent chromosomes separate.



•Describe Mieosis

Meiosis

•Parent chromosomes are copied. (92 total)



•Describe Mieosis

Meiosis

•Like Chromosomes

(homologous) pair up together.





•Describe Mieosis •Chromosomes “swap” sections of DNA (crossing over).

•This creates a mix of new genetic material in the offspring's cells.

•Describe Mieosis

Meiosis

•That nucleus divides into 2

“daughter” cells. With a mix if genetic info.

•Each now has 46 chromosomes (2n)



•Describe Mieosis

Meiosis

•Daughter nuclei divide again producing 4 haploid (n) cells

(contains “half” of the genetic info, or 23 chromosomes)

•Chromosomes divide, daughter nuclei end up with single chromosome (chromotid) with new genetic mix.



• In males, the 4 1n haploids develop

“heads” and “tails”.

• In females, out of the 4, 1n haploids, usually only 1 survives. The others (polar bodies) usually are absorbed by the body and do not develop.



•Why is crossing over important?

Meiosis 1

•Crossing over is vital.

•When two haploid (n) cells combine, the resulting cell is a diploid (2n)

•It received 1 of each type of chromosome from each “pair”.

•importance, it will help that person have traits that may help it survive better.

•People are getting taller, stronger and faster because of crossing over.

Genetics!

• Shake what yo mama gave you!

Standard 2

d. students know combinations of alleles may be generated in a zygote through the fusion of male and female gametes (fertilization).

g. how to predict possible combinations of alleles in a zygote from the genetic make up of parents.

STANDARD 3

Multicellular organism develops from a single zygote, and its phenotype depends on its genotype which happens at fertilization.

a. students know how to predict the probable outcome of phenotypes in a genetic cross from the genotypes from parents either dominant or recessive.

b.

Students know the genetic basis for Mendel’s laws of segregation and independent assortment.

Daily Question #23

2 test questions, Slide will change in 6 minutes.

Daily Question #23

1. ** In fruit flies, the gene for red eyes (R) is dominant and the gene for sepia eyes (r) is recessive. What are the possible combinations of genes in the offspring of two red-eyed heterozygous flies (Rr)?

a. RR only b. Rr and rr only c. rr only d. RR, Rr, and rr only

2. **Mendel hypothesized that reproductive cells have only one factor for each inherited trait. This hypothesis is supported by the observation that.

a. Haploid cells are produced by mitosis b. Diploid cells are produced by mitosis c.

Haploid cells are produced by meiosis d. Diploid cells are produced by meiosis

Daily Question #23

3. Put these in order from smallest to largest: Chromosome, nucleotide, chromatid, nucleic acid, nitrogen, Cell,

Nucleus.

4. Describe how a DNA mutation could be a GOOD thing.

5. Cell Division is a normal process, what makes CANCER so bad/fatal.

6. What is a dominant trait?

7. What is a recessive trait?

Daily Question #23

1. ** In fruit flies, the gene for red eyes (R) is dominant and the gene for sepia eyes (r) is recessive. What are the possible combinations of genes in the offspring of two red-eyed heterozygous flies (Rr)?

a. RR only b. Rr and rr only c. rr only d. RR, Rr, and rr only

2. **Mendel hypothesized that reproductive cells have only one factor for each inherited trait. This hypothesis is supported by the observation that.

a. Haploid cells are produced by mitosis b. Diploid cells are produced by mitosis c.

Haploid cells are produced by meiosis d. Diploid cells are produced by meiosis

Daily Question #23

3. Put these in order from smallest to largest: Chromosome, nucleotide, chromatid, nucleic acid, nitrogen, Cell,

Nucleus.

4. Describe how a DNA mutation could be a GOOD thing.

5. Cell Division is a normal process, what makes CANCER so bad/fatal.

6. What is a dominant trait?

7. What is a recessive trait?

•What is the scientific study of heredity.

•Who was Gregor

Mendel

Genetics

•The scientific study of heredity is called genetics.

•Gregor Mendel was monk who studied the genetics of pea plants.

