Chromosoma (2000) 109:498–505
DOI 10.1007/s004120000103
O R I G I N A L A RT I C L E
Amy E. Wandstrat · Stuart Schwartz
Isolation and molecular analysis of inv dup(15)
and construction of a physical map of a common breakpoint
in order to elucidate their mechanism of formation
Received: 4 January 2000 / In revised form: 11 May 2000 / Accepted: 29 June 2000 / Published online: 28 October 2000
© Springer-Verlag 2000
Abstract An inverted duplication of chromosome 15
[inv dup(15)] is the most common supernumerary marker chromosome, comprising approximately 50% of all
chromosomes in this class. Structurally, the inv dup(15)
is a mirror image with the central axis defining a distal
break within either the heterochromatic α-satellite array
or along the euchromatin in the long (q) arm of the chromosome. There are several types of inv dup(15), classified by the amount of euchromatic material present.
Generally, they are bisatellited, pseudodicentric and have
a breakpoint in 15q11–q14. A suggested mechanism of
formation of inv dup(15) involves illegitimate recombination between homologous chromosomes followed by
nondisjunction and centromere inactivation. The proximal portion of chromosome 15 contains several lowcopy repeat sequence families and it has been hypothesized that errors in pairing among these repeats may result in structural rearrangements of this chromosome including the inv dup(15). To test this hypothesis and to
determine the mechanism of formation, the inv dup(15)
from four cases was isolated in somatic cell hybrids and
polymerase chain reaction microsatellite markers were
used to determine the origin of exchange. Two appeared
to result from interchromosomal and two from intrachromosomal exchange, one of which occurred post-recombination. In addition, a detailed physical map of the
breakpoint region in the largest inv dup(15) was constructed placing eight new sequence-tagged sites and ten
new bacterial artificial chromosome markers in the region.
Edited by: T. Hassold
A.E. Wandstrat · S. Schwartz (✉)
Department of Genetics and Center for Human Genetics,
Case Western Reserve University School of Medicine and
University Hospitals of Cleveland, OH 44106-9959, USA
e-mail: sxs95@po.cwru.edu
Introduction
Extra structurally abnormal chromosomes (ESACs)
(Hook and Cross 1987) or supernumerary marker chromosomes (SMCs) (Paris Conference 1971) can be derived from any chromosome and have been estimated to
occur in approximately 0.014%–0.072% of liveborn individuals (Jacobs et al. 1974; Hamerton et al. 1975;
Nielsen and Rasmussen 1975; Buckton et al. 1980;
Nielsen and Wohlert 1991) and in 0.065%–0.19% of fetuses in prenatal studies (Benn and Hsu 1984; FergusonSmith and Yates 1984; Warburton 1984; Hook and Cross
1987; Sachs et al. 1987; Warburton 1991). Cytogenetic
studies indicated that approximately 50% of these are bisatellited and 70%–80% of the latter are derived from
chromosome 15, commonly referred to as inverted duplications of chromosome 15 [inv dup(15)] (Wisniewski
et al. 1979; Mattei et al. 1984; Buckton et al. 1985). A
more recent study by Blennow et al. (1994) using fluorescence in situ hybridization (FISH) to determine retrospectively the chromosomal origin confirmed original
estimates by reporting a frequency of 0.8 per 1000,
with inv dup(15) comprising 57% (approximately 0.4 per
1000) of all ESAC/SMCs.
Most such individuals are ascertained through mental
and/or developmental retardation (Schreck et al. 1977;
Wisniewski et al. 1979; Maraschio et al. 1981); however,
reported phenotypes range from normal (Stetten et al.
1981; Knight et al. 1984) to Prader-Willi (Fujita et al.
1980; Wisniewski et al. 1980; Ledbetter et al. 1982;
Robinson et al. 1993; Cheng et al. 1994; Blennow et al.
1995) or Angelman syndrome (Robinson et al. 1993;
Spinner et al. 1995; Buchholz et al. 1996) to the inv
dup(15) syndrome (Wisniewski et al. 1980; Zannotti
et al. 1980; Plattner et al. 1991; Battaglia et al. 1997).
The inv dup(15) syndrome includes characteristics such
as mild, moderate or severe mental and developmental
retardation, seizures, autism or autistic traits, abnormal
dermatoglyphics and strabismus (Zannotti et al. 1980;
Plattner et al. 1993). Leana-Cox et al. (1994) demonstrated a positive correlation between the presence of the
499
3–4 Mb PWS/AS chromosomal region (15q11–q13)
(Mutirangura et al. 1993) in the inv dup(15) and mental
retardation.
Inv dup(15) are more accurately referred to as pseudodicentric chromosomes 15 [psu dic(15;15)]. First described by Van Dyke et al. (1977), the inv dup(15) is a
mirror image with a central axis defining a distal break
within either the heterochromatic α-satellite array or
along the euchromatin in the long (q) arm of the chromosome. These chromosomes are bisatellited with two copies of the short (p) arm and can be either mono- or dicentric. The majority of inv dup(15) are dicentrics in which
one of the centromeres has been inactivated, hence pseudodicentric.
The proximal portion of chromosome 15 is unique in
that it contains several genes that undergo parental imprinting (Hall 1990; Nicholls 1993) and that this area of
the human genome is often involved in structural rearrangements (Mattei et al. 1984). Seven genes/pseudogenes have been identified in proximal chromosome 15
(Wagstaff et al. 1991; Buiting et al. 1992; Dittrich et al.
1993; Knoll et al. 1993; Lehman et al. 1998; Ritchie
et al. 1998; Christian et al. 1999; Ji et al. 1999) and have
been implicated in the mechanism that results in both deletions and duplications of 15q11–q13 (Buiting et al.
