Living Environment
Characteristics of Life
Life Functions
Vocabulary
Cells
Cell Respiration
Energy
Excretion
Genetic code Growth
Homeostasis Inorganic
Metabolism Organelles
Organic Organs
Organ Systems Response
Reproduction Stimulus
Synthesis Tissues
Transport
Characteristics of Life
• Living things share certain characteristics that distinguish them from
nonliving things.
• All living things are made up of one or more cells – the basic unit of
structure and function that makes up all organisms
• Living things use energy – food energy - to maintain life and to grow and
develop.
• Homeostasis – maintenance of internal environment when the external
environment changes constantly.
•
•
•
Metabolism – all the chemical reactions that occur in an organism.
Organelles – a structure within the cell that carries out a specific
function.
Organic – term used to describe molecules that contain both hydrogen
and carbon.
•
•
•
•
•
•
•
•
Organs – a body structure made of different kinds of tissues combined to
perform a specific function.
Organ Systems – several organs that work together to perform a major
function in the body.
Response – single, specific reaction to a stimulus – a signal to which an
organism responds.
Reproduction – the process by which organisms produce new organisms
of the same type - is the process that passes hereditary information to new
organisms of the same type.
Living things are based on a universal genetic code -– the biochemical
basis of hereditary in all living organisms.
Tissues – a group of specialized cells that perform a specific function.
Taken as a group living things change over time
In bodies of animals, it is organized from simple to more complex:
organelles, cells, tissues, organs and organ systems
Cell
Tissue
Organ
Organ System
* Viruses are not living because they are not cells. They do not independently carry out
life processes; instead they invade cells of living organisms.
Life Processes
• Obtaining nutrients from the environment and breaking them down for
transport - needed substances and wastes carried to and from cells in the
body
• Transporting materials throughout the organism
• Breaking nutrients into smaller units to release the chemical energy stored
in them through the process known as cell respiration - the process by
which the chemical bond energy stored in nutrients is released for use in
cells.
•
•
•
Combining simple substances into complex substances during the process
known as synthesis
Increasing the size or number of cells through the process of growth
Removing waste products from the organism through the process known
as excretion
Responding to internal and external stimuli
•
Reproducing more of their own species
•
•
Growth
Respiration/Transport
Multiple Choice Review Questions
1. One characteristic of all living organisms is that they
(1) make food
(2) live on land
(3) maintain homeostasis
(4) move from place to place
2. Viruses are exceptions to the cell theory, but they have some characteristics of
living things. What is one of these characteristics?
(1) They are made up of many specialized
(2) They contain genetic material
(3) They reproduce by mitosis
(4) They contain chlorophyll
3. Which activity is illustrated in the diagram of an ameba shown below?
(1)
(2)
(3)
(4)
egestion
synthesis
respiration
ingestion
4. A paramecium absorbs materials from its environment and circulates these
materials throughout its' cytoplasm. Which life function is described by these
activities?
(1)
(2)
(3)
(4)
synthesis
reproduction
respiration
transport
5. Locomotive structures found in some protists include
(1)
(2)
(3)
(4)
muscles
flagella
tentacles
contractile vacuoles
6. In humans, gas exchange and gas transport occur as a result of the functioning of
a system of
(1) phloem tubes
(2) lungs and blood vessels
(3) ganglia
(4) setae
7. A biologist would most likely study all of the chemical activities of an organism
to obtain information about the organism’s
(1) number of mutations
(2) reproductive cycle
(3) development
(4) metabolism
8. Cells are to tissues as organs are to
(1) organ systems
(2) cells
(3) genes
(4) organelles
9. The ability of an organism to maintain internal stability is known as
(1) metabolism
(2) homeostasis
(3) circulation
(4) excretion
10. Organisms remove metabolic cellular wastes by the process of
(1) E\xcretion
(2) absorption
(3) coordination
(4) digestion
Constructed Response Questions
11. State two ways in which a single-celled organism, such as an amoeba, and a
human body cell are alike.
________________________________________________________________________
__________________________________________________
________________________________________________________________________
__________________________________________________
12. Identify a specific structure in a single-celled organism. State how that structure is
involved in the survival of the organism.
________________________________________________________________________
__________________________________________________
________________________________________________________________________
__________________________________________________
Scientific Method
Vocabulary
Analysis Bias
Conclusion Control
Controlled Experiment Data
Dependent Variable Evidence
Hypothesis
Independent Variable
Inference
Model
Observation
Opinion
Peer Review
Research Plan
Scientific Literacy Scientific Law
Scientific Theory
Scientific Method
• Research Plan – the initial stage of an experiment that involves finding
background information, developing a hypothesis, and devising an
experimental method for testing the hypothesis
• Hypothesis - an attempt to explain what has been observed in a way that
can be tested.
•
•
•
•
•
•
•
•
•
•
•
•
•
•
•
•
•
Experiments a series of trials to test a hypothesis to either support it or fail
to support it.
Dependent Variable – depends on what you do in the experiment (what
you will measure)
Independent Variable – the variable that you will manipulate (what are
you going to change/do in the experiment)
Control – established reference point used as a standard of comparison.
Controlled experiment – the possible variables have been carefully
considered and regulated so the results are due to the independent variable
you are testing. Only testing one variable with two identical set ups.
Observation – any information that is collected with any of the senses
Data - information that can be presented in a chart, graph, and/or
pictures
Data is used to find out whether certain factors changed of remained the
same in an experiment
Opinion – ideas people have that may or may not be based in fact
Analyzing – examine critically - data to form conclusions.
Scientific theory – a concept, which has been tested and confirmed in
many different ways, that explains a wide variety of observations
Scientific Law – a statement that describes some aspect of a phenomenon
that is always true.
Conclusion – the decision made about the outcome of an experiment;
usually based on how well the actual result matches the predicted result
Evidence – support for the idea that something is true
Inference – a conclusion or deduction based on observations
Peer Review – the process by which scientists carefully examine the work
of other scientists to look for possible flaws in their experimental design or
their interpretation of results
Scientific Literacy – a basic knowledge of the natural world combined
with an understanding of the diverse ways that scientists gain knowledge
*Example Experiment
1. Question: How many drops of water can fit on a coin?
Research and hypothesis: Student try to guess how many drops of water will fit on a
coin. Students should find out about surface tension and base their hypothesis on that
concept.
Experiment: Students work in pairs. You need coins and water droppers. Students drop
slowly drop water onto the coin as their partner counts how many drops fit on the coin
without it overflowing. Do this activity three times and then average your results. This
is a good experiment for discussing constants and variables.
Independent Variable: How you drop water
Dependent Variable: Amount of water than fits on the coin
Constants: The height from which they drop the water
The student dropping the water
The pressure on the dropper
The side of the coin
Analysis:
Students can graph their results in a pictograph or bar graph.
Conclusion: Students can discuss why their hypothesis might have been wrong such as
the variables were hard to control - it was hard to drop each drop with same amount of
pressure.
2. Question: Does the width (or length) of a rubber band affect how far it will fly?
Research and hypothesis: Student try to guess how far a rubber band will go when shot
across the room. Students should find out about tension and kinetic energy.
Experiment: You need rubber bands that are the same width and different lengths, or
vice versa. Determine a "shooting method" and starting line. Students shoot their rubber
bands and measure the distance they travel. This works well outside or in a gym. Do
this activity three times and then have them average their results. This is a good
experiment for discussing constants and variables.
Independent Variable: The width (or length) of the rubber band
Dependent Variable: The distance the rubber band flies
Constants: How you shoot the rubber band
The width or length (the opposite to the variable)
How far you pull the rubber band back
Analysis: Students can graph their results in a pictograph or bar graph.
Conclusion: Then they can discuss why their hypothesis might have been wrong such as
the variables were hard to control - it was hard to shoot each rubber band the same way
or the rubber bands were different lengths and widths.
Multiple Choice Review Questions
1. A biologist in a laboratory reports a new discovery based on experimental results. If
the experimental results are valid,
biologists in other laboratories should be able to
(1) repeat the experiment with a different variable and obtain the same results
(2) perform the same experiment and obtain different results
(3) repeat the same experiment and obtain the same results
(4) perform the same experiment under different experimental conditions and
obtain
the same results
2. Which statement describes the best procedure to determine if a vaccine for a disease in
a certain bird species is effective?
(1)
Vaccinate 100 birds and expose all 100 to the disease.
(2)
Vaccinate 100 birds and expose only 50 of them to the disease.
(3)
Vaccinate 50 birds, do not vaccinate 50 other birds, and expose all 100
to the disease.
(4)
Vaccinate 50 birds, do not vaccinate 50 other birds, and expose only
the vaccinated birds to the disease.
2 Diagrams, tables, and graphs are used by scientists mainly to
(1)
design a research plan for an experiment
(2)
test a hypothesis
(3)
organize data
(4)
predict the independent variable
3. A biologist observed a plant cell in a drop of water as shown in diagram A. The
biologist added a 10% salt solution to the slide and observed the cell as shown in diagram
B.
The change in appearance of the cell resulted from
(1)
more salt moving out of the cell than into the cell
(2)
more salt moving into the cell than out of the cell
(3)
more water moving into the cell than out of the cell
(4)
more water moving out of the cell than into the cell
4. A drug company tested a new medication before putting it on the commercial market.
Pills without medication were given to 500 test subjects in group B. In this experiment,
the individuals in group A served as the
1. host group
2. dependent variable
3. control
4. hypothesis
5. A scientist tested a hypothesis that white-tailed deer would prefer apples over corn as a
primary food source. The findings of the test, in which the scientist claimed that the deer
preferred apples, were published. Which research technique, if used by the scientist,
might result in this claim being questioned?
(1)
The scientist observed four deer in different locations at various times of
the day
(2)
The scientist observed a total of 500 deer in 20 different locations at
various times of the day.
(3)
The scientist observed 200 deer in various natural settings, but none in
captivity.
(4)
The scientist observed 300 deer in various locations in captivity, but none
in natural settings.
6. Tomato plants in a garden are not growing well. The gardener hypothesizes that the
soil is too acidic. To test this hypothesis accurately, the gardener could
(1)
plant seeds of a different kind of plant
(2)
move the tomato plants to an area with less sunlight
(3)
change the pH of the soil
(4)
reduce the amount of water available to the plant
7. The current knowledge concerning cells is the result of the investigations and
observations of many scientists. The work of these scientists forms a well-accepted body
of knowledge about cells. This body of knowledge is an example of a
(1)
hypothesis
(2)
controlled experiment
(3)
theory
(4)
research plan
8. A student conducted an original, well-designed experiment, carefully following proper
scientific procedure. In order for the conclusions to become generally accepted, the
experiment must
(1)
contains several experiment variables
(2)
support the original hypothesis
(3)
be repeated to verify the reliability of the data
(4)
be conducted by a scientist
9. A student tossed a coin five times and observed results of four tails and one head. He
conducted that when a coin is tossed, there is an 80% chance of getting a tail and a 20%
chance of getting a head. The conclusionwould be more valid if
(1)
only two tosses of the coin had been used
(2)
the weight of the coin has been taken into consideration
(3)
a greater number of tosses had been used
(4)
the surface of the coin landed on had been taken into consideration
10. A scientific study showed that the depth at which some microscopic plants were
found in a lake varied from day to day. On clear days, the plants were found as far as 6
meters below the surface of the water but were only 1 meter below the surface on cloudy
days. Which hypothesis would these observations support?
(1) Light intensity affects the growth of microscopic plants.
(2) Wind currents affect the growth of microscopic plants.
(3) Nitrogen concentrations affects the growth of microscopic plants.
(4) Precipitation affects the growth of microscopic plants.
Constructed Response Questions
1. In an experiment to test the effect of light on plant growth, a student used two marigold
plants of the same age. The plants were grown in separate pots. One pot was exposed to
sunlight, the other to artificial light. All other conditions were kept the same. The height
of each plant was measured at the start and at the end of the experiment. The student’s
data are shown in the table below.
Plant Grown In
Sunlight
Artificial Light
Data Table
Increase in Plant Height
(cm)
9
8
The student concluded that all plants grow more rapidly in sunlight than in artificial light.
Discuss whether this conclusion is valid. Your answer must include at least:
•the significance of the difference in the results shown in the data table
•the significance of the number of individual plants used in the experiment
•the significance of the number of species of plants used in the experiment
________________________________________________________________________
__________________________________________________
________________________________________________________________________
__________________________________________________
________________________________________________________________________
__________________________________________________
________________________________________________________________________
__________________________________________________
2. State two safety procedures that should be followed when conducting an experiment
that involves heating protein in a test tube containing water, an acid, and a digestive
enzyme.
_____________________________________________________________
_____________________________________________________________
________________________________________________________________________
________________________________________________________________________
________________________________________________________________________
____________________________
3. An experiment was carried out to determine how competition for living space affects
plant height. Different numbers of plants were grown in three pots, A, B, and C. All
three pots were the same size. The data collected are shown in the table below.
Day 1
Average Daily Plant Height (mm)
Day 2
Day 3
Day 4
Day 5
Day 6
Day 7
Pot A – 5
2
4
6
8
10
14
16
Pot B – 10
2
4
6
8
10
12
12
Pot C – 20
2
2
2
6
6
8
8
Analyze the experiment that produced the data shown in the table.
In your answer be sure to:
• state a hypothesis for the experiment
• identify one factor, other than pot size, that should have been kept the same
each experimental group
• identify the dependent variable
• state whether the data supports or fails to support your hypothesis and
justify your answer
_____________________________________________________________
in
_____________________________________________________________
________________________________________________________________________
________________________________________________________________________
________________________________________________________________________
____________________________
_____________________________________________________________
_____________________________________________________________
________________________________________________________________________
________________________________________________________________________
________________________________________________________________________
____________________________
4. Base your answers to questions 2 and 3 on the information in the newspaper article
below and on your knowledge of biology.
Patients to test tumor fighter
Boston-Endostatin, the highly publicized experimental cancer drug that wiped out tumors
in mice and raised the hopes of cancer patients, will be tested on patients this year. “I
think it’s exciting, but . . . you always have the risk that something will fail in testing,”
said Dr. Judah Folkman, the, Harvard University researcher whose assistant, Michael
O’Reilly, discovered endostatin. Endostatin and a sister protein, angiostatin, destroy the
tumors’ ability to sprout new blood vessels. This makes cancer fall dormant in lab
animals, but no one knows if that will happen in humans. (The Associated Press)
2 Explain why it is necessary to test these experimental drugs on human volunteers as
well as on test animals.
_____________________________________________________________
_____________________________________________________________
________________________________________________________________________
________________________________________________________________________
________________________________________________________________________
____________________________
3 State one reason that mice are often used by scientists for testing experimental drugs
that may be used by humans.
_____________________________________________________________
_____________________________________________________________
________________________________________________________________________
________________________________________________________________________
________________________________________________________________________
____________________________
Basic Chemistry
Important vocabulary:
Chemistry
Atom
Element
Molecule
Compound
Carbon
Oxygen
Hydrogen
Nitrogen
pH
Ion
Acid
Base
Basic Chemistry
Living things and non-living things (from a one celled amoeba, to a giant redwood
tree out in Oregon, to the desk you are leaning on) are made up of the same
building blocks.
Chemistry tells us what the millions of different substances are made up of.
Chemistry: The study of matter
Atom: the basic building block of matter: atoms cannot be divided any further by
ordinary means.
Substances made up of only one kind of atom are called ELEMENTS.
Ex: carbon, oxygen, nitrogen and hydrogen
The periodic table contains the elements found on the earth.
Under normal circumstances: atoms have equal number of electrons, protons
and neutrons.
There are times when atoms do not have an equal number of protons, neutrons
and electrons:
Ion: an atom with a negative or a positive charge
?What is an ion?
Sometimes it is possible for an atom to give away or receive electrons; this
causes it to have a charge
Ex- H+ and OH-
Basic Chemical Bonding:
Most substances in this world are COMPOUNDS-which are two or more kinds of
atoms combined in definite proportions.
*Ex-Water (H20) and table salt (NaCl)
Chemical bond: the force of attraction between two or more atoms that hold
them together
Types of bonds:
1- Ionic bonding: when 1 or more electrons are transferred from one atom to the
other. This is what creates IONS.
Ex- NaCl
2. Covalent bonding: When atoms share electrons to form molecules
Ex: water (H20)
Molecule: two or more atoms are combined and act as a single particle
pH- acids and bases
Acid: any compound that produces H+ (a hydrogen ion) in a solution (water).
HCl H+ + ClAcid rain: fossil fuels are burned and release sulfur and nitrogen into the air. These mix
with the rainwater and produce acids.
Base: any compound that produces a Hydroxide ion (OH-) when dissolved in a solution
(water). When something is a base it is also known as ALKALINE.
NaOH Na+ + OHWhen solutions of an equal amount of an acid and a base are mixed what will result?
H+ + OH- H2O
The process of reacting an acid with a base to produce a NEUTRAL solution is called:
NEUTRALIZATION.
The pH scale:
Scientists devised a measurement system called the pH scale to indicate the amount of
H+ ions in a solution.
**the pH scale ranges from 0 to 14 with stronger acids starting a 0 and stronger bases
beginning at 14.
***** Alkaline= Basic
The human body and pH:
The pH of the fluid in most body cells must be kept within 6.5 to 7.5 or death will result!
? What is one exception to this rule?
(Stomach acid-about 2 on the pH scale)
What is a stomach ulcer? When the environment of the stomach is too ACIDIC! The
acid eats away at the lining of the stomach and causes painful sores!!!!
Organic Chemistry
Important vocabulary:
Inorganic
Organic
Dehydration synthesis
Hydrolysis
Nucleic acid
Carbohydrate
Lipid
Protein
Enzyme
Monosaccharide
Polysaccharide
Amino acid
Glycerol
Fatty acid
Saturated fats
Unsaturated fats
Glucose
Organic vs. Inorganic compounds
What makes something organic?
*always contains carbon
*usually contains hydrogen
*may contain oxygen and nitrogen
Organic compound- a compound that contains the element carbon
*most organic compounds occur naturally only in living organisms or in their
byproducts.
Ex- sugar (from a plant)
Oil (from a plant)
What makes something inorganic?
*a compound that doesn’t contain carbon
An important inorganic compound…
H2O!!!!
Why is water so important to living organisms?
*all living organisms need water to survive
*65% of your body is water
Structure and Type of Organic Compounds:
***Organic compounds are very complex and large
Remember: all organic compounds contain
carbon
****the possible size and variety of these compounds is unlimited!!!!
4 Major Types of Organic Compounds
1.
2.
3.
4.
Carbohydrates
Lipids.
Proteins
Nucleic Acids
Carbohydrates:
Carbohydrate: an organic compound made up of carbon, hydrogen and oxygen
C: H: O
•
•
2: 1 ratio of hydrogen to oxygen in carbohydrates
ex: Glucose C6H12O6
Monosaccharide: the simplest carbohydrate
“simple sugar”
*the building blocks of carbohydrates
Ex- glucose, sucrose, galactose
Hint: You can recognize most sugars because they end USUALLY end in “-ose”.
Lactose, glucose, fructose, sucrose
Exception: starch
Why are sugars so important?
*they contain large amounts of energy
*nearly all living organisms use glucose for
energy
Dehydration Synthesis:
Dehydration synthesis is a process that bonds molecules together by removing H20.
Ex- the formation of a disaccharide.
Disaccharide- the molecule formed by joining two simple sugars (monosaccharides) by
dehydration synthesis.
Ex- sucrose
Polysaccharide: many simple sugars bonded together through dehydration synthesis to
create a chain of repeating subunits.
Ex- starch (plants)
Hydrolysis: the reversal of dehydration synthesis
-disaccharide/polysaccharide is broken down into simple sugars by adding H2O
Lipids
Lipid: an organic compound made up of Carbon, Oxygen and Hydrogen
What are lipids? Fats, Oils, Waxes
Function: lipids are part of a cells structure and serve as a reserve energy supply,
insulation and also act as a protective coating.
****Lipids are insoluble in H2O
Synthesis of a Fat:
*a molecule of fat is formed by the dehydration synthesis of 3 fatty acid molecules and
1 glycerol molecule.
Saturated and Unsaturated fats:
Saturated Fat: fats that are formed from fatty acids that have single to single carbon
bonds
diagram on board:
ex- solid at room Temperature
butter
*Diets high in saturated fats tend to increase cholesterol levels (increase in plaque formed
in blood vessels)
*This increases the risk for strokes and heart attacks.
Unsaturated fat: one pair of carbon atoms is joined by a double bond/triple bond
Ex- liquid at room temperature
Oils
Nucleic Acids
Nucleic acids: compounds that contain
*carbon
*hydrogen
*oxygen
*phosphorous
*nitrogen
2 types of N.A:
DNA: (deoxyribonucleic acid) found in the nucleus of the cell. DNA is the
hereditary information that is passed from parent to offspring.
RNA- (ribonucleic acid) also found in the nucleus of the cell. RNA is
responsible for protein synthesis (making proteins)
***DNA and RNA work together to control the development and activities of ALL cells
in an organism!!!!
Proteins
Proteins: very large complex compounds that contain Carbon, Hydrogen, Oxygen and
Nitrogen. Some contain Sulfur and Phosphorus as well.
Where are proteins found?
*Proteins are found throughout living organisms. Proteins make up muscle, bones,
hormones (insulin), antibodies (protect us against disease), and enzymes (allow chemical
reactions to take place)
*there are millions of different types of proteins
*proteins are extremely large and complex
What are proteins made of?
Amino Acids- the building blocks of proteins.
Peptide bond- the bond between two amino acids
Enzymes - protein substances that are necessary for most of the chemical reactions that
occur in living cells
•
•
•
•
•
for each step of a reaction that occurs in a living organism there is a particular
enzyme at work
Enzymes enter into a chemical reaction only temporarily
Enzymes are NOT changed by the reaction
Enzymes are used again and again for the same purpose.
All enzymes are made up by the cells of the living organism
Catalyst- a substance that brings about a reaction without being changed itself
*enzymes are organic catalysts
Substrate- the substance an enzyme acts upon
HINT: the names of enzymes usually end in –ASE.
Ex- the enzyme that breaks maltose into two glucose molecules is
maltase
Ex- the enzyme that breaks down fat is lipase.
How enzymes work: “lock and key model”
Factors that affect enzyme action:
*each enzyme must have a specific shape to work correctly and anything that alters that
shape will affect the enzyme’s ability to function properly.
*high temperatures and pH changes can cause enzyme shape to change
*enzymes work best at certain temperatures (laundry detergent)
*enzymes work best at certain pH values. (pepsin in the stomach)
Graphs showing factors that affect enzyme action
Compare and Contrast Chart
Organic Compounds
Characteristic
Elements
present/
Building
Blocks
Function in
humans
Food sources
(For nucleic
acids write
where it is found
in the human
body)
Molecular/
Structural
Formula of the
building block
Carbohydrates
Lipids
Proteins
Nucleic Acids
Regents review questions:
1. Living things are made mostly of these four main elements:
A. hydrogen, oxygen, nitrogen and protein
B. water, protein, carbohydrate and fat
C. carbon, hydrogen, oxygen, and nitrogen
D. glucose, salt, mineral and base
2. What is the principal inorganic solvent in cells?
A. salt
B. water
C. alcohol
D. carbon dioxide
3. Fats that are stored in human tissue contain molecules of:
A. glycerol and fatty acids
B. amino acids
C. monosaccharides and disaccharides
D. nucleotides
4. One of the carbon compounds found in a cell has twice as many hydrogen atoms
as oxygen atoms. This compound most likely belongs to the group of substances
known as:
A. nucleic acids
B. lipids
C. proteins
D. carbohydrates
5. Which formula represents an organic compound?
A. NH3
B. H20
NaCl
C. C12H6O11
6. Starch is classified as a:
disaccharide
polypeptide
nucleotide
polysaccharide
7. Which organic compound is correctly matched with the subunit that composes it?
maltose-amino acid
Starch-glucose
protein-fatty acid
lipid-sucrose
8. Only small amounts of enzymes are required for reactions within cells because
enzymes are:
Fragile
reused
small molecules
constantly synthesized
9. Which cell organelle controls the synthesis of enzymes?
cell membrane
nucleus
Cell Wall
Ribosomes
10. In order to survive all living things must carry out:
autotrophic nutrition
heterotrophic nutrition
enzyme-controlled reactions
the process of reproduction
11. Which group of organic compounds includes the enzymes?
carbohydrates
lipids
proteins
starches
12. The enzyme pepsin will act on protein but not on starch. This action illustrates
that salivary amylase:
contains protein
is chemically specific
is not reusable
lacks starch
13. A particular human intestinal enzyme is most active at a pH of 8.0 and a
temperature of 37 degrees Celsius. The activity of this enzyme would most likely
decrease with an increase in the:
amount of light shining on the reaction
amount of enzyme
amount of substance being acted on
temperature to over 50 degrees Celsius
14. Enzymes influence chemical reactions in living systems by:
becoming part of the product after the reactions occur
combining with atmospheric gases to form waste products
affecting the rate at which reactions occur
absorbing water during synthesis and digestion
15. Which of the following is characteristic of an enzyme?
it is an organic catalyst
it is destroyed after each chemical reaction
It provides energy for any chemical reaction
It regulates the rate of a specific chemical reaction
both A and D
16. Which of the following variables has the least direct effect on the rate of an
enzyme-regulated reaction?
temperature
pH
carbon dioxide concentration
enzyme concentration
Constructed response questions:
19. There are four major types of organic molecules that are important in living
things; these are carbohydrates, lipids, proteins and nucleic acids. Select any tow
and, for each on chosen, describe the structure of the molecule and state two ways
that the molecule is useful to living organisms.
_____________________________________________________________________
_____________________________________________________________________
_____________________________________________________________________
_____________________________________________________________________
_____________________________________________________________________
_____________________________________________________________________
_____________________________________________________________________
_____________________________________________________________________
20. Fresh pineapple contains an enzyme that digests proteins. Adding fresh
pineapple to gelatin (a protein) prevents it from setting or jelling. Adding cooked
or canned pineapple does not have this effect and the gelatin can set normally.
Explain why these differences occur.
__________________________________________________________________
__________________________________________________________________
__________________________________________________________________
__________________________________________________________________
__________________________________________________________________
____________________________________________________________
21. When an apple is cut open, the inside soon turns brown. This is because enzymes
that are released from the cut cells react with certain molecules in the apple. Rubbing
lemon juice (which contains citric acid) on the cut apple prevents it form browning.
Explain why this is so.
_____________________________________________________________________
_____________________________________________________________________
_____________________________________________________________________
_____________________________________________________________________
_____________________________________________________________________
_____________________________________________________________________
_____________________________________________________________________
The Cell
Important Vocabulary:
Active Transport
Cell
Prokaryotic
Concentration
Receptor
Diffusion
Eukaryotic
Organelle
Osmosis
Passive Transport
Permeable
1. The cell is the basic unit of life.
2. The Cell Theory –
a. All organisms are made of one or more cells
b. All cells carry on life activities
c. New cells arise only from other living cells.
3. Two cell types:
a. Prokaryotic – No nucleus Ex.) Bacteria
b. Eukaryotic – Have a nucleus Ex.) Human cells
4. Cell Structure –
Organelles – parts of cells
a.
b.
c.
d.
e.
f.
g.
h.
i.
j.
k.
l.
m.
n.
Cell wall – Only in plant cells, protects cell (made of cellulose)
Cell membrane – allows things in/out of cell (made of lipids)
Nucleus – Control center of cell (contains DNA)
Cytoplasm – gel-like substance, chem. reactions take place
Endoplasmic Reticulum – tubes that transport materials
Ribosomes – makes proteins
Golgi Bodies – flat sacs that process and package chemicals
Lysosomes – digest and recycle substances
Mitochondria – Respiration – produces energy for the cell
Microtubules – give cell shape and help cell and organelles move
Centrioles – Only in animal cells, help cell divide
Cilia and flagella – hair like, help cell move
Vacuoles – store food and water
Chloroplast – Only in plant cells, Photosynthesis – use light to make
sugar
Cell Transport - How things get into and out of cells
Cells need oxygen, water, sugar, and minerals to survive. They must release CO2 and
other wastes. All of these things must pass through the cell membrane.
Selectively Permeable Membrane – Only certain substance can pass through membrane
Diffusion – The movement of molecules from an area of high concentration (more
crowded) to low concentration.
High Conc. (Crowded) ---> Low Conc. 1
Passive Transport – the movement of molecules without the use of energy
Ex.) Diffusion, Osmosis and Facilitated Diffusion
Osmosis – the diffusion of water into or out of a cell. Cell B shrinks when water leaves.
Plant Cell in Fresh (Left) and Saltwater 1
Active Transport – The movement of molecules from an area of low concentration to
high concentration. The cell uses energy for this kind of transport.
Ex.) Phagocytosis – when a cell engulfs a large particle or another organism.
White Blood Cell Engulfing Bacteria 1
Recognizing signals
Certain protein molecules in the cell membrane can receive chemical signals from other
cells. These molecules are called receptor molecules. Chemicals produced by
endocrine glands (hormones) and by nerve cells (neurotransmitters) act as chemical
signals between cells. They work by bonding to a receptor whose (sp?) shape fits the
specific signal molecule.
Review Questions
1. Which structure is the boundary between a living cell and its environment?
a) cell membrane
b) cytoplasm
c) vacuole
d) ribosome
2. The cell nucleus functions
a) in obtaining energy for the cell
b) in the storage of digestive enzymes
c) as the center of control for cell metabolism and reproduction
d) in the transport of materials throughout the cell
3. The genetic material of an animal cell is found in the..
a) nucleus
b) cytoplasm
c) ribosomes
d) vacuole
4. Current evidence indicates that ribosomes are most closely associated with
a) contraction of the cytoplasm
b) production of DNA
c) synthesis of protein
d) regulation of mitosis
5. Mitochondria are organelles in which
a) digestive enzymes are stored
b) secretory products are packaged and stored
c) the energy needed by the cell is released from nutrients
d) protein manufacture occurs
6. Which cell organelles are most closely associated with energy changes in a plant?
a) mitochondria and chromosomes
b) chloroplasts and mitochondria
c) chromosomes and nucleus
d) chloroplasts and nucleus
7. Which is the most accurate statement concerning protein synthesis in cells?
a) proteins are synthesized at the mitochondria in all living cells
b) proteins are synthesized at the ribosomes in all living cells
c) proteins are synthesized at the ribosomes in plant cells only
d) proteins are synthesized by the nuclei in animal cells only
8. Which of the following would be least affected by defective receptor proteins on a cell
membrane?
a) homeostasis
b) muscle activity
c) nerve signals
d)diffusion
9. In both plant and animal cells, the cell membrane..
a) produces enzymes
b) controls reproduction
c) is composed of sugars
d) regulates diffusion
10. Since the relative concentration of water in the pond in which a paramecium ( a
single celled organism ) lives is greater than the concentration of water in its cytoplasm,
water molecules constantly move from the pond into the paramecium. The best long-term
solution to the problem or maintaining a stable internal environment is for the
paramecium to..
a) change the water into carbon dioxide and excrete it
b) store water molecules
c) incorporate water molecules into its structure
d) actively transport water molecules out of its cell
11. A biologist diluted a blood sample with distilled water. While observing the sample
with a microscope, she noted that the red blood cells, had burst. This bursting is most
likely the result of which process?
a) staining
b) diffusion
c) digestion
d) active transport
12. Amino acids tend to diffuse from a blood capillary to the adjacent cell because
a) this is the only direction they can move
b) the brain directs the movement into cells
c) the cell needs the amino acids to make protein
d) the concentration of amino acids is lower in the cell
13. Cytoplasm in a plant cell will shrink if the cell is
a) placed in a concentrated salt solution
b) kept warm and moist and in medium light
c) placed in distilled water
d) exposed to a different concentration of nitrogen gas
14. A cell containing 98% water in its cytoplasm is placed in a 2% salt solution. It
should..
a) lose water
b)gain water
c) neither lose nor gain water
d) gain salt because of the high rate of diffusion
15. A cell is placed in distilled water and then transferred to a 5% salt solution. As a
result of this procedure, the cell would be likely to..
a) get larger
b) get larger , then smaller
c) get smaller
d) get smaller, then larger
16. A high concentration of calcium salts is normally found within the cytoplasm of a
certain protozoan, while the surrounding environment contains a lower concentration of
the calcium salts. The higher concentration in the protozoan is most probably the result of
a) diffusion
b) excretion
c) active transport
d) cellular dehydration
17. The unit of structure and function of all living things is
a) an organ
b) an atom
c) a cell
d) a nucleolus
18. According to the cell theory, which statement is correct?
a) viruses are true living things
b) all cells are basically unalike in structure
c) mitochondria are found only in plant cells
d) all cells come from preexisting cells
19. Chloroplasts and mitochondria are examples of
a) cells
b) tissue
c) organelles
d) organs
20. The term, " selectively permeable" is used in reference to the
a) nucleus
b) cell wall
c)cytoplasm
d) cell membrane
21. The part of a cell that is in most direct contact with the environment is the
a) nucleus
b) cell membrane
c) mitochondria
d) vacuole
22. Plant cell organelles that contain photosynthetic pigments are
a) chloroplasts
b) ribosomes
c)chromosomes
d) cell walls
23. An observable difference between onion skin cells and cheek cells is that the onion
cells have a
a) cell membrane
b) nucleus
c) vacuole
d) cell wall
24. The sites of protein synthesis is the cytoplasm are the
a) ribosomes
b) chromosomes
c) nuclei
d) vacuoles
25. The watery environment in which most life activities of a cell take place is the
a) cell membrane
b) chloroplast
c) cytoplasm
d) vacuole
26. Transport of materials into and out of a cell is most closely associated with the
a) nucleus
b) cell wall
c) ribosome
d) cell membrane
27. Which organelle contains genetic material and controls most cell activities?
a) nucleus
b) cell membrane
c) vacuole
d) endoplasmic reticulum
Photosynthesis and Cellular Respiration
Important vocabulary:
ATP
Cellular respiration
Chloroplast
Energy
Enzyme
Glucose
Mitochondria
Photosynthesis
Photosynthesis
What do cells need to carry out everyday activities?
ENERGY
Energy: the ability to do work
What is photosynthesis?
The ability of plants to take sunlight and convert it into energy (sugar/glucose)
Where does photosynthesis occur in plant cells?
Chloroplasts
Diagram on board:
Photosynthesis formula:
(enzymes)
Sunlight + H2O + CO2 glucose + oxygen + H20
One of the final products of photosynthesis is glucose (a source of energy!!!)….How is
glucose then broken down?????? (either by the plant or the animal that eats the plant?)
Cellular Respiration!!!!!!!!!!!!!!
Cellular respiration: the process by which cells break down glucose into an energy
source the organism can use (ATP)
Cellular respiration takes place in the mitochondria of the cell.
Diagram:
Cellular respiration formula:
(enzymes)
Glucose + oxygen H2O + CO2 + ATP
What is ATP?
Adenosine triphosphate
Diagram:
*energy is released when the 3rd phosphate bond is broken on an ATP molecule resulting
in an ADP molecule
(ADP-adenosine diphosphate)
*ADP will reform ATP when another phosphate becomes available
Reminder!!!!!
Since plants are able to make their own food in the form of organic glucose they are
considered Autotrophs!!!!!
Animals cannot make their own food, they must go out and find it…therefore, they are
considered Heterotrophs!!!!!!
Anaerobic vs. Aerobic Respiration
In most organisms, cellular respiration is carried out in the presence of oxygen
Aerobic respiration: requires oxygen
Anaerobic respiration: does not require
oxygen
Aerobic respiration is much more productive than anaerobic respiration! Aerobic
respiration produces much more ATP than anaerobic respiration.
*some organisms, like yeast and bacteria, carry on respiration without oxygen.
*most organisms (humans) carry out cellular respiration with and without oxygen…but
respiration using oxygen is much more efficient!!!!
Fermentation (Anaerobic respiration):
Fermentation: provides energy for cells without using oxygen
2 types of fermentation
1. Alcoholic fermentation: an anaerobic process where cells, such as yeast, convert
glucose into CO2 and ethyl alcohol. (yields 2 ATP molecules)
Formula:
Glucose + yeast CO2 + ethyl alcohol + ATP
Picture from regents:
Muscle Fatigue: when the body undergoes extreme physical activity the cells are
sometimes deprived of oxygen necessary for cellular respiration to take place. During
muscle fatigue a characteristic burning may be felt in the muscles.
What causes this burning sensation is Lactic Acid fermentation, a form of anaerobic
cellular respiration that occurs in our bodies!!!!
2. Lactic Acid fermentation: an anaerobic process where body cells convert glucose into
CO2 and lactic acid. (yields 2 ATP molecules) This process occurs during extreme
muscle fatigue when the cells are deprived of oxygen.
Formula:
Glucose CO2 + ATP + lactic acid
Diagram showing Photosynthesis and Cellular respiration occurring
simultaneously:
Comparison of Photosynthesis and Cellular Respiration
Cellular Respiration
Photosynthesis
Glucose is ___________________
Glucose is ________________
Glucose is converted into __________
Sunlight is converted into ___________
Carbon dioxide ______________
Carbon dioxide _______________
Oxygen ______________
Oxygen _________________
Takes place in the
________________________
Takes place in the
___________________
Occurs in ___________________ cells
Occurs __________________ cells
Regents review questions:
By which process are CO2 and H20 converted into carbohydrates?
Transpiration
respiration
photosynthesis
fermentation
The conversion of light energy into chemical bond energy occurs within the cells of?
molds
yeasts
dogs
algae
Glucose molecules may be stored in plants in the form of:
oxygen
starch
nucleic acids
amino acids
Organisms capable of manufacturing organic molecules from inorganic raw materials
are classified as:
autotrophs
heterotrophs
plants
both A and C
The basic raw materials for photosynthesis are:
Water and carbon dioxide
Oxygen and water
Sugar and carbon dioxide
Carbon dioxide and oxygen
Which word equation represents the process of photosynthesis?
Carbon dioxide + water glucose + oxygen + water
Glucose alcohol + carbon dioxide
Maltose + water glucose + oxygen + water
Glucose + oxygen carbon dioxide + oxgyen
Which word equation represents the process of aerobic cellular respiration?
Carbon dioxide + water glucose + oxygen + water
Glucose alcohol + carbon dioxide + ATP
ATP + water glucose + oxygen + water
Glucose + oxygen carbon dioxide + water + ATP
Autotrophic activity in plant cells is most closely associated with the organelles
called:
Mitochondria
Ribosomes
Lysosomes
Chloroplasts
In terms of nutrition, the functional difference between animals and plants is that
green plants are able to:
Synthesize glucose
Break down carbohydrates
Carry on aerobic respiration
Form ATP molecules
Most animals make energy available for cell activity by transferring the potential
energy of glucose to ATP. This process occurs during:
Aerobic respiration only
Anaerobic respiration only
Both aerobic and anaerobic respiration
Neither aerobic and anaerobic respiration
In animal cells, the energy to convert ADP to ATP comes directly from:
hormones
sunlight
organic molecules
inorganic molecules
the organelles where cellular respiration take place are called the:
mitochondria
chloroplasts
lysosomes
ribosomes
The substances that directly control the rate of reaction of the chemical processes of
photosynthesis and cellular respiration are:
phosphates
ADP
ATP
enzymes
Energy for use in cells is stored in the form of:
Physical energy
Chemical bond energy
Heat energy
Mechanical energy
Energy released from the cellular respiration of glucose is:
First stored within ATP
Stored in the liver as fat
Turned into fat
Used directly for body activity
As a direct result of the life process called cellular respiration in humans,
Liquid wastes are eliminated from the body
Food is digested and absorbed into the blood
Energy is released from digested food within the cells
Nutrients are transported within the cells
Constructed response questions:
17. Compare photosynthesis and respiration with regard to each of the following:
*source of energy
*materials used by each process
*location of each process in the cell
*when each process occurs in plants and animals
_____________________________________________________________________
_____________________________________________________________________
_____________________________________________________________________
_____________________________________________________________________
_____________________________________________________________________
_____________________________________________________________________
_____________________________________________________________________
_____________________________________________________________________
21. Do plants carry out cellular respiration? Explain your answer.
__________________________________________________________________
__________________________________________________________________
__________________________________________________________________
__________________________________________________________________
__________________________________________________________________
____________________________________________________________
20. Explain how photosynthesis and cellular respiration are cyclical in nature.
_____________________________________________________________________
_____________________________________________________________________
_____________________________________________________________________
_____________________________________________________________________
_____________________________________________________________________
_____________________________________________________________________
_____________________________________________________________________
Reproduction and Development
Important vocabulary:
Asexual reproduction
Crossing over
Differentiation
Egg
Embryo
Estrogen
Fertilization
Fetus
Gamete
Meiosis
Mitosis
Ovaries
Placenta
Progesterone
Recombination
Sex cell
Sexual reproduction
Sperm
Testes
Testosterone
Uterus
Zygote
Asexual versus Sexual reproduction
Asexual reproduction involves only one parent and results in one or more offspring that
are genetically identical to the parent.
Examples of asexual reproduction:
1. Binary fission: *Simplest form of mitosis (asexual reproduction)
*The parent cell divides into
two parts that are equal
Fission in protozoa: nuclear division (mitosis)
Cytokinesis (the division of cytoplasm) occurs
2. Budding: *parent divides into 2 unequal parts
*parent and offspring are not the
same size
Diagram of yeast:
3. Spore formation:
Spore: single specialized cells that are produced by certain organisms
*formed asexually or sexually
*mitotic cell division
Diagram
:
4. Regeneration: ability of an organism to re-grow lost body parts
Ex- salamanders (only tail)
Starfish (whole new starfish)
Crab (lost claws)
5. Vegetative Reproduction:
*most plants reproduce sexually (seeds), but asexual reproduction is also possible
Roots, stems and leaves give rise to a new plant vegetative reproduction
*undifferentiated cells (cambium or epithelial cells) divide mitotically then will
differentiate into a new plant
Diagrams of asexual vegetative reproduction:
Sexual Reproduction
Sexual reproduction involves two parents and results in offspring that have some genetic
material (DNA) from each parent. The resulting offspring may be similar to one or both
parents, but not identical
*offspring receives half their genetic material from mom and half from dad
Ex: Human reproduction
Cell Division (mitosis and meiosis)
Mitosis
Why can’t a cell grow to one giant cell?
*Diffusion limits size
*Over long distances diffusion becomes slow and inefficient
*Big cells would starve or die of a build up of wastes if they got too large
What will a cell do before it gets too large?
Divide
Cell division = Cell Reproduction = Mitosis = Asexual reproduction
What is the difference between Mitosis and Meiosis?
Mitosis: the division of body cells
*in humans: cells with 46 chromosomes
Meiosis: division of sex cells (sperm and eggs)
*in humans: cells with 23 chromosomes
When a eukaryotic (a cell with a nucleus) cell divides it takes place in two stages:
Mitosis: nucleus divides to form 2 identical nuclei
Cytokinesis: cytoplasm divides
Changes in the nucleus during Mitosis
*the nucleus plays a major role in cell division
Nucleus: control center of the cell
*DNA (deoxyribonucleic acid)
In non-dividing cells, DNA exists as CHROMATIN: spaghetti like twisted threads of
DNA
Diagram:
When mitosis begins chromatin shortens and thickens into rod-like structures called
chromosomes.
The phases of mitosis:
Interphase:
*the phase when a cell is between
mitotic cycles
*growth period
-grows in size
-metabolizes
-chromosomes
replicate
Prophase:
*the first and longest phase
of mitosis
*replicated chromosomes become
visible
*centrioles move to opposite
ends of the cell (poles)
*nuclear membrane
disintegrates
*asters form around centrioles
*spindle fibers form
*replicated chromosomes
move toward equator
Metaphase:
*replicated chromosomes attach
to spindle fibers
*chromosomes line up midline
Anaphase:
*separation of sister chromatids
*each chromatid moves to an
opposite pole
*one complete set of chromosomes
goes to one pole while an identical
set goes to the other
Telophase:
:
*phase begins once the chromosomes
(chromatids) reach the poles
*chromosomes unwrap chromatin
*spindle breaks down
*nuclear membrane reforms
At the conclusion of telophase, cytokinesis occurs…
*cell membrane pinches off
*division of cytoplasm
*2 daughter cells complete
Diagram of mitosis:
Meiotic Cell Division
Meiosis and Sexual Reproduction
Refresher:
Asexual reproduction (Mitosis) the parent cell divides to produce offspring with the
same genetic makeup as the parent.
Sexual reproduction requires two different parent cells, one from mom and one from
dad.
*Sexual reproduction produces offspring that are genetically different
from either parent.
Gametes: sex cells (male: sperm/ female: egg)
New life forms when the gametes join together (fertilization)
Fertilization: the fusion of the nuclei of the male and the female gametes
Zygote: the single cell formed from this fusion
Gametes are formed by the process of MEIOSIS
Meiosis: a kind of cell division that results in gametes with half the number of
chromosomes as the parent cell
How many chromosomes does a human have?
46 chromosomes!!!!
Why must an egg and a sperm have 23 chromosomes each?
When the sperm and the egg unite during fertilization the resulting baby must have
46 chromosomes…NOT 92!!!
*each pair of chromosomes, one from mom and one from dad, are known as
HOMOLOGOUS CHROMOSOMES
Homologous chromosomes: a pair of chromosomes that are similar in size and shape, and
have similar genetic content
Cells that are homologous are known as: somatic cells (body) or diploid cells or 2n
Somatic cells: body cells that have 46 chromosomes in humans (23 pairs)
Somatic cells = body cells = diploid cells = 2n
Haploid cell (n): a cell with one of each kind of chromosome
These cells are our sex cells (gametes)
Stages of Meiosis:
Meiosis starts in 1 diploid cell (a cell with 46 chromosomes) (ovaries and testes)
Meiosis ends with 4 haploid cells (cells with 23 chromosomes)
The process of meiosis occurs in two parts meiosis I and meiosis II
*the phases of each part are similar to mitosis
Meiosis (interphase has already occurred)
Prophase I:
*each chromosome has already replicated
*each homologous chromosome lines up
with its pair, and becomes fastened at the
CENTROMERE
This process is called SYNAPSIS
Each group of four chromatids is a
TETRAD
CROSSING OVER occurs
Metaphase I:
Tetrads line up across the equator
Anaphase I:
Tetrads separate (disjunction)
You are now left with 23 replicated
chromosomes
Telophase I:
Two daughter cells are formed with half
the number of chromosomes as the parent
cell.
Chromosomes are already in their
replicated form
Prophase II:
Chromosomes move toward equator
Metaphase II:
Chromosomes line up on the equator of
both daughter cells
Anaphase II:
Chromatids separate each becoming a
single stranded
Chromosome
Telophase II:
Both daughter cells divide, forming 4
haploid (n) cells
Diagram of Meiosis:
Human Reproduction
The Male Reproductive system:
Testes (2): the male sex glands (gonads).
*produce sperm (gametes)
*produce testosterone (hormone)
What does testosterone do?
*development of secondary sex characteristics
(body hair, muscle development and deep
voice)
Scrotum: a sac of skin that holds the testes
*helps keep the sperm below body temp.
*increased temp can kill sperm
Vas deferens: a tube that leads upward towards the urethra from the epididymis.
Urethra: the vas deferens empty the sperm into the urethra (the same tube that urine
leaves through!!!!)
****sperm and urine do not leave the body at the same time
Ejaculation: involuntary muscle contractions that force semen outside of the body.
The Female Reproductive system:
Ovaries (2): the female gonads (sex glands)
*make eggs (female gametes)
*each ovary contains 200,000 follicles
(immature egg sacs)
*only 500 eggs mature in each female lifespan
*secrete estrogen
What does estrogen do?
*causes the development of secondary sex
characteristics (breasts, broadened pelvis,
distribution of body fat)
*plays an important role in the menstrual cycle
Ovulation: when an egg matures the egg is released from the ovary (only one ovary
produces an egg each month of a mature female). An egg can be fertilized only for about
24 hours after ovulation occurs.
Fallopian tube (oviduct): the tube that connects the ovary to the uterus. It is here that
most eggs are fertilized by a sperm.
Uterus: a thick walled, muscular pear shaped organ. If the egg is fertilized it will attach
to the wall of the uterus and develop into a fetus.
Cervix: the neck of the uterus
Vagina: muscular passage from the uterus to outside the body. This is also known as the
birth canal.
****The female is different from the male in that the urinary and reproductive systems
are completely separate.
The menstrual cycle (in humans):
*in the human a mature egg leaves one of the ovaries about every 28-32 days
*at this time the body prepares for a potential pregnancy by thickening the uterine walls
with a rich supply of blood vessels
*if the egg doesn’t become fertilized the uterus will shed the lining and the unfertilized
egg as menstrual blood. (this is your period!!!!)
*another egg will begin to mature as the cycle begins again.
Stages of the menstrual cycle:
1st stage: follicle stage: pituitary secretes FSH (follicle stimulating hormone) which
causes an egg to begin developing. This causes an increase in estrogen production. As
the estrogen level increases the uterine wall thickens with blood vessels (10-14 days)
2nd stage: Ovulation: when the estrogen level reaches a certain point, the pituitary gland
will start secreting LH (lutenizing hormone). When the LH level reaches a certain point,
a mature egg will be released from the follicle within the ovary. (takes place on day 14)
3rd stage: Corpus luteum: the empty follicle will fill with a yellow body called the corpus
luteum, which secretes the hormone progesterone. Increased progesterone levels
maintain the growth of the uterine wall. (10-14 days)
4th stage: Menstruation: if fertilization does not occur, LH secretion decreases, the
corpus luteum breaks down, and progesterone levels drop. This causes the uterus to shed
its lining. This is menstrual blood.
Fertilization and Development:
When the male ejaculates, 200 million sperm are deposited inside the vagina just below
the cervix.
The sperm will begin their journey from there….
It is in the fallopian tube that the sperm will encounter the egg and fertilization occurs. (in
vivo fertilization)
Egg (ovum or gamete):
*it is a round cell that is unable to move on its own…it is propelled through the oviduct
by cilia.
*contains a nucleus and mitochondria
*larger than the sperm
*contains half the number of chromosomes than the mother
(23 chromosomes….haploid)
Sperm: (gamete)
*head, mitochondria flagellum and acrosome
*head contains the nucleus and acrosome (contains enzymes to help penetrate the egg)
*contains half the number of chromosomes than the father
Fertilization:
*joining of a sperm and egg
*only one sperm can enter the egg
*haploid (egg) + haploid (sperm) diploid (zygote)
Zygote: first cell of life
The zygote will then begin to divide by mitosis.
Diagram:
The zygote will then begin to divide (cleavage) into many identical cells that form a
blastula…it is now an embryo
Implantation:
*after 5-10 days the embryo will begin to implant into the uterine lining
*the embryo secretes enzymes to break some of the lining of the uterus and embeds itself
within the uterus lining
*after implantation, the embryo differentiates (gastrulation) forming layers that become
tissues and organs
*after 8 weeks the embryo is now a fetus.
What is In Vitro fertilization?
If a woman’s fallopian tubes are blocked or she has some other medical condition where
she cannot conceive a child, in vitro fertilization may be attempted.
Fertilization occurs in a petri dish and then the embryo will be placed in the uterus of the
mother.
Fetal Development:
Placenta: temporary network of blood vessels that allows the exchange of nutrients and
wastes between the fetus and the mother. Considered an organ
Umbilical cord: rope-like connection between the placenta and the fetus
Amniotic fluid: fluid that surrounds the fetus, giving it a stable environment and acts as a
shock absorber
Amniotic sac: membrane-lined sac that holds the fetus
Uterus: thick walled, muscular organ where the baby develops
Fetus: developing baby after eight weeks gestation
Vagina: birth canal
Cervix: narrow neck to the uterus that opens 10 cm during labor
Diagram:
Birth:
Gestation period: length of pregnancy; 40 weeks in humans
Labor: uterine contraction begin (muscle tightening of the uterus)
*cervix begins to open (closed10 cm
*contractions get stronger to push baby out of mothers body
*after birth the umbilical cord needs to be tied off and cut.
*after birth will deliver the placenta
Twins:
Fraternal twins: the mother ovulates two eggs that are fertilized by two different sperm!
The babies will have different genetic material.
Identical twins: one egg is fertilized by one sperm and the zygotes splits into two
identical zygotes. The babies will have identical genetic material. Identical twins have to
be the same sex (boy/boy or girl/girl)
Amniocentesis:
Regents review questions:
22. Each of the two daughter cells that results from the normal mitotic division of the
original parent cell contains
A. The same number of chromosomes but has genes different from those of
the parent cell
B. The same number of chromosomes and has genes identical to those of the
parent cell
C. One half the number of chromosomes but has genes different from those
of the parent cell
D. One half the number of chromosomes and has genes identical to those of
the parent cell
23. The following list describes some of the events associated with normal cell
division.
1. nuclear membrane formation around each set of newly formed chromosomes
2. pinching in of cell membrane to separate daughter nuclei and divide cytoplasm
3. replication of each chromosome to form double sets of double stranded
chromosomes
4. movement of single stranded chromosomes to opposite ends of the spindle fibers
What is the normal sequence on which these events occur?
A. 1234
B. 3241
C. 3412
D. 4321
24. What is the result of normal chromosome replication?
A. Lost or worn out chromosomes are replaced
B. Each daughter cell is provided with twice as many chromosomes as the
parent cell
C. The exact number of centrioles is produced for spindle fiber attachment
D. Two identical sets of chromosomes are produced
25. In non-dividing cells, the chromosome material is in the form of
A. chromatids
B. centrioles
C. spindle fibers
D. chromatin
26. The basic raw materials for photosynthesis are:
A. Water and carbon dioxide
B. Oxygen and water
Sugar and carbon dioxide
C. Carbon dioxide and oxygen
27. Organisms that reproduce asexually usually do so by a form of cell division
called:
meiosis
mitosis
gamete formation
sperm formation
28. If the sperm cells of a cat contain 14 chromosomes, how many chromosomes
would be found in the cells forming the liver of the cat?
14
7
28
36
29. A normal body cell of a giraffe contains 20 chromosomes. How many
chromosomes would be present in one of the giraffe’s egg cell?
20
40
10
5
30. Compared to the parent cell, a daughter cell produced as a result of binary fission
Has one half as many chromosomes
Has twice as many chromosomes
Is the same size, but has fewer chromosomes
Is smaller but has the same number of chromosomes
31. A form of asexual reproduction that occurs in yeast is called
Binary fission
regeneration
sporulation (spore formation)
vegetative reproduction
32. A type of asexual reproduction in which new plants develop from the roots,
stems, or leaves of an existing plant is called
Binary fission
sporulation
regeneration
vegetative reproduction
33. In human males, the maximum number of functional sperm cells that is normally
produced from each primary sex cell is:
1
2
3
4
34. Haploid gametes are produced in animals as a result of:
mitosis
meiosis
binary fission
fertilization
35. Sexually reproducing species show greater variation that asexually reproducing
species due to:
Lower rates of mutation
Higher rates of reproduction
Environmental changes
Recombination during meiosis
36. In animals, polar bodies are formed as a result of
Meiotic cell division in females
Meiotic cell division in males
Mitotic cell division in females
Mitotic cell division in males
37. During normal meiotic division of a diploid cell, the change in chromosome
number that occurs is represented as
4n
n
2n
4n
2n
n
n
1/2n
38. In a developing embryo, the process most closely associated with the
differentiation of cells is called
gastrulation
menstruation
ovulation
fertilization
39. In mammals the placenta is essential to the embryo for
Nutrition, reproduction, growth
Nutrition, respiration, excretion
Locomotion, respiration, excretion
D. Nutrition, excretion, reproduction
40. What substances are involves in controlling the production of sperm and eggs in
humans?:
vitamins
starches
minerals
hormones
41. Which is arranged in the correct sequence?
Fertilization
embryo development
meiosis
birth
embryo development fertilization
meiosis
birth
meiosis
fertilization
embryo development
birth
meiosis embryo development
fertilization birth
Constructed response questions:
21. Briefly discuss the function of the following structures in the development of the
human embryo: placenta, umbilical, amniotic fluid
_____________________________________________________________________
_____________________________________________________________________
_____________________________________________________________________
_____________________________________________________________________
_____________________________________________________________________
_____________________________________________________________________
_____________________________________________________________________
_____________________________________________________________________
22. Compare and contrast the processes of mitosis and meiosis. What is the function
of each process.
__________________________________________________________________
__________________________________________________________________
__________________________________________________________________
__________________________________________________________________
__________________________________________________________________
____________________________________________________________
23. Compare and contrast the processes of sperm and egg production in terms of:
i. where each process occurs
ii. the relative numbers of gametes produced by each process
________________________________________________________________________
________________________________________________________________________
________________________________________________________________________
________________________________________________________________________
________________________________________________________________________
________________________________________________________________________
________________________________________________________________________
24. Explain how the daughter cells produced during meiosis may be genetically
different from one another even though they result from the same original diploid
cell. Why is this variation important? Why are cells produced by mitosis not
genetically different from one another?
_____________________________________________________________________
_____________________________________________________________________
_____________________________________________________________________
_____________________________________________________________________
_____________________________________________________________________
_____________________________________________________________________
_____________________________________________________________________
_____________________________________________________________________
_____________________________________________________________________
GENETICS
Genetics – The study of heredity – traits passed down from one generation to the next.
Gregor Mendel (1850’s) – The Father of Heredity
Mendel was a monk in Europe who grew pea plants and discovered basic principles of
heredity that are still accepted today.
Because of him, we know that certain traits in pea plants (and humans) are dominant. If
an organism has one dominant gene and one recessive gene, the recessive trait will
remain hidden and the dominant will show itself.
For example, if a person received a brown eyed gene from one parent and a blue eyed
gene from the other, then that person will have brown eyes.
Pic of punnett square
Offspring get their traits from genes found on chromosomes that are inside the egg and
sperm cells. Each of these cells carries 23 chromosomes so that the baby ends up with
46.
Genes are made of a chemical called DNA. DNA is made of smaller subunits called
nucleotides. There are only four different nucleotides bases (A,T, C. & G) in the DNA
of every living thing.
So if every orgainism has the same 4 building blocks, then why don’t we all look the
same? That’s because the order of the bases is what determines what we are like.
Humans have 3 billion base pairs (A-T or C-G) and the different possible combinations
are endless.
How does the chemical DNA make my eyes brown or my height 6 foot?
DNA synthesizes, or makes, the proteins that make up the important parts of living
things. For example, the chemical that makes your eyes brown is a protein called
melanin. If you have the gene for brown eyes, then the order of your DNA bases will be
read and used to make this protein.
Many people have the same gene for brown eyes or the genes to be 6 foot, but no two
people look exactly alike because their DNA isn’t exactly alike. Except Identical twins.
They look alike because they both came form one egg cell that split into 2 clone
(identical) cells.
Whenever a cell reproduces (Mitosis) it makes a copy of its DNA. This is called
Replication.
Sometimes there are errors in the DNA code. These errors are called Mutations.
Mutations can happen during replication if the wrong base is used to make the new DNA
strand.
Pic of mutations (from review book)
Harmful substances like cigarette smoke and the sun’s radiation can cause mutations.
Often these mutations cause cancers like lung or skin cancer.
GENETIC DISEASE
People can be born with mutations that cause Genetic Diseases. Some common genetic
diseases are : Sickle cell anemia, Cystic fibrosis and Tay sachs disease. Sickle cell is
caused by a mutation in the gene for hemoglobin, the protein that carries oxygen in your
blood. Because there is an error in the person’s DNA, there will also be an error in the
hemoglobin that their DNA makes. The deformed hemoglobin causes the Red blood
cells to be sickle shaped. These cells can’t carry enough oxygen and they can cause pain
when they get stuck in blood vessels.
Genetic engineering is a new technology that humans use to alter the genetic
instructions in organisms. The idea of altering organisms to have more desirable traits,
however, is not new. In fact, biotechnology – the application of biological science – has
been producing useful products for thousands of years. Cheese and bread are just two
examples of “biotech” products made with the use of microbes.
Throughout recorded history, humans have also used selective breeding – a process that
produces domestic animals and new varieties of plants with traits that are particularly
desirable. Many meat products, for example, come from animals that have been bred to
contain less fat. In addition, many of the fruits and vegetables we consume have been
selectively bred to be larger, sweeter, hardier or even juicier. For example, corn plants
originally grew wild and had tiny ears (left). After centuries of selective breeding,
humans have produced the large ear that we are used to eating (right).
