CHAPTER 15: GENES AND HOW THEY WORK
WHERE DOES IT ALL FIT IN?
Chapter 15 takes the information on DNA structure and function in Chapter 14 and uses it to explain
gene expression. It is critical that students have a good understanding of nucleotides before
proceeding with Chapter 15. So, it is important that students have a fresh understanding of Chapters
12 and 13 before moving into gene expression. The concepts in Chapter 15 are essential for
understanding natural selection and development.
SYNOPSIS
The current model of heredity states that individual genes on chromosomes code for particular
polypeptides, which are then assembled into complex proteins. This is basically a two-step process
with the DNA coding for various forms of RNA, which are then used to produce a polypeptide.
There are three general classes of RNA derived from DNA; messenger RNA (mRNA), ribosomal
RNA (rRNA), and transfer RNA (tRNA). The first step, DNA to RNA, is called transcription. The
language of the molecules is basically the same (excluding the substitution of uracil for thymine), the
product is mRNA. The second step, RNA to protein, is called translation. There is a change in
language from the nucleic acid sequence of the RNA to the amino acid sequence of the protein
product. All three RNAs are involved in this process; mRNA is the blueprint, rRNA is the assembly
line machinery, and tRNA is the robot that delivers the amino acids from the supply room to the
assembly line. Both transcription and translation are ultimately controlled by various assembly
enzymes that recognize specific nucleotide sequences.
The genetic code that translates base pair sequence into amino acid sequence was deciphered by
several researchers, including Crick. Crick postulated that each letter of the code was a block of three
nucleotides, called a codon. Experimental data confirmed this and indicated that the code was a
simple linear arrangement not punctuated by intervening nucleotides. Each of the 64 possible codons
codes for a particular amino acid, a start or a stop signal. A few amino acids are represented by
several codons, while others are represented by only one or two. Individual activating enzymes
recognize certain short sequences in a specific region of the tRNA. Alteration of these sequences
attaches an amino acid other than that associated with its anticodon onto the tRNA. The genetic code
is almost universal. Except for a few exceptions, all organisms use the same genetic code.
Transcription, preparing the mRNA blueprint from the master DNA information, is completely
dependent on the complex molecule RNA polymerase. Unlike DNA replication, RNA transcription
does not require any primer. There are three main steps to transcription: initiation, elongation, and
termination. RNA polymerase recognizes a specific site on the coding strand of DNA and causes the
double helix to unwind forming a transcription bubble. The transcription bubble travels down the
length of the gene until an appropriate stop signal is reached and transcription is terminated. Unlike
DNA replication, RNA transcription has no proofreading capabilities. In eukaryotes, the initial RNA
transcript is modified before it leaves the nucleus. These modifications include addition of a 5’ cap,
3’ tail and removal of intervening sequences, known as introns. With the knowledge gained from the
Human Genome Project, it is apparent that introns may be removed in different patterns depending
on the cells expressing the gene. This phenomenon is alternative splicing.
120
The mechanism of protein synthesis is controlled by several enzymes and initiation factors that
accurately place the mRNA within the rRNA of the ribosome. Positioning is critical throughout the
process to ensure proper reading of the sequences so the polypeptide is made correctly. The ribosome
moves along the mRNA sequentially, reading the codon and adding a new amino acid to the growing
chain. When a stop signal is reached, the entire complex disassociates its components free to be used
elsewhere.
LEARNING OUTCOMES









Differentiate among the three kinds of RNA in terms of structure and function.
Understand the kind of code present in the nucleotide sequence of DNA.
Describe the process of transcription, its machinery, and end products.
Describe the process of translation, its machinery, and end products.
Understand how specific amino acids are added to the proper tRNAs.
Describe the process of protein synthesis.
Understand how transcription, translation, and protein synthesis are interrelated.
Know the differences between prokaryotic and eukaryotic protein synthesis.
Understand why eukaryotic gene transcripts must be spliced. How are introns and exons
involved?
COMMON STUDENT MISCONCEPTIONS
There is ample evidence in the educational literature that student misconceptions of information
will inhibit the learning of concepts related to the misinformation. The following concepts
covered in Chapter 15 are commonly the subject of student misconceptions. This information on
“bioliteracy” was collected from faculty and the science education literature.