1998; Robinson et al. 1998; Amos-Landgraf et al. 1999;
Christian et al. 1999). Such sequences may confer DNA
instability by facilitating misalignment and illegitimate
recombination during replication (Lupski et al. 1996). In
order to test the above hypothesis, we have used the inv
dup(15) as a model.
Early cytogenetic studies indicated that inv dup(15)
vary slightly in size and reports described inv dup(15) as
smaller, equivalent, or larger than G group (chromosome
21 or 22) chromosomes (Maraschio et al. 1981; Buckton
et al. 1985; Maraschio et al. 1988; Blennow et al. 1995).
Fluorescence in situ hybridization analysis using probes
that span the proximal portion of chromosome 15 has
confirmed the existence of different-sized classes of inv
dup(15) (Rauch et al. 1992; Cheng et al. 1994; LeanaCox et al. 1994; Crolla et al. 1995; Mignon et al. 1996).
There are at least five types of inverted duplications of
chromosome 15 that have been described thus far, based on the amount of euchromatic material present
(Wandstrat et al. 1998).
In order to further address the mechanism of formation of large inv dup(15), the inv dup(15) was isolated
away from the normal chromosomes 15 from four cases
in a somatic cell hybrid system. Polymerase chain reaction (PCR) microsatellite markers were used to determine whether the exchange leading to abnormal chromosome formation occurred between homologous chromosomes or sister chromatids. Additionally, in order to determine whether a low-copy repeat is located at the
breakpoint region of the largest inv dup(15), a detailed
physical map of this breakpoint region was generated.
The ends of three yeast artificial chromosome (YAC) inserts that detect DNA at or near the breakpoint were subcloned. These fragments were then sequenced to design
sequence-tagged sites (STSs) and used to screen a bacterial artificial chromosome (BAC) library. Ten BAC
clones were identified and analyzed by FISH.
Materials and methods
Sample acquisition
Patients with an inv dup(15) were ascertained and lymphoblast or
fibroblast cell lines were established through standard cytogenetic
methods. Detailed clinical information on these cases has been
published elsewhere: Case 1 (Flejter et al. 1996, their Case JB;
Wandstrat et al. 1998, their Case 4), Cases 2 and 3 (Leana-Cox
et al. 1994, their Cases 3 and 21, respectively; Wandstrat et al.
1998, their Cases 8 and 14, respectively), and Case 4 (Wandstrat
et al. (1998, their Case 15).
Establishment of somatic cell hybrids
Somatic cell hybrids were generated as described initially by
Brahe and Serra (1981) and Jackson (1995). For lymphoblast cell
line fusion, 2.5×106 Ade-C (hamster) recipient cells and 5×107
lymphoblast cells were used. For fibroblast cell line fusion, equal
numbers, approximately 500,000, of Ade-C and human cells were
used. Fused cells were maintained in RPMI selection medium containing 5% dialyzed FCS and 1×ouabain (1.9×10–6 M). Individual
colonies were picked and grown to confluency for both cytogenetic analysis and DNA extraction.
Mapping and analysis of YACs
The YACs were selected from the Whitehead map maintained
by the Whitehead Institute/MIT Center for Genome Research
(http://www-genome.wi.mit.edu) and screened by PCR and FISH
analysis as previously described by Wandstrat et al. (1998). Isolation of the YAC end fragments was accomplished by amplifying
the human YAC insert by ligation-mediated PCR as described by
Kere et al. (1992). InterAlu-PCR products of amplified human
YAC inserts were generated using Alu consensus-sequence primers (Nelson et al. 1989; Tagle and Collins 1992). Alu-PCR products were then cloned into a TA cloning vector using the Original
TA Cloning Kit with pCR 2.1 (Invitrogen) following the manufacturer’s instructions. DNA was extracted from colonies that contained the insert and sequenced using the consensus T7 or Sp6
primers in an Applied Biosystems 373A automated sequencer.
Fluorescence in situ hybridization using BAC and cosmid clones
The BAC and cosmid DNA was prepared following the Qiagen
DNA preparation kit following their protocol with the manufacturer’s recommended modification for BACs. Fluorescence in situ hybridization was performed in accordance with the technique described by Pinkel et al. (1986). The slides used ranged in age from a
few days to several months and were stored at –20°C prior to hybridization. Slides were visualized under a Zeiss Axiophot microscope
equipped with a cooled charge-coupled-device camera and were
photographed using a digital multicolor image analysis system.
Results
Somatic cell hybrid studies
Somatic cell hybrids were used to isolate the inv dup(15)
chromosome from the normal chromosomes 15 in four
500
Table 1 Polymerase chain reaction (PCR) microsatellite analysis of inv dup(15) isolated in somatic cell hybrids. Allele designations are
intended to represent the different alleles present and do not depict locus copy number. (N/A, not available; N/T, not tested)
Case
number
Reference numbers
Family
member
D15S541
1a
JB (Flejter et al. 1996)
Father
Proband
Hybrid
Mother
N/A
ABD
B
N/A
4 (Wandstrat et al. 1998)
2
3 (Leana-Cox et al. 1994)
8 (Wandstrat et al. 1998)
3
21 (Leana-Cox et al. 1994)
14 (Wandstrat et al. 1998)
4
a Genotype
15 (Wandstrat et al. 1998)
Father
Proband
Hybrid
Mother
N/T
Father
Proband
Hybrid
Mother
N/T
Father
Proband
Hybrid
Mother
B
BF
B
BF
D15S542
D15S543
D15S128
D15S122
GABRβ3
N/A
CDE
C
N/A
N/A
AB
B
N/A
N/A
AB
B
N/A
EF
ADF
A
AD
D
DEF
EF
EF
D
DE
DE
DE
AB
ABD
AD
AD
CD
ADE
AE
AE
N/T
N/A
AB
AB
N/A
N/A
AB
AB
N/A
N/T
N/T
AB
BE
E
E
N/T
N/T
CD
BCD
BD
BD
N/T
N/A
B
B
N/A
N/T
of parents is from Flejter et al. (1996)
cases (Cases 1–4). All four of these inv dup(15)s included material from the PWS/AS chromosomal region. One
case (Case 1) had a breakpoint between D15S12 and
D15S24 and the other three cases had a breakpoint
between D15S165 and D15S144 within YAC 810f11
(Wandstrat et al. 1998). Additionally, in all four of these
cases parent-of-origin studies including methylation and,
when possible, microsatellite marker analysis were performed. In all four cases, the inv dup(15) was known to
be maternal in origin (Wandstrat et al. 1998).
