Saint Martin’s University A media-based comparison of bacteria on the external surface of cage-free, conventional, and pasteurized chicken eggs Enjoli Washington BIO 402 Final Draft May 7, 2008 Table of Contents Abstract 3 Introduction Background information 4 Presence of Salmonella in poultry environments 5 Salmonella penetration of fertile and infertile chicken eggs 6 Salmonella typhimurium penetration through eggshells 7 Presence of Salmonella enteritidis in the egg yolk and albumen 8 Reduction of S. typhimurium from eggshell membranes 9 Testing for bacteria on the inner eggshell membrane 9 Hypothesis 10 Methods Test 1: Presence on Salmonella on the external eggshell surface 12 Test 2: Presence of bacteria on inner eggshell surface 13 Controls 14 DNA Amplification Using PCR 14 Agarose Gel Electrophoresis 15 Data analysis 16 Test 1: Presence on Salmonella on the external eggshell surface 16 Gel Electrophoresis 20 Test 2: Presence of bacteria on inner eggshell surface 21 Results Discussion 22 Acknowledgements 27 Literature cited 28 2 Abstract The external eggshell surface houses a plethora of bacteria including Salmonella, which may contaminate household surfaces. Cage-free, conventional and pasteurized eggs were tested for Salmonella by inoculating Brilliant Green agar plates. Bacterial DNA from the growth was extracted and used in Polymerase Chain Reaction (PCR) to amplify regions of DNA corresponding to the fliC gene in S. typhimurium. Results from gel electrophoresis showed that the fliC gene, indicating Salmonella, was found in a small number of cage-free eggs. Colony counts were used in an ANOVA test to determine if there was a statistically significant difference in the amount of bacteria between the three egg types. The results of the ANOVA test showed there was no difference in the amount of bacterial growth between the three egg types (cage-free, conventional, and pasteurized). The importance of this study is that as consumers, the more we educate ourselves about the products we buy, the better we can protect ourselves and others. 3 Introduction Salmonellosis, a form of food poisoning caused by different serotypes of the bacteria Salmonella, poses a substantial health risk to those who consume poultry products (Roy et al., 2002). A serotype is a variation of an organism that causes the release of different antibodies from the affected person’s immune system (Pommerville, 2004). According to the United States Department of Agriculture (2007), pregnant women, children, the elderly, and people with weakened immune systems are the most susceptible to the effects of salmonellosis. According to Pommerville (2004), symptoms of salmonellosis include, but are not limited to, fever, vomiting, abdominal cramps, diarrhea, and sometimes dehydration. Salmonellosis is often diagnosed by observing a serotype of Salmonella in stool samples and by culturing with the use of differential media (Pommerville, 2004). The Centers for Disease Control and Prevention (2006) states that nearly 40,000 salmonellosis cases are reported in the United States each year, while this number seems high, it is likely that many cases go unreported and in fact, the actual number of cases exceeds what is known (CDC, 2006). Salmonellosis affects humans when they consume eggs that have been contaminated with Salmonella through exposure to avian fecal matter containing the bacteria. Contamination can occur while the egg is still in the hen before the shell has developed, after the egg has been laid, or when the shell is cracked. There are several different types of chicken eggs available for purchase from local grocery stores, all of which have the potential to be contaminated. Cage-free (free-range) eggs come from chickens that have access to the outdoors and are able to freely roam the farm instead of living in cages. These hens have not been treated with hormones and are raised on feed that has been cultivated without synthetic pesticides or fertilizers (American Egg Board, 2007). They are often fed an all vegetarian diet as well. Conventional chicken eggs are collected from hens 4 living on commercial farms. Often, conventional chickens are confined to cages and have limited space to roam. Commercially farmed chickens are often given feed that has been cultivated using pesticides and fertilizers. Pasteurized eggs are a newer product and are so named because they are heated within their shells until the yolk reaches a temperature of 53 - 59°C (128 – 138.5°F), thus reducing the amount of Salmonella that may have been present (Davidson, 2000; Patent Storm, 2004). Currently, there is no evidence that cage-free (free-range) chickens contain fewer Salmonella than conventional chickens (Durham, 2004). However, many consumers often believe this to be true (Durham, 2004). Roy et al. (2002) studied 4,745 different poultry samples over the course of one year. They worked to determine which, if any, would test positive for Salmonella and how the bacteria would react to antibiotic treatments. The samples collected were from poultry products and poultry house environments. Several different methods to test for Salmonella were used because they collected several different types of samples. For example, in order to test ground chicken meat, they added ground chicken to sterile buffered peptone water and then blended the mixture. This mixture was then incubated for 20 hours at 35°C, after which 1mL was added to tetrathionate broth and incubated for another 20 hours at 37°C. This broth was streaked on to XLT4 agar and incubated for 20 hours at 37°C. If any colonies appeared black or red in color they were transferred to triple sugar iron agar slants. Further identification was carried out using serological processes. The most common species of Salmonella that cause food related illness are Salmonella