•He applied math towards the probability of traits of garden peas to be certain colors/shapes.

•He used self fertilization (where plants can fertilize themselves b/c) or cross fertilization (where plants pollinate other plants).

Daily Question #24

1.

What type of plants did Mendel use to conduct his experiments on genetics on?

2.

List 3 reasons why he used them.

3.

Describe his 3 step method for fertilizing his pea plants.

4.

Describe self fertilization.

5.

Describe cross fertilization.

6.

You have a blue shirt and a red shirt, jeans and shorts. List all the possible combinations you could wear. (draw a punnet square if you dare... Bwahahahahahahahahaha)

•Describe

Mendel’s 3 step experiment.

Genetics

1. Produced PURE breading strains.

These offspring produced only 1 kind of trait i.e. flower color, pea shape, etc. He called these pure plants the parental generation

(parents) or the P generation . He had multiple pure pea plants for different traits.

•Describe


Genetics

2. Crossed 2 different varieties purple and white in the P generation through cross polination and collected the seeds. These were called the filial generation or F1 .

Offspring were all “hybrid”.

What is a hybrid?

P1

•Describe


Genetics

3 . Mendel allowed the F1 generation to SELF fertilize to produce the F2 generation of plants. He noticed that white flowers reappeared .

He added math to try and understand the ratio of plants. In the F2 generation the ration was 3:1 or 75% of the plants were purple, and 25% of the plants were white.

IF you did this experiment, what conclusions could you come up with on why the plants would turn out this color?

Genetics

With Mendels tests he came up with a set of rules that could be used to predict patterns of heredity.

In peas, there are different traits: flower color, seed color, seed shape, pod color, flower height and flower position. In animals obviously there are a lot more.

•Describe

Mendel’s 5 heredity “rules”.

Genetics

1. parents transfer info about traits to offspring = “factors”

2.

Each individual has 2 “factors” for each trait. The factors may or may not have same info.

• SAME factors are homozygous .

BB for brown hair and bb for blonde.

• If they do NOT have the same factors, they will by heterozygous . For example Bb.

•Describe


Genetics

3. Alternative forms of a “factor” or gene are called alleles . Many alleles make up an organisms genotype.

This is the code for the genes.

Its like an xbox game. The disk you put in contains all the (same) info for that game in code. But each game is expressed differently on screen depending on the order of that code.

Genotype are the “codes”.

Phenotype is an organism’s physical appearance. brown or blonde hair etc... It’s the “physical” expression of that gene.

•Describe


Genetics

4 . An individual has 2 alleles for each trait. One from each parent.

Blonde hair for example has the allele b for blonde, and B for brown.

Alleles are passed on from parent to offspring.

•Describe


•Contrast between dominant and recessive alleles.

Genetics

5 . Just because one allele is present does not mean it will be expressed.

Some genes are dominant. Like arm wrestling. The dominant,

“stronger” allele will win over the recessive gene/allele.

Brown hair is a dominant gene so it is a capital B, blonde is a recessive gene so it is a lower case b.

Recessive genes are present but do not get expressed. You have to have a homozygous recessive gene (bb for blonde) in order to have that gene expressed. So that means you received both recessive traits from your parents.

Daily Question #25

• Slide will change automatically after 4 minutes, please write a complete sentences for your answer…

CO- Students will compare the relationships between homozygous and heterozygous and genotype and phenotype.

LO- Students will work on examples and actively take notes.

1.

Daily Question #25

2.



3.

Daily Question #25

4. Draw a punnet square crossing a male dwarf bearded dragon (dd) with a regular

(heterozygous) bearded dragon that carries the gene for dwarfism. List Genotype and phenotypes.

•Mendels conclusions



Genetics

• Because some attributes “disappear” for a generation, he concluded there must be 2 factors for each genetic trait: Mendel’s first law, the law of segregation

• The L of segregation states that the members of each pair of alleles separate when gametes are formed. A gamete receives one allele or the other

• Genes for two different traits don’t always stay together: Mendel’s second law, law of independent assortment

• The L of Ind. Ass. States that 2 or more pairs of alleles separate independently of one another during gamete formation.