Resultant hybrid colonies were analyzed with PCR microsatellite markers and FISH in order to confirm the sole
presence of the inv dup(15) chromosome. Three markers
from the PWS/AS chromosomal region, D15S11,
GABRβ3, and D15S122 or D15S128, and one marker
from 15q26, D15S127, were used to identify the hybrid
colonies that potentially contained the inv dup(15). Fluorescence in situ hybridization was used to analyze further
colonies that were positive for the three markers from the
PWS/AS chromosomal region and negative for the marker
from 15q26. Cosmids for the SNRPN and GABRβ3 loci
were used for FISH analysis to confirm the presence of
the inv dup(15) in hybrid colonies derived from the fusion
of Case 4, where the inv dup(15) has a breakpoint between D15S12 and D15S24. A cosmid for D15S17 was
used to confirm the presence of the inv dup(15) in hybrid
colonies derived from Cases 2–4, where the inv dup(15)
has a breakpoint within YAC 810f11 (Wandstrat et al.
1998). Colonies were identified as having only inv
dup(15) material when the cosmid probes showed one and
sometimes two signals, depending on the quality of the
preparation, on the inv dup(15) in metaphase spreads and
two signals from the inv dup(15) in interphase cells.
Additional microsatellite markers from the Whitehead
database were then studied to determine whether the inv
dup(15) was the result of exchange between homologous
chromosomes or sister chromatids. Microsatellite markers from 15q11–q13 were used to detect allelic differences that would be expected if the inv dup(15) was the
result of exchange between homologous chromosomes.
Additionally, several microsatellite markers near the centromere, D15S541, D15S542, and D15S543, were used
to determine whether the exchange occurred pre- or postrecombination. Results from these studies are summarized in Table 1.
In Case 1, analysis at the GABRβ3 locus showed that
the mother was heterozygous at that locus (Flejter et al.
1996) and the patient’s DNA shows three alleles. However, the hybrid derived from this case had only one
allele. Although parental genotype information was
not available for microsatellite markers D15S541 and
D15S543, genomic DNA from the patient showed three
alleles, while DNA from the hybrid again showed just
one allele. These results indicate that in Case 4, the inv
dup(15) was the result of intrachromosomal (i.e. sister
chromatid) exchange.
Of the three cases where the inv dup(15) had a breakpoint distal to D15S24, Case 2 showed allelic differences
at D15S542, D15S122, D15S128 and D15S543. This is
consistent with the inv dup(15) resulting from an interchromosomal exchange. Case 3 also showed two alleles
from both the patient’s and the hybrid DNA at D15S543
and D15S128, indicating that the inv dup(15) is also the
result of interchromosomal exchange. Unfortunately, parental DNA was not available for this case.
The final case, Case 4, had two different alleles at
D15S122. Genotype results at D15S543 confirm the maternal origin of the inv dup(15) because although the
mother is homozygous for allele E, the paternal genotype
is AB and the hybrid has allele E only. Reduction to ho-
501
Fig. 1 Physical map of the
breakpoint region in the largest
Inv dup(15) chromosome. Sequence-tagged sites (STSs)
known to be contained in the
yeast artificial chromosomes
(YACs) and bacterial artificial
chromosomes (BACs) from the
breakpoint region are indicated
by the filled circles, STSs generated from the YAC insert
boundaries are designated by X,
and STSs generated from interAlu fingerprint bands derived
from the centromeric end of
YAC 810f11 are denoted by the
filled squares. The breakpoint
region in the largest inv
dup(15)s lies between 2at7,
4brev, 5brev and D15S1010
mozygosity near the centromere is detected by the microsatellite marker D15S541, indicating that the inv
dup(15) in this case is the result of an intrachromosomal
exchange that occurred post-recombination.
Physical mapping of the breakpoint region
in large inv dup(15)
Previously, our laboratory identified a common breakpoint in 13 cases of the largest inv dup(15) to within the
940 kb YAC 810f11, which includes material located at
D15S1010 and D15S144 (Wandstrat et al. 1998). In order to build a useful physical map of the region (Fig. 1),
we attempted to isolate end clones from the three YACs,
810f11, 920a7, and 859c11, that span the breakpoint region based on information in the Whitehead database.
Ligation-mediated PCR using vectorette primers was
used to amplify the sequence located at the vector/insert
boundaries. Table 2 lists the resultant primer sequences
that we used in the course of this study.
All six of the STSs generated from the YAC end
clones as well as four STSs, D15S165, D15S1031,
D15S1010, and D15S144, identified in the Whitehead
database, were then used to analyze the inv dup(15)
chromosomal DNA. A positive control, genomic DNA,
DNA from the somatic cell hybrids generated in the
course of this study, DNA from two somatic cell hybrids
that contained only a normal chromosome 15 as the sole
human component, DNA from the unfused rodent cell
background used to generate the somatic cell hybrids,
and DNA from YACs 810f11, 920a7, and 859c11 were
analyzed. This allowed the YACs to be mapped relative
to each other and the breakpoint in the inv dup(15).
