पेटेंट कार्ाालर् शासकीर् जर्ाल OFFICIAL JOURNAL OF THE PATENT OFFICE नर्र्ामर् सं. 51/2015 ISSUE NO. 51/2015 शक्र ु वार FRIDAY दिर्ांक: 18/12/2015 DATE: 18/12/2015 पेटेंट कार्ाालर् का एक प्रकाशर् PUBLICATION OF THE PATENT OFFICE The Patent Office Journal 18/12/2015 65536 INTRODUCTION In view of the recent amendment made in the Patents Act, 1970 by the Patents (Amendment) Act, 2005 effective from 01st January 2005, the Official Journal of The Patent Office is required to be published under the Statute. This Journal is being published on weekly basis on every Friday covering the various proceedings on Patents as required according to the provision of Section 145 of the Patents Act 1970. All the enquiries on this Official Journal and other information as required by the public should be addressed to the Controller General of Patents, Designs & Trade Marks. Suggestions and comments are requested from all quarters so that the content can be enriched. ( Om Prakash Gupta ) CONTROLLER GENERAL OF PATENTS, DESIGNS & TRADE MARKS 18TH DECEMBER, 2015 The Patent Office Journal 18/12/2015 65537 CONTENTS SUBJECT PAGE NUMBER JURISDICTION : 65539 – 65540 SPECIAL NOTICE : 65541 – 65542 LIST OF HOLIDAYS FOR THE YEAR-2016 (ENGLISH) : 65543 LIST OF HOLIDAYS FOR THE YEAR-2016 (HINDI) : 65544 EARLY PUBLICATION (DELHI) : 65545 – 65564 EARLY PUBLICATION (MUMBAI) : 65565 – 65586 65587 – 65588 EARLY PUBLICATION (KOLKATA) PUBLICATION AFTER 18 MONTHS (DELHI) : 65589 – 66022 PUBLICATION AFTER 18 MONTHS (MUMBAI) : 66023 – 66082 PUBLICATION AFTER 18 MONTHS (CHENNAI) : 66083 – 66442 PUBLICATION AFTER 18 MONTHS (KOLKATA) : 66443 – 66902 PUBLICATION U/S.60 IN RESPECT OF APPLICATION FOR RESTORATION OF PATENTS ( KOLKATA) : 66903 PUBLICATION UNDER SECTION 43(2) IN RESPECT OF THE GRANT (DELHI) : 66904 – 66906 PUBLICATION UNDER SECTION 43(2) IN RESPECT OF THE GRANT (MUMBAI) : 66907 – 66909 PUBLICATION UNDER SECTION 43(2) IN RESPECT OF THE GRANT (KOLKATA) : 66910 – 66911 INTRODUCTION TO DESIGN PUBLICATION : 66912 THE DESIGNS ACT 2000 SECTION 30 DESIGN ASSIGNMENT : 66913 REGISTRATION OF DESIGNS : 66914 - 66973 The Patent Office Journal 18/12/2015 65538 THE PATENT OFFICE KOLKATA, 18/12/2015 Address of the Patent Offices/Jurisdictions The following are addresses of all the Patent Offices located at different places having their Territorial Jurisdiction on a Zonal basis as shown below:1 Office of the Controller General of Patents, Designs & Trade Marks, Boudhik Sampada Bhavan, Near Antop Hill Post Office,S.M.Road,Antop Hill, Mumbai – 400 037 4 Phone: (91)(22) 24123311, Fax : (91)(22) 24123322 E-mail: cgpdtm@nic.in The Patent Office, Government of India, Intellectual Property Rights Building, G.S.T. Road, Guindy, Chennai – 600 032. Phone: (91)(44) 2250 2081-84 Fax : (91)(44) 2250 2066 E-mail: chennai-patent@nic.in The States of Andhra Pradesh, Telangana, Karnataka, Kerala, Tamil Nadu and the Union Territories of Puducherry and Lakshadweep. 2 The Patent Office, Government of India, Boudhik Sampada Bhavan, Near Antop Hill Post Office,S.M.Road,Antop Hill, Mumbai – 400 037 Phone: (91)(22) 24137701 Fax: (91)(22) 24130387 E-mail: mumbai-patent@nic.in The States of Gujarat, Maharashtra, Madhya Pradesh, Goa and Chhattisgarh and the Union Territories of Daman and Diu & Dadra and Nagar Haveli 5 The Patent Office (Head Office), Government of India, Boudhik Sampada Bhavan, CP-2, Sector –V, Salt Lake City, Kolkata- 700 091 Phone: (91)(33) 2367 1943/44/45/46/87 Fax: (91)(33) 2367 1988 E-Mail: kolkata-patent@nic.in Rest of India 3 The Patent Office, Government of India, Boudhik Sampada Bhavan, Plot No. 32., Sector-14, Dwarka, New Delhi – 110075 Phone: (91)(11) 2808 1921 – 25 Fax: (91)(11) 2808 1920 & 2808 1940 E.mail: delhi-patent@nic.in The States of Haryana, Himachal Pradesh, Jammu and Kashmir, Punjab, Rajasthan, Uttar Pradesh, Uttaranchal, Delhi and the Union Territory of Chandigarh. Website: www.ipindia.nic.in www.patentoffice.nic.in All applications, notices, statements or other documents or any fees required by the Patents Act, 1970 and The Patents (Amendment) Act, 2005 or by the Patents (Amendment) Rules, 2006 will be received only at the appropriate offices of the Patent Office. Fees: The Fees may either be paid in cash or may be sent by Bank Draft or Cheques payable to the Controller of Patents drawn on a scheduled Bank at the place where the appropriate office is situated. The Patent Office Journal 18/12/2015 65539 पेटेंट कार्ाालर् कोलकाता, दिर्ांक 18/12/2015 •कार्ाालर्ों के क्षेत्राधिकार के पते ववभिन्र् जर्हों पर स्थित पेटेंट कार्ाालर् के पते आंचभलक आिार पर िभशात उर्के प्रािे भशक अधिकार क्षेत्र के 1 कार्ाालर् : महानर्र्ंत्रक, एकथव, अभिकल्प साि र्ीचे दिए र्ए है :4 पेटेंट कार्ाालर्, िारत सरकार तिा व्र्ापार धचहर्, इंटