Issues in Biotechnology: The Way We Work With Life Dr. Albert P. Kausch life edu.org Part II of the Course The Applications of Biotechnology A Sweeping General Survey on Life and Biotechnology The University of Rhode Island © life_edu Issues in Biotechnology: The Way We Work With Life Dr. Albert P. Kausch life edu.org Forensics 25. Trace Evidence 26. DNA based Forensic 27. The National Debate Public Safety vs The Right to Privacy A Sweeping General Survey on Life and Biotechnology The University of Rhode Island Forensics Lectures 25, 26 & 27 Issues in Biotechnology: The Way We Work With Life Dr. Albert P. Kausch life edu.org Forensics DNA Based Evidence The University of Rhode Island Forensics: Bioweapons DNA Based Forensic Evidence Forensic DNA Databases: The National Debate Biotechnology Stocks Project Time to cash in (or out) as the case may be!!! $100,000.00!!!!!!! What happened to your Invested in Biotech. Stocks this Semester? 1. Select and Research five Biotech companies 2. Print out the current stock quote and annual chart 3. Invest chosen amounts in each. Calculate shares in each. 4. Monitor Stock 5. Print out the stock quote and annual chart Weds. 6. Calculate gains and losses. Submit report. Are you here? A. Yes B. No C. Uncertain 60 40 20 0 1 2 3 Whan that Aprill, with her shoures soote The droghte of March is perced to the roote And bathed every veyne in swich licour, Of which vertu engendred is the flour; Whan Zephirus eek with his sweete breeth Inspired hath in every holt and heeth The tendre croppes, and the yonge sonne Hath in the Ram his halfe cours yronne, And smale foweles maken melodye, And slepen al the nyght with open eye(So priketh hem Nature in hir corages); Thanne longen folk to goon on pilgrimages And especially from every shires ende Of URI, to 271 Chaffee they wende, When in April the sweet showers fall That pierce March's drought to the root And bathed every vein in sweet liquor That has power to generate therein and sire the flower; When Zephyr also has with his sweet breath ,Filled again, in every holt and heath, The tender shoots and leaves, and the young sun His half-course in the sign of the Ram has run, And many little birds make melody That sleep through all the night with open eye (So Nature pricks them on to ramp and rage) Then folk do long to go on pilgrimages And especially from every shire's end Of URI they to 271 Chaffee they went Interpreting the Human Genome What do we have? EAKANDWEARYOVERMANYAQUAINTANDCURIOUSVOLUMEOFFOR GOTTENLOREWHILEINODDEDNEARLYNAPPINGSUDDENLYTHEREC AMEATAPPINGASOFSOMEONEGENTLYRAPPINGRAPPINGATMYCH AMBERDOORTISSOMEVISITORIMUTTEREDTAPPINGATMYCHAMO NCEUPONAMIDNIGHTDREARYWHILEIPONDEREDWBERDOORONLY THISANDNOTHINGMOREAHDISTINCTLYIREMEMBERITWASINTHEB LEAKDECEMBERANDEACHSEPARATEDYINGEMBERWROUGHTITSG HOSTUPONTHEFLOOREAGERLYIWISHEDTHEMORROWVAINLYIHA DSOUGHTTOBORROWFROMMYBOOKSSURCEASEOFSORROWSORR OWFORTHELOSTLENOREFORTHERAREANDRADIANTMAIDENWHO MTHEANGELSNAMELENORENAMELESSHEREFOREVERMOREANDT HESILKENSADUNCERTAINRUSTLINGOFEACHPURPLECURTAINTHR ILLEDMEFILLEDMEWITHFANTASTICTERRORSNEVERFELTBEFORE SOTHATNOWTOSTILLTHEBEATINGOFMYHEARTISTOODREPEATIN GTISSOMEVISITORENTREATINGENTRANCEATMYCHAMBERDOORS OMELATEVISITORENTREATINGENTRANCEATMYCHAMBERDOORT HISITISANDNOTHINGMORE Interpreting the Human Genome Organization and structure is needed! Once upon a midnight dreary, while I pondered, weak and weary, Over many a quaint and curious volume of forgotten lore, While I nodded, nearly napping, suddenly there came a tapping, As of some one gently rapping, rapping at my chamber door. “Tis some visitor," I muttered, "tapping at my chamber door— Only this, and nothing more." Ah, distinctly I remember it was in the bleak December, And each separate dying ember wrought its ghost upon the floor. Eagerly I wished the morrow;--vainly I had sought to borrow From my books surcease of sorrow--sorrow for the lostLenore— For the rare and radiant maiden whom the angels name Lenore--Nameless here for evermore. Pharmacogenomics Making Sense Organization and structure is needed! Once upon a midnight dreary, while I pondered, weak and weary, Over many a quaint and curious volume of forgotten lore, While I nodded, nearly napping, suddenly there came a tapping, As of some one gently rapping, rapping at my chamber door. “Tis some visitor," I