D15S165 and D15S1031 were found to be present in the
hybrids containing the isolated inv dup(15) while
D15S1010 and D15S144 were absent. The PCR results
of the STSs located at the YAC insert boundaries were
used to determine to which end of the YAC they
mapped. One marker, 36a8, mapped to the centromeric
end of 810f11, and two, 34a6 and 23a2, mapped to the
telomeric end. STS 13a1 mapped to the centromeric end
of 859c11. However, no suitable end fragments and
therefore no STSs could be generated from YAC 920a7.
Figure 1 shows our map of this region.
Sequence tagged site markers were also made from
the interAlu “fingerprint” bands that were unique to
YAC 810f11 when compared with YAC 920a7 (Table 2).
As we observed in our previous FISH studies, while
YAC 810f11 hybridized to the inv dup(15), YAC 920a7
failed to hybridize (Table 2). These STSs were used to
map finely the region between the centromeric end of
YAC 810f11 and the centromeric end of YAC 920a7.
STS 5bt7 was found to be positive for both the somatic
cell hybrid DNA containing the inv dup(15) and YACs
810f11 and 859c11 but not 920a7, placing it centromeric
to YAC 920a7. STSs 2at7, 4bRev, and 5bRev were also
present in the inv dup(15) and all three YACs, 810f11,
859c11, and 920a7. All of these STSs were positive for
all three of the somatic cell hybrids containing the large
inv dup(15). These results indicate that the breakpoint in
the largest inv dup(15) lies inside the centromeric end of
YAC 920a7, between 2at7, 4bRev, and 5bRev (the relative order of these STSs is not known) and D15S1010
(Fig. 1).
In order to narrow further the breakpoint region to
within a clone, a BAC library was screened with the
STSs that were generated from both the YAC insert end
502
Fig. 2A, B Fluorescence in situ hybridization (FISH) results using
BACs. All chromosomes are counterstained with 4′,6-diamidino2-phenylindole and appear blue and all probes are labeled with
fluorescein isothiocyanate and appear green. A A partial metaphase spread from Case 15 hybridizing BAC 288L4. All of the
BACs identified that map to the proximal end of YAC810f11
show this pattern of hybridization with two signals in proximal 15
and a third, faint, signal near the telomere on both of the normal
chromosomes 15. B A partial metaphase spread from Case 14 hybridizing BAC 363N11. This BAC appears on both of the normal
chromosomes 15 but not on the inv dup(15) (indicated by the
arrow). Unlike the BACs exemplified in panel A, the signal from
363N11 is single and distinct
Table 2 Sequence-tagged sites (STSs) used in this study. (F, forward primer; R, reverse primer; YAC, yeast artificial chromosome)
STSs from YAC insert boundaries
13a1
F: GGGAGAAACTTCCAACCCAT
R: TCCCCAGCCTCTCTTTTACA
36a8
F: GCACTGGGAGACAACGTGTA
R: TTCTGAGGGACTTCAGTGGG
34a6
F: AGCGAGGGTAGCAAGGTCTA
R: CAGCAGCATCCCTCATACCT
23a2
F: CGGGATCTCCAATTTTTCTTC
R: TCACAACCATTGTTTGAATACAC
STSs from interAlu bands derived from YAC 810f11
2at7
F: GGTCTGCTTCCACGTTTGTT
R: TTGATTTCTGAGAGACGGGG
4bRev
F: CCATGCTCTTGTGATGCTGT
R: CCTTTTGTTGTGGGGAGAGA
5bRev
F: GCCTTGAAAACTCTCCCCAT
R: TGGGATCATCTGGGAAGAAC
5bt7
F: GGTTGTTTTAGGATAAGTGGTCTGA
R: TGGTTTTGGAATCTGCATCA
fragments and the interAlu fingerprint bands (Table 2).
The BAC library from Research Genetics is estimated to
contain approximately sixfold coverage of the human genome (Kim et al. 1996). It is a PCR-based screening
system in a gridded array. STSs D15S1010, 36a8, 34a6,
2at7, 4bREv, 5bt7, and 5bREv were used to screen the
library but only six of these detected single BAC colonies (341e8, 328p9, 288l4, 360g23, 156d8, and 282o1).
D15S1010 failed to detect any BAC colonies (Fig. 1).
The BACs were then tested by FISH analysis. As expected, BACs that mapped to the centromeric end of the
three YACs, 810f11, 859c11, and 920a7, hybridized to
the inv dup(15) (Fig. 2A). Interestingly, all of these
BACs showed a distinct pattern of hybridization with
three signals on the normal chromosomes 15, two in
proximal 15q13–q14 and one signal near the telomere.
Three signals are also observed on the inv dup(15) chromosome. Fluorescence in situ hybridization analysis was
also performed on the four BACs (363n11, 358d5, 350l1,
and 70p13) that mapped to the telomeric end of YAC
810f11. These BACs did not hybridize to the inv dup(15)
and showed a normal single signal on the two normal
chromosomes 15 (Fig. 2B). The fact that all six BACs
located in the breakpoint region detect the same pattern
reduces the likelihood that the BACs are chimeric and
raises the possibility that sequences contained in the
BAC insert are detecting a low-copy repeat family that
may lie at or near the breakpoint in the largest inv
dup(15).
Discussion
Analysis of the chromosomal content of the inv dup(15)
Molecular studies utilizing diagnostic tools such as the
allele-specific methylation pattern at the D15S63 and the
SNRPN loci (Driscoll et al. 1992; Dittrich et al. 1993;
Crolla et al. 1995; Buchholz et al. 1996; Glenn et al.
1996; Mignon et al. 1996) and PCR microsatellite analysis of both the individuals with an inv dup(15) and their
parents (Robinson et al. 1993; Crolla et al. 1995; Huang
et al. 1997) have been used accurately to assign the
parent-of-origin of the inv dup(15). These studies have
shown a predominance of maternally derived inv
dup(15); however, they are of limited use when trying to
determine the precise molecular content of the inv
dup(15). The presence of the parentally derived normal
503
chromosomes 15 interferes with the interpretation of the
data. In order successfully to determine the molecular
content of the duplicated euchromatic material on the inv
dup(15), it is necessary to isolate that chromosome away
from the normal chromosomes 15. To accomplish this,
we used somatic cell hybrids to isolate the inv dup(15)
from the two normal chromosomes 15 in four cases
(Cases 1–4). After isolation of the inv dup(15), PCR microsatellite markers were used in order to determine
whether the inv dup(15) was the result of exchange between homologous chromosomes or sister chromatids.
Our study gave a number of interesting results. These
suggest that the initial hypothesis that all inv dup(15) are
the result of an aberrant recombination event between
homologous chromosomes may prove inaccurate and
that exchange may readily occur between either sister
chromatids or homologous chromosomes, pre- or postrecombination. This is consistent with reports that deletions of chromosome 15 associated with PWS/AS are
also the result of inter- and intrachromosomal rearrangements (Carrozzo et al. 1997; Robinson et al. 1998). It
should be noted that although microsatellite markers
near the centromere were used and two cases appeared to
result from interchromosomal exchange, one occurring
post-recombination, and two cases appeared to involve
interchromosomal exchange, a marker at the chromosome 15 centromere is not available. There may be undetected crossovers between the centromere and the nearest
markers (D15S541, D15S542, and D15S543), a distance
estimated to be approximately 12 cM using ovarian
teratomas (Christian et al. 1995). Thus, it is formally
possible that all of the inv dup(15) are the result of interchromosomal exchange, some of which occur postrecombination and involve a crossover between the centromere and the closest markers. Of course, many more
cases need to be analyzed in order to determine whether
the variety that we have seen is merely coincidental or
whether it is an accurate reflection of the patient population.
Breakpoint analysis of large inv dup(15)
At the onset of this study, few microsatellite markers or
YACs and no BACs had been mapped to the region distal to the PWS/AS chromosomal region (15q13–q14).
Sequence-tagged sites were generated from end fragments of YACs 810f11 and 859c11 and interAlu PCR
products from the centromeric end of YACs 810f11 and
920a7. In order to map these STSs relative to the breakpoint, a panel that included DNA from the somatic cell
hybrids containing the largest inv dup(15) (Cases 2–4)
was used. Results from these studies indicate that the
breakpoint in the largest inv dup(15) is located between
STSs 2at7, 4bREv, 5bRev (their relative order is not
known) and D15S1010 (Fig. 1). These STSs were also
used to screen the BAC library (Research Genetics). Surprisingly, two signals were seen in the 15q13–q14 region
with the more distal of the two quite possibly at or near
the breakpoint as three signals were observed on the inv
dup(15) from all of the BACs containing STSs from the
centromeric end of the YACs. A third signal was located
at the telomeric end of the chromosome 15, quite distal
to the breakpoint region. These findings raise the possibility that these BACs are detecting a low-copy repeat
that is either at or near the breakpoint in the largest inv
dup(15). In 13 of our largest inv dup(15) cases, FISH
analysis with YAC 810f11 showed one, reduced signal
on both metaphase and interphase cells, indicating that
the YAC spans the breakpoint (Wandstrat et al. 1998).
The BAC analysis helped to confirm the original hypothesis as BACs generated from the centromeric end of the
YAC did hybridize to the inverted duplication of chromosome 15, while BACs generated from the telomeric
end of the YAC failed to hybridize. The presence of multiple signals on the inverted duplication of chromosome
15 made FISH analysis difficult, raising the possibility
that the breakpoints are occurring outside of the repetitive DNA sequence.
Proximal chromosome 15q is believed to be highly
unstable as evidenced by its frequent involvement in
structural rearrangements. The heterogeneous nature of
the breakpoints involved in these chromosomal abnormalities suggests that either several low-copy repeat sequences are involved in the genesis of these chromosomal abnormalities and/or that the same repeat sequence is
located in many places throughout proximal 15. Recently, Buiting et al. (1998) used the MN7 clone to identify
the expressed low-copy repeat D15F37 and found that it
was indeed present in multiple copies throughout
15q11–q13 and in at least one copy on 16p11.2 (Buiting
et al. 1998; Amos-Landgraf et al. 1999; Christian et al.
1999). They suggested that the crossover events associated with the common deletion breakpoints in PWS/AS
occur at or near different copies of these sequence family
members. Further analysis identified the presence of two
cDNA clones that correspond to the HERC2 (Ji et al.
1999) or ERY-1 (Buiting et al. 1998) gene in humans.
The mouse homolog for HERC2, rjs (Lehman et al.
1998) or herc2 (Ji et al. 1999), has also been identified.
Three other unknown transcripts, two transcripts with
similarity to MYLE and KIAA0393, and two potential
pseudogenes for the BEM-1/BUD5 suppressor-like protein and an ATP-binding cassette protein have also been
identified near the regions duplicated along proximal
chromosome 15 (Christian et al. 1999). Although the
presence of these site-specific repeat families is intriguing, one has to wonder whether there is some other property that predisposes these sites to rearrangement, as
many repetitive sequences present throughout the genome do not result in a higher proportion of chromosomal aberrations (Robinson et al. 1998). It may be that duplication of large genomic fragments in the proximity of
the pericentromeric region yields additional genomic instability (Eichler 1998) and these repetitive sequences
may confer some alteration in normal chromatin configuration that enables regions containing these repetitive
elements to be quite close together in the cell (Ritchie
504
et al. 1998). Then, the orientation of the repetitive elements may determine whether the aberrant recombination event results in a deletion, duplication or inverted
duplication (Robinson et al. 1998). On the other hand,
the higher proportion of chromosomal rearrangements
may simply reflect greater viability of fetuses carrying
chromosomal aberrations involving chromosome 15 as
opposed to some other chromosome. The low-copy repeat that we have detected using the BACs may be one
part of the D15S37 family or may be a different lowcopy repeat. Results from our chromosomal content
studies suggest that these repetitive elements may be involved in the genesis of the inv dup(15) chromosome.