enteritidis, S. typhimurium, and S. heidelberg. The authors found 569 (12%) of the samples tested positive for some form of Salmonella, from those they were able to obtain 97 isolates. They found S. heidelberg to have the greatest occurrence out of the 97 isolates. They then extracted DNA from 92 different Salmonella species using a GENERATION capture 5 column kit. They amplified the DNA through polymerase chain reaction (PCR) utilizing oligonucleotide primers that had been previously used in other studies. Stock cultures were also used to determine the effectiveness of antibiotics using zone of inhibition tests. Roy et al. (2002) found that 92 of 97 samples showed no sensitivity to erythromycin, lincomycin, and penicillin. Two of these resistant samples included S. typhimurium and S. enteritidis. All but one showed no sensitivity to penicillin and to some degree, all were sensitive to sarafloxacin, centiofur, sulfamethoxadole-trimethoprim, gentamicin, triple sulfa, and tetracycline. Based on the sample used in this study, about 12% tested positive for Salmonella. I may not see such a large amount of samples test positive for Salmonella because my sample will not be as large as the one used in this study. While I did not test hen houses, this study showed that a number of factors may be responsible for the transmission of Salmonella from hen to egg including hen carcasses and hen house cleanlisness. Williams and Dillard (1968) studied S. typhimurium penetration in fertile and infertile chicken eggs and exposed the eggs to the bacteria over the course of several days by attaching aluminum cylinders that contained frozen chicken feces to the shell using paraffin. They added a saline solution containing S. typhimurium to the cylinder and allowed the feces to thaw. The eggs were incubated for up to 18 days and then observed for the occurrence of bacterial penetration. They selected day 4 of incubation as a start date to observe the samples because it was when they noticed the start of embryonic development within the eggs through candling (a process in which the egg is held up to a light source and examined for defects). They looked for contamination in three different areas within the eggs: 1.) the cuticle and shell, 2.) the cuticle, shell, and outer shell membrane, and 3.) the cuticle, shell, and inner shell membrane based on methods used in a study by Williams and Whittemore (1967, as cited by Williams and Dillard, 1968). They took cotton 6 swab samples supplemented with a tetrathionate broth base containing brilliant green, iodine, and neo-tetrazolium chloride. Any positives from the tetrathionate were inoculated onto Brilliant Green agar plates and incubated at 37°C for 48 hours. Colonies present after incubation were further identified using serological processes. Williams and Dillard (1968) found infertile eggs to be more prone to Salmonella penetration than fertile eggs. They believed this was because embryonic development may impact the ability of the bacteria to pass through the shell membranes. Infertile eggs showed greater penetration of bacteria into the third area when compared to fertile eggs. On average, they found penetration to at least one of the areas to be 31.33% in infertile and 8.66% in fertile chicken eggs between four and eight days of incubation. These percentages increased after 14 and 18 days of incubation to 38.60% in infertile and 11.30% in fertile chicken eggs. As such, there is a greater chance of finding Salmonella in infertile eggs compared to fertile eggs, but Salmonella is not found in every egg. I chose to use infertile chicken eggs in my study based on the results found by Williams and Dillard (1968). Padron (1990) also investigated the penetration of S. typhimurium through eggshells, but in recently laid commercial eggs using two different methods: moisture and dry. He stated that penetration through shell structures can take place very quickly, which emphasized the importance of new or updated collection procedures to prevent the spread of contamination. Previous studies had shown that moisture on the eggshell may aid S. typhimurium penetration. Padron (1990) tested recently collected eggs by spraying them with the bacteria (the moisture method) or by spraying the nest materials and then letting them dry before exposing the eggs (the dry method), and found that although moisture is not necessary for S. typhimurium penetration, it has an effect on the likelihood of its transmission. Another factor influencing bacterial penetration included the lack of complete formation of the cuticle before the egg was laid. This 7 caused some pores to remain open, which allowed easier passage of bacteria. Eggs may also become infected before they are laid, and when cooled naturally, a negative pressure can permit bacteria to pass through the pores. These findings stressed the importance of maintaining clean hen houses to further reduce the amount of contamination from fecal matter, as well as updating collection procedures as contamination can take place within minutes. In this study Padron (1990) used live chicken embryos from commercial hens. I did not choose to use live chicken eggs because our lab would not accommodate this type of sample; though I was interested in using eggs from commercial hens. Infertile eggs from commercial hens experience many of the same environmental factors as fertile eggs. My sample type should have been exposed to some of the same types of bacterial transmission recreated in this study, contamination by feces and nest litter. Gast and Holt (2000) studied the levels of three different strains of S. enteritidis in eggs laid by hens that had been experimentally exposed to the bacteria. These three strains included A (PT13a) from a poultry source in Pennsylvania, B (PT4) from a poultry source in the United Kingdom, and