muttered, "tapping at my chamber door— Only this, and nothing more." Ah, distinctly I remember it was in the bleak December, And each separate dying ember wrought its ghost upon the floor. Eagerly I wished the morrow;--vainly I had sought to borrow From my books surcease of sorrow--sorrow for the lostLenore— For the rare and radiant maiden whom the angels name Lenore--Nameless here for evermore. Do you know how to make a nuclear bomb? A. B. C. D. Yes No Uncertain I could find out 30 20 10 0 1 2 3 4 Synthetic Biology A Larger Threat to World Peace than Nuclear War? To whom much is given much is required Luke 12:48 Once you know, you cannot unknow Kausch, The Abandon In much wisdom there is grief in much knowledge there is pain Ecclesiastes 1:18 Now that you know, know that you now Kausch, The Abandon Issues in Biotechnology: The Way We Work With Life Dr. Albert P. Kausch life edu.org Forensics DNA Based Evidence The University of Rhode Island Forensics: DNA Based Evidence Forensic DNA Databases: The National Debate Trace Evidence I typically watch TV: A. B. C. D. E. 0-2 hrs/day 2-3 hrs/day 3-5 hrs/day 5-10 hrs/day Over 10 hrs/day 50 40 30 20 10 0 1 2 3 4 5 The average American watches TV: A. B. C. D. E. 0-2 hrs/day 2-3 hrs/day 3-5 hrs/day 5-10 hrs/day Over 10 hrs/day I typically watch TV: 4 hrs X 365 = 1460 hrs/yr 1460 hrs/yr ÷ 16 hrs waking hrs/day = 91.25 days/yr 91.25 days/yr over 50 yrs = 4562.5 days or 12.5 yrs Does watching TV influence teenage sexual behavior? Does watching TV influence teenage violent behavior? Children And TV Violence 2012 Hundreds of studies on the effects of TV violence on children and teenagers have found that children may: •become "immune" or numb to the horror of violence •gradually accept violence as a way to solve problems •imitate the violence they observe on television; and •identify with certain characters, victims and/or victimizers Children And TV Violence 2008 •Nearly 2 out of 3 TV programs contain some violence, averaging about 6 violent acts per hour. •The average child who watches 2 hours of cartoons a day may see nearly 10,000 violent incidents each year, of which the researchers estimate that at least 500 pose a high risk for learning and imitating aggression and becoming desensitized to violence. Center for Communication and Social Policy, University of California, Santa Barbara (UCSB), National Television Violence Study, Executive Summary, Volume 3 2008. Longitudinal Relations Between Children’s Exposure to TV Violence and Their Aggressive and Violent Behavior in Young Adulthood: 1977–1992 L. Rowell Huesmann, Jessica Moise-Titus, Cheryl-Lynn Podolski, and Leonard D. Eron University of Michigan Developmental Psychology 2003 The American Psychological Association, Inc. 2003, Vol. 39, No. 2, 201–221 ABSTRACT Although the relation between TV-violence viewing and aggression in childhood has been clearly demonstrated, only a few studies have examined this relation from childhood to adulthood, and these studies of children growing up in the 1960s reported significant relations only for boys. The current study examines the longitudinal relations between TV-violence viewing at ages 6 to 10 and adult aggressive behavior about 15 years later for a sample growing up in the 1970s and 1980s. Follow-up archival data (N 450) and interview data (N 329) reveal that childhood exposure to media violence predicts young adult aggressive behavior for both males and females. Identification with aggressive TV characters and perceived realism of TV violence also predict later aggression. These relations persist even when the effects of socioeconomic status, intellectual ability, and a variety of parenting factors are controlled. Connecticut State Forensic Science Laboratory Michael Adamowicz, Criminalist Carll Ladd, Lead Criminalist Forensic Biology The Rhode Island State Crime Lab: Forensic Examinations Dennis Hilliard, Director Amy Duhaime Criminalist III Rhode Island State Crime Lab Forensic DNA Testing is Nothing Just ing like CSI! Forensic Science: the application of natural sciences to matters of the law. Physical Evidence Analysis • Is concerned with the recognition, identification, comparison, individualization, interpretation and reconstruction of evidence. Criminalistics: Study and evaluate the recognition, identification, individualization, and