Acknowledgements The authors would like to thank Dr. Robert
Nicholls for supplying the hybrid cell lines A15 and A15-1 and
Dr. Huntington Willard for his thoughtful input to this project.
References
Amos-Landgraf JM, Ji Y, Gottlieb W, Depinet T, Wandstrat AE,
Cassidy SB, Driscoll DJ, Rogan PK, Schwartz S, Nicholls RD
(1999) Chromosome breakage in the Prader-Willi and Angelman syndromes involves recombination between large, transcribed repeats at proximal and distal breakpoints. Am J Hum
Genet 65:370–386
Battaglia A, Gurrieri F, Bertini E, Bellacosa A, Pomponi MG,
Paravatou-Petsotas M, Mazza S, Neri G (1997) The inv
dup(15) syndrome: a clinically recognizable syndrome with altered behavior, mental retardation, and epilepsy. Neurology
48:1081–1986
Benn PA, Hsu LYF (1984) Incidence and significance of supernumerary marker chromosomes in prenatal diagnosis. Am J Hum
Genet 36:1092–1102
Blennow E, Telenius H, de Vos D, Larsson C, Henriksson P,
Johansson O, Carter NP, Nordenskjold M (1994) Tetrasomy
15q: two marker chromosomes with no detectable alphasatellite DNA. Am J Hum Genet 54:877–883
Blennow E, Brondum-Nielsen Telenius H, Carter NP, Kristoffersson
U, Holmberg E, Gillberg C, Nordenskjold M (1995) Fifty probands with extra structurally abnormal chromosomes characterized by fluorescence in situ hybridization. Am J Med Genet
55:85–94
Brahe C, Serra A (1981) A simple method for fusing human lymphocytes with rodent cells in monolayer by polyethylene glycol. Somat Cell Genet 7:109–115
Buchholz T, Schuffenhauer S, Evans K, Robson L, Appleton B,
Smith A (1996) Molecular analysis of an extra inv
dup(15)(q13) chromosome in two patients with Angelman
syndrome. Acta Genet Med Gemellol (Roma) 45:217–220
Buckton KE, O’Riordan ML, Ratcliffe S, Slight J, Mitchell M,
McBeath S (1980) A G-band study of chromosomes in liveborn infants. Ann Hum Genet 43:227–239
Buckton KE, Spoward G, Newton MS, Evans HJ (1985) Fortyfour probands with an additional “marker” chromosome. Hum
Genet 69:353–370
Buiting K, Greger V, Brownstein BH, Mohr RM, Viovulescu I,
Winterpacht A, Zabel B, Horthemke B (1992) A putative gene
family in 15q11–q13 and 16p11.2: possible implications for
Prader-Willi and Angelman syndromes. Proc Natl Acad Sci U
S A 89:5457–5461
Buiting K, Gross S, Ji Y, Senger G, Nicholls RD, Horsthemke B
(1998) Expressed copies of the MN7 (D15F37) gene family
map close to the common deletion breakpoints in the PraderWilli/Angelman syndromes. Cytogenet Cell Genet 81:247–
253
Carrozzo R, Rossi E, Christian SL, Kittikamron K, Livieri C,
Corrias A, Pucci L, Fois A, Simi P, Bosio L, Beccaria L,
Zuffardi O, Ledbetter DH (1997) Inter- and intrachromosomal
rearrangements are both involved in the origin of 15q11–q13
deletions in Prader-Willi syndrome. Am J Hum Genet 61:
228–231
Cheng S-D, Spinner NB, Zackai EH, Knoll JHM (1994) Cytogenetic and molecular characterization of inverted duplicated
chromosomes 15 from 11 patients. Am J Hum Genet 55:753–
759
Christian SL, Robinson WP, Huang B, Mutirangura A, Line MR,
Nakao M, Surti U, Chakravarti A, Ledbetter DH (1995) Molecular characterization of two proximal deletion breakpoint
regions in both Prader-Willi and Angelman syndrome patients.
Am J Hum Genet 57:40–48
Christian SL, Fantes JA, Mewborn SK, Huang B, Ledbetter DH
(1999) Large genomic duplications map to sites of instability
in the Prader-Willi/Angelman syndrome chromosome region
(15q11–q13). Hum Mol Genet 8:1025–1037
Crolla JA, Harvey JF, Sitch FL, Dennis NR (1995) Supernumerary
marker 15 chromosomes: a clinical, molecular, and FISH approach to diagnosis and prognosis. Hum Genet 95:161–170
Dittrich B, Knoblauch H, Buiting K, Horsthemke B (1993)
Characterization of a DNA sequence family in the PraderWilli/Angelman syndrome chromosome region in 15q11–q13.
