1
Propofol exerts its anti-inflammatory effect in Alveolar type II epithelial cells
through downregulation of CD14 and TLR4 expression
Ling Ma, Weimin Chen, Xiuying Wu, Lingxin Meng, Yuji Fujino
Authors: Ling Ma, M.D.1, Xiuying Wu, M.D, Ph.D2， Weimin Chen, M.D, Ph.D3, Yuji Fujino, M.D,
Ph.D 4
1. Lecturer, Department of Anesthesiology, Shengjing Hospital of China Medical University,
Shenyang, China
2. Associate Professor, Department of Anesthesiology, Shengjing Hospital of China Medical
University, Shenyang, China
3. Professor, Department of Anesthesiology, Shengjing Hospital of China Medical University,
Shenyang, China
4. Associate Professor, Department of Anesthesiology and Intensive Care Medicine, Osaka
University Medical School, Osaka, Japan
Corresponding author: Weimin Chen.
Mailing address: Department of Anesthesiology, No.36 Sanhao Street, Heping District, Shenyang,
110004, China.
Phone: +86-13386861177
Email: chenwm@sj-hospital.org
Running title: propofol and alveolar type II epithelial cell
2
Summary
Background: We investigated whether LPS induced inflammation in ATII is through CD14 and TLR4 and the
effect of different dosage of propofol on the inflammation in primary cultured rat alveolar epithelial type II (ATII)
cells.
Methods: The cultured ATII cells were randomly assigned to one of the following five groups: Group C: AT II
cells in untreated group (control) was cultured in the absence of propofol and LPS; Group LPS: treated with 1μg.
-1ml
LPS; Group P1: treated with 1μ.ml-1 LPS and 25μM propofol; Group P2: treated with 1μg.ml-1 LPS and 50μM
propofol; Group P3: treated with 1μg.ml-1 LPS and 100μM propofol. ATII cells in untreated and propofol control
groups were cultured at 37°C for 3 h. CD14 and TLR4 mRNA were detected using real-time PCR. Western blot
were used to detect CD14 and TLR4 protein expression. CD14 and TLR4 expression on the AT II cells were
imaged using immunofluorescence. TNF-α
using ELISA kit.
Results: LPS stimulation resulted in an increased CD14 and TLR4 expression and increased TNF-α production in
AT II cells. Propofol, at concentrations 50 µM, significantly (P < 0.05) and dose-dependently decreased CD14
and TLR4 mRNA expression and protein expression in AT II cells. This was accompanied by decreases in TNF-α
production (P < 0.05).
Conclusion: These results suggest that propofol, at clinical relevant concentrations, can reduce inflammatory
response in LPS-induced AT II cells injury through downregulation of CD14 and TLR4 expression.
Key words: propofol; alveolar type II epithelial cell; CD14; Toll like receptor-4
3
Introduction:
The lung represents a site for the invasion of various bacteria or bacterial products. Along with alveolar
macrophages, pulmonary epithelial cells are the first cells to be challenged by pathogenic microorganisms. rat
alveolar epithelial type II (ATII) cells synthesize and secrete surfactant, control the volume and composition of
fluid in the alveolar space, and proliferate and differentiate into alveolar type I epithelial cells after lung injury to
maintain the integrity of the alveolar lining 1,2. Recently, there have been publications reporting the involvement of
ATII in modulating the development of inflammatory reactions within the alveolus3. ATII secrete chemokines in
response to inflammatory stimuli in vitro, suggesting a potential physiologic role in acute inflammatory lung injury
4, 5.
Lipopolysaccharide (LPS) triggers a physical association between cluster of differentiation 14 (CD14) and Toll
like receptor 4 (TLR4) 6, 7. Inflammatory response to endotoxin is largely mediated through CD14 and TLR4 8, 9.
The activation of CD14 and TLR4 leads to proinflammatory cascade including the expression of proinflammatory
mediators, such as TNF-α. CD14 and TLR4 have been found on ATII 10,11and could thus play an important role in
the innate immune response at the alveolar surface area.
Little is known about the interaction of generally used intravenous anesthetic propofol (2, 6-diisopropylphenol)
with AT II. Our goal is to investigate whether LPS induced inflammation in ATII is through CD14 and TLR4 and
the effect of different dosage of propofol on the inflammation.