evaluation of physical evidence using the methods of the natural sciences in matters of legal significance. Physical evidence examination can : Link a suspect with the victim Link a person to a crime scene Link an object to a crime Disprove or support witness testimony Identify a person Aid in the Reconstruction of a crime Chain of Custody The chain of custody begins when the evidence is located at the scene even before it is collected and does not end, until the case has been adjudicated in court and all appeals have been exhausted. Forensic Science Lab Services Criminalistics • Forensic Biology Serology DNA • Trace Analysis • Chemistry • Instrumentation Identification Latent Print Section Questioned Documents Imprints Firearms Toolmarks Forensic Photography *Crime Scene Reconstruction How Does DNA Forensic Testing Help Help an Investigation? By Providing Important Linkages: Link suspect to victim Link suspect to scene Link victim to scene Forensic DNA Evidence Circumstantial Evidence Was a person there? Patterns Patterns? Patterns are the basis of DNA Identification DNA Profiles, Marker D10S28 C V D E1 E2 E3 C Patterns in DNA markers can link a suspect to a crime scene C = Control V = Victim D = Defendant E = Evidentiary sample Issues in Biotechnology If you flip a coin six times and get heads on all six flips, what is the probability of getting heads on the next toss? A B C D F 1/2 1/100 1/1000 1/10,000 1/1,000,000 40 30 20 10 0 1 2 3 4 5 Murder at Rodman Dam, 1988 • In July 1987 Randall Scott Jones and Chris Reesh, both in their teens, went target shooting with a 30/30 hunting rifle at the Rodman Dam Recreation Area in Florida. While they were shooting, Jone’s pickup truck became stuck in a sand pit. A fisherman suggested they ask a couple in a pickup parked nearby for help. Jones and Reesh approached the truck, where Kelly Lynn Perry and her fiancé Matthew Brock were sleeping. The two men debated whether or not to wake them to ask for assistance. Murder at Rodman Dam, 1988 • The following morning, fishermen found the bodies of Perry and Brock in the woods adjacent to the recreation area. Police investigation revealed that they had been shot with a 30 caliber bullet and Perry had been sexually assaulted. Their pickup was reported stolen. Murder at Rodman Dam, 1988 • In August, Jones was arrested in Mississippi, found driving Brocks pickup. Reesh was arrested the next day in Palatka, Florida, after Jones told police that they were together that night in July. Both were indicted on counts of first degree assault and sexual battery. Murder at Rodman Dam, 1988 • A semen sample E(vs) retrieved from Perry’s body, and blood samples from Reesh, S1, and Jones, S2, were compared at a laboratory that specialized in DNA testing. The resulting DNA evidence indicated which man was guilty of rape. Murder at Rodman Dam, 1988 • DNA results Who is most likely guilty of the rape? A. Chris Reesh B. Randall Jones Murder at Rodman Dam, 1988 • Using the DNA results and other evidence, officials identified Jones as the rapist and were able to piece together the events of the crime. • Without waking the couple in the pickup, Jones shot both Perry and Brock in the head at close range. He and Reesh then dragged the bodies into the woods nearby. They towed Jone’s truck with Brock’s pickup and left with both trucks. • Later, Jones returned to the crime scene, moved the bodies further into the woods, and raped Perry. Murder at Rodman Dam, 1988 • A representative from the DNA lab testified that the chance of another person having the same DNA fingerprint as Jones was one in 9,390,000,000, about twice the earth’s population. • After deliberating only 15 minutes, the jury convicted Jones of murder and rape. The judge sentenced him to a double death sentence, making this the first case involving DNA evidence in the U.S. legal history in which the death sentence was handed down. Reesh was sentenced to six years in prison and twenty years probation. DNA Uses for DNA Analysis Criminal Investigations Paternity Cases Genetic Disease Diagnosis Identifying Endangered Animals Identifying Remains from War Identifying Accident Victims DNA Hereditary material of all living organisms. Found predominantly in the cell nucleus. Organized into chromosomes. Humans-46 chromosomes. 