Genomics 16:269–271
Driscoll DJ, Waters MF, Williams CA, Zori RT, Glenn CC,
Avidano KM, Nicholls RD (1992) A DNA methylation imprint, determined by the sex of the parent, distinguishes the
Angelman and Prader-Willi syndromes. Genomics 13:917–924
Eichler EE (1998) Masquerading repeats: paralogous pitfalls of
the human genome. Genome Res 8:758–762
Ferguson-Smith MA, Yates JRW (1984) Maternal age specific
rates for chromosome aberrations and factors influencing
them: a report of a collaborative European study on 52,965
amniocenteses. Prenat Diagn 4:5–44
Flejter WL, Bennett-Baker PE, Ghaziuddin M, McDonald M,
Sheldon S, Gorski JL (1996) Cytogenetic and molecular analysis of inv dup(15) chromosomes observed in two patients
with autistic disorder and mental retardation. Am J Med Genet
61:182–187
Fujita H, Sakamoto Y, Hamamoto Y (1980) An extra idic(15p)
(q11) chromosome in Prader-Willi syndrome. Hum Genet
55:409–411
Glenn CC, Saitoh S, Jong MTC, Filbrandt MM, Surti U, Driscoll
DJ (1996) Gene structure, DNA methylation, and imprinted
expression of the human SNRPN gene. Am J Hum Genet
58:335–346
Hall JG (1990) Genomic imprinting: review and relevance to human disease. Am J Hum Genet 46:857–873
Hamerton JL, Canning N, Ray M, Smith S (1975) A cytogenetic
survey of 14,069 newborn infants. I. Incidence of chromosome
abnormalities. Clin Genet 8:223–243
Hook EB, Cross PK (1987) Extra structurally abnormal chromosomes (ESAC) detected at amniocentesis: frequency in approximately 75,000 prenatal cytogenetic diagnoses and associations with maternal and paternal age. Am J Hum Genet
40:83–101
Huang B, Crolla JA, Christian SL, Wolf-Ledbetter ME, Macha
ME, Papendausen PN, Ledbetter DH (1997) Refined molecular characterization of the breakpoints in small inv dup(15)
chromosomes. Hum Genet 99:11–17
Jackson CL (1995) In: Dracopoi NC, Haines JL, Korf BR, Moir
DT, Morton CC, Seidman CE, Seidman JG, Smith DR (eds)
Current protocols in human genetics. Wiley, New York,
pp 3.2.8
Jacobs PA, Melville M, Ratcliffe S, Keay AJ, Syme J (1974) A cytogenetic survey of 11,680 newborn infants. Ann Hum Genet
37:359–376
Ji Y, Walkowicz MJ, Buiting K, Johnson DK, Tarvin RE, Rinchik
EM, Horsthemke B, Stubbs L, Nicholls RD (1999) The ancestral gene for transcribed, low-copy repeats in the PraderWilli/Angelman region encodes a large protein implicated in
protein trafficking, which is deficient in mice with neuromus-
505
cular and spermiogenic abnormalities. Hum Mol Genet 8:
533–542
Kere J, Nagaraja R, Mumm S, Ciccodicola A, D’Urso M,
Schlessinger D (1992) Mapping human chromosomes by
walking with sequence-tagged sites from end fragments of
yeast artificial chromosome inserts. Genomics 14:241–248
Kim UJ, Birren BW, Slepak T, Mancino V, Boysen C, Kang HL,
Simon MI, Shizuya H (1996) Construction and characterization of a human bacterial artificial chromosome library. Genomics 34:213–218
Knight LA, Lipson M, Mann J, Bachman R (1984) Mosaic inversion duplication of chromosome 15 without phenotypic effect:
occurrence in a father and daughter. Am J Med Genet
17:649–654
Knoll JHM, Sinnett D, Wagstaff J, Glatt K, Wilcox AS, Whiting
PM, Wingrove P, Sikela JM, Lalande M (1993) FISH ordering
of reference markers and of the gene for the α5 subunit of the
γ-aminobutyric acid receptor (GABRA5) within the Angelman
and Prader-Willi syndrome chromosomal regions. Hum Mol
Genet 2:183–189
Leana-Cox J, Jenkins L, Palmer CG, Plattner R, Sheppard L,
Flejter WL, Zackowski J, Tsien F, Schwartz S (1994) Molecular cytogenetic analysis of inv dup(15) chromosomes, using
probes specific for the Prader-Willi/Angelman syndrome region: clinical implications. Am J Hum Genet 54:748–756
Ledbetter DH, Mascarello JT, Riccardi VM, Harper VD, Airhart
SD, Strobel RJ (1982) Chromosome 15 abnormalities and the
Prader-Willi syndrome: a follow-up report of 40 cases. Am
J Hum Genet 34:278–285
Lehman AL, Nakatsu Y, Ching A, Bronson RT, Oakey RJ, KeiperHrynko N, Finger JN, Durham-Pierre D, Horton DB, Newton
JM, Lyon MF, Brilliant MH (1998) A very large protein with
diverse functional motifs is deficient in rjs (runty, jerky,
sterile) mice. Proc Natl Acad Sci U S A 95:9436–9441
Lupski JR, Roth JR, Weinstock GM (1996) Review: chromosomal
duplications in bacteria, fruit flies, and humans. Am J Hum
Genet 58:21–27
Maraschio P, Zuffardi O, Bernardi F, Bozzola M, De Paoli C,
Fonatsch C, Flatz SD, Ghersini L, Gimelli G, Loi M, Lorini R,
Peretti D, Poloni L, Tonetti D, Vanni R, Zamboni G (1981)
Preferential maternal derivation in inv dup(15). Hum Genet
57:345–350
Maraschio P, Cuoco C, Gimelli G, Zuffardi O, Tiepolo L (1988)
In: Daniels A (ed) The cytogenetics of mammalian autosomal
rearrangements. AR Liss, New York, pp 615–634
Mattei MG, Souiah N, Mattei JF (1984) Chromosome 15 anomalies and the Prader-Willi syndrome: cytogenetic analysis. Hum
Genet 66:313–334
Mignon C, Malzac P, Moncla A, Depetris D, Roeckel N, Croquette
M-F, Mattei M-G (1996) Clinical heterogeneity in 16 patients