Methods and Materials
Isolation of alveolar epithelial cell and primary culture
ATII were isolated from male SPF degree Wistar rats (180-250g), following the protocol according to the
method of Richard et al 12. Briefly, after intraperitoneal sodium pentobarbital (60 mg.kg-1) and heparin (400U.kg-1),
the thoracic cavity was opened and the inferior vena cava was cut. The lungs were perfused via the right atrium
with sterile saline and inflated simultaneously with air. After removal from the thoracic cavity, they were washed 6
times with normal saline and digested enzymatically with typsin. The lungs were then minced in fetal bovine serum
(FBS) and DNase I (Roche), and the resulting suspension was filtered through 150μm and 30 μm mesh once.
The cell mixture was purified by centrifugation on a discontinuous Percoll gradient (density 1.089 and 1.04, 400 g,
20 min). The interface was collected and after rewashing the cells were seeded onto 6-well culture dishes at a
4
density of 1×106 cells/dish in Dulbecco's modified Eagle medium (DMEM) with 10% inactivated FBS, penicillin
(100U.ml-1), streptomycin (100 μg.ml-1) at 37℃ in the humidified atmosphere of 95% air/5% CO2 and cultured for
18-20 hours.
Characterization of type II pneumocyte
Alkaline Phosphatase Histochemical Staining
Alkaline phosphatase staining served to identify ATII cells in primary cultured cells grown on glass coverslips.
Briefly, the cells were fixed for 15 min at room temperature in 4% paraformaldehyde solution, rinsed for 1 min in
distilled water, and air-dried. Fixed cells were incubated with BCIP/NBT stain (Sigma Chemical, St Louis, Mo) for
10 min at room temperature. The samples were then rinsed with distilled water for 1 min and air-dried. The cells
were counterstained with 0.1% neutral red solution (Sigma) for 1 min at room temperature, rinsed for 1 min,
air-dried, and photographed under light microscopy. Blue staining identified cells with high alkaline phosphatase
activity, whereas other cells, such as macrophages, were counterstained in red.
Transmission electron microscopy
Cells were fixed in 2.5% glutaraldehyde, washed three times in 0.1M phosphate buffered saline (PBS) and
serially dehydrated in acetone and embedded in Epon 812. Ultrathin sections (70 nm) were examined with a
transmission electron microscope (JEM-1200EX, JEOL, Tokyo, Japan).
Experimental design
The cultured ATII cells were randomly assigned to one of the following five groups: Group C: AT II cells in
untreated group (control) was cultured for 3 h in the absence of propofol (AstraZeneca, Basiglio, Italy) and LPS (E.
Coli O55: B5, Sigma); Group LPS: treated with 1μg. -1ml LPS for 3 h; Group P1: treated with 1μ.ml-1 LPS and
25μM propofol for 3 h; Group P2: treated with 1μg.ml-1 LPS and 50μM propofol for 3 h; Group P3: treated with
1μg.ml-1 LPS and 100μM propofol for 3 h.
Real Time PCR
Total RNA was extracted by TRIzol reagent (Invitrogen, Carlsbad, CA). Real time PCRs were conducted with
SYBR PrimeScriptTM RT-PCR kit (Cat. no. DRR063S, TaKaRa Biotechnology, Dalian, China) according to the
manufacturer’s instructions. Briefly, total RNA (500 ng) was reverse-transcribed into cDNA using 0.5μl
PrimeScript RT Enzyme Mix I, 0.5μl Random 6 mers. Quantitative real time PCR was done using an ABI PRISM®
7500 Real-Time PCR System (PE Applied Biosystems, Foster City, CA). The reactions were carried out on
5
multiple 8-well stripes. GAPDH was amplified on the same plates and used to normalize the data. The reaction
volume was 25μl containing 12.5μl of the SYBR Premix EX Taq, 0.5μl of ROX reference Dye II, 2.5μl each of
2μM forward and reverse primers,5μl of RNase free water, and 2μl of the cDNA samples. Real-time PCRs were
performed in triplicate for each sample and at least 3 different sets of cell preparations were used. The thermal
cycling conditions used were: 95℃ for 10 s followed by 40 cycles at 95℃ for 5 s, 60℃ for 34 s. PCR products were
heated to 95℃ for 15s, annealed at 60℃ for 1 min and then heated from 60℃ to 95℃ for 15 s to obtain melting curve.
Dissociation curve analysis was performed for each gene to ensure the specificity of PCR products. Serial dilutions
(10-fold) of one of the samples were used to generate the standard curve for each PCR. All sense and antisense
primers were supplied by Sangon (Shanghai, China). The oligonucleotides primers used for real-time PCR were: rat
CD14: forward ATTCCCGACCCTCCAAGT; reverse CCAGCAGTATCCCGCAGT; rat TLR4: forward
GAGGACTGGGTGAGAAACGA; reverse GAAACTGCCATGTCTGAGCA; rat GAPDH: forward
ATGTTCCAGTATGACTCCACTCACG; reverse GAAGACACCAGTAGACTCCACGACA.