• Mendel’s work showed that chromosomes were the carriers of heredity.

•Contrast between heterozygous and homozygous

•Contrast genotype and phenotype

Genetics



Genetics

A HETEROZYGOUS trait is a trait with two different ALLELES.

Example?

Brown hair – Allele = B (dominant)

Blonde hair – Allele = b (recessive)

HETEROZYGOUS would be Bb

A HOMOZYGOUS trait is a trait with the

SAME alleles.

Example?

Homozygous for Brown hair

SEE THE DIFFERENCE?

– Alleles = BB

Homozygous for Blonde hair – Alleles = bb



Here are a few traits…

Brown hair – B

Blonde hair

– b

Hitchhiker thumb – H

Genetics

Straight hair - S



curly hair - s attached ear lobes – L

Non-hitchhiker thumb – h unattached ear lobes – l

Write down your answers!

1. What is the homozygous recessive for curly hair?

2. What is the homozygous dominant for Brown hair?

3. What is the heterozygous trait for attached/unattached ear lobes?

4. What is the heterozygous trait for thumbs?

5. Homozygous dominant for thumbs.

6. Heterozygous for curly/straight hair.

Here are a few traits…

Brown hair – B

Blonde hair

– b

Hitchhiker thumb – H

Genetics

Straight hair - S curly hair - s



attached ear lobes – L

Non-hitchhiker thumb – h unattached ear lobes – l

GENOTYPE vs. PHENOTYPE

A GENOTYPE are the alleles used to describe a gene. For example Bb is the genotype (heterozygous) for which trait?

Genotypes can be any letters.

A PHENOTYPE is the physical expression of that gene, or what that gene does to the organism.

So what is the phenotype for s?

What are the genotypes for thumbs?

What is the phenotype for L?

Genetics

You will have a quiz on your reading.

I will check your homework AFTER the quiz.

Everything cleared off (in 5 minutes) of your desk for the quiz.

If you brought colored pencils/crayons, have them out on your desk.

CO- Students will compare the different nucleotides that create genetic diversity in the DNA strand on the chromosome.

LO- Students will take a quiz on the functions then do active reading/coloring of DNA parts.

A. Bb

B. bb

C. BB

D. Ss

E. Dominant

A. SS

B. ss

C. Ff

D. ff

E. Recessive

A. homozygous

B. heterozygous

C. genotype

D. phenotype

E. allele

1. Alleles that produce a physical (detectable) trait of an organism.

2. An allele that does not achieve expression but is still present in an individual.

3. A specific combination of alleles in an individuals DNA.

4. This describes an organism that has 2 different alleles of a particular gene.

5. One of the two or more of an alternative forms of a gene, leading to a unique trait.

A. Bb

B. bb

C. BB

D. Ss

E. Dominant

A. SS

B. ss

C. Ff

D. ff

E. Recessive

A. homozygous

B. heterozygous

C. genotype

D. phenotype

E. allele

6. An allele that achieves expression when it is present in an individual.

7. Describes a an organism that has 2 of the same alleles of a particular gene.

8. Which of the above is homozygous dominant for the allele for Brown fur (B)?

9. Which of the above would be heterozygous for spots (s)?

10. A male, no freckles (Ff) and a female, no freckles (Ff) have children. (ff) is recessive for freckles. Which genotype from above would be most common for their kids?

Heterozygous

Homozygous

Genotype phenotype

Mendel…taking a pea

Daily Question #26

1. A killer whale with 3 spots (KK) mates with a killer whale with 1 spot (kk) draw a punnet square and list the possible genotype and phenotypes for the offspring. (Kk= 2 spots).

2.

What do we call the gene that “controls” a trait (stronger)?

3. Who was the scientist that made the most notable contributions to genetics?

4. In a gene what does a capital letter stand for?

5. A lower case letter?

Daily Question #26

6.

Construct a cross between a male heterozygous brown haired hamster and a female heterozygous brown haired hamster.