C (PT4) from a poultry source in California. Not only did they seek to determine where the bacteria would be found within the egg, but whether refrigeration substantially reduced the amounts found. Seventy-two hens that tested negative for Salmonella were introduced to the three different strains of the bacteria. One week after exposure, the hens were retested and all were positive for Salmonella. Eggs were then collected from the hens and dipped in a 70% ethanol solution for disinfection purposes. The egg contents (yolk and albumen) were separated and portions of yolk and albumen were added to tryptone soya broth enhanced with ferrous sulfate and incubated at 37°C. These samples were then added to Rappaport Vassiliadis broth and inoculated on Brilliant Green agar to identify the S. enteritidis strain present. Gast and 8 Holt (2000) concluded that yolk contamination of by three strains was greater than albumen contamination. They also found that samples held at lower temperatures showed less contamination than the other samples. This supports the assertion that certain methods and treatments in handling can help protect consumers from Salmonella infection. Padron (1995) conducted another study to determine ways to reduce S. typhimurium within eggshell membranes. Although there are several methods that have been successful in reducing bacteria on external surfaces, many of them are now regulated because of their negative effects. For example, formaldehyde and phenol have been shown to reduce the amount of bacteria on the eggshell surface, but they can be harmful to humans as they are both toxic. Padron (1995) also mentioned another study that found formaldehyde to reduce the hatchability in eggs. By using different pressures and temperatures, he sought the best way to reduce the occurrence of bacteria. He tested several eggs by contaminating them with S. typhimurium, heating them for a certain period of time, and then cooling them to create a difference in pressure. The eggs were then dipped twice in a 6% hydrogen peroxide (H2O2) solution. Eggs absorbed more liquid when double dipped in water before using a disinfectant. Eggs dipped in the solution under positive pressure reduced the amount of bacteria in the membranes by 95%. Padron (1995) also concluded that using H2O2 did not have major implications on the health of the egg when compared to the control group. The methods used in this study are both useful and promising in helping reduce the spread of S. typhimurium within the egg industry. Board and Board (1967) studied a method for observing bacterial penetration through the shells of chicken eggs using eggs that were experimentally exposed to bacteria. Several studies had been conducted prior to this study, but none of them went into detail on the penetration patterns of the bacteria. They based their study on a specific method for testing for the presence 9 of bacteria on the inner eggshell surface which would show where on the shell bacteria entered. Board and Board (1967) used day old chicken eggs and began by candling these eggs to check the quality of the shells. They then made a solution of gram-negative bacteria and selected eggs at random to place into the solution. After a time period of 10 to 15 minutes the eggs were removed and dried using a hair dryer. The pointed ends of the eggs were removed using an electric carborundum-disc, the contents were drained, and the egg was rinsed with sterile water. The shells were then filled with a mixture containing glycerol (0.5% w/v), yeast extract (0.05% w/v), tetrazolium (0.01% w/v), agar (2.0% w/v), and tap water with a pH of 7.2. After this mixture had set, the holes were sealed with sterile paraffin wax and incubated at 27°C. After about two days of incubation, Board and Board (1967) observed the eggs by candling. They found dark spots on the inner and outer shell membranes where the tetrazolium was reduced to formazan and deposited leaving evidence of where bacterial penetration occurred. The bacteria used in this study were different than the bacteria I was looking for; as such this study served as a basis for a methods test with in my experiment. Hypothesis I hypothesized that cage-free chicken eggs would show a greater occurrence of S. typhimurium contamination when compared to conventional chicken eggs and pasteurized eggs, because cage-free hens are not given feed with fertilizers and are not treated with hormones. Pasteurized eggs would have fewer occurrences of S. typhimurium because they were heated such that any bacteria present would be reduced. Varying conditions where the eggs were laid including cleanliness of the hen house, the amount of time after the egg is laid until it was collected, and the overall health of the hens may have considerably affected the incidence of Salmonella transmission in eggs. I tested for S. typhimurium on the external eggshell surface 10 using three different egg types, cage-free, conventional, and pasteurized. I also used statistical analysis to determine if there was a difference in the amount of bacteria on the external eggshell surface of the three egg types. Methods I began by purchasing eggs from various stores in Lacey, Washington. I purchased one dozen white, conventional eggs and one dozen white, cage-free eggs from a total of three stores. I also purchased one dozen white, pasteurized eggs from only one of the three stores as this was the only store I found that carried them. These stores were selected based on the availability of egg variety, as I found many stores carried the same brand of eggs. I chose to withhold the names of the stores through out my study to maintain their anonymity. Before I purchased the eggs I checked them for cracks, as if I were purchasing them for home use, and recorded the temperatures of the egg cases. The average