S UPPL E MEN T ARY M ET HO DS
Agarose gel electrophoresis
RNA samples were denatured in Formamide loading dye (Fermentas, St. Leon-Rot, Germany)
at 65° for 5 minutes, chilled on ice and loaded directly on 1.5% TAE agarose gel (Invitrogen
UltraPure Agarose (Invitrogen, Karlsruhe, Germany)). 5μl of pre-mixed High Range RNA
Ladder and Generuler DNA ladder mix (Fermentas, St. Leon-Rot, Germany) were used each,
2μg of other samples was loaded per lane. The gel was run at 5 V/cm for 90 minutes and
stained with 0.5μg/ml Ethidium Bromide in 0.5x TAE Buffer. Bands were visualized and
fotographed under UV light.
Bone Marrow stimulation
Bone Marrow was isolated from femur and tibia of 6 week old C57BL/6 wildtype and TLR7knockout mice according to standard procedures. Erythrocytes were lysed using BD
Pharmlyse (BD, Heidelberg, Germany) and cells were plated in RPMI 1640 (Biochrom,
Berlin, Germany) (with 10% FBS, L-glutamine, non-essential amino acids, sodium pyruvate
and antibiotics) (Sigma-Aldrich, St. Louis, MO) in 96-well plates (2x10^5 cells/well). After 4
hours, cells were stimulated with 2.5μg/ml Ribomunyl®, ODN 1826 (TLR9 ligand)
(Metabion, Martinsried, Germany) and 2.5μg/ml of RNAs (Ribomunyl®-RNA, polyU (TLR7
ligand), polyA (non-stimulatory RNA) in complex with cationic peptides if indicated (scaled
proportionally to amounts used for PBMCs). R848 (TLR7/8 ligand) (Alexis, Lörrach,
Germany) was used at a concentration of 0.4μM. After 18 h, supernatants were collected and
IFN- was determined using a sandwich ELISA: rat monoclonal antibody to mouse IFN-
(clone RMMA-1) was used as the capture antibody, rabbit polyclonal antibody to mouse IFN for detection (both from PBL Biomedical Laboratories, Piscataway, NJ) together with HRP-
conjugated donkey antibody to rabbit IgG as the secondary reagent (Jackson
ImmunoLaboratories, West Grove, PA). Recombinant mouse IFN-A (PBL Biomedical
Laboratories, Piscataway, NJ) was used as the standard.
Lentiviral Vector production for TLR3 knock down:
To introduce shRNA–expression cassettes into cells lentiviral vector particles were used.
They were generated by using the 3rd generation packaging constructs pMD2.G, pRSV.Rev
and pMDL.g/pRRE (Dull T. et al, 1998 J Virol 72(11):8463-8471). The shRNA-cassettes
were encoded on pLKO.1 plasmids purchased from Sigma Aldrich (St. Louis, MO) (SHC 002
for non-targeting shRNA, TRCN0000056849 for shTLR3). For production of vector particles
in HEK 293T cells 10 g shRNA-Plasmid, 2,5 g pRSV:Rev, 3,5 g pMD2.G and 6,5 g
pMDL.g/pRRE were transfected into the cells via the calcium phosphate precipitation method
(Hawley et al, 1989 Plasmid 22(2):120-131). Media was changes 12h post transfection.
Vector containing supernatant was harvested 48h post transfection and cleared by filtration
using a 0,45 m filter (Sartorius, Göttingen, Germany) and subsequently stored at -80°C.
Generation of TLR3 knock down cell line
For generation of knock down cells 50.000 IGROV cells were grown in 6 well plates and
transduced with lentiviral particles. 48h post transduction cells were exposed to 5 g/ml
puromycin. The selected cells were expanded and checked for knockdown via qPCR.
qPCR Analysis of TLR3 expression:
For qPCR Analysis whole RNA was extracted from IGROV cells using TRIzol (Invitrogen,
Karlsruhe, Germany) according to manufacturers instructions. The following cDNA synthesis
was performed using the SuperScript VILO cDNA Synthesis-Kit (Invitrogen, Karlsruhe,
Germany). The qPCR on TLR3 was performed using the LC480 (Roche, Mannheim,
Germany) on a probe based detection format. The qPCR was designed using the Roche
Universal Probe Library Assay Design Center (probe # 88, Primer1: aaggctagcagtcatccaaca,
Primer 2: agcaacttcatggctaacagtg). The assay was performed in a relative fashion compared to
ß-Actin.
Culture and stimulation of TLR3 reporter cells:
IGROV cells with or without TLR3 knock down were cultured in RPMI Media containing
10% FCS. For stimulation, cells were seeded at 50.000 per 96 well and stimulus was added
either directly to the supernatant or in complex with poly-L-Arginine (pArg) or Protamine as
described in Method section.
Ribomunyl® + Protamine aerosolic application
A clean standard spray bottle used for intranasal application was filled with 4.75ml of sterile
isotonic NaCl solution (0.9%). 250 μl of Ribomunyl® supension (1μg/μl) and 3.75μl of
Protamin Valeant® 5000 (50μg/μl) were added, the bottle was shaken (5 seconds) and
subsequently incubated for 20 minutes. The spray volume of one application was
experimentally determined to be in average 50μl. Different parts of a 96-well plate containing
PBMCs (4x10^5/well) in RPMI 1640 growth medium (100μl/well) were sprayed 0-10 times,
as indicated.