B= black, b= white, Bb= brown P1

Include all possible genotypes

And phenotypes.

Genotypes=

Phenotypes=

P2

Daily Question #27

1. A heterozygous tiger salamander with yellow stripes, is crossed with a heterozygous tiger salamander. Yellow is dominant with a rare recessive trait of making red stripes. Construct a punnet square and list all possible geno and pheno types.

2. Using the words: ribosome(s), protein(s),

DNA, Nucleus, Cytoplasm, mRNA, and replication, describe the process of protein synthesis (the making of) starting with the instructions from the DNA molecule.

3. Get a separate piece of paper out and your paragraph from your coloring packet.

Daily Question #28

1. How much genetic information do you get from your parents?

2. What are the two sex cells (gametes) called?

3. What is a cell called that contains all 46 chromosomes?

4. What is a cell called that contains 23 chromosomes?

5. Albinism is a rare recessive trait among turtles

(a). What is the probability of albinism in turtle offspring if two heterozygous parents that carry the albino gene mate? Create a punnet square.

Daily Questions #29

1. Name the four nucleotide bases found on your

DNA strand.

2. What is the Base Pair Rule and how does it work?

3. What are the 3 parts that make up a nucleotide?

4. Which organelle in the cell makes proteins?

5. A normal healthy cheetah (F) is crossed with a heterozygous cheetah carrying a recessive (f) allele that affects muscle tone, making the cheetah slower. Draw a punnet square, list the possible geno and phenotypes.

•Patterns of inheritance

Genetics

• Mendel concluded that genes combing according to probability.

• The probability of parents have an offspring with a certain trait depends on the traits THEY have to pass on.

• Punnet squares are an easy way to illustrate this probability.

WW ww

Patterns of Inheritance

•What is a punnett • Punnett squares help us visualize how often a gene will be expressed in offspring. For square?

convenience, letters are used to represent alleles for a specific trait. Lets go back to

Mendel’s peas.

WW

• Mendel bred “true” or “pure” traits. A purple pea flower is Dominant so it will be “W”. A

White pea flower is recessive so it will be “w”.

A homozygous purple=WW and white = ww.

(Hom, Purple)

W

W

(hom, white) w ww w

•What is a punnett square?

Genetics

• So all of our offspring for F1 turned out to be Ww.

• Is Ww heterozygous or homozygous?

• What gene will be “expressed”?

• What happens if we cross those two to make F2 generation?

• Which will yield purple flowers and which white?

W

Ww w

W

Ww w

•What is a punnett square?

Genetics

• A Dihybrid cross is a little trickier.

• Dihybrid crosses show 2 traits of interest.

• Dihybrid crosses contain 16 boxes.

• Lets cross 2 traits color and seed shape

YyRr= YR, Yr, yR, yr

•What is a punnett • Parents (P) = Yellow, round seed (YyRr) and

Yellow round seed (YyRr).

square?

Yellow, round seed (YyRr)

Yellow, round seed (YyRr)

YR Yr yR yr

YR

Yr yR yr

YYRR YYRr YyRR

YyRr YYRr

YyRR

YYrr

YyRr

YyRr Yyrr yyRR yyRr

YyRr

Yyrr yyRr yyrr


1. When 2 traits BLEND together, like a red flower and white flower making a pink flower, what is it called?

2. When 2 traits or genes are BOTH expressed together, it is called ______

Homework!

homework:

Ch. 12.4, vocab: codominance , polygenic character, incomplete dominance .

Questions: 1, 2, 3, 5.

Don’t forget your page numbers!


1. Which part of the cell is responsible for making proteins?

2. Proteins are long chains of _____ _____.

3. DNA is coiled up into shapes called _____, they are located in the _____ of almost every cell of your body.

4. A nucleotide has 3 parts: a phosphorus, a ______ and 1 of 4 ______.

5. The 4 bases of a nucleotide are ______, ______,

______, ______.

6. The base pair rule says that _____ always bonds with ______ and _____ always bonds with _____.

7. In mRNA, ______ is replaced by ______.

•Other heredity factors

Genetics

• Two traits can blend creating an incomplete dominance . (Like our example with black and blonde hair = brown hair.)