23 maternal & 23 paternal. Polymer-individual units called nucleotides. Structure-double helix. Watson and Crick, 1953. Forensic Identification: Basic Principles Each of us is genetically unique. If enough genetic variation is tested, each of us can be uniquely identified. DNA is found in nearly all cells (blood, semen, hair, etc.). DNA from an evidentiary sample can be matched with DNA from a suspect to implicate or exonerate. DNA Casework 1. Forensic Analysis (Criminal). -132 labs conducting DNA analysis in 49 states. ~ 40,000 cases/year received. ~25,000 analyzed. ~80% sexual assaults. 2. ~30% of the time the suspect is excluded by DNA. 3. ~ 300,000 paternity cases per year. Sources of Biological Evidence • • • • • • • • Blood Semen Saliva Urine Hair Teeth Bone Tissue Other Possible items for DNA Testing: 1. cigarette butts 2. gloves, bandanas, ski masks, baseball caps general clothing 3. condoms (inside vs. outside) 4. stains on furniture, pillows, sheets 5. hair clips, lipsticks 6. letters, envelopes, and stamps 7. plant and animal sources of evidence PCR Gel Electrophoresis: the separation of molecules, DNA, RNA and proteins by charge and size Electro refers to the energy of electricity. Phoresis, from the Greek verb phoros, means "to carry across." Thus, gel electrophoresis refers to the technique in which molecules are forced across a span of gel, motivated by an electrical current. The gel matrix acts as a sieve for DNA molecules. Large molecules have difficulty getting through the holes in the matrix. Small molecules move easily through the holes. Because of this, large fragments will lag behind small fragments as DNA migrates through the gel. As the separation process continues, the separation between the larger and smaller fragments increases. •Molecular weight markers are often electrophoresed with DNA. •Molecular weight markers are usually a mixture of DNAs with known molecular weights •Molecular weight markers are used to estimate the sizes of DNA fragments in a DNA sample What are some of the DNA technologies used in forensic investigations? Restriction Fragment Length Polymorphism (RFLP) PCR Analysis STR Analysis Mitochondrial DNA Analysis Y-Chromosome Analysis Restriction Fragment Length Polymorphism (RFLP) RFLP is a technique for analyzing the variable lengths of DNA fragments that result from digesting a DNA sample with a special kind of enzyme. This enzyme, a restriction endonuclease, cuts DNA at a specific sequence pattern know as a restriction endonuclease recognition site. The presence or absence of certain recognition sites in a DNA sample generates variable lengths of DNA fragments, which are separated using gel electrophoresis. They are then hybridized with DNA probes that bind to a complementary DNA sequence in the sample. RFLP is one of the original applications of DNA analysis to forensic investigation. With the development of newer, more efficient DNA-analysis techniques, RFLP is not used as much as it once was because it requires relatively large amounts of DNA. In addition, samples degraded by environmental factors, such as dirt or mold, do not work well with RFLP. PCR Analysis PCR (polymerase chain reaction) is used to make millions of exact copies of DNA from a biological sample. DNA amplification with PCR allows DNA analysis on biological samples as small as a few skin cells. With RFLP, DNA samples would have to be about the size of a quarter. The ability of PCR to amplify such tiny quantities of DNA enables even highly degraded samples to be analyzed. Great care, however, must be taken to prevent contamination with other biological materials during the identifying, collecting, and preserving of a sample. STR Analysis Short tandem repeat (STR) technology is used to evaluate specific regions (loci) within nuclear DNA. Variability in STR regions can be used to distinguish one DNA profile from another. The Federal Bureau of Investigation (FBI) uses a standard set of 13 specific STR regions for CODIS. CODIS is a software program that operates local, state, and national databases of DNA profiles from convicted offenders, unsolved crime scene evidence, and missing persons. The odds that two individuals will have the same 13-loci DNA profile is about one in one billion. Mitochondrial DNA Analysis Mitochondrial DNA analysis (mtDNA) can be used to examine the DNA