temperature of the store’s egg cases was - 0.38°C. The eggs were transported from the store on ice to the laboratory at St. Martin’s University and the temperature of the ice chest was recorded (6.5°C). I transported the eggs this way to try to keep them at the recommended temperature of approximately 4°C to limit microbial growth. Upon arrival, I labeled the cartons and placed them in the refrigerator. Any eggs that were not being processed were kept in the refrigerator in their original cartons at approximately 4°C until they were ready to be processed. I conducted two different tests: test one, the presence of Salmonella on the external eggshell surface, had a sample size of seven dozen eggs (84 eggs total) and test two, the presence of bacteria on the inner eggshell surface, had a sample size of 42 eggs. 11 Test 1: Presence of Salmonella on the external eggshell surface The first test was conducted to determine the presence of Salmonella on the outer eggshell surface. The external surface is important because when an egg is cracked, any bacteria on the shell may contaminate the yolk and egg white. Also, people come in contact with the external surface when preparing meals containing eggs and may contaminate other surfaces they come in contact with if they do not properly wash their hands. I dipped a sterile swab in a premade, sterile 1% CaCl2 solution before swabbing the egg surface. The CaCl2 solution was used because it provided an appropriate osmotic environment for the bacteria on the external eggshell surface. I tried to roll the swab over the same area on one side of each egg at the same angle. I also tried to keep the pressure at which I applied the swab consistent. I placed the used swab into a sterile test tube and broke off the end of the swab so the tube could be closed. The test tube contained 5ml of nutrient broth and was agitated for up to 30 seconds to loosen bacterial cells from the swab. The test tubes were incubated at 37°C for 24 – 48 hours. This broth was chosen as an initial media because it was a non-selective media that provided enough nutrients for gram-negative bacteria to grow. I then pipetted a 100μl aliquot onto Brilliant Green agar plates and spread (Pierce and Leboffe, 2005). The plates were prepared in advance according to the formula provided on the Becton, Dickson and Company website, autoclaved using a Tuttnauer model 2540E at 121°C, 21 psi, for 15 minutes, and poured into sterile Petri dishes. The Brilliant Green agar plates were incubated at 37°C for 18 – 24 hours and observations based on growth were recorded. Brilliant Green agar was used because it was selective for S. typhimurium from food products. It was important to use a media that would isolate Salmonella from other bacteria present on the 12 external eggshell surface as the eggs could have been exposed to other bacteria while they were in the hen house as well during the packing process, by store employees, and consumers. Test 2: Presence of bacteria on the inner eggshell surface The second test explored the inner eggshell surface for the presence of bacteria. This test was important because as consumers we eat the yolk and white of the egg, if any bacteria penetrated the inner membranes, we may be at risk. The methods for this test were adapted by those established in 1967 by Board and Board. Only half of the eggs from test one were used in this test because of space and time limitations. The eggs used were selected at random, but six from each dozen were included. I poked a hole in one end of each egg using a sterile 16 gauge needle and removed the yolk and egg white with a sterile 20ml syringe. The inside of the egg was rinsed with 5ml of sterile water to remove any traces of yolk and egg white and filled with a mixture of glycerol (0.5% w/v), yeast extract (0.05% w/v), tetrazolium (0.01% w/v), agar (2.0% w/v), and tap water (Board and Board, 1967). I allowed the agar to set and covered the hole with sterilized paraffin wax. The eggs were placed back in their cartons and incubated at 27°C for 48 hours to one week (Board and Board, 1967). After the eggs were incubated, they were held up to a light and inspected for dark spots which indicated the presence of bacteria. The bacteria that were present inside the egg would degrade the tetrazolium to formazan, which would result in areas of dark pigmentation. The eggs that had dark pigmentation were photographed to show where the spots were most abundant and then cracked open to verify those areas. Conducting this test allowed me to evaluate the methods used by Board and Board (1967) to examine the amount of bacteria present on the internal eggshell surface. 13 Controls The positive controls for both tests were processed according to the same procedures mentioned above using S. typhimurium purchased from Carolina Biological Supply. The negative control for test one consisted of a sterile swab run through the same procedures and the negative control for PCR was sterile water. DNA Amplification Using PCR Salmonella isolated from the first test were further analyzed using PCR following bacterial preparation methods outlined on the Access Excellence website. This information was provided by The National Health Museum and the site was created to allow science teachers to communicate with other teachers and scientists, and to have access to various sources of information. I used a flamed transfer loop to collect cells from Brilliant Green agar plates with growth representative of Salmonella and placed the loop in a micro centrifuge tube with 500μl of sterile water and agitated it. The tube was then placed in the freezer until the solution was frozen, then thawed and vortexed. This step was repeated two more times to lyse bacterial cells and separate them from their DNA. After the last thawing, the tube was placed in a 95°C