• Or in the case of a red flower mixed with a white flower making pink flowers. A blend of both.

• Or straight hair from parent and curly hair from parent producing “wavy” hair in children.


Genetics

• Two traits can blend creating an incomplete dominance. (Like our example with black and blonde hair = brown hair.)

• Or in the case of a red flower mixed with a white flower making pink flowers. A blend of both.

• In some cases both genes (heterozygote) are expressed called codominance.

• A “roan” coat in horses is where both traits are expressed so you have both white hairs and black hairs and red hairs showing up instead of one solid color.


Genetics

• Some traits are controlled by genes that have more than 2 alleles.

• Blood type in humans is controlled by multiple alleles.

• A,B,O = AA, AO, BB, BO, AB, O+/-

• Some traits are controlled by many genes = polygenic.

• Polygenic genes control (in humans) height, weight, body build, hair and skin color.

• Gene expressions can be affected by environment (temperature etc..)

• Some animals change colors, like arctic fox, controlled by enzymes that stop producing in summer.

•How did

Understanding DNA

• Scientists did not know whether it was DNA or the proteins that store and transmit genetic scientists identify traits.

DNA?

• There were several studies with bacteria that gave them answers.

•How did


• 1928, London, Frederick Griffith used mice to test virulent and non-virulent bacteria called scientists identify pneumococcus.

DNA?

• Virulent bacteria formed “smooth” colonies in petri dishes, and nonvirulent formed “rough” colonies in petri dishes.

• Virulent bacteria injected in mice killed them.

• Nonvirulent injected did not harm mice

• Virulent bacteria killed with heat, did not harm mice

• Mixture of non-virulent and heat-killed virulent bacteria killed mice…why?

• The non-virulent bacteria went through transformation and became virulent by taking in parts of virulent bacteria.

•How did


• Oswald Avery, 1944, New York, copied experiment that Griffith did and noticed that scientists identify transformation did NOT occur when

DNA?

destroying enzymes killed the DNA.

• Most scientists still held on to the idea that the proteins held genetic material though.

So…

• Hershey and Chase confirmed this through radiation marked bacteria.

• Here is how they work…

• So…what the heck, WHY is this important?!?!

• Vaccinations have saved billions of lives by being able to blocking viruses from taking over your body! You would be dead.

• Yeah pretty important.


1. From your DNA homework case study, do you think t was right or wrong?

2. List 2 pieces of evidence that support your conclusion.

3. Draw the image and complete the following: a) Circle a nucleotide.

b) Label the sugar and phosphate.

c) Label the bases that are blank

You’ve got the cutest little babyface!

Bio technology has allowed us to determine or make an educated guess (very accurately I might add) about which traits will most likely get passed down to your children.

There’s even an app for that!

For example:

CO-Students will explore DNA and Chromosomes in terms of genes and their instructions for passing traits from parents to offspring.

LOStudents will work in pairs to determine which traits their “offspring” will have and then draw their baby’s face.











+







+







Using the “class set” and your lab paper, FOLLOW THE

INSTRUCTIONS on how to choose the traits for your baby and compose a portrait of that baby using the specified trait diagrams.

Good luck… 



STANDARD 4

The genetic composition of cells can be altered by incorporation of exogenous

DNA into the cells. As a basis for understanding this concept: a. Students know the general structures and functions of DNA, RNA, and protein b. Students know how to apply base-pairing rules to explain precise copying of DNA during semi-conservative replication and transcription of information from DNA into mRNA.

c. Students know genetic engineering

(biotechnology) is used to produce novel biomedical and agricultural products.

Daily Question #32

LOOKIN NB!

The following are test questions, rewrite the question and the answer. (you don’t have to draw the chart)

Slides will change automatically.

Daily Question #32

LOOKIN NB!

*1. A strand of mRNA containing the repeating sequence

AAGAAGAAGUAA could code for which sequence?

a. lys-arg-glu-lys b. ser-ser-glu-glu c. lys-arg-lys-arg c. lys-lys-lyse-stop

30 seconds!