from samples that cannot be analyzed by RFLP or STR. Nuclear DNA must be extracted from samples for use in RFLP, PCR, and STR; however, mtDNA analysis uses DNA extracted from another cellular organelle called a mitochondrion. While older biological samples that lack nucleated cellular material, such as hair, bones, and teeth, cannot be analyzed with STR and RFLP, they can be analyzed with mtDNA. In the investigation of cases that have gone unsolved for many years, mtDNA is extremely valuable. All mothers have the same mitochondrial DNA as their daughters. This is because the mitochondria of each new embryo comes from the mother's egg cell. The father's sperm contributes only nuclear DNA. Comparing the mtDNA profile of unidentified remains with the profile of a potential maternal relative can be an important technique in missing person investigations. Y-Chromosome Analysis The Y chromosome is passed directly from father to son, so the analysis of genetic markers on the Y chromosome is especially useful for tracing relationships among males or for analyzing biological evidence involving multiple male contributors. PCR The Polymerase Chain Reaction Let’s Take a Break PCR The Polymerase Chain Reaction Repetition of this cycle will cause repeated replication of the target THERE ARE MILLIONS OF DIFFERENT GENES OR SEQUENCES WITHIN ANY DNA SAMPLE (BLOOD, TISSUE, PLANT, ETC.). A SPECIFIC SEQUENCE IS SELECTED TO BE AMPLIFIED (RED ABOVE). THIS SEQUENCE CAN BE ANY GENE OF INTEREST OR A NON-CODING MARKER REGION OF DNA. IN ORDER TO COPY THE SEQUENCE OR GENE, A SHORT SEQUENCE ON EITHER SIDE OF THE SECTION MUST BE KNOWN. THIS REGION (BLUE ABOVE) WILL SERVE AS A PRIMER ATTACHMENT SITE TO COPY THE DNA TARGET SEGMENT. IN ORDER TO AMPLIFY A SPECIFIC FRAGMENT OF DNA, SEVERAL THINGS ARE NEEDED, INCLUDING PRIMERS AND DNA POLYMERASE, AN ENZYME WHICH COPIES DNA. PRIMERS ARE SHORT PIECES OF DNA OR RNA DESIGNED TO PAIR WITH GENOMIC DNA AT A SPECIFIC ATTACHMENT SITE FOR THE MAIN PURPOSE OF HELPING THE DNA POLYMERASE BIND AT THE DESIRED SECTION. WITHOUT A SHORT PIECE OF DNA(OR RNA) TO ATTACH TO, DNA POLYMERASE CAN NOT COPY A DNA STRAND. NUCLEOSIDE TRIPHOSPHATES, THE BUILDING BLOCKS OF DNA ARE ALSO NEEDED. EACH NUCLEOSIDE TRIPHOSPHATE CONSISTS OF: A BASE (ADENINE, THYMINE, CYTOSINE OR GUANINE). A SUGAR AND THREE PHOSPHATES. PCR REQUIRES SEVERAL CYCLES OF AMPLIFICATION. EACH CYCLE CONSISTS OF THREE TEMPERATURE CHANGES. THE STARTING TEMPERATURE (95 C) SEPARATES THE DNA STRANDS. A LOWERED TEMPERATURE (50-60 C) ALLOWS PRIMERS TO BIND TO COMPLEMENTARY SEQUENCES IN THE DNA. A SLIGHTLY HIGHER TEMPERATURE (72 C) ALLOWS DNA POLYMERASE TO ATTACH TO THE PRIMERS AND COPY THE DNA STRANDS (EXTENSION). DNA STRANDS ARE SEPARATED BY HEATING @ 94o C. THE TEMPERATURE IS LOWERED TO 54oC TO ALLOW PRIMERS TO PAIR WITH COMPLEMENTARY DNA SEQUENCES. MAKING NEW DNA MOLECULES: DNA POLYMERASE ATTACHES TO THE PRIMERS @ 72 C. DNA POLYMERASE ADDS NUCLEOSIDE TRIPHOSPHATES TO THE PRIMERS TO COPY THE DNA STRANDS. COPYING IS COMPLETED FOR EACH STRAND. THE PROCESS IS REPEATED IN THE NEXT CYCLE. THE TEMPERATURE IS RAISED AGAIN TO SEPARATE THE DNA STRANDS. THE TEMPERATURE IS LOWERED TO ALLOW PRIMERS TO ANNEAL. DNA POLYMERASE ATTACHES TO THE PRIMERS AND DNA IS COPIED TO MAKE 4 STRANDS OF DNA. STRs Are Used in Identity Testing “Short Tandem Repeat sequence” ...atatatacaacttactaccatata ccgattacgatcgaattataccgcgga cgtagtaatgacgatgaagtaactata tatatatatatatatatatatatatatatata tatatatatatatatatatatatatatatata tatatatatatatatatatatatatatatata tatatatatatatatatatatatatatatata tatatatatatatatatatatatatatatata tatatatatatatatatatatatatatat atactacctaccagggaggagata... CODIS 13 Core STR Loci with Human Chromosomal Positions TPOX D3S1358 D8S1179 D5S818 FGA CSF1PO TH01 VWA D7S820 AMEL D13S317 D16S539 D18S51 D21S11 AMEL THE PROCESS OF COPYING DNA STRANDS IS REPEATED 32-35 TIMES. WITH EACH AMPLIFICATION CYCLE, THE NUMBER OF COPIES OF THE DNA SEQUENCE IS DOUBLED UNTIL MILLIONS OF COPIES HAVE BEEN MADE. Over 1 million copies are generated in 32 cycles of this chain reaction These copies can easily be detected by gel electrophoresis. The size of the DNA fragement should be that of thetarget sequence What is CODIS? Combined DNA Index System CODIS is a computer software program that operates local, State, and national databases of DNA profiles from convicted