water bath for 5 minutes to prevent DNase from degrading the bacterial DNA and then centrifuged at 1200-1500xg for about 3 minutes. The extracted bacterial template DNA was stored in a refrigerator until ready to use. Before each run of PCR, I added the following ingredients to sterile eppendorf tubes: 5.0µl buffer (1X), 6.0µl MgCl2, 1.0µl deoxynucleotides, 2.0µl of each primer, 28.5µl sterile water, 5.0µl template DNA, and 0.5µl Go Taq Flexi DNA polymerase. The primers I selected were for the fliC gene and were used by Soumet et al., (1999). The forward primer, Fli15, was 14 22 nucleotides in length and the reverse primer, Tym, was also 22 nucleotides in length. Their sequences were as follows: Table 1. Primer sequences and lengths Primer Sequence 5′ → 3′ Length of amplified region (bp) Fli15 CGGTGTTGCCCAGGTTGGTAAT 559 Tym ACTCTTGCTGGCGGTGCGACTT 559 The total volume of sample used for PCR was 50μl. PCR was carried out on the Bio-Rad gene thermocycler according to the program used by Soumet et al., (1999). The steps for PCR included denaturation which took place at 94°C for 30 seconds, annealing occurred at 56°C for 1 minute 30 seconds, and primer extension took place at 72°C for 30 seconds. A final primer extension step also occurred at 72°C for 10 minutes. The initial primer extension step cycled 35 times and the products obtained were used for gel electrophoresis. Agarose Gel Electrophoresis The products from PCR were separated by size using electrophoresis; the gel acted as a matrix and separated the different sized molecules. Large molecules did not easily pass through, however smaller molecules moved easily through the gel when voltage was applied. A 1% agarose gel was used for this step. Agarose was mixed with TAE buffer (1X) and heated in the microwave until the mixture was clear upon swirling. After the agarose mixture was clear, 3.0μl of Ethidium bromide, which served as a stain for DNA, was added and swirled in before the gels were cast. After the gels were set, they were placed into a gel box and TAE (1X) buffer was added until the gel was covered. I carefully pipetted 6.0µl of the 100bp benchtop ladder into the first well, 20µl positive control into the second well, and 20µl of each PCR product or 20µl sterile water into wells 3, 4, 5, 6, 7, and 8. The gel box was hooked up to a power supply and the 15 gels were run at 120 volts for about 20 minutes. The gels were observed under long wave ultraviolet light (365nm), photographed, and an approximate length of the amplified region was determined. If S. typhimurium was present in the PCR product, the length of the amplified region would be consistent with that of the primers used and would show up around 500 to 600bp. Data Analysis The colonies present on the Brilliant Green agar plates from test one were counted and recorded. These counts were analyzed using the statistical analysis of variance (ANOVA) test and the Tukey test if applicable. I used the Minitab 15 Statistical software program at St. Martin’s University to carry out the statistical tests for my study The ANOVA test told me if there was a statistical difference in the amount of bacteria between cage-free, conventional, and pasteurized egg groups. If there was a statistical difference the Tukey test was used to determine which groups were different. The level of significance I used was a p-value of 0.05. If the pvalue found for the data were less than or equal to this significance level, I failed to reject my hypothesis that cage-free eggs had more bacteria present than the other two egg groups. If the pvalue was greater than or equal to this value, I rejected my hypothesis that cage-free eggs had more bacteria. Analysis for test two was qualitative rather than quantitative; as such the eggs were simply observed and photographed. Results Test 1: Presence of Salmonella on the external eggshell surface The presence of Salmonella on the external eggshell surface was tested from cultures grown on Brilliant Green agar plates and was collected with a sterile swab and grown in nutrient broth before being plated on the Brilliant Green agar plates. While 84 eggs were used in this test, not all of the plates produced growth. Figure 1 shows the number of test tubes with bacterial 16 growth. Bacterial growth was determined by a cloudy appearance in the test tube. As each egg type (cage-free, conventional, and pasteurized) consisted of a total of 12 eggs, there were a total of 84 incubated test tubes. The test tubes contained nutrient broth and the swab from the external surface of each egg. Figure 1. Summary of data from test 1 that showed the number of test tubes with bacterial growth. Tubes were incubated at 37°C for 48 hours. Note pasteurized eggs were only purchased at store A and as such there was no data for stores B and C. Figure 2 presents the types of bacteria present based on color of growth and color change of agar on Brilliant Green agar plates after incubation. Determination of types of bacteria was based on color of growth and agar compared to the expected results for growth given by Beckton, Dickson and Company’s formula for Brilliant Green agar (2007). Some Petri dishes had multiple colors of growth and agar, which made classification of bacteria difficult to determine. Not all plates yielded growth and as such they were classified as no growth. Cagefree and conventional eggs showed the same degree of bacterial diversity. 17 Figure 2. Summary of bacterial growth on Brilliant Green agar plates after 72 hours of incubation at 37°C. Figure 3 presents the number of colonies on Brilliant Green agar plates after incubation. Colony counts included all growth on the plates that could be counted. From the graph, the means of the colony counts range from 33.8 to 366 colonies. Based on the colony counts, an ANOVA test was run to determine whether or not there was a difference in bacterial growth between egg types. The ANOVA test resulted in no statistical difference in bacterial growth between the three different egg types, cage-free, conventional, and pasteurized (f = 1.60; d.f. = 2; p = 0.216). 