GENE MANIPULATION
In recent years, plants and animals have been genetically engineered by manipulating
their DNA instructions. The result of this genetic manipulation is new characteristics and
new varieties of organisms. Consequently, we have been able to produce plants with
many beneficial traits. In one instance, plants can now contain genes with the
instructions for making chemicals that kill the insects that feed on them. Scientists have
also engineered bacteria that can be used to clean up oil spills or that produce human
growth hormone.
The basic method that alters genes in organisms uses special enzymes. These enzymes
cut DNA segments in a way that allows the segments to be spliced, or moved and
attached to DNA in a new organism. Once in the new organism, the transferred genes
direct the new organisms cells to make the same protein product as the original organism.
For example, when we move a human insulin-producing gene into a bacteria cell, the
bacterium – and all its offspring- will produce large quantities of a hormone at low cost.
Genes for other human proteins have also been inserted into bacteria cells, as illustrated
below.
Pic of gene splicing
Figure. Genetic Engineering using bacteria: (A) A special enzyme is used to cut a
segment of DNA from a human cell and a circular piece of DNA from a bacteria cell.
(B) When the piece of human DNA is mixed with the open loop of bacterial DNA, they
join in a closed loop. (C) That loop is then inserted into another bacterial cell, (D), where
it will produce its protein product and be duplicated every time the cell divides.
APPLICATIONS OF BIOTECHOLOGY
The healthcare field has much to gain through our increasing knowledge of genetics and
biotechnology. New methods enable us to locate and decode genes that cause diseases.
Once we have a better understanding of the gene’s specific defect, we may be able to
develop ways to treat victims of the disease. In some cases, we may be able to alter the
DNA in affected cells and cure the person.
Important voaculary:
Biotechnology
Cancer
Chromosomes
Clones
Dominant
DNA
Genes
Genetics
Genetic Engineering
Gregor Mendel
Mutations
Nucleotides
Protein Synthesis
Recessive
Replication
Splicing
Review questions
1. Which is not a requirement of genetic material?
a) it must be able to make a copy of itself
b) it must be weak so that it can fall apart easily
c) it must be able to mutate from time to time
d) it must be able to store information
2. Which two bases are always found in the same amount in DNA?
a) adenine and thymine
b) adenine and guanine
c) thymine and guanine
d) cytosine and adenine
3. Watson and Crick contributed to the study of DNA by..
a) experimenting with pea plants
b) recognizing that traits are inherited
c) discovering the double helix structure of DNA
d) mapping the entire human genome
4. The DNA molecule is formed from subunits arranged in a
a) sequence with three kinds of bases
b) circle with four kinds of bases
c) sequence with four kinds of bases
d) sequence with four kinds of acids
5. The base pairs in DNA are similar in arrangement to the
a) sides of a ladder
b) steps of a ladder
c) railing of a staircase
d) surface of a ramp
6. The order of subunits in a strand of DNA is called a
a) subunit sequence
b) linear sequence
c) strand sequence
d) nucleotide sequence
7. If one strand of DNA molecule is G-A-T-C-C-A-T, what is the sequence of the
opposite strand ?
a) G-A-T-C-C-A-T
b) C-T-A-G-G-T-A
c) A-T-G-G-A-T-G
d) T-A-C-C-T-A-G
8. The organization of bases in DNA can be best likened to the..
a) arrangement of letters in a word
b) kinds of tools in a garage
c) number of books in a library
d) colors in a rainbow
9. To pass along the genetic information, DNA must first undergo
a) mutation
b) replication
c) digestion
d) synthesis
10. What must organisms do to use the genetic information stored in DNA?
a) rearrange the base pairs
b) use it to make proteins
c) combine the DNA strands
d) change it into phosphates
11. The subunits of proteins are
a) phosphates
b) bases
c) amino acids
d) enzymes
12. During the first step in the replication of DNA, the
a) double helix unwinds
b) template is created
c) subunits of DNA form pairs
d) double helix winds itself
13. Genes can best be described as
a) directions for making DNA
b) directions for making protein
c) subunits of proteins
d) molecules that transfer information out of the nucleus
14. Which path correctly describes the flow of information in cells?
a) DNA -> RNA -> protein
b) protein -> RNA -> DNA
c) protein -> DNA -> RNA
d) RNA -> DNA -> protein
15. The role of the messenger RNA is to
a) prevent mutations during DNA replications
b) match ribose-containing subunits to subunits of DNA
c) move the information in a base sequence out to the ribosomes
d) translate the base sequence at the ribosomes
16. RNA receives information from DNA by
a) binding with a double helix as a third strand
b) matching with subunits of a single strand of DNA
c) making an exact copy of the DNA molecule
d) accepting proteins through pores in the nuclear membrane
17. What happens at the ribosome?
a) the DNA strands separate
b) RNA matches up with the DNA strands
c) genetic information is mutated
d) RNA is translated into amino acids
18. How many bases make up one codon?
a) one
b) two
c) three
d) four
19. What does a codon represent?
a) a specific amino acid
b) a specific base
c) an RNA molecule
d) an enzyme
20. The genetic code is ..
a) different for every organism
b) the same for all organisms
c) constantly changing
d) impossible to identify
21. The sequence of amino acids in a protein is determined by the
a) speed at which translation occurs
b) size of the cell involved
c) number of ribosomes in a cell
d) order of bases in the DNA
22. A mutation is inherited if it
a) occurs in a gamete that is used in sexual reproduction
b) occurs in a cell that under goes mitosis
c) occurs only in the cells of the mother
d) occurs only in the cells of the father
23. Scientists use restriction enzymes to
a) limit the length of DNA molecules
b) stop parts of DNA from replicating
c) prevent certain genes from being expressed
d) cut specific base pair sequences out of DNA
24. The molecules that can move cut pieces of DNA from one organism to another are
called
a) vectors
b) splicers
c) transformers
d) combiners
25. Genetic engineering has been used to improve crop varieties by
a) reproducing old genes for wild characteristics
b) removing genes that cause them to get diseases
c) inserting genes that make them diseases-resistant
d) adding animal genes that make them grow faster
26. Why scientists insert human genes into bacteria?
a) to give bacteria some human traits
b) to make large amounts of human proteins
c) to dispose of our defective genes
d) to find out what the bacteria will do
27.When a human gene is inserted into a bacteria cell to become part of its DNA, it is an
example of
a) DNA fingerprinting
b) biotechnology
c) karyotyping
d) defective genes
28. Why are bacterial cells useful in recombinant DNA technology?
a) they reproduce quickly
b) they reproduce slowly
c) they are almost identical to human cells
d) they can be placed within the human body
29. The bacteria that are genetically engineered to produce insulin for people do so with
genes that originally come from
a) other bacteria
b) healthy cattle
c) healthy humans
d) chimpanzees
Classification and Evolution
Part I Classification
The branch of biology that classify or organizers living things is called Taxonomy.
There are over 10 million types of organisms or species on earth. The smallest being a
single cell bacteria, the largest a giant red wood tree.
Carl Linnaeus, a Swedish scientist developed modern taxonomy is the late 1700’s.
Linnaeus used binomial nomenclature to name each species on earth. Giving in Latin a
word that described to organism.
All species are ranked form most complex to least complex staring in kingdoms / phylum
/ order / family / genus / species
Example human kingdom animalia
Phylum chordata – spinal cord
Class mammalia – produces milk
Order primates
Family hominid
Genus homo
Species Homo sapiens
Kingdoms of Life
Kingdom
Monera
Example
Bacteria
Protista
Ameba
Paramecium
Fungi
Mushroom
Yeast
Mold
Plant
Moss
Fern
Flowers
Animal
Coral
Sponge
Mammals
Phylogenetic tree shows how closely related different species are what common
ancestress they might have shared.
ameba kingdom protsta
Mushrooms kingdom fungi
bacteria kingdom monera
Taxonomic Key
Taxonomic Key tool used to identify a species already classified by taxonomy.
Regents Living Environment
Ecology and Human Impact on Ecosystems
Part I Ecology
Ecology Vocabulary
Pioneer Organisms Biosphere Ecosystem Community
Population Succession Biotic
Food web
Autotroph Biomass Producer Heterotroph
Omnivore Carnivore Predator Prey
Scavenger Saprophyte Commensalism Mutualism
Parasitism Climax Community Ecology Abiotic
Ecology
The study of the interaction between living organisms and the physical environment.
All living things are dependant on other living things and nonliving things to survive.
Biosphere
The portion of the earth where live exists.
Ecosystem
All the living things and the physical environment functioning together in a specific area.
Community
All the organisms in a specific area living together at the same time.
Population
All the members of the same species living together in the same area at the same time.
How Ecosystems Function
Ecosystems involve the interaction between abiotic and biotic factors.
Abiotic
Biotic
not living and never was
living or made by living things
sunlight
animals
water
plants
air
bacteria
Ecosystems are self- sustaining units.
Ecosystems must have a constant source of energy usually the sun.
Ecosystems have the ability to cycle and recycle materials in them.
Biotic Factor Relationships
Living things transfer energy from the sun by photosynthesis to other organisms by
eating.
Food chain or web
Shows the path of energy form the sun to other organisms. The more complex the path
the more stable the ecosystem will become.
Autotrophs or Producers
Organisms that make their own food by photosynthesis from sunlight and CO2.
Make up most of the Biomass of the ecosystem.
Heterotroph or Consumer
Depend on the organism for food
Omnivores
Eat both plants and animals
Carnivores
Eat other animals.
Predators hunt living prey.
Scavengers eat dead animal the find.
Saprophytes or Decomposers
Use dead material and waste from other living things for energy.
Return nutrients back to the ecosystem to be reused.
Examples are fungi mold and bacteria
Ecosystem Energy Pyramid
In each transfer of energy a small amount (10%) is lost so a constant input in is required.
Other Biotic Factors
Symbiotic Relationships
Relationships between organisms that live together in a close association.
Commensalism
One organism benefits and the other organism is not harmed
Example a fern living under the shade of a tree
Mutualism
Both organisms benefit
Example protozoa in a cow’s stomach
Parasitism
One organism is harmed while the other organism benefits
Example tapeworms living in a human’s digestive system
Mutualism
Competition In Ecosystems
Different species living in the same habitat are unlikely to use the same limited resources
Niche
The resources used by a member of the ecosystem community. Only one species per
niche can survive in nature. Parts of a species niche may overlap with another species.
Ecosystem Formation
An areas climate is the main factor in determining the type of ecosystem that will form.
Ecological Succession
The step-by-step replacement of one community by another community until a stable
ecosystem is reached
Pioneer Organisms
The first living things to populate an area
Examples Lichens moss grass
Climax Community
The stable community forming and ecosystem
Example Deciduous trees Oak Hickory
NYS Stages of Succession
Lichens / grasses / shrubs / conifers / deciduous trees
Biomes
Common types of climax ecosystems found on Earth.
Some factors that determine biome type. Latitude / altitude / rain fall / temperature
Terrestrial Biomes – Land
Tundra / taiga / Deciduous forest / tropical forest / grassland / desert
Aquatic Biomes – water
Marine / estuary / fresh
Human Impact on the Environment
Humans have modified the environment more then another species in history.
Effecting one part of an ecosystem may have unintended effects on another part of the
ecosystem.
Glossary of Major Environmental Problems
Acid Rain
When coal is burned in a power plant small amounts of sulfur in the coal goes into the air
out of the smoke stack. This smoke mixes with the moisture in the air becoming sulfuric
acid. The acid falls to the earth as acid rain contaminating the environment.
Ozone Hole
There is a layer in the upper atmosphere that protects the earth from cancer causing UV
ray of the sun called the Ozone Layer. The Ozone layer has been destroyed by a
chemical known as CFC that comes from arousal spray cans and refrigerator coolant. A
hole above Antarctica has formed in the ozone layer do to CFC use. CFC has now been
banned and the ozone hole in getting smaller.
Global Warming
The earth is getting warmer which causes glaciers to melt and sea levels to rise. The
increase in global temperature may be caused by high levels of carbon dioxide being
released into the air by burning fossil fuels. The CO2 traps earth’s heat that would
normally be released into space.
