DNA Study Guide
Vaccine – a weakened or killed version of a virus that is used to build up someone’s
immune system against that disease (keeps you from getting it)
Virulent – causes disease
Transformation – taking up of DNA from surrounding environment and changing
the cell (R taking in S bacteria)
Bacteriophage – virus that infects a bacteria
Double helix – “twisted ladder” shape of DNA
Nucleotide – monomer (building block) of DNA; made of sugar, phosphate and
nitrogenous base
Deoxyribose – sugar in DNA
Ribose – sugar in RNA
Purine – A (Adenine) and G (Guanine) bases – Remember “Purines Are Good”
Pyrimidine – C (Cytosine) and T (Thymine) (and Uracil for RNA)
Codon – Group of 3 bases on mRNA that is used to code for 1 amino acid (1 part of a
protein)
Anticodon – Group of 3 bases on tRNA that matches the codon; transports amino
acids to ribosomes to build proteins
DNA helicases – breaks hydrogen bond between the two strands of a double helix to
allow the DNA to either a) replicate or b) be transcribed
DNA polymerases – adds nucleotides to a parent strand during replication to build
new DNA molecules
Replication fork - point at which the 2 strands of a double helix separate during
replication and transcription
Fill in the scientist’s contributions/discoveries
Watson & Crick – discovered the double helix shape of DNA
Explain the following experiments step by step, and describe their findings
(conclusion)
Griffith’s experiment –
Griffith’s experiments showed that hereditary material can pass from one bacterial
cell to another.
R bacteria non-virulent (didn’t cause disease) because it didn’t have a capsule.
S bacteria virulent (causes disease) because it has a capsule.
R bacteria didn’t kill mouse
S bacteria did kill mouse
Heat killed S bacteria didn’t kill mouse because bacteria was already dead
Heat Killed S bacteria mixed with R killed the mouse because the R took up the
DNA from the S and got the instruction for how to make a capsule
Hershey & Chase experiment –
Hershey and Chase confirmed that DNA, and not protein, is the hereditary
material.
Bacteriophase (virus) is not made up of cells. It only has DNA and protein.
Made Bacteriophage with radioactive sulfur (glowing protein) and mixed it with a
bacteria – protein did not go into the bacteria
Made bacteriophage with radioactive phosphorous (glowing DNA) and mixed it
with a bacteria – bacteria started glowing because DNA went into bacteria
What is the structural location and function of the parts of DNA:
Phosphate group
Sugar (deosyribose)
Hydrogen bond
Adenine
Thymine
Cytosine
Guanine
Double helix
List three main differences between DNA & RNA:
1. DNA is double stranded and RNA is single (to get out of nucleus)
2. DNA has deoxyribose sugar and RNA has ribose
3. DNA has T and RNA has U
How is bacterial DNA different from Eukaryotic DNA?
Eukaryotic = linear; divide by mitosis
Prokaryotic = circular; divide by binary fission
Complete the following table
Describe what happens:
Where does this take
place?
Transcription
DNA is used to make
mRNA.
mRNA will be read in
groups of 3 bases called
codons.
Nucleus
Translation
mRNA is read by
ribosomes.
Ribosomes signal for
tRNA to bring in amino
acids. Proteins are built.
Cytoplasm (ribosome)
Why do we have RNA? What does it do that DNA cannot?
RNA is single stranded, and it can get out of the nucleus. DNA is double stranded
and cannot.
Complete both the mRNA sequence and the polypeptide chain.
DNA
TACAGCGATTCCAGGGTGGGGATC
mRNA
AUGUCGCUAAGGUCCCACCCCUAG
polypeptide chain
MET – SER – LEU – ARG – SER- HIS –PRO - STOP