Immunoblotting
Cells were lysed using a commercially available kit (KGP250; Nanjing Keygen Biotech Co. Ltd., Nanjing,
China). Protein concentration was determined using the EasyQuant protein assay kit (Cat. no. DQ 101, TransGen
Biotech Co. Ltd., Beijing, China) and boiled for 5 min at 100℃. Each vessel homogenate was diluted with PBS to
obtain the same protein concentration. Then 20 μg of protein per lane was separated on a 10% SDS-polyacrylamide
gels and transferred to a nitrocellulose membrane (Bio-Rad, Hercules, CA). The transfers were blocked overnight
with 5% dry skim milk power. The membranes were incubated with anti-CD14 (sc-9150), anti-TLR4 (sc-16240) or
anti-β-actin (sc-47778; all Santa Cruz Biotechnology, CA) antibodies at 1:200 dilutions for 2 h at 37℃. After being
washed in PBS 3 times, the membranes were incubated with 1:2000 horseradish peroxidase-conjugated anti-rabbit,
-goat, or -mouse IgGs (Pierce, Rockford, IL) for 1 h at room temperature. The blots were washed again. The
individual target proteins were developed with chemiluminescent reagent (Cat. no. DW101, EasyECL Western Blot
kit; TransGen Biotech Co. Ltd., Beijing, China) using the enhanced chemiluminescence detection system. The
relative band density was determined on an imaging system (Scion Image for Windows; Scion Corporation,
Federick, MD). The results described were obtained in at least three independent experiments. Gel loadings were
normalized with β-actin antibody.
Immunocytochemistry Detection of CD14 and TLR4
6
ATII were plated onto 18 × 18 mm glass coverslips and treated with LPS for 3 h in the presence/absence of
propofol as described in experimental design. Afterwards, the coverslips were fixed with 4 % paraformaldehyde for
30min at room temperature and washed 3 times in PBS. Cells were incubated with blocking solution (5% BSA) at
room temperature for 15 min and incubated overnight at 4℃ with 1: 160 dilution of anti-CD14 antibody (sc-9150)
and with 1: 160 dilution of anti- TLR4 antibody (sc-16240). Slides were then washed 3 times with PBS and
incubated with 1:200 Rhodamine (TRITC)-Conjugated AffiniPure Goat Anti-Rabbit IgG (H+L) (Cat. no. ZF-0316,
Beijing Zhongshan Golden Bridge Biotechnology Co., Ltd., China) and 1:200 Fluorescein (FITC)-conjugated
AffiniPure Rabbit Anti-Goat IgG (H+L) (Cat. no. ZF-0313, Beijing Zhongshan Golden Bridge Biotechnology Co.,
Ltd., China).
TNF-α
nzyme-linked immunosorbent assay
Cell culture supernatants were collected and stored at -70℃ until analysis. The levels of TNF-α
were determined in duplicate using rat TNF-α
kit (R&D Systems Inc, Minneapolis, MN) following the
manufacturer’s instructions. The results are presented as the mean ±SD of three replicates from one representative
experiment; this experiment was repeated three times.
Statistical analysis
The data were normally distributed as determined by the Levene’s test. ANOVA followed by a post hoc Tukey’s
test was used for multiple-group comparisons. Values are expressed as means±SD. The significance level was set at
P<0.05. SPSS 13.0 software (SPSS Inc. Chicago, IL) was used for all statistical work.
Results
Identification of ATII cells
The cell mix, obtained by the discontinuous Percoll gradient centrifugation method, contained 82±5% of ATII
which were stained blue with alkaline phosphatase histochemical staining. (Fig.1A). Transmission electron
microscopy showed typical lamella bodies in ATII. (Fig. 1B)
7
Fig1. Alkaline phosphatase histochemical staining shows ATII in blue by phase-contrast objective (1A). 200×.
ATII cells are characterized by lamellar body (LB) inclusions in the cytoplasm by transmission electron
micrographs (1B), magnification: 4000×.