offenders, unsolved crime scene evidence, and missing persons. Every State in the Nation has a statutory provision for the establishment of a DNA database that allows for the collection of DNA profiles from offenders convicted of particular crimes. CODIS software enables State, local, and national law enforcement crime laboratories to compare DNA profiles electronically, thereby linking serial crimes to each other and identifying suspects by matching DNA profiles from crime scenes with profiles from convicted offenders. The success of CODIS is demonstrated by the thousands of matches that have linked serial cases to each other and cases that have been solved by matching crime scene evidence to known convicted offenders. The missing persons index consists of the unidentified persons index and the reference index. The unidentified persons index contains DNA profiles from recovered remains, such as bone, teeth, or hair. The reference index contains DNA profiles from related individuals of missing persons so that they can be periodically compared to the unidentified persons index. All samples for this index are typed using mtDNA and STR DNA analysis (if possible) to maximize the power of advancing technology. PCR Copies DNA Exponentially through Multiple Thermal Cycles Original DNA target region Thermal cycle In 32 cycles at 100% efficiency, 1.07 billion copies of targeted DNA region are created Laboratory PCR Instrument INPUT: Sample DNA, PCR enzymes, primers, individual nucleotide building blocks (and maybe fluorescent labels) OUTPUT: Specific DNA fragments amplified millions of times for easy visualization With sizes that vary between individuals Multiplex PCR • Over 10 Markers Can Be Copied at Once • Sensitivities to levels less than 1 ng of DNA • Ability to Handle Mixtures and Degraded Samples • Different Fluorescent Dyes Used to Distinguish STR Alleles with Overlapping Size Ranges Available Kits for STR Analysis • Kits make it easy for labs to just add DNA samples to a pre-made mix • 13 CODIS core loci – Profiler Plus and COfiler (PE Applied Biosystems) – PowerPlex 1.1 and 2.1 (Promega Corporation) • Increased power of discrimination – CTT (1994): 1 in 410 – SGM Plus™ (1999): 1 in 3 trillion – PowerPlex ™ 16 (2000): 1 in 2 x 1017 Identity Testing Using PCR Analysis of four different sections of the DNA Possible conclusions: S = size standards V = victim’s DNA 1 = suspect #1 blood 2 = suspect #2 blood 3 = suspect #3 blood E = evidence #1 S = size standards A. Suspect 1 DNA was at the scene B. Suspect 2 DNA was at the scene C. Suspect 3 DNA was at the scene D. None were at the scene E. Multiple suspects were at the scene F. Data are inconclusive S S = size standards V = victim’s DNA 1 = suspect #1 blood 2 = suspect #2 blood 3 = suspect #3 blood E = evidence #1 S = size standards V 1 2 3 E S 450 400 350 300 250 200 150 100 50 A complete match! Case Study: State v. Michael DeCorso Homicide (no DNA) Rape: DNA in semen samples from two teenage female victims DNA Profiles, Marker D10S28 C V D E1 E2 E3 C C = Control V = Victim D = Defendant E = Evidentiary sample Population frequency of defendant’s genotype = 1/50 DNA Profiles, Marker D4S139 C V D E1 E2 E3 C C = Control V = Victim D = Defendant E = Evidentiary sample Population frequency of defendant’s genotype = 1/90 DNA Profiles, Marker D5S110 C V D E1 E2 E3 C C = Control V = Victim D = Defendant E = Evidentiary sample Population frequency of defendant’s genotype = 1/10 DNA Profiles, Marker TH01 C V D E1 E2 E3 C C = Control V = Victim D = Defendant E = Evidentiary sample Population frequency of defendant’s genotype = 1/70 The information from each gel can be combined to tell us how common the DNA profile is in the general population 1/50 x 1/90 x 1/10 x 1/70 = 1/3,150,000 Random match probabilities Year Case No. of loci Match probability 1996 State v. DeCorso 4 RFLPs 1/3,000,000 1997 State v. Higgins 5 RFLPs 1/400,000,000 1999 State v. Butterfield 9 STRs 1/215,000,000,000 1999 State v. Troyer 9 STRs 1/200,000,000,000 CODIS with 13 Markers- Probability of an identical match greater than all the people who have ever been born in the history of the earth Forensic applications of DNA based technologies Fingerprinting OJ Simpson • Identification • Paternity • Crime Solving • World wide data base • Dramatic Growth In DNA-Based Forensics Doesn't Translate Into Very Many Job Opportunities One set of 22 autosomes (plus X) One set of 22 autosomes (plus X or Y) Paternity Testing Three children: The father claims he is not the father of the third child Note: There are two alleles* for each genetic marker USE OF NON-HUMAN DNA PERFECT DNA MATCH WITH CAT STRS (NY TIMES INTERNATIONAL APRIL 24, 1997) 1994 HOMICIDE PLASTIC BAG FOUND IN SHALLOW GRAVE WITH BLOODY JACKET AND TRACE HAIRS HAIRS BELONGED TO SUSPECT’S CAT, SNOWBALL DOG DNA CONTRIBUTES TO MURDER CONVICTIONS SEATTLE, 1996 DOUBLE MURDER, 2 SUSPECTS COUPLE TORTURED AND SHOT ALONG WITH PET DOG DID BLOOD ON SUSPECT’S CLOTHING MATCH THE DOG? 1 IN 3 BILLION MATCH PROBABILITY IN RANDOM CANINE POPULATION. FORENSIC PLANT DNA DNA MARKERS FOR PLANTS CAN BE USED TO LINK EVIDENCE TO A CRIME SCENE GRASS STAINS LINKED TO LAWNS VEGTABLE DNA LINKED TO RESTURANTES RARE OR UNUSUAL PLANTS LINKED TO VEHICLES MARAJUANA The CT CODIS Database collects two types of samples; (1) Convicted Offender Samples that include all Felony Convictions (since 03/01/04) and, (2) Forensic Unknowns that include any DNA profile from an evidentiary sample that does not match the victim or an elimination known. There are currently 10,793 offenders in CT Database and over 1500 offender samples are added per month. Currently there are how many felons on the CT database? (A) 1 out of 50 males in CT (B) 1 out of 500 males in CT (B) 1 out of 1000 males in CT (C) 1 out of 10,000 males in CT (E) None of these answers is correct 25 20 15 10 5 0 1 2 3 4 5 CASE STUDY Renee Pellegrino Renee Pellegrino • Renee Pellegrino’s found June 25, 1997,murder victim. • Renee Pellegrino was an accomplished scholar with a law degree, had become addicted to crack cocaine and turned to prostitution. She was 40 years old and pregnant when her naked body was discovered in a cul-de-sac off Waterford Parkway South, CT. Renee Pellegrino She had just been released from a three-week prison stay when she was apparently picked up by her killer in downtown New London on June 25, 1997, murdered and left naked on Parkway South. She had been strangled, and the killer had left her body in what the judge described as an "extreme" manner. Renee Pellegrino Cold Case Dickie Anderson 2012 Charged Police make arrest in Pellegrino cold case June 1, 2010 13 years later • Police charged Dickie E. Anderson Jr., 40, with murder in the 41-year-old Pellegrino's death. • The arrest was the result of a cold-case investigation into Pellegrino's death, which occurred on a dead-end street in Waterford. The state Office of the Chief Medical Examiner ruled that Pellegrino had been strangled. • Anderson, who was 27 at the time of the crime, was arrested as a result of an investigation conducted by the Southeastern Connecticut Cold Case Unit. The arrest warrant has been sealed. Dickie Anderson 2012 Charged Police make arrest in Pellegrino cold case June 1, 2010 Dickie Anderson 2012 Charged Police make arrest in Pellegrino cold case June 1, 2010 Police used a combination of evidence to build the case against the man accused in the 1997 murder of Renee Pellegrino, including DNA, inconsistent statements Dickie E. Anderson Jr. made to police over the years and his own admission that he was with Pellegrino shortly before her body was discovered in Waterford. Dickie Anderson 2012 • Over 13 years a case was built using DNA, inconsistent statements Anderson had made and his admission that he was with Pellegrino shortly before her body was discovered in a cul-de-sac off Parkway South, CT. Dickie Anderson 2012 • This is not a trick question • “If you had to vote right now in this case, guilty or not guilty, what would you do?" A. Guilty B. Not Guilty C. Can’t vote; I don’t know the facts of the case Dickie Anderson 2012 • This is not a trick question • “If you had to vote right now in this case, guilty or not guilty, what would you do?" This is a common question during jury selection, and many people are tempted to respond, incorrectly, that they can't vote because they don't know the facts of the case. The correct answer, as supplied by a woman in New London CT who was eventually selected to serve on the panel, is "not guilty." Dickie Anderson 2012 In a second case against, police charged Anderson with killing 29-year-old Michelle Comeau of Norwich in 1998. Anderson was previously charged with the murder of Renee Pellegrino. The Comeau case did not involve DNA. Both of the women had been working as prostitutes and were victims of strangulation. Police found Comeau's body dumped along an access road to the Norwich Industrial Park near Dodd Stadium in May 1998. Anderson has acknowledged he knew both victims. He told police he had been with Pellegrino on the night she disappeared from downtown New London. Dickie Anderson 2012 • . Pellegrino had been strangled, and her killer had posed her naked body. In May 1998, police found Comeau's body dumped along an access road to the Norwich Industrial Park near the Norwich-Franklin town line. She too had been strangled. The state claims her killer was in the process of posing her naked body in a similar manner but was interrupted and left the scene. Anderson's DNA was found on Pellegrino's body, but there is no DNA evidence to link him to the Comeau case. He knew both women and admitted to having sex with them on the day they were killed Dickie Anderson 2012 • One inmate reported that Anderson admitted to killing "Renee" and said several times that he would have never done it if he had known Pellegrino was pregnant. She was 17 weeks pregnant when she died, according to the state Office of the Chief Medical Examiner. • Police also spoke with former girlfriends of Anderson who told them he was rough during sex. One woman said Anderson threatened her and said he had gotten away with killing somebody. The woman said Anderson said he fought with a prostitute who kept asking him for money, and that he hit and killed the girl in Bates Woods in New London. Dickie Anderson 2012 • The police also interviewed a girlfriend who broke up with Anderson in 2000. She recalled that twice Anderson choked her so hard he left red marks on her neck, the warrant says. She turned over to police a picture of her injuries that she said a friend had taken • Another former girlfriend, whom Anderson was convicted of strangling in 2008, said the two had argued about her getting a job and that Anderson threw her to the floor and began choking her. She said if police did not break into the apartment and physically remove Anderson from her, she thinks she would have died. Dickie Anderson 2012 • . Dickie Anderson Jr., a self-confessed "trick artist" who told police he often traded crack cocaine for sex with prostitutes, was connected by witnesses to both of the women he is accused of killing. • In 2008, the state forensic laboratory had notified police that DNA taken from Pellegrino's body matched a DNA sample that had been taken from Anderson. The laboratory also found DNA on Pellegrino from an unknown source. Dickie Anderson 2012 • Anderson's previous convictions include: • • Jan. 2007, third-degree assault • • November 2005, violation of a protective order • • September 2005, second-degree failure to appear in court, second-degree threatening, second-degree criminal mischief • • May 2003, violation of probation, evading responsibility, second-degree failure to appear in court, third-degree assault • • July 2002, interfering with a police officer • • March 1999, second-degree assault Dickie Anderson 2012 • Dickie Anderson 2012 • This is not a trick question • “If you had to vote right now in this case, guilty or not guilty, what would you do?" A. Guilty B. Not Guilty C. Can’t vote; I don’t know the facts of the case Dickie Anderson 2012 • Dickie Anderson 2012 • . Anderson convicted of one of two murders • • Jury decides he killed Pellegrino in Waterford cold case; mistrial declared in deadlock over second prostitute murder The Death Penalty The Death Penalty A. For B. Against The Death Penalty Capital punishment in Rhode Island The Hollow Men T. S. Eliot Mistah Kurtz—he dead. A penny for the Old Guy I. We are the hollow men We are the stuffed men Leaning together Headpiece filled with straw. Alas! Our dried voices, when We whisper together Are quiet and meaningless As wind in dry grass Or rats’ feet over broken glass In our dry cellar Shape without form, shade without color, Paralyzed force, gesture without motion; Those who have crossed With direct eyes, to death’s other Kingdom Remember us—if at all—not as lost Violent souls, but only As the hollow men The stuffed men. Can We Please Take a Break?