Daily Question #32

LOOKIN NB!

*2. The following sequence of DNA is part of a gene. How many amino acids are coded for by this segment?

5’ ATCAGCGCTGGC 3’ a. 8 b. 4 c. 12 d. 20

*3. A scientist puts nucleotide chains of AAAAAA in a test tube under conditions allowing protein synthesis. Soon the tube is full of polypeptide chains of only the amino acid lysine. What does this experiment show?

a. Amino Acid Lysine is composed of adenine.

b. AAA codes for the amino acid lysine 30 seconds!

c. Protein synthesis malfunctions in test tubes.

d. most proteins contain only one type of amino acid.

Daily Question #32

LOOKIN NB!

*4. Which of these would MOST likely cause a mutation?

a. the placement of ribosomes on the endoplasmic reticulum b. the insertion of a nucleotide into DNA c. the movement of tRNA out of the nucleus d. the release of mRNA from DNA

*5. the clear protein of an egg white becomes opaque and firm when cooked because the heat a. mutates the DNA b. turns the protein into carbohydrates c. stops protein formation d. changes the protein structure

30 seconds!

Daily Question #32

LOOKIN NB!

6. The following segment of DNA has undergone a mutation in which three nucleotides have been deleted. A repair enzyme would replace them with

5’ G T A _ _ _ A A 3’

3’ C A T GCA T T 5’ a. CGT b. GCA c. CTG d. GTA

30 seconds!

Daily Question #32

LOOKIN NB!

*1. A strand of mRNA containing the repeating sequence

AAGAAGAAGUAA could code for which sequence?

a. lys-arg-glu-lys b. ser-ser-glu-glu c. lys-arg-lys-arg c. lys-lys-lyse-stop

Daily Question #32

LOOKIN NB!

*2. The following sequence of DNA is part of a gene. How many amino acids are coded for by this segment?

5’ ATCAGCGCTGGC 3’ a. 8 b. 4 c. 12 d. 20

*3. A scientist puts nucleotide chains of AAAAAA in a test tube under conditions allowing protein synthesis. Soon the tube is full of polypeptide chains of only the amino acid lysine. What does this experiment show?

a. Amino Acid Lysine is composed of adenine.

b. AAA codes for the amino acid lysine c. Protein synthesis malfunctions in test tubes.

d. most proteins contain only one type of amino acid.

Daily Question #32

LOOKIN NB!

*4. Which of these would MOST likely cause a mutation?

a. the placement of ribosomes on the endoplasmic reticulum b. the insertion of a nucleotide into DNA c. the movement of tRNA out of the nucleus d. the release of mRNA from DNA

*5. the clear protein of an egg white becomes opaque and firm when cooked because the heat a. mutates the DNA b. turns the protein into carbohydrates c. stops protein formation d. changes the protein structure

Daily Question #32

LOOKIN NB!

6. The following segment of DNA has undergone a mutation in which three nucleotides have been deleted. A repair enzyme would replace them with

5’ G T A _ _ _ A A 3’

3’ C A T GCA T T 5’ a. CGT b. GCA c. CTG d. GTA

Baby Face

• You will have about 12 minutes to finish your baby face! It must have color.




• DNA is composed of nucleotides.

•Rosalind Franklin

• A nucleotide is composed of 3 parts: discovers DNA shape.

• A sugar (deoxyribose)

• A phosphate

• And a base.

CO-Students will identify the different parts of DNA, Nucleotides.

LO- Students will take active notes and draw examples of DNA and

Nucleotides.

• The base can be one of 4 kinds

• The 2 larger bases are called

PURINES

• Adenine

• Guanine

• The 2 smaller bases are called

PYRIMIDINES

• Thymine

• Cytosine


• Scientists discovered that the amount of one

•Rosalind Franklin base always equaled the amount of another discovers DNA base and they were always paired together.

shape.

• A & T (or T & A)

• G & C (or C & G)

• Known as Chargaff’s rule or the Base Pair

Rule (discovered by Erwin Chargaff).