CD14 and TLR4 mRNA changes with different concentration of propofol
LPS at the concentration of 1μg/ml significantly increased the CD14 mRNA (P<0.05) and TLR4 mRNA (P<0.05)
in ATII. To determine whether propofol suppressed the LPS induced CD14 and TLR4 mRNA expression in
cultured ATII, various concentrations of propofol (25, 50, and 100μM) were used in this study. Propofol at the
concentrations of 50 and 100μM (p<0.05) dose-dependently suppressed both CD14 and TLR4 mRNA expression
of the LPS-treated AT II cells (Fig. 2).
Fig. 2
Relative expression of CD14 and TLR4 mRNA. (A) CD14 mRNA expression increased significantly in the
LPS group and P1 group compared with control. CD14 mRNA expression is suppressed significantly in the P2
group and P3 group compared with LPS group. (B) TLR4 mRNA expression increased significantly in the LPS
group and P1 group compared with control. TLR4 mRNA expression is suppressed significantly in the P2 group
and P3 group compared with LPS group. C = control; LPS = ATII cells subjected to 1μg/ml LPS; P1 = ATII cells
subjected to 1μg/ml LPS and 25μM propofol; P2 = ATII cells subjected to 1μg/ml LPS and 50μM propofol; P3 =
ATII cells subjected to 1μg/ml LPS and 100μM propofol. *compare with the control, P<0.05; # compare with LPS
group, P<0.05
8
CD14 and TLR4 protein changes with different concentrations of propofol
As quantified by scanning the chemiluminescence's bands from four different experiments. The CD 14 and
TLR4 protein expression was increased after LPS stimulation for 3 hours (P<0.001 and P=0.002, respectively), and
the increase was lower in the propofol and LPS cointubation compared with LPS alone. CD14 protein expressions
were lower in P1, P2 and P3 groups compared with LPS group with P<0.001. TLR4 protein expressions were
lower in P2 and P3 groups compared with LPS group with P=0.003 and P<0.001, respectively. Figure 3.
Fig. 3. Representative immunoblot of CD14 and TLR4 protein in ATII cells (Fig 3A and 3B). LPS increased both
CD14 and TLR4 protein expression while propofol at concentration of 25, 50 and 100μM could decrease CD14
protein expression (Fig 3C) and propofol at concentration of 50 and 100μM could decrease TLR4 protein
expression (Fig 3D) compared with LPS alone. C = control; LPS = ATII cells subjected to 1μg/ml LPS; P1 = ATII
cells subjected to 1μg/ml LPS and 25μM propofol; P2 = ATII cells subjected to 1μg/ml LPS and 50μM propofol;
P3 = ATII cells subjected to 1μg/ml LPS and 100μM propofol. *compare with the control, P<0.05; # compare with
LPS, P<0.05
9
Distribution of CD14 and TLR4 in ATII with immunofluorescence
To confirm the TLR4 expression on the cell surface, we performed the phase contrast imaging that revealed the
location of TLR4 expression on the external membrane of AT II cells. (Figure 4). We further investigated the effect
of LPS and propofol on CD14 and TLR4 distribution using confocal microscope. As shown in Fig. 5, distribution
of CD14 on the cell surface is consistent with TLR4 and we observed CD14 and TLR4 increase in ATII in response
to LPS (1μg/ml) treatment. After stimulation with propofol at 25μM, 50μM and 100μM, CD14 and TLR4
expression in ATII decreased in a dose-dependent manner.
Fig. 4. Phase-contrast micrograph shows the AT II cells (Fig 4A) and TLR4 expressions were shown by
immunofluorescence micrographs (Fig 4B). The majority of cells in cultures were positively stained with an
antibody to TLR4 protein on the external surface (Fig 4C).
10
11
Fig 5 Representative photomicrographs of ATII cells subjected to immunofluorescence analysis. Cells were fixed,
permeabilized, and stained with antibodies to CD14 (shown in red) and TLR4 (shown in green). There were
increases in CD14 and TLR4 expressions in LPS group. CD14 and TLR4 expressions were lower in P1, P2 and P3
groups compared with LPS group. C = control; LPS = ATII cells subjected to 1μg/ml LPS; P1 = ATII cells
subjected to 1μg/ml LPS and 25μM propofol; P2 = ATII cells subjected to 1μg/ml LPS and 50μM propofol; P3 =
ATII cells subjected to 1μg/ml LPS and 100μM propofol. Scale bars=37.5μm.
Effect of propofol on TNF-α in LPS incubated ATII cells
TNF-α levels in the control group was 271±35 pg/ml. 1μg/ml LPS increased TNF-α level to 600±222 pg/ml
with P=0.003 compared with control. Propofol at concentration of 25μM, 50μM and 50μM decreased the TNF-α
levels to 374±197 pg/ml, 325±79 pg/ml and 232±44 pg/ml in ATII cells with P values of 0.07, 0.017 and 0.001
compared with LPS group, respectively. (Figure 6)
Fig 6. The concentrations of TNF-α were measured by ELISA. LPS incubation increased TNF-α concentration.
Propofol at the concentration of 25, 50 and 100μM decreased the TNF-α concentration dose-dependently. C =
control; LPS = ATII cells subjected to 1μg/ml LPS; P1 = ATII cells subjected to 1μg/ml LPS and 25μM propofol;
P2 = ATII cells subjected to 1μg/ml LPS and 50μM propofol; P3 = ATII cells subjected to 1μg/ml LPS and 100μM
propofol. *compare with the control, P<0.05; # compare with LPS, P<0.05. Results are representative of three
independent experiments.
Discussion
In this study, we demonstrated propofol at the concentration of 50 μM and 100 μM decreased CD14 and TLR4 in
primary cultured adult rat AT II cells at the mRNA and protein levels as well as decrease TNF-α secretion.
The CD14 and TLR4 expression are key early event in the generation of an innate immune response mediated
12
LPS-signaling pathway and may play a key role in the regulation of alternative splicing of NF-κB in the lungs after
injury9, 13. LPS upregulates the CD14 and TLR4-dependent cytokine production in various cell types through
mechanisms involving p38 MAPK, ERK1/2, or JNK14, 15 An upregulated TLR-4 expression is known to play a
pivotal role in the development of sepsis-related organ injuries16. In our study, stimulation of ATII with LPS for 3
hours triggered significant upregulation of CD14 and TLR4 gene expression, hence TNF-α expression, which is
consistent with the previous reports.
Pretreatment with 100μM propofol in hepatocytes was reported to alleviate sepsis-related systemic inflammatory
response by downregulation of TLR4 expression and partial suppression on the phosphorylation of ERK1/2 and
IκB-α as well as the NF-κB nuclear translocation 17. Propofol at a concentration of 157 μM reportedly increased
LPS-stimulated TNF-α production in human whole blood 18, it was shown to inhibit nitric oxide and TNF-α release
from alveolar macrophages in an endotoxin-induced lung injury model 19 and to suppress nitric oxide and iNOS
expression in LPS-stimulated macrophages at 25–100 μM 20. However, there is no study about the
immunorgulation of propofol on the primaried cultured ATII cells. To our knowledge, this is the first study to
report the effects of propofol on inflammatory responses of primary cultures of rat alveolar type II cells stimulated
with LPS.
We found that propofol dose-dependently reduced LPS-stimulated increase of CD14 and TLR4 in ATII cells.
Propofol was also found to inhibit LPS-induced TNF-α production in ATII cells. Significant effects on ATII cells
were observed at a propofol concentration of 50μM and 100μM. This study raised the possibility that propofol
might modulate some of the inflammatory processes in these pathological conditions, which is consistent with our
previous in vivo study that propofol attenuates the LPS induced acute lung injury through TLR4 downregulation.
Clinically relevant blood concentration of propofol is 3-11 μg/ml (approximately 17-62 μM) for maintenance of
satisfactory anesthesia 21, 22. The blood concentration of bolus injection of propofol can reach 56 μM 23. Therefore
we considered 25–100μM as the range of clinically relevant concentrations achievable during propofol anaesthesia.
Our results suggest that propofol may modulate some of the inflammatory responses of ATII cells stimulated by
LPS in vitro at the high range of clinically achievable concentrations.
In conclusion, we found that propofol at the concentration of 50 and 100μM inhibited some of the inflammatory
responses of alveolar type II cells treated with LPS with decreasing TNF-α levels. Propofol, in large concentrations
13
(more than 50μM), may be a good choice of anesthetics to reduce inflammatory responses when using in patients
with acute lung injury and related respiratory diseases.
Acknowledgements
This work was supported financially by the Hospital Foundation of Shengjing Hospital of China Medical
University, China.
14
References
1.
Evans MJ, Cabral LJ, Stephens RJ, et al. Transformation of alveolar type 2 cells to type 1 cells following
exposure to NO2. Exp Mol Pathol 1975; 22:142-50.
2.
Crandall ED, Matthay MA. Alveolar epithelial transport. Basic science to clinical medicine. Am J Respir
Crit Care Med 2001;163:1021-9.
3.
McRitchie DI, Isowa N, Edelson JD, et al. Production of tumour necrosis factor alpha by primary cultured
rat alveolar epithelial cells. Cytokine 2000; 12: 644–654.