18 Average number of colony forming units 500 400 300 Store A 200 Store B Store C 100 0 Cage-free Conventional Pasteurized -100 Egg Types Figure 3. Colony count on Brilliant Green agar plates after 120 hours of incubation at 37°C. Each bar represents the average number of colonies for each egg type. The number of plates with growth from each store varied, but ranged from 1 to 8 plates counted. Error bars represent one standard error (n=12). Note pasteurized eggs were only purchased at store A and as such there is no data for stores B and C. Figures 4 and 5 are examples of growth on some of the Brilliant Green agar plates after incubation at 37°C. The two plates showed growth representative of Salmonella and E. coli. Growth representative of Salmonella was pink or red in color and the agar surrounding it was also red in color. Growth representative of E. coli was white or yellow and the agar surrounding it was yellowish-green in color. Figure 4. Brilliant Green agar plate with conventional sample from store C. Growth representative of Salmonella. Figure 5. Brilliant Green agar plate with sample from store A. Growth representative of both E. coli and Salmonella. 19 Agarose Gel Electrophoresis I ran six of my positive controls and sterile water on a gel to get an idea of what the bands would look like under ultraviolet light. Figure 6A is a picture of the gel under long wave ultraviolet light. The bands for each of the controls showed up between 500 and 600bp. There was no band in well 8 as this was where sterile water was run. I then ran six of the cage-free samples from stores A and B and sterile water on a gel. Figure 6B is a picture of the gel under long wave ultraviolet light. The band for the positive control showed up between 500 and 600bp, samples in wells 3, 7, and 8 also showed up around 500 and 600bp, and there was no band in well 5 as this was where sterile water was run. A fluorescent band in the region of 550 - 600bp indicated the presence of S. typhimurium in the sample. 500-600bp 500-600bp 1 2 3 4 5 6 7 1 2 8 Figure 6A. Gel electrophoresis of positive (S. typhimurium) and negative (sterile water) controls. 3 4 5 6 7 8 Figure 6B. Gel electrophoresis of positive control (well 2), different cage-free samples from stores A and B (wells 3, 4, 6, 7, and 8) and sterile water (well 5). I ran six of the cage free samples from store A and sterile water on a gel. Figure 7A is a picture of the gel under long wave ultraviolet light. The band for the control showed up between 500 and 600bp, samples in wells 3, 4, 6, and 7 also showed up around 500 to 550bp, and there was no band in well 5 as it had sterile water and well 8 was empty. I ran six of the cage-free samples from store B and sterile water on a gel. Figure 7B is a picture of the gel under long wave 20 ultraviolet light. The band for the positive control showed up around 500 to 600bp, samples in wells 3, 4, 6, and 7 also showed up around 500bp. There was no band in well 5 as this was where sterile water was run and well 8 was empty. A fluorescent band in the region of 550 - 600bp indicated the presence of S. typhimurium in the sample. 500 bp 1 2 3 4 5 6 500-600bp 7 8 1 Figure 7A. Gel electrophoresis of positive control (well 2), different cage-free samples from store A (wells 3, 4, 6, and 7), sterile water (well 5), and well 8 empty. 2 3 4 5 6 7 8 Figure 7B. Gel electrophoresis of positive control (well 2), different cage-free samples from store B (wells 3, 4, 6, and 7), sterile water (well 5), and well 8 empty. Test 2: Presence of bacteria on the inner eggshell surface The presence of bacteria on the inner eggshell surface was tested in 42 eggs selected at random from test one. The eggs were emptied and filled with an agar mixture containing tetrazolium chloride and incubated for one week at 27°C (Board and Board, 1967). The eggs were first examined with a lamp to determine where dark pigmentation was on the inner surface Figure 8A is a picture of one of the eggs being observed for dark pigmentation using a microscope lamp. The eggs were then cracked open and the inner shell was examined for dark pigmentation. Figure 9B is a picture of what the agar looked like after the eggshell was removed for further observation. Figure 10 showed the average number of spots counted on the eggshell for each egg type. 21 Figure 9A. Evidence of dark pigmented spot on the inner surface of a filled egg. Figure 9B. The agar after removing the eggshell Figure 10. Agar filled eggs from test 2: presence of bacteria on the inner eggshell surface, were opened after a 1 week incubation period at 27°C and the internal shell surface was examined for dark pigmented spots. Each bar represents the mean of each type of egg from each store. Error bars represent one standard error (n=6). Note pasteurized eggs were only purchased at store A and as such there is no data for stores B and C. Discussion The results of the first test of this experiment show that there was a difference in the number and type of bacteria that grew on the external eggshell surface of cage-free, conventional, and pasteurized eggs; however there was not a statistically significant difference in 22 the amount between the three types of eggs. The swabs from the external eggshell surface were initially grown in nutrient broth and then plated onto Brilliant Green agar plates, which were specific for Salmonella from food products. Out of the 84 test tubes that were incubated with the swabs, not all grew (Figure 1) which resulted in a reduced sample size for the rest of the study. Cage-free eggs from store C did not