• Rosalind Franklin then produced an image using xray diffraction showing DNA’s “double helix shape....like a tightly coiled spring.



Nucleotides.

Daily Question #33

LOOKIN NB!

The following are test questions, write down the question and your answer…

Your test is next week!!!

Daily Question #33

LOOKIN NB!

*1. Although there are a limited number of amino acids, many different types of proteins exist because a. size of a given amino acid can vary b. chemical composition of a given amino acid can vary c. sequence and number of amino acids is different d. same amino acid can have many different properties.

*2. How would a base sequence (ACAGTGC) be coded on mRNA?

a. TGTCACG c. UGUCACG b. GUGACAU d. CACUGUA

Daily Question #33

LOOKIN NB!

*3. The bacterium agrobacterium tumefaciens infects plants, and a portion of its DNA is inserted into the plants chromosomes. This causes the plant to produce gall cells which manufacture amino acids that the bacterium uses as food. This process is a natural example of a. poyploidy b. genetic manipulation c. grafting d. hybridization

Daily Question #33

LOOKIN NB!

*4. In carrier pigeons there is a rare inherited condition that causes the death of the chicks before hatching. In order for this disease to be passed from generation to generation there must be parent birds that a. are heterozygous for the disease b. have the disease themselves c. produce new mutations for this disease d. are closely interbred

Daily Question #33

LOOKIN NB!

*5. Mutations within a DNA sequence are

a. natural processes that produce genetic diversity b. natural processes that always affect the phenotype c. unnatural processes that always affect the phenotype d. unnatural processes that are harmful to genetic diversity.

6

. Put the following in order going from DNA to protein synthesis

Protein, DNA, translation, transcription, RNA

This is DNA to amino Acids (protein). Draw this in your notebook and complete what you think each strand would be, based off the given RNA strand.

You will need the amino acid chart for this one! So leave blank for now…

Daily Question #33

LOOKIN NB!

*1. Although there are a limited number of amino acids, many different types of proteins exist because a. size of a given amino acid can vary b. chemical composition of a given amino acid can vary c. sequence and number of amino acids is different d. same amino acid can have many different properties.

*2. How would a base sequence (ACAGTGC) be coded on mRNA?

a. TGTCACG c. UGUCACG b. GUGACAU d. CACUGUA

Daily Question #33

LOOKIN NB!

*3. The bacterium agrobacterium tumefaciens infects plants, and a portion of its DNA is inserted into the plants chromosomes. This causes the plant to produce gall cells which manufacture amino acids that the bacterium uses as food. This process is a natural example of a. poyploidy b. genetic manipulation c. grafting d. hybridization

Daily Question #33

LOOKIN NB!

*4. In carrier pigeons there is a rare inherited condition that causes the death of the chicks before hatching. In order for this disease to be passed from generation to generation there must be parent birds that a. are heterozygous for the disease b. have the disease themselves c. produce new mutations for this disease d. are closely interbred

Daily Question #33

LOOKIN NB!

*5. Mutations within a DNA sequence are

a. natural processes that produce genetic diversity b. natural processes that always affect the phenotype c. unnatural processes that always affect the phenotype d. unnatural processes that are harmful to genetic diversity.

6. Put the following in order going from DNA to protein synthesis

Protein, DNA, translation, transcription, RNA

Copy this chart in your notebook!

• Color!

Daily Questions #34

1. What is mRNA?

2. What is tRNA?

3. Put the following in order: transcription, translation, DNA, mRNA, tRNA, protein, amino acid.

4. Proteins are just long chains of what?

5. What are the four nucleotides used in a DNA strand?

6. What letters represent those nucleotides?

7. Name all the possible pairings that are possible between nucleotides?

8. What letter replaces T in mRNA and tRNA?


• DNA contains nucleotides that only bond with

•Watson and Crick certain pairs. AT, TA or GC, CG build DNA model

• The bases face each other and form together by a weak hydrogen bond.



Nucleotides.