4.
Farivar AS, Woolley SM, Fraga CH, et al. Proinflammatory response of alveolar type II pneumocytes to in
vitro hypoxia and reoxygenation. Am J Transplant 2004; 4:346-51.
5.
Hahon N, Castranova V. Interferon production in rat type II pneumocytes and alveolar macrophages. Exp
Lung Res. 1989;15:429-45.
6.
da Silva Correia J, Soldau K, Christen U, et al. Lipopolysaccharide is in close proximity to each of the
proteins in its membrane receptor complex. J Biol Chem 2001; 276: 21129-35.
7.
Jiang Q, Akashi S, Miyake K, Petty HR. Lipopolysaccharide induces physical proximity between CD14 and
toll-like receptor 4 (TLR4) prior to nuclear translocation of NF-kappa B. J Immunol 2000;165:3541-4.
8.
Landmann R, Zimmerli W, Sansano S, et al. Increased circulating soluble CD14 is associated with high
mortality in Gram-negative septic shock. J Infect Dis 1995; 171:639-44.
9.
Togbe D, Schnyder-Candrian S, Schnyder B, et al.TLR4 gene dosage contributes to endotoxin-induced
acute respiratory inflammation. J Leukoc Bio 2006; 80:451-7.
10. Wissel H, Schulz C, Koehne P, et al. Chlamydophila pneumoniae induces expression of toll-like receptor 4
and release of TNF-alpha and MIP-2 via an NF-kappaB pathway in rat type II pneumocytes. Respir Res
2005; 6: 51.
11. Armstrong L, Medford AR, Uppington KM, et al. Expression of functional toll-like receptor-2 and -4 on
alveolar epithelial cells. Am J Respir Cell Mol Biol 2004; 31: 241-5.
12. Richards RJ, Davies N, Atkins J, Oreffo VI. Isolation, biochemical characterization, and culture of lung
type II cells of the rat. Lung, 1987; 165: 143-158.
13. Phan HH, Cho K, Sainz-Lyon KS, Shin S, Greenhalgh DG. CD14-dependent modulation of NF-kappaB
15
alternative splicing in the lung after burn injury. Gene 2006; 371:121-9.
14. Cheng C, Qin Y, Shao X, et al. Induction of TNF-alpha by LPS in Schwann cell is regulated by MAPK
activation signals. Cell Mol Neurobiol 2007; 27: 909–921.
15. O'Toole T, Peppelenbosch MP. Phosphatidyl inositol-3-phosphate kinase mediates CD14 dependent
signaling. Mol Immunol 2007; 44: 2362–9.
16. Barsness KA, Arcaroli J, Harken AH, et al. Hemorrhage-induced acute lung injury is TLR-4 dependent. Am
J Physiol Regul Integr Comp Physiol 2004; 287: R592–9.
17. Jawan B, Kao YH, Goto S, et al. Propofol pretreatment attenuates LPS-induced granulocyte-macrophage
colony-stimulating factor production in cultured hepatocytes by suppressing MAPK/ERK activity and
NF-kappaB translocation. Toxicol Appl Pharmacol 2008; 229:362-73.
18. Larsen B, Hoff G, Wilhelm W, Buchinger H, Wanner GA, Bauer M. Effect of intravenous anesthetics on
spontaneous and endotoxin-stimulated cytokine response in cultured human whole blood. Anesthesiology
1998; 89:1218-27.
19. Chu CH, David Liu D, Hsu YH, Lee KC, Chen HI. Propofol exerts protective effects on the acute lung
injury induced by endotoxin in rats. Pulm Pharmacol Ther 2007; 20:503-12.
20. Chen RM, Wu GJ, Tai YT, et al. Propofol reduces nitric oxide biosynthesis in lipopolysaccharide-activated
macrophages by downregulating the expression of inducible nitric oxide synthase. Arch Toxicol 2003;
77:418-23.
21. Short TG, Aun CS, Tan P, et al. A prospective evaluation of pharmacokinetic model controlled infusion of
propofol in paediatric patients. Br J Anaesth 1994; 72: 302– 6.
22. Gepts E, Camu F, Cockshott ID, Douglas EJ. Disposition of propofol administered as constant rate
intravenous infusions in humans. Anesth Analg 1987; 66: 1256–63.
23. Servin F, Desmonts JM, Haberer JP, et al. Pharmacokinetics and protein binding of propofol in patients with
cirrhosis. Anesthesiology 1988; 69:887–91.