Exam I The following are study questions. I will select some of these as written for the in-class exam. You will not be
able to bring anything other than your beautiful sharp young minds (and a pen/pencil) to the exam. There are three
questions at the bottom of the exam that are open book. DO EACH and bring finished to the exam. To find the
answers, start with our notes and the book. THEN look up for additional information on the web. I am looking to see
YOUR understanding of these answers, NOT your ability to regurgitate what I have in my notes or from a website. This
class is not graded on your ability to memorize material, but is instead will assess your learning on how to use and apply
the techniques we have learned and used in class. Good luck.
1) Describe the factors that one must consider when running an agarose gel for analysis vs isolating DNA from an
enzyme digest. What is the depth of gel and how much buffer should be used when preparing an agarose gel? What
are the most common problems encountered with agarose gels.
2) You were given a microfuge tube of plasmid DNA, a tube of RNA and a tube of chromosomal DNA. In a simple
mistake, you have forgotten to label the tubes and didn't notice this until after you ran the sample through a mini-prep
silica column (Qiagen). Which of the tubes will bind to the silica? When will the DNA or RNA elute if they bind (assume
a standard procedure we used in class) and propose a simple experiment to tell which is which.
3) A random mutation arose in the lacI gene in the pET-41 vector that you are using, so that the protein produced from
that gene now is unable to bind lactose (or IPTG). You have already successfully cloned egfp downstream of gst (in
frame). How does the modification in lacI affect the expression of the recombinant GST::EGFP fusion protein? Assume
this mutation has no additional effect on the LacI protein other than the inability to bind lactose/IPTG. To fully explain
your answer, describe what happens in the non-mutated (wild-type) repressed and derepressed states AND mutant
repressed and derepressed states.
4) Matt wants to directional clone mfg (matt’s favorite gene) into the plasmid pWlfpk. The polylinker for pWlfpk is
shown above; assume enzymes sites listed are unique in the plasmid. Discuss whether each enzyme or pair of
enzymes listed below can be used to force clone mfg into pWlfpk. Assume that mfg can be isolated using the same
enzyme(s) with which you will cut the vector. Your answer should clearly indicate yes or no, include the
sequence(s) of the restriction enzyme (available at www.neb.com), and discuss why forced cloning will or will
not work.
5) Monica purified the pBIT plasmid DNA by alkaline lysis followed by anion exchange chromatography and
resuspended the final DNA pellet in a total volume of 500 µl TE buffer. She used the Nanodrop (as you did in lab) and
obtained the following absorbance readings: Show your math and circle the answer. Units must be correct!
A230 = 0.16
A260 = 2.9
A280 = 2.2
A. What is the concentration of DNA in her sample? (Be sure to include the appropriate units!)
B. What volume of pBIT plasmid DNA would she need to pipet to obtain 50 ng of plasmid to use in a ligation? Explain
thoroughly including dilutions that need to be done, if necessary.
C. She wants to set up a ligation reaction with 50 ng of vector DNA. If the vector is 4 kb and the insert is 900 bp, how
many nanograms of insert DNA would she need in order to obtain a 1:3 vector to insert ratio?
D. Is the DNA pure? If yes, how do you know? If not, what is the most likely contaminant?
6) What is a riboswitch, promotor and RBS? What makes a strong vs weak promoter? There is a consensus sequence
for a strong promoter, describe how this is not likely found as a "strong" promoter as is.
7) Shan is engineering a new cloning vector. For each site (1, 2, and 3) on the
cloning vector below, describe why it would or would not be a good place for him to
put the polylinker. You can assume that the polylinker itself will not interfere with
coding sequence in that region. The arrows indicate the direction of transcription for
the gene. (Hint: consider issues of selectable and screenable markers.)
8) Polylinker region of pWlfpk-1
BamHI
Nco I
XhoI
ClaI
SalI
Matt wants to directional clone mfg (matt’s favorite gene) into the plasmid pWlfpk. The polylinker for pWlfpk is shown
above; assume enzymes sites listed are unique in the plasmid. Discuss whether each enzyme or pair of enzymes listed
below can be used to force clone mfg into pWlfpk. Assume that mfg can be isolated using the same enzyme(s) with
which you will cut the vector. Your answer should clearly indicate yes or no, include the sequence(s) of the
restriction enzyme (available at www.neb.com), and discuss why forced cloning will or will not work.
9) What are the key elements of a plasmid?
10) Kumar is planning to prepare plasmid DNA to clone and asked you to get a competent cell out of the freezer for him
to use. You find lots of types of competent cells and have things narrowed down to a BL21 (DE3), a DH5alpha, and
JM109. What are the reasons for using EACH of these and which should you bring to Kumar? How is a competent cell
prepared? And, oh, by the way... what is the purpose of the 'recovery' step in transformation? When does it happen in
the protocol?
TAKE HOME (Open book, bring your completed answer to EACH question to the exam).
1) Describe the differences and important points to be concerned about when cloning using traditional restriction
enzyme digest (two different sticky ends vs blunt end enzymes), gibson assembly AND TA cloning.
2) Create a protocol for a restriction digest with a total volume of 30 µl to digest 1.0 µg of plasmid DNA to completion.
You have an RE in a standard 50% glycerol at 5 Units / µl but wish to do a standard 'overdigestion' in which you will
put the maximum allowable enzyme in the digest. (Indicate how many Units will be in the digest.) You have a
compatible 10X restriction buffer, and your DNA is at 0.3 µg / µl.
Indicate the volumes of each reagent, including water, if needed, to a final total volume of 20 µl. Indicate as appropriate
an order of addition for the reagents.
3) You are interested in producing recombinant vasopressin, a small peptide hormone responsible for regulating
homeostatis by affecting permeability of the kidney. The DNA sequence of vasopressin
(with the start and stop codons bolded) is:
ATGTGCTACTTCGAACACTGTCCCAATGGTTAG. You are currently in possession of a
vasopressin construct where the vasopressin DNA sequence is cloned directly between
the BamHI (G/GATCC) and the EcoRI (G/AATTC) sites of pUC19 (shown below). In
other words, your DNA sequence in the vector looks like this:
…GGATCCATGTGCTACTTCGAACACTGTCCCAATGGTTAGGAATTC…
Which pET-41 vector would you choose to subclone the vasopressin gene using BamHI
and EcoRI so you could make the desired recombinant protein?
NcoI
BamHI
EcoRI
BsrGI
pET-41a(+): ATG…gst…CC/C ATG GGA TAT CGG GGA TCC GAA TTC TGT ACA GGC CTT
Met
Pro Met Gly Tyr Arg Gly Ser Glu Phe Cys Thr Gly Leu
pET-41b(+): ATG…gst…CC/C ATG GAT ATC GGG GAT CCG AAT TCT GTA CAG GCC TTG
Met
Pro Met Asp Ile Gly Asp Pro Asn Ser Val Gln Ala Leu
pET-41c(+): ATG…gst…CC/C ATG GCG ATA TCG GGG ATC CGA ATT CTG TAC AGG CCT
Met
Pro Met Ala Ile Ser Gly Ile Arg Ile Leu Tyr Arg Pro