with inv dup(15) chromosome: cytogenetic and molecular studies, search for an imprinting effect. Eur J Hum Genet 4:88–100
Mutirangura A, Jayakumar A, Sutcliffe JS, Nakao M, McKinney
MJ, Buiting K, Horsthemke B, Beaudet AL, Chinault AC,
Ledbetter DH (1993) A complete YAC contig of the PraderWilli/Angelman chromosome region (15q11–q13) and refined
localization of the SNRPN gene. Genomics 18:546–552
Nelson DL, Ledbetter SA, Corbo L, Victoria MF, Ramirez-Solis
R, Webster TD, Ledbetter DH, Caskey CT (1989) Alu polymerase chain reaction: a method for rapid isolation of humanspecific sequences from complex DNA sources. Proc Natl
Acad Sci U S A 86:6686–6690
Nicholls RD (1993) Genomic imprinting and uniparental disomy
in Angelman and Prader-Willi syndromes: a review. Am
J Med Genet 46:16–25
Nielsen J, Rasmussen K (1975) Extra marker chromosomes in
newborn children. Hereditas 81:221–224
Nielsen J, Wohlert M (1991) Chromosome abnormalities found
among 34,910 newborn children: results from a 13-year incidence study in Arhus, Denmark. Hum Genet 87:81–83
Paris Conference (1971) Standardization in human cytogenetics:
birth defects. Ser. VIII. The National Foundation, New York
Pinkel D, Straume T, Gray JW (1986) Cytogenetic analysis using
quantitative, high-sensitivity fluorescence hybridization. Proc
Natl Acad Sci U S A 83:2934–2938
Plattner R, Heerema NA, Patil SR, Howard-Peebles PN, Palmer
CG (1991) Characterization of seven DA/DAPI-positive bisatellited marker chromosomes by in situ hybridization. Hum
Genet 87:290–296
Plattner R, Heerema NA, Howard-Peebles PN, Miles JH, Soukup
S, Palmer CG (1993) Clinical findings in patients with marker
chromosomes identified by fluorescence in situ hybridization.
Hum Genet 91:589–598
Rauch A, Pfeiffer RA, Trautmann U, Liehr T, Rott HD, Ulmer R
(1992) A study of ten small supernumerary (marker) chromosomes identified by fluorescence in situ hybridization (FISH).
Clin Genet 42:84–90
Ritchie RJ, Mattei MG, Lalande M (1998) A large polymorphic
repeat in the pericentromeric region of human chromosome
15q contains three partial gene duplications. Hum Mol Genet
7:1253–1260
Robinson WP, Wagstaff J, Bernasconi F, Baccichetti C, Artifoni L,
Franzoni E, Suslak L, Shih L-Y, Aviv H, Schinzel A (1993)
Uniparental disomy explains the occurrence of the Angelman
or Prader-Willi syndrome in patients with an additional small
inv dup(15) chromosome. J Med Genet 30:756–760
Robinson WP, Dutly F, Nicholls RD, Bernasconi F, Penaherrera
M, Michaelis RC, Abeliovich D, Schinzel AA (1998) The
mechanisms involved in formation of deletions and duplications of 15q11–q13. J Med Genet 35:130–136
Sachs ES, Van Hemel JO, Den Hollander JC, Jahoda MGJ (1987)
Marker chromosomes in a series of 10,000 prenatal diagnoses:
cytogenetic and follow-up studies. Prenat Diag 7:81–89
Schreck RR, Breg WR, Erlanger BF, Miller OJ (1977) Preferential
derivation of abnormal human G-group-like chromosomes
from chromosome 15. Hum Genet 36:1–12
Spinner NB, Zackai E, Cheng S-D, Knoll JH (1995) Supernumerary inv dup(15) in a patient with Angelman syndrome and a
deletion of 15q11–q13. Am J Med Genet 57:61–65
Stetten G, Sroka-Zaczek B, Corson VL (1981) Prenatal detection
of an accessory chromosome identified as an inversion duplication (15). Hum Genet 57:357–359
Tagle DA, Collins FS (1992) An optimized Alu-PCR primer pair
for human-specific amplification of YACs and somatic cell hybrids. Hum Mol Genet 1:121–122
Van Dyke DL, Weiss L, Logan M, Pai GS (1977) The origin and
behavior of two isodicentric bisatellited chromosomes. Am
J Hum Genet 29:294–300
Wagstaff J, Knoll JHM, Fleming J, Kirkness EF, Martin-Gallardo
A, Greenberg F, Graham JM Jr, Menninger J, Ward D, Venter
JC, Lalande M (1991) Localization of the gene encoding the
GABAA receptor β3 subunit to the Angelman/Prader-Willi region of chromosom 15. Am J Hum Genet 49:330–337
Wandstrat AE, Leana-Cox J, Jenkins L, Schwartz S (1998) Molecular cytogenetic evidence for a common breakpoint in the
largest inverted duplications of chromosome 15. Am J Hum
Genet 62:925–936
Warburton D (1984) Outcome of cases of de novo structural rearrangements diagnosed at amniocentesis. Prenat Diagn 4:69–80
Warburton D (1991) De novo balanced chromosome rearrangements and extra marker chromosomes identified at prenatal diagnosis: clinical significance and distribution of breakpoints.
Am J Hum Genet 49:995–1013
Wisniewski L, Hassold T, Heffelfinger J, Higgins JV (1979) Cytogenetic and clinical studies in five cases of inv dup(15). Hum
Genet 50:259–270
Wisniewski LP, Witt ME, Ginsberg-Fellner F, Wilner J, Desnick
RJ (1980) Prader-Willi syndrome and a disatellited derivative
of chromosome 15. Clin Genet 18:42–47
Zannotti M, Preto A, Giovanardi PR, Dallapiccola B (1980) Extra
dicentric 15pter–q21/22 chromosomes in five unrelated patients with a distinct syndrome of progressive psychomotor retardation, seizures, hyper-reactivity and dermatoglyphic abnormalities. J Ment Defic Res 24:235–242