• IF we are to pass on genetic info, that genetic

•DNA unzips to info needs to be copied like in a zerox get copied… machine. So how does it work?

• EASY!

• Since A and T always go together (in DNA), and G and C always go together…the DNA unzips, matches the bases with its opposite pair and shabam…copied!

• This process is called REPLICATION.

• DNA unzips, exposing the nucleotide sequence, DNA polymerase (enzyme) moves down the line pairing the bases together, a complimentary strand is formed and then they join back up making 2 identical copies.

• Think about the Kinex



Nucleotides.


•How proteins are • FIRST, DNA uncoils in nucleus made.

• mRNA is made by an enzyme RNA polymerase. Here, T is substituted by the amino acid U.

• mRNA leaves nucleus and enters the cytoplasm

• tRNA (transfer RNA) interprets code written on mRNA

• tRNA brings code to ribosome to make the protein.

• Once completed tRNA detaches and is free to go do its job all over again.

Lets look at it here .



Nucleotides.

So what the heck?

• Proteins are made in 3 steps:

– DNA gets copied. (each nucleotide)

– mRNA transcribes

– tRNA transposes to ribosomes

• Practice

Start with DNA, transcribe to mRNA, transpose to tRNA = amino acids

• ATC CGC GGG CTA AGT TTA AAA – DNA

- mRNA

- tRNA

Amino Acids

EVERY THREE NUCLEOTIDES CODES FOR AA.


• DNA strands are described by their position.

•DNA unzips to get copied…

• 5’ (prime) to 3’ is usually the top strand

5’

• 3’ to 5’ is the bottom strand (exactly opposite)

3’

3’

• Each sequence forms a “code” that is 5’ translated by the tRNA (transfer RNA) and the mRNA (messenger RNA) to create the amino acids for the proteins.

• Proteins then make up everything in your body!

So what the heck?

• Practice DNA, mRNA, tRNA, Amino Acids

• Remember every 3 nucleotides is an amino acid so……. How many AA are here?

• ATTGTACGCCCCGGGAAATATGAT

STANDARD 5

Genes are a set of instructions encoded in the DNA sequence of each organism that specify the sequence of amino acids in proteins characteristic of that organism. As a basis for understanding this concept

: c.

Students know how mutations in the DNA sequence of a gene may or may not affect the expression of the gene or the sequence of amino acids in an encoded protein.

d. Students know specialization of cells in multicellular organisms is usually due to different patterns of gene expression rather than to differences of the genes themselves.

e. Students know proteins can differ from one another in the number and sequence of amino acids.

The

(spc) cali

(spc) game

(spc) is

(spc) a

(spc) trippy

(spc) mind

(spc) state

Genetics - Mr. McCabe

Genetics Standard 2

Open your notebook to the page where you wrote 46=23

DNA pairs – please draw and color on left side of notebook. This is not a DQ.

Try to be accurate with coloring

Daily Question #20

Mitosis with Allium (onion root tip)

Mitosis

Standard 2a

After you finish DQ 38 you will need a separate piece of paper (1/2 sheet) to write some questions on.

Set the half sheet aside for now until you need it (follow the directions on

DQ 38)

Mitosis Worksheet

Daily Questions # 39

Meiosis!

Genetics!

Standard 2

STANDARD 3

Daily Questions #29

YyRr= YR, Yr, yR, yr

Daily Questions # 30

Homework!

Daily Questions # 30

Daily Questions # 31

You’ve got the cutest little babyface!

You’ve got the cutest little babyface!

You’ve got the cutest little babyface!

You’ve got the cutest little babyface!

You’ve got the cutest little babyface!

You’ve got the cutest little babyface!

You’ve got the cutest little babyface!

You’ve got the cutest little babyface!

You’ve got the cutest little babyface!

STANDARD 4

Baby Face

*5. Mutations within a DNA sequence are

6

*5. Mutations within a DNA sequence are

Copy this chart in your notebook!

Daily Questions #34

So what the heck?

So what the heck?

STANDARD 5

Related documents

Add this document to collection(s)

Add this document to saved

Suggest us how to improve StudyLib