Algae Blooms
Fertilizes from farms, parks, golf courses and private laws wash into streams, rivers,
lakes and eventually the ocean and cause huge amounts of algae to grow. When the algae
dies and sinks to the bottom of the water, bacteria that decomposes them suck the oxygen
out of the water killing many of the fish.
Invasive Species
Humans have introduced new organisms to an ecosystem. The new non-native or
unnatural organism disrupts the natural environment. Zebra mussels are an example of
an invasive species brought to the great lake from Asia in large cargo ships.
Regents Living Environment Project
Human Impact On The Environment
How do these issues effect the environment we depend on?
Topic Selections
Environmental Issues
Acid Rain
Nuclear Waste Disposal
Ozone Hole
Algae blooms
Deforestation
Global Warming
MTBE fuel additive
Forest Fire Prevention
Hudson River PCB
Invasive species
Pesticides
Mercury contamination
Name: ___________
Due Date: __________
Topic Selected: ______________
Test on all presentations will be given
Power Point Documentary
• Title page with picture
Cover topic thoroughly include when applicable
How humans caused the problem
How the problem affects the environment
How the problem affects Humans
How can the problem be fixed Include opposing views
•
•
•
•
•
•
Include at least 4 graphics (1 map/ 1 graph/ 1 table/ 1 diagram)
One comprehensive, student generated picture, indicated as such that summaries
the presentation
All slides organized/ legible / max of 100 words per slide
All slides Appropriate Graphic/ sounds /colors
NPR article on separate slide listed with 5 bullet facts
Glossary of 10 scientific terms. Have terms in bold on PowerPoint
• 5 meaningful test questions with answers, which reviews the main points
• Complete project on the schools system
Store project in a folder in your proper class section
Laboratory Skills
Vocabulary
Balance
Compound light microscope
Electronic balance
Graduated cylinder
Indicator
Metric ruler
Microscope
Stereoscope
Total Magnification
Chromatography
Dichotomous key
Electrophoresis
Graphs
Mass
Micrometers
Stain
Triple-beam balance
Volume
Laboratory Skills
• Graduated cylinder – used to measure a liquid’s volume (the space it
occupies)
•
•
•
Balance – used to calculate mass (a measure of the quantity of matter in
an object).
Triple-beam balance – has three beams (bars) and one pan. The balance
needs to be a zero before you try to calculate the mass of something. The
beams need to be moved until the pointer is at zero. The mass of the
object is equal to the sum of the three beams.
Electronic balance – measures automatically.
•
•
•
Most scientists use the metric system when collecting data and performing
experiments
Metric System – a universal decimal system of weights and measures
based on the meter and the kilogram
Metric ruler – used to measure length (meter)
Metric ruler
•
Micrometers (µ
µm) - tiny units used to measure things under the
microscope 1000 µm = 1 mm
•
Microscopes - tools that produce magnified images of structures that are
too small to see with the unaided eye
Compound light microscope – uses one ocular lens, one objective lens
and a light source
Total magnification – calculated by multiplying the eyepiece times the
obje
ctiv
e
lens.
•
•
•
•
Stereoscope – also known as a dissecting scope, has two ocular eyepiece
lenses and one or more objectives. This type of microscope makes the
image 3-D. It is mostly used with specimens such as insects, worms or
flowers.
Model – a representation of used to explain or demonstrate a process or
structure; also used to predict what might occur in a new situation
Microscope
Parts of the microscope
• Eyepiece or ocular – lens nearest the eye and used to look through (10x
magnification)
• Objective lenses - lenses closest to the specimen (4x, 10x and 40x
magnification usually)
• Stage – flat surface on which the specimen is placed
• Diaphragm – controls the amount of light the passes through the specimen
• Light source – provides light that passes through the specimen to make it
visible (can be a light bulb or a mirror)
• Coarse adjustment (focus knob) – focus under low power (up to 100x ).
Usually larger and moves the lenses or the stage.
• Fine adjustment (focus knob) – used to sharpen image (usually used with
high power)
Techniques for Using Microscope
• Image will be upside-down and backwards
• To move image, you need to move the slide in the opposite direction in which
the organism appears to be moving (of how you want it to move)
• Increase light as you move from low to high power
• More of the image under low power, less detail
• Less of the image under high power, more detail
To use the compound light microscope:
1. Turn ON the light source or adjust the mirror.
2. Lower the stage.
3. Rotate to the 4x objective, if it is not already in place.
4. Clip in a slide.
– the slide is moved about the stage mechanically using the two directional
knobs to the right of the stage
– locations of microscopic organisms on the slide may be recorded, using
the
vertical and horizontal calibration marks along each axis of the stage
5. Adjust the inter-ocular distance of the eyepieces to suit your eyes.
6. Use the COARSE FOCUS adjustment knob ONLY when using the 4X or 5X
objective. Use the FINE FOCUS adjustment knob when using all other
objectives.
7. Focusing may be improved by adjusting the left ocular:
– cover your right eye –don’t squint – and focus using the adjustment knob
surrounding the ocular
– next, cover your left eye and focus using the fine focus adjustment knob
8. The iris diaphragm controls the amount of light passing through a specimen;
optimize contrast/reduce glare by adjusting the iris diaphragm:
– close the lever fully
– next, slowly open the diaphragm
9. The condenser concentrates light on the specimen; optimize the light conditions
by
adjusting the condenser:
– move the condenser to the top position, using the rack and pinion knob
– next, slowly lower the condenser until the background conditions look good
10. Increase magnification by rotating the nosepiece to a higher objective, but use
only
the fine focus adjustment knob to focus with 10X and higher objectives:
– when switching objectives, look at the objective to make sure you do not
hit
the slide
– be extremely careful of any thick slides you use in this course; they are
easily
damaged by carelessness during focusing
– LOOK at the slide when you change objectives or use the coarse focus
Preparing a Wet-mount Slide
1.
Using a pipette (eye dropper), add a small drop of water to the center of a
clean slide.
2.
Place the object to be viewed in the water.
3.
Use forceps to position a coverslip at a 45° angle. As seen in the diagram
below
4.
Lower the coverslip slowly to avoid bubbles.
Staining Specimens
• Stains – can be used to make cell structures more visible
• Iodine and Methylene blue are common stains used in the lab
• Place a drop of the stain on the edge of the coverslip
• Next, touch a small piece of towel to the opposite edge and the stain should
be drawn across the slide under the coverslip
Methylene Blue
Lugol’s Iodine
Additional Laboratory Techniques
• Gel Electrophoresis – procedure used to separate mixtures of large
molecules according to size, such as DNA and proteins.
o Protein gel, a sample of biological material containing proteins is
prepared by breaking open the cells in order to release the proteins
o Next, the proteins are treated with both chemicals and heat
o One of the chemicals used coats the protein molecules and gives
them a negative charge
o Small amounts of the prepared sample are placed in gel
electrophoresis apparatus
o The gel is placed between two electrodes (positive and negative)
that are connected to a power supply
o As charged particles move towards opposite charges, the smaller
particles travel more quickly than the larger ones, separating the
protein by size and charge.
• DNA gel electrophoresis
o Fragments of DNA are separated and will vary in size and number
from one individual to another due to each person’s unique genetic
codes
o Special enzymes cut the DNA a specific points.
o Next, small amounts of the DNA samples are placed in a semisolid
gel.
o The gel is located between two electrodes (positive and negative)
that are connected to a power supply.
o As charged particles move towards opposite charges, the smaller
particles travel more quickly than the larger ones, separating DNA
into a s distinct pattern that becomes visible through staining or a
variety of other techniques.
• The information provided by both Gel and DNA gel electrophoresis looks
like a bar code.
• The patterns can provide information about individual relatedness.
• Used in identifying parents of children and in criminal investigations.
• Chromatography – technique used for separating mixtures of molecules.
o The rate at which a substance moves along the paper in a given
solvent can be used to separate it from other substances
o The mixture being separated is placed on paper to which it sticks.
o Example: chloropyll extract from plant leaves is placed on filter
paper, or chromatography paper, and causes very colorful bands
of plant pigments
One end of the paper has the extract, the other end is
placed into a solvent (ex. Alcohol)
As the solvent soaks into the paper and moves upward,
substances in the mixture that do not stick tightly to the
paper will be picked up by the solvent and move ahead
quickly
Others less attracted to the solvent will stick more tightly
and move more slowly
This results in formation of bands of the different
substances on the paper
Indicators – a substance that changes color when it contacts certain
chemicals
Litmus paper turns red or a shade of
red in acids. Litmus turns blue or a
shade of blue in bases. It is important
to place a few drops or a small amount
of the substance to be tested on the
litmus paper when testing it. Do not
dip the litmus paper in the substance to
be tested. A paper which provides a
more specific indication of the pH level
of a substance is pH paper. This paper
turns different shades of various colors
which may be compared to a scale to
determine the pH value.
•
2. Bromthymol blue is an indicator
used to show the presence of either
carbon dioxide in solution or an acidic
solution. Low levels of carbon dioxide
or acid will result in the bromthymol
blue solution remaining blue, while
higher levels of carbon dioxide or acid
will result in the bromthymol solution
taking on a yellow tint. Frequently this
indicator is used in biology labs to
indicate photosynthetic activity (solution
turns blue as CO2 is used) or respiratory
activity (solution turns yellow as CO2 is
added to the solution).
3. Lugol's solution (which is actually
IKI) is a brown solution which turns
black in the presence of starches. The
test tube at the right shows Lugol's
(iodine) solution mixed with a starch
suspension.
4. Benedict's solution is used to detect
the presence of simple sugars such as
glucose. When a simple sugar is mixed
in Benedict's solution and heated for a
short period of time in a test tube, it
goes through a variety of color changes,
eventually ending as an orange-red or
brick red color. The use of Benedict's
solution before and after using it to
detect the presence of the simple sugar
glucose is shown in the pictures on the
right.
The pH Scale
Acids and bases (alkalis) are common substances studied in science.
The pH scale is used to indicate the relative strength of an acid of base. The pH scale
goes from 0 to 14. A pH of 7.0 is considered to be neutral. The greater the pH is than
7.0, the more basic the substance is. The lower the pH is below 7.0, the more acidic a
substance is.
Stomach acid has a pH of approximately 2.0.
1.
•
Dichotomous Key - a key used to sort , name, and/or classify a particular
organism. Typically consists of two statements that divide the things
being classified into two groups.
•
Graphs – organize data to see trends and patterns and allows us to form
opinions and to make comparisons quickly.
o Appropriate labels on the axes and a title is a necessity
o The dependent variable is plotted on the y-axis
o The independent variable is plotted on the x-axis
o The spacing between the numbers on both axes must be in
equal increments
o Four types of graphs:
1. Pie or circle graphs
2. Bar graphs
3. Histogram
4. Line graph
2.
3.
4.
Multiple Choice Review Questions
1. Of the following, which instrument is most commonly used to observe the external
features of a grasshopper's abdomen?
1.
2.
3.
4.
ultracentrifuge
microdissection instrument
dissecting microscope
electron microscope
2. A student observed a Paramecium under the low power objective of a microscope
(100x) and then under high power (400x). The image of the Paramecium under low
power, compared to the image of the same Paramecium under high power, would be
1. smaller and in a darker field of view
2. smaller and in a brighter field of view
3. larger and in a darker field of view
4. larger and in a brighter field of view
3. The width of a human hair is 0.1 millimeter. The width of this human hair in microns
is
1. 1 u
2. 10 u
3. 100 u
4. 1000 u
4. A coverslip should be used for preparing a
1. frog for dissection
2. solution of iodine for food testing
3. wet mount of elodea (a simple plant)
4. test to determine the pH of a solution
5. To test for the presence of glucose, a student added the same amount of Benedict’s
solution to each of the four test tubes. Two of the test tubes contained unknown
solutions. The other two test tubes contained known solutions. The chart below shows
the color results obtained after the solutions were heated in the four test tubes in a hot
water bath.
Data Table
Tube
Contents
Color After Heating
1
Unknown solution +
Benedict’s solution
Royal Blue
2
Unknown solution +
Benedict’s solution
Red Orange
3
Water + Benedict’s
solution
Royal Blue
4
Glucose + Water +
Benedict’s solution
Red Orange
The student could conclude that
1. All of the tubes contained glucose
2. Tubes 1 and 2 contained glucose
3. Tube 1 did not contain glucose, but tube 2 did
4. Tube 2 did not contain glucose, but tube 1 did
6. What is the approximate length of the earthworm shown in the diagram below?
QuickTime™ and a
TIFF (LZW) decompressor
are needed to see this picture.