Students think that DNA works independently to control the cell
Students do not fully understand the role of genetics and environment on determining
observable variation in organisms
Students think all genes code for proteins
Students believe that genes somehow contain all the information for a trait
Students confuse the terms transcription and translation
Students do not distinguish between prokaryotic and eukaryotic gene expression
Students believe tRNA fits perfectly on the mRNA triplet
Students believe that mRNA can only be produced from the sense strand
Students believe that the cell uses both DNA strands for transcription in eukaryotes
Students do not equate pre-mRNA with the presence of introns
Students believe that prokaryotes carry out pre-mRNA processing
Students believe that ribosomes have a passive role in translation
Students think that all mutations are bad
Students think that all mutation greatly disrupt the nucleotide sequence
Students think nondisjunctions are the only type of chromosome aberration
121
INSTRUCTIONAL STRATEGY PRESENTATION ASSISTANCE
Students may become confused with the three terms: transcription, translation, and
translocation. It is important to use the entire word and not shorthand when presenting the
material to the students. Also, describing the rationale behind the names is useful. Transcription
is essentially a process not unlike copying a set of class notes, whether by hand or by machine.
There is a slight difference between the original and the copy; the original notes may be written
in blue pen, the photocopy is composed of dark black carbon deposits. In the cell, the original is
double-stranded DNA containing thymine, the copy is single-stranded mRNA containing uracil.
Messenger RNA is simply a copy of the cell’s blueprint for a protein. The cell doesn’t use its
original set of instructions for the same reasons that a carpenter wouldn’t take the original
building blueprints to the work site – they need to remain intact and readable. Also, many
different workers need to use blueprint copies at the same time to do all different sorts of
construction, often in different locations in the building. Similarly transcription of mRNA allows
many different kinds of protein synthesis to occur at the same time; the DNA is not held to
making only one protein at a time.
Translation, on the other hand, is not a simple copying process. One language, that of the
sequence of nucleotides that compose the RNA, is changed into an entirely different language,
that of the sequence of amino acids that comprises polypeptides and therefore, protein structure.
This is not unlike the process of translating English into Chinese. Wholly different words and
symbols are exchanged for one another yet the same meaning is conveyed by both. Fortunately
there are fewer semantic discrepancies in biological translation as each codon stands for only one
specific amino acid.
It makes sense that DNA replication requires a proofreading mechanism while mRNA
transcription does not. DNA replication is like printing a bound copy of a book, the process is
expensive and the product must be accurate without mistakes or changes. Transcription is a
cheap photocopy process. Many copies are made quickly and easily. If a few copies don’t turn
out too well, just throw them in the trash! If the RNA transcript is damaged and doesn’t work –
no big deal, there’s another floating around. But if the DNA copy is altered from the original, the
whole existence of the cell may be compromised.
If one looks at protein synthesis as a collection of subassemblies of various molecules, it is much
easier to understand. Henry Ford didn’t invent the assembly line, cells did. The ribosome is the
construction site for protein synthesis. The ER is analogous to the truck or rail system that moves
the product from the assembly line to where it is needed. If you expect your students to be able to
identify the A site and the P site on the ribosome, remind them that the A site is the location
where the tRNA with the single amino acid attaches. The P site is the spot where the tRNA with
the polypeptide chain is located. Obviously the E site is the exit.
When discussing the genetic code (i.e., table 15.1), point out that where there are two or more
codons that specify a single amino acid, the variation is usually in the third nucleic acid. Leucine
and arginine are exceptions with variation in the first and third letters, the former being coded for
by CU(UCAG) and UU(AG), the latter coded by CG(UCAG) and AG(AG).
122
The amino acid assembly within the ribosome is not a difficult process if compared to
constructing a chain from individual links. One could lay out all the links in appropriate order
and then construct a long pinching apparatus that would put them all together at once. This
would be fine if all the chains this machine ever produces are the same length (or shorter). A
biological machine of this sort would have to be thousands of pinchers long, as long as the
longest polypeptide, a real waste to have around to produce mostly short polypeptides. A smaller
device could put short batches together and link them one by one, but there would be greater
chance for error with this process. The easiest way to do it is the way the cell does it. Only two
links are important at a time, the one connected to the rest of the chain and the one being added.
A long polypeptide can be assembled just as readily as a short one and the chance for assembly
errors are much reduced. Translocation is simply the process of moving the last end of the chain
from one hand to the next so a new link can be grabbed out of the appropriate box.
HIGHER LEVEL ASSESSMENT
Higher level assessment measures a student’s ability to use terms and concepts learned from the
lecture and the textbook. A complete understanding of biology content provides students with the
tools to synthesize new hypotheses and knowledge using the facts they have learned. The
following table provides examples of assessing a student’s ability to apply, analyze, synthesize,
and evaluate information from Chapter 15.
Application
Analysis
Synthesis

Have students predict the mRNA and codon sequence of a DNA strand
ATTCGCCCATTATCCCC.

Have students determine the possible DNA sequence of a peptide
composed of lysine-tyrosine-methonine-leucine-lysine.

Ask students investigate the effects on a protein if the third thymine is
removed from the sequence CTCACGGCATTACGCCCG

Have students explain the various effects on a cell if adenine was replaced
by a cytosine in the DNA sequence.

Ask students to determine the safety to humans of antibacterial drugs that
interfere with translation in bacteria.

