Tutorial 4
What structure do DNA nucleotides and
RNA nucleotides have in common?
•
Both DNA and RNA nucleotides are each
composed of a pentose sugar, a
phosphate, and a nitrogen base.
Why is DNA replication termed
‘semiconservative’
•
‘Semiconservative’ refers to the fact that
each of the daughter molecule retains
one parental strand and has one new
strand; in other words, each is half new
and half old.
Explain the central dogma in molecular
biology
•
Transfer of biological information from
DNA to RNA to protein is call central
dogma of molecular biology. DNA directs
its own replication to produce new DNA.
The DNA of a gene is transcribed to
produce an RNA molecule that is
complementary to the DNA. The RNA
sequence is then translated into the
corresponding sequence of amino acids
to form a protein [8 marks]
On average, RNA polymerase makes one
error for every 10,000 nucleotides it
incorporates in RNA. By contras, only one
base pair error remains for every ten billion
base pairs during DNA replication. Explain
why the accuracy of RNA transcription is not
as critical as the accuracy of DNA replication.
•
DNA is the permanent repository of the
genetic information of an organism, thus
changes to the DNA result in permanent
changes in the genetic code. RNA is a
temporary copy of the genetic code, therefore
errors in RNA do not have lasting effect.
What is the difference between a
promoter sequence and origin?
•
A promoter is a DNA sequence that
initiates transcription; an origin is a point
where DNA replication begins.
What is the function of ligase during DNA
replication?
•
Ligase functions to anneal Okazaki
fragments during replication of the
lagging strand.
Discuss the step involved in cloning a gene
• i) Isolating the source/ gene of interest and vector
DNA. The DNA's must be relatively free of
contaminating materials which interfere with the
subsequent enzymatic steps.
• ii) Both the source and vector DNA are cut with
restriction enzymes. When sticky ends are formed
the DNA is cut with the same restriction enzyme(s),
but restriction enzyme that produce blunt ends also
work well in cloning.
• iii) The vector and source DNA are mixed with a
ligase system and covalently bonded together.
• iv) Finally, the ligated DNA is transformed into a host
cell. Usually the host cell is a competent bacterium,
but increasingly eukaryotic cells are being used.
After suitable growth has occurred the host cells are
examined for the presence of the source or cloned
DNA in its cytoplasm.
•
•
•
•
If molecules of mRNA have the following
nucleotide base sequences, what will be the
sequence of amino acids in polypeptides
synthesized in eukaryotic ribosomes?
a. AUGGGGAUACGCUACCCC
b. CCGUACAUGCUAAUCCCU
c. CCGAUGUAACCUCGAUCC
d. AUGCGGUCAGCCCCGUGA
•
•
•
•
a. Met-Gly-Ile-Arg-Tyr-Pro
b. Pro-Tyr-Met-Leu-Ile-Pro
c. Pro-Met (stop)
d. Met-Arg-Ser-Ala-Pro (stop, or SeCys)
Give definition about DNA
– replication
– transcription
– translation
•
replication – DNA replication is an anabolic
polymerization process, that allows a cell to
pass copies of its genome to its descendants.
The key to DNA replication is the
complementary structure of the two strands:
Adenine and guanine in one strand bond with
thymine and cytosine, respectively, in the
other. DNA replication is a simple concept - a
cell separates the two original strands and
uses each as a template for the synthesis of a
new complementary strand. Biologists say that
DNA replication is semiconservative because
each daughter DNA molecule is composed of
one original strand and one new strand.
•
Transcription – is a process of copying
information coded in DNA to RNA copy
of gene. Cells do not transfer the
information coded in DNA directly but
first make an RNA copy of gene.
•
Translation - Translation is the process
whereby ribosomes use the genetic
information of nucleotide sequences to
synthesize polypeptides composed of
specific amino acid sequences.
Beside the fact that it synthesizes RNA, how
does RNA polymerase differ in function from
DNA polymerase?
•
RNA polymerase acts to unwind or unzip
whereas in DNA replication helicase, not DNA
polymerase, performs this function. RNA
polymerase does not need a primer. DNA
polymerase acts as a proofreader to assure
accuracy in replication whereas RNA
polymerase does not. RNA is slower than
DNA. RNA incorporates ribonucleotides
instead of dexoyribonucleotides. Uracil is used
in RNA instead of thyamine.
Describe three artificial methods of introducing DNA
into cells.
• Electroporation
• Electroporation involves using an electrical current to
puncture microscopic holes through a cell's membrane
so that DNA can enter the cell from the environment.
Electroporation can be used on all types of cells,
though the thick-walled cells of fungi and algae must
first be converted to protoplasts, which are cells
whose cell walls have been enzymatically removed.
Cells treated by electroporation repair their
membranes and cell walls after a time.
• Protoplast fusion
• When protoplasts encounter one another,
their cytoplasmic membranes may fuse to
form a single cell that contains the
genomes of both "parent" cells. Exposure
to polyethylene glycol increases the rate of
fusion. The DNA from the two fused cells
recombines to form a recombinant
molecule. Scientists often use protoplast
fusion for the genetic modification of
plants.
• Injection
• Two types of injection are commonly used with larger
eukaryotic cells. Researchers use a gene gun
powered by a blank .22-caliber cartridge or
compressed gas to fire tiny tungsten or gold beads
coated with DNA into a target cell. The cell eventually
eliminates the inert metal beads. In microinjection, a
geneticist inserts DNA into a target cell with a glass
micropipette having a tip diameter smaller than that
of the cell or nucleus. Unlike electroporation and
protoplast fusion, injection can be used on intact
tissues such as in plant seeds. In every case, foreign
DNA that enters a cell remains in a cell's progeny
only if the DNA is self-replicating, as in the case of
plasmid and viral vectors, or if the DNA integrates
into a cellular chromosome by recombination.
Extra discussion
If a scientist synthesizes a DNA
molecule with the nucleotide base
sequence
TACGGGGGAGGGGGAGGGGGA and
then uses it for transcription and
translation, what would be the amino
acid sequence of the product?
The peptide sequence for this synthetic
DNA is:
Met-Pro-Pro-Pro-Pro-Pro-Pro.