(1) 9 mm
(2) 90 mm
(3) 10.6 cm
(4) 106 cm
7. How much water should be removed from the graduated cylinder shown below to
leave 5 milliliters of water in the cylinder?
QuickTime™ and a
TIFF (LZW) decompressor
are needed to see this picture.
(1) 6 mL
(3) 11 mL
(2) 7 mL
(4) 12 mL
8. Compounds containing phosphorus that are dumped into the environment can upset
ecosystems because phosphorus acts as a fertilizer.
The graph below shows measurements of phosphorus concentrations taken during the
month of June at two sites from 1991 to 1997.
QuickTime™ and a
TIFF (LZW) decompressor
are needed to see this picture.
Which statement represents a valid inference based on information in the graph?
(1)There was no decrease in the amount of compounds containing phosphorus
dumped at site 2 during the period from 1991 to 1997.
(2) Pollution controls may have been put into operation at site 1 in 1995.
(3) There was most likely no vegetation present near site 2 from 1993 to 1994.
(4) There was a greater variation in phosphorous concentration at site 1 than there
was
at site 2.
9. While viewing a specimen under high power of a compound light microscope, a
student noticed that the specimen was out of focus. Which part of the microscope should
the student turn to obtain a clearer image under high power?
(1) eyepiece
(2) fine adjustment
(3) coarse adjustment
(4) nosepiece
10. To demonstrate techniques used in DNA analysis, a student was given two paper strip
samples of DNA. The two DNA samples are shown below.
Sample 1: ATTCCGGTAATCCCGTAATGCCGGATAATACTCCGGTAATATC
Sample 2: ATTCCGGTAATCCCGTAATGCCGGATAATACTCCGGTAATATC
The student cut between the C and G in each of the shaded CCGG sequences in sample 1
and between the As in each of the shaded TAAT sequences in sample 2. Both sets of
fragments were then arranged on a paper model of a gel.
The results of this type of DNA analysis are often used to help determine
(1) the number of DNA molecules in an organism
(2) if two species are closely related
(3) the number of mRNA molecules in DNA
(4) if two organisms contain carbohydrate molecules
Constructed Response Questions
1. Base your answers to questions 1-4 on the information below and on your
knowledge of biology.
A student was working on an investigation to measure the relative activity of an enzyme
at various pH values.
He collected the following data:
pH 2 – enzyme activity 10
pH8 – enzyme activity 50
pH 12 – enzyme activity 10
pH 4 – enzyme activity 20
pH 6 – enzyme activity 40
pH 10 – enzyme activity 40
1. What is the independent variable in this experiment?
________________________________________________________________________
________________________________________________________________________
________________________________________________________________________
________________________________________________________________________
2. Organize the data above by filling in the data table provided below. Follow these
directions when completing your data table.
•
Provide an appropriate title for the data table.
•
Fillin the first box in each column with an appropriate heading.
•
Arrange the data so that pH values are in increasing order.
Title:
3. Construct a graph using the information in the data table, the following directions,
and the grid provided.
•
Provide an appropriate title for the graph.
•
Make and label an appropriate scale on each axis.
•
Plot and connect the points. Surround each data point with a circle.
4. According to the data, this enzyme would probably work best at what pH value?
(1) 7 and 8
(2) 2 and 12
(3) 6 and 7
(4) 4 and 10
2.
QuickTime™ and a
TIFF (LZW) decompressor
are needed to see this picture.
QuickTime™ and a
TIFF (LZW) decompressor
are needed to see this picture.
Immune System
Vocabulary
AIDS
Antibodies
Antihistamines
B-cell
Diabetes
Dynamic Equilibrium
Homeostasis
Lymphatic System
Microbe
Parasite
T-cells
Vaccine
Allergy
Antigen
Bacteria
Cancer
Disease
Histamines
Immunity
Lymph
Pathogen
White Blood Cells
Virus
Homeostasis
• Dynamic Equilibrium – the constant small corrections that normally occur to
keep an organism’s internal environment within the limits needed to survive.
• Homeostasis – the ability of an organism to maintain a stable internal
environment even when the external environment changes.
o
Homeostasis is regulated by the endocrine and nervous systems.
• Disease – any condition that prevents the body from working as it should
• If the body fails to maintain homeostasis, disease may occur.
• Many organisms, such as viruses, bacteria, fungi, and parasites may cause
disease.
Causes of Disease
Cause of Disease
Inherited disorders
Exposure to toxins
Poor nutrition
Organ malfunction
High-risk behaviors
Examples
Down syndrome, cystic fibrosis, sickle cell
anemia
Lead poisoning, radiation
Scurvy (lack of Vit. C), and goiter (lack of
iron).
Heart attack and diabetes
Lung cancer, drug addiction, skin cancer
• Lymphatic System - a complex network of lymphoid organs that produce and
transport lymph fluid from tissues to the circulatory system. The lymphatic
system has three interrelated functions: (1) removal of excess fluids from body
tissues, (2) absorption of fatty acids and subsequent transport of fat to the
circulatory system and, (3) production of immune cells (such as lymphocytes and
antibody producing cells).
• Lymph - A clear, watery, sometimes faintly yellowish fluid derived from body
tissues that contains white blood cells and circulates throughout the lymphatic
system, returning to the bloodstream
• The immune response is the defensive reaction of the body to foreign substances
or organisms. The immune system also protects against some cancer cells which
may arise in the body.
• Immunity – the body’s primary defense against disease-causing pathogens
• Pathogens – organism that invades the body, causing disease.
o Pathogens may be viruses, bacteria, fungi and other parasites
• If a pathogen or other toxic substances enters the body, this can lead to a
disruption of the body’s ability to function normally.
• Also, poor nutrition, organ malfunction and inherited disorders can lead to
disruption of homeostasis.
• Some pathogens can lead to cancer – abnormal cells division.
o Exposing cells to certain chemicals and radiation increases
mutations and thus increases the chance of cancer.
o The mass of abnormal cells is called a tumor
o Abnormal cells can be attacked by the immune system
Pathogens and Disease
Pathogen
Virus
Bacterium
Description of Pathogen
Viruses are particles
composed of nucleic acid
and protein. They
reproduce when they invade
living cells
Bacteria are one-celled
organisms
Examples of Disease
Viral diseases can spread
quickly
Ex. Common cold,
influenza, AIDS and
chicken pox
Bacterial illnesses include
strep throat, syphilis and
food poisoning.
Antiobiotics are used to
Fungus
Parasites
Fungi are organisms made
of either one or many cells.
They include yeasts and
molds. They eat by
absorbing organic
substances
Some animals and onecelled organisms are
parasites that survive by
living and feeding on other
organisms
treat many bacterial
diseases
Ex. Athlete’s foot and
ringworm. Fungicides and
antibiotics are used to fight
fungal disease
Include leeches and
tapeworms.
Ex. Malaria and heartworm
• Immune System – the body’s primary defense against disease-causing bacteria
o Pathogens, foreign substances or cancer cells threaten our homeostasis and
the immune system fights back
• Antigens – a molecule found on the outer surfaces of cells that the immune system
recognizes as either part of the body or an outside invader
o Toxins can also act as antigens
o All cells have antigens on their surfaces
o The immune system can determine if the molecule is good or bad (foreign)
o When immune system detects a foreign molecule it attacks it
• Antibodies – proteins that either attack the invaders or mark them for killing
o The marked invaders may be killed by white blood cells
o White blood cells – leukocytes, protects the body from invasion by foreign
substances and organisms (destroys by the process of phagocytosis)
o B-cells make the antibodies to attack the foreign invader and the
o T-Cell engulfs the invader and destroys it.
• Microbe – microscopic organism that may cause and immune response
• Vaccine – a substance made of weakened, killed, or partial pathogens and
designed to protect the body from future invasions of that pathogen
o When a vaccine is injected into the body, it triggers and immune response
o Antibodies are produced to attack the foreign invader
o The immune system “remembers” the specific pathogen by leaving behind
white blood cells that have the antibody to protect against that pathogen.
o Each antibody is specific for each pathogen
• Virus – a nonliving particle or protein and genetic material that reproduces by
invading the cell of a living organism
• AIDS – Aquired Immunodeficiency Syndrome, a viral disease that attacks the
immune system. Caused by a group of retroviruses known as HIV.
o AIDS causes the a person to be unable to fight off disease, infection and
cancerous cells because it attacks the T-cells (your ability to engulf
pathogens)
o People often die of infections in result of AIDS
Overview of the Immune Response
• Allergy – a rapid immune system reaction to environmental substances that are
normally harmless
o Causes of allergies: certain foods, pollen, and chemicals from insect bites
o Immune system reacts by releasing histamines – a substance produced by
white blood cells that cause a reaction (swelling, sneezing, rash, increase
in mucus or in some cases throat closing)
o Use antihistamines – reduce the effects of histamines and the symptoms
they cause
• Sometimes the immune system attacks the body’s own cells.
Examples include:
o Pancreas cells that produce insulin cause diabetes – a disease caused by
the lack of insulin produced by the pancreas.
o Transplanted organs come from another person and when put into a
different body, may cause the immune system to detect them as foreign
and attach it.
To avoid rejection of the organ, patients can be injected with
immunosuppresent drugs that will stop the immune response.
Multiple Choice Review Questions
1. A malfunction of the lymph nodes would most likely interfere with the
(1)
(2)
(3)
(4)
release of carbon dioxide into the lymph
filtering of glucose from the lymph
release of oxygen into the lymph
filtering of bacteria from the lymph
3. Many bacteria that enter the circulatory system are engulfed and destroyed by
(1) phagocytic white blood cells
(2) pinocytic red blood cells
(3) plasma
(4) platelets
4. During a race, the body temperature of a runner increases. The runner responds by
perspiring, which lowers body temperature. This process is an example of
(1) maintenance of homeostasis
(2) an antigen-antibody reaction
(3) an acquired characteristic
(4) environmental factors affecting phenotype
5. Homeostasis in living things is regulated by the action of
(1) the nervous system, only
(2) the endocrine system, only
(3) both the nervous and endocrine systems
(4) neither the nervous nor the endocrine system
6. The body makes chemicals that can help to destroy harmful viruses and bacteria.
These chemicals are called
(1) antibodies
(2) vaccines
(3) hormones
(4) antibiotics
7. A vaccine can protect you against a disease because it
(1) destroys toxic substances from bacteria before they can make you sick.
(2) stimulates your immune system against the pathogen
(3) kills any pathogenic bacteria in your body
(4) changes pathogenic bacteria into harmless bacteria
8. Parasitic strains of E.coli may produce poisonous chemicals that attack living tissue ad
cause disease in humans. These chemicals are called
(1) antibodies
(2) toxins
(3) viruses
(4) antibodies
9. Uncontrolled cell division is known as
(1) meiosis
(2) cancer
(3) antibody production
(4) sexual reproduction
10. The resistance of the body to a pathogen is called
(1) immunity
(2) antigen
(3) cancer
(4) infection
Constructed Response Questions
1. Not all diseases are caused by pathogenic organisms. Other factors, such as
inheritance,
poor nutrition, and toxic substances, may also cause disease.
Describe a disease or disorder that can occur as a result of one of these other factors.
Your answer must include at least:
• the name of the disease [1]
• one specific factor that causes this disease [1]
• one major effect of this disease on the body, other than death [1]
• one way this disease can be prevented, treated, or cured [1]
________________________________________________________________________
________________________________________________________________________
________________________________________________________________________
________________________________________________________________________
________________________________________________________________________
________________________________________________________________________
________________________________________________________________________
2. Base your answers to questions 1 and 2 on the diagram of a slide of normal human
blood below and on your knowledge of biology.
QuickTime™ and a
TIFF (LZW) decompressor
are needed to see this picture.
1. An increase in the production of the cells labeled A is a response to an internal
environmental change. State a change that might cause this response. [1]
______________________________________________________________________
______________________________________________________________________
______________________________________________________________________
2. Describe one possible immune response, other than an increase in number, that one of
the cells labeled A would carry out. [1]
______________________________________________________________________
______________________________________________________________________
______________________________________________________________________