Ask students to explain the possible outcomes of a genetic disease that
prevents certain spliceosomes from working.

Ask students determine the effects on a cell after large amounts of mRNA
from its complementary strand are introduced into the cell.

Have students describe the nature of a drug that would interfere with
protein synthesis in eukaryotes without harming prokaryotes.

Ask students come up use a technique that induces specific frameshift
123
mutations in a particular gene.
Evaluation

Ask students to evaluate the limitations of trying to express eukaryotic
DNA in a prokaryote.

Ask students evaluate the effectiveness of anticancer drugs that interfere
with specific RNA polymerases.

Ask to research the pros and cons of a medical treatment called RNA
interference therapy.
VISUAL RESOURCES
A variety of visuals are possible for this material, many mentioned above in terms of machineoriented analogies. With enough time, effort, raw materials, and perhaps assistance from the
mechanical engineering department, an interesting working model could be constructed.
For many students, animations are extremely helpful. It is hard to understand the process when
only presented with words and still pictures. To actually see the ribosome moving down the
mRNA and various tRNA coming into place makes the process much easier to understand for
many students.
IN-CLASS CONCEPTUAL DEMONSTRATIONS
A. Replicating Students – Eukaryotic Gene Expression
Introduction
This fun and fast demonstration engages students in demonstrating the process of gene
expression. It uses student input to design the sequence the events of protein synthesis in
prokaryotes and eukaryotes.
Materials





4 Student volunteers
Overhead display of a anti-codon chart with the appropriate amino acids
1 large t-shirt labeled ribosome
Large black marker
48 sheets of 8 1/2 “ by 11” white paper representing DNA nucleotides
o 10 sheets labeled with a large black “A”
o 10 sheets labeled with a large black “C”
o 10 sheets labeled with a large black “G”
o 10 sheets labeled with a large black “T”
o 4 sheets labeled with a large black “3 prime end”
o 4 sheets labeled with a large black “5 prime end”
124





20 sheets of 8 1/2 “ by 11” pink paper representing RNA nucleotides
o 10 sheets labeled with a large black “A”
o 10 sheets labeled with a large black “C”
o 10 sheets labeled with a large black “G”
o 10 sheets labeled with a large black “T”
4 sheets of 8 1/2 “ by 11” green paper
o 1 sheet labeled RNA polymerase
o 1 sheet labeled primer
o Spliceosome
o Transfer RNA
10 index cards.
10 sheets of 8 1/2 “ by 11” yellow paper labeled tRNA
Roll of tape
Procedure & Inquiry
1. Call four students to the front of the room.
2. Have one student where the t-shirt and play the role the ribosome.
3. Assign another student to hold the marker, tape, index cards, and tRNA papers. Their role
is build the appropriate tRNA needed for translation.
4. Tell the students to build the following DNA sense strand by taping the white nucleotide
papers on the board keeping in the mind the 3’ and 5’ ends:
AACGTACCGCTATCTCTATCT
5. Then have the class tell the students to carry out transcription using the RNA pink paper.
6. Now have the class instruct the students to proceed to translation.
7. Have the class evaluate if the process was carried out correctly and ask them how
prokaryotic replication would differ.
B. Virtual Gene Expression Concept Map
Introduction
This fun and fast way to build a concept map engages students in developing a scheme
for reviewing all the facts and concepts associated with gene expression It helps student select
relevant information needed to understand prokaryotic and eukaryotic protein syntheis. The
simple click and drag animated concept mapping tool should be practiced before using in class.
Materials



Computer with live access to Internet
LCD projector attached to computer
Web browser with bookmark to Michigan State University C-Tool:
http://ctools.msu.edu/ctools/index.html
Procedure & Inquiry
125
1. Tell students that you would like to do a quick review of the concepts associated with
gene expression and mutation
2. Then go to the Michigan State University C-Tool and add the concept map term “Gene
Expression”. Use the “Add” and “Concept Word” feature to place a term on the map
background.
3. Solicit a few more terms or concepts and then ask the class how the concepts are
connected to each other. Use the “Add” and “Linking Line” feature to build a connecting
line.
4. Then ask the students to justify the concept linking lines. Use the “Add” and “Linking
Word” feature to place student comments on the map.
5. Continue the activity until you feel the students made a comprehensive map.
USEFUL INTERNET RESOURCES
1. Animations are a valuable classroom resource for reinforcing a lecture on gene
expression. The Cell Biology Animation website provides a well-done animation
sequence showing the components and organelles involved in protein synthesis. This
website can be found at http://www.johnkyrk.com/CellIndex.html
2. Students can be shown the value of knowing DNA sequences by introducing them to
DNA database information services. One such database called the Cystic Fibrosis
Mutation Database is a simple to use resource for showing students how database
information is used by researchers and genetic counselors. The website can be found at
http://www.genet.sickkids.on.ca/cftr/app.
3. The biology project sponsored by the University of Arizona has a valuable gene
expression tutorial that can be used in class or for home use by students. This website can
be found at http://www.biology.arizona.edu/molecular_bio/molecular_bio.html.
4. Case studies are a highly effective way to reinforce the learning of complex topics in
genetics. A case study called “In Sickness and in Health: A Trip to the Genetic
Counselor” has student use their knowledge of gene expression and mutation to
investigate the scientific and ethical decisions associated with gene testing. The website
can be found at http://www.sciencecases.org/genes/genes.asp.
LABORATORY IDEAS
Database Lab – Chernobyl Swallows
Studies on the environmental causes of mutations use simple statistical analyses on databases to
look for changes in mutation rates. This investigation provides students with the means to
perform a trend analysis to investigate the link between radioactive contamination and an
increase in mutations in wildlife populations.
a. Introduce the concept of databases to students. Tell them that they contain information
that may or may not be useful for particular types of analyses.
b. Then discuss that databases are being used to investigate the effects of radioactive
contamination from the Chernobyl nuclear power facility causing mutations in wildlife
126
even years after what was considered the world's worst nuclear power accident occurred
in 1986.
c. Provide students with the following:
a. Barn swallow data on collected by Tim Mousseau, of the University of South
Carolina, and Anders Moller, of the France University of Pierre et Marie Curie in
France.
b. Internet access.
c. Access to statistics books or websites where they can look up the meaning of
standard deviation and other statistical analysis concepts.
d. Access to statistical software or calculators if desired.
d. Tell the class to see if they can find any evidence that could indicate an increase in
mutations among the barn swallows in Chernobyl. Provide them with the following
inquiry questions and tasks:
a. Have the students look up the proximity of Chernobyl to Kanev and Denmark.
b. They should also be asked to research the possibility of radiation contamination
from the Chernobyl nuclear power facility reaching those areas.
c. Have the students research the types of mutations generated by exposure to
nuclear radiation.
d. Have the students identify any features that appear to be significantly different in
the Chernobyl animals compared to the others.
e. Ask the students to come up with ways that they could determine through
experimentation if any the changes in mutation rate that they identified could be
associated with the Chernobyl incident.
e. In conclusion students should see evidence of mutational changes due to the Chernobyl
incident. Mousseau and Moller’s reviews of other research showed that more than 20
species that show genetic damage as a consequence of Chernobyl contaminants. There
study was the first systematic review of the genetic consequences of low dose radiation in
a natural environment and suggests that such damage may be extensive.
f.
Data Tables:
127
128
Data from: Møller, A. P., and T. A. Mousseau. 2003. Mutation and sexual selection: A test using
barn swallows from Chernobyl. Evolution, 57: 2139-2146.
http://cricket.biol.sc.edu/chernobyl/papers/moller-mousseau-evolution-2003.pdf
LEARNING THROUGH SERVICE
Service learning is a strategy of teaching, learning and reflective assessment that merges the
academic curriculum with meaningful community service. As a teaching methodology, it falls
under the category of experiential education. It is a way students can carry out volunteer projects
in the community for public agencies, nonprofit agencies, civic groups, charitable organizations,
and governmental organizations. It encourages critical thinking and reinforces many of the
concepts learned in a course.
1. Have students do a presentation for children on genes for elementary school children or
youth civic groups.
2. Have students design an educational PowerPoint presentation on protein synthesis for
middle school teachers.
129
3. Have students tutor middle school or high school biology students studying genetics.
4. Have students design a display on gene expression for a school library.
This project is funded by a grant awarded under the President’s Community Based Job Training Grant as implemented by the U.S.
Department of Labor’s Employment and Training Administration (CB-15-162-06-60). NCC is an equal opportunity employer and
does not discriminate on the following basis:

against any individual in the United States, on the basis of race, color, religion, sex, national origin, age disability, political
affiliation or belief; and

against any beneficiary of programs financially assisted under Title I of the Workforce Investment Act of 1998 (WIA), on
the basis of the beneficiary’s citizenship/status as a lawfully admitted immigrant authorized to work in the United States, or
his or her participation in any WIA Title I-financially assisted program or activity.
This workforce solution was funded by a grant awarded under the President’s CommunityBased Job Training Grants as implemented by the U.S. Department of Labor’s Employment
and Training Administration. The solution was created by the grantee and does not
130
necessarily reflect the official position of the U.S. Department of Labor. The Department of
Labor makes no guarantees, warranties, or assurances of any kind, express or implied, with
respect to such information, including any information on linked sites and including, but not
limited to, accuracy of the information or its completeness, timeliness, usefulness, adequacy,
continued availability, or ownership. This solution is copyrighted by the institution that
created it. Internal use by an organization and/or personal use by an individual for noncommercial purposes is permissible. All other uses require the prior authorization of the
copyright owner.
131