result in any growth, however this was not seen in stores A or B for the same type of egg. Test tubes with swabs from conventional eggs from store C did result in bacterial growth. Only the tubes with growth were used for the next step. After incubation, the Brilliant Green agar plates yielded many types of growth based on the changes in the color of the agar, the color and morphology of the growth. Some plates had multiple types of bacteria while others only had one type (Figure 2); meaning more than one type was present on the actual eggshell surface before testing. Also, not all of the bacterial growth looked the same. Some growth was small, round colonies while others were round with raised edges and depressed centers, and others were growing up and over each other resembling volcanoes. Because of this, classification of bacteria on some of the plates was difficult. According to the key I was using to classify the plates, there were 6 different types of bacteria possible (Beckton, Dickson and Company’s formula for Brilliant Green agar, 2007). The color changes I was looking for were white to red colonies surrounded by red agar. Colonies that matched this description were prepared for DNA extraction and used to determine whether or not S. typhimurium was present using PCR and gel electrophoresis. Counting the number of individual colonies was also difficult because many of the colonies on the plates were growing together and over each other. An ANOVA test was used to determine if there was a statistical difference in the amounts of bacterial growth between cage-free, conventional, and pasteurized eggs. Based on the 23 ANOVA test, there was no statistically significant difference between the three egg types (f = 1.60; d.f. = 2; p = 0.216). As mentioned before, the sample size was reduced due to the amount of growth in the early steps of test one, which may be one of the reasons a statistically significant difference was not found. As such, based on the data, I failed to reject my null hypothesis that there was no difference in the amount of bacteria between the three egg types, cage-free, conventional, and pasteurized. A larger sample size may have resulted in different statistical results which could be tested in a future study. I believe the swabbing of the external eggshell surface using sterile CaCl2 worked well for collection of bacterial cells. However, the swab was placed in the test tube with nutrient broth and allowed to incubate which made removal of aliquot difficult when it came time to inoculate the Brilliant Green agar plates. I think smaller vials could have been used so that when the swab was added it could be vortexed to shake cells from the swab and then removed using sterile forceps. Also, it may be interesting to remove nutrient broth as an initial media and inoculate the Brilliant Green agar plates directly with the swab to determine if the nutrient broth had an effect on the Brilliant Green agar. The results obtained after running gel electrophoresis showed that most of the samples positive for S. typhimurium were represented by bands in a region between 500 and 600bp. As reported in a study done by Soumet et al., (1999) samples positive for S. typhimurium amplified around 559bp when ran through gel electrophoresis. It was also stated in this paper that samples with bands in the 400-450bp region were related to Salmonella. In Figure 7A not all of the samples amplified between 500 and 600bp. The cage-free samples in this gel amplified in the region between 400 and 500bp. For these samples S. typhimurium may not have been present, but rather Salmonella. 24 Test 2, the presence of bacteria on the inner eggshell surface, was harder to analyze as it was more of a qualitative test than a quantitative one. I began by observing the agar filled eggs for dark pigmented spots using a high powered microscope light. When I found spots I circled them on the external eggshell so that I could use those areas to compare with the spots I found directly on the inner eggshell surface. When I opened the eggs I found that not all of the spots I circled on the outside were spots on the inner shell. Some of the dark areas I saw using the light were areas of mold on the agar. I believe the mold was able to grow because not all of the eggs were sealed well with the paraffin wax and were open to the air. Based on the spot count on the inner eggshell membrane, cage-free eggs from store B had the highest average of dark pigmented spots when compared to the other egg types from the other two stores. Emptying the eggs so that they could be rinsed and filled with the agar mixture was difficult and I was unable to remove all of the yolk and albumen, which may have slightly altered the results. As mentioned before, sealing the hole in the eggshell with paraffin wax was also difficult. I think there are better ways of removing the egg contents and rinsing the eggs which may have yielded more accurate results. If a drill could be used to make the hole in the egg I think it would be better than poking a hole with a needle. The drill bit would need to be sterilized between eggs and practiced on other eggs so that the right amount of pressure could be found so that the eggshell would remain intact. Also, after opening some of the eggs, the inner eggshell surface was wet in some places. If this test was repeated in the future it would be beneficial to allow the empty eggs to dry longer. This may help the observer determine between actual spots where bacteria penetrated the eggshell or where the dye in the agar accumulated. Further analysis on this subject would include ways to reduce the amount of bacteria on the external eggshell surface and testing the yolk and egg white for presence of bacteria. If 25 testing the microbial properties of various solutions on the external eggshell surface, I would swab the egg as I did in this study, but revise the media I used. I would also do dilutions when plating the bacteria so that there would be a better chance of individual colony growth which would yield better colony counts for use in an ANOVA test. After testing the egg for the initial amounts of external eggshell bacteria, I would clean some of the same eggs using a H2O2 solution (Padron, 1995), dip some in an ethanol solution (Gast and Holt, 2000), and rinse others under running water. After the eggs were dry, I would use the same procedures to test for the bacteria as before and compare the results and determine if there was a statistical difference between the cleaning methods. If there were a safe way to clean eggs before they are cracked open, which did not alter the taste of the egg contents, I think it would have a beneficial impact on reducing the spread of bacteria in the kitchen. To test the egg contents I would devise methods based on a study by Gast and Holt (2000) where they tested the levels of three different strains of Salmonella enteritidis in hens that had been experimentally exposed to the bacteria. They also tested whether or not refrigeration substantially reduced the amount of bacteria found. This test would allow the observer to determine which part of the egg, the yolk or the albumen, housed more bacteria and whether or not refrigeration really reduced contamination. This test would also be important because it would reinforce the importance of thoroughly cooking eggs to prevent food born illness and proper storage techniques. This experiment has strengthened my beliefs in safe handling of uncooked chicken eggs. While the results of this study showed there was not a statistically significant difference in the amount of bacteria on the external eggshell surface of cage-free, conventional, and pasteurized eggs, they did show that bacteria is present. In fact several different types of bacteria were found 26 on the external eggshell surface, which means consumers are at risk of the spread of bacteria. Hence, no matter what type of eggs one chooses to eat, it is important to wash your hands after handling them to prevent further contamination of other surfaces. In doing so, one can protect themselves and family from any bacteria on the external eggshell surface Acknowledgements I would like to thank Dr. Aaron Coby, Dr. Mary Jo Hartman, and Dr. Margaret Olney for their advice and support throughout my study. As well as the numerous hours they spent editing my drafts. I would also like to thank Cheryl Guglielmo for her support in the lab and help in obtaining all the materials necessary for my study. And lastly I would like to thank Shannon Davis for her spending several hours in the lab with me, her support, and positive thinking. 27 Literature Cited American Egg Board. [Internet]. 2007 Sep 26 [cited 2007 Oct 24]. The American Egg Board. Available from http://www.aeb.org/Index.asp Board, P. Board, R.G. 1967. A method of studying bacterial penetration of the shell of the hen’s egg. Laboratory Practices. 16: 471-472. CDC. Salmonellosis. [Internet]. 2006 Nov 4 [cited 2007 Oct 4]. Centers for Disease Control. Available from http://cdc.gov/ncidod/dbmd/diseaseinfo/salmonellosis_g.htm Davidson, L.J. Pasteurized in-shell chicken eggs. [Internet]. 2000 Dec 26 [cited 2007 Oct 4]. United States Patent and Trademark Office. Available from http://patft.uspto.gov/netacgl/hph_Parser? Durham, S. Free-range chicken-no guarantee it’s free of Salmonella. [Internet]. 2004 Sep 20 [cited 2007 Oct 4]. United States Department of Agriculture. Available from http://www.ars.usda.gov/is/pr/2004/040920.htm Gast, R.K., Holt, P.S. 2000. Deposition of phage type 4 and 13a Salmonella enteritidis strains in the yolk and albumen of eggs laid by experimentally infected hens. Avian Diseases. 44: 706-710. Padron, Mario. 1990. Salmonella typhimurium penetration through the eggshell of hatching eggs. Avian Diseases. 34: 463-465. Padron, M. 1995. Egg dipping in hydrogen peroxide solution to eliminate Salmonella typhimurium from eggshell membranes. Avian Diseases. 39: 627-630. Patent Storm. Pasteurized in-shell chicken eggs. [Internet]. 2004 [cited 2007 Nov 21]. Patent Storm, LLC. Available from http://www.patentstorm.us/patents/6165538-claims.html Pierce, B.E., Leboffe, M. 2005. Exercises for the Microbiology Laboratory, third ed. Morton Publishing Company, CO, pp. viii, 2-3, 7, 13-14, 182-183, 191. Pommerville, J. 2004. Alcamo’s Fundamentals of Microbiology, seventh ed. Jones and Bartlett Publishers, MA, pp. 318-319. Roy, P., Dhillon, A.S., Lauerman, L.H., Schaberg, D.M., Bandli, D., Johnson, S. 2002. Results of Salmonella isolation from poultry products, poultry, poultry environment, and other characteristics. Avian Diseases. 46: 17-24. Soumet, C., Ermel, G., Rose, V., Rose, N., Drouin, P., Salvat, G., Colin, P. 1999. Identification by a multiplex PCR-based assay of Salmonella typhimurium and Salmonella enteritidis strains from environmental swabs of poultry houses. Letters in Applied Microbiology. 29: 1-6. USDA. Shell eggs from farm to table. [Internet]. 2007 Mar 27 [cited 2007 Oct 4]. United States Department of Agriculture. Available from http://fsis.usda.gov/Fact_Sheets/Focus_On_Shell_Eggs/Index.asp Veilleux, C. PCR Technology. [Internet]. 2007 Nov 30 [cited 2007 Nov 30]. Access Excellence. Available from http://www.accessexcellence.org/LC/SS/PS/PCR/PCR_technology.html Williams, J.E., Dillard, L.H. 1968. Salmonella penetration of fertile and infertile chicken eggs at progressive stages of incubation. Avian Diseases. 12: 629-635. 28
0
You can add this document to your study collection(s)
Sign in Available only to authorized usersYou can add this document to your saved list
Sign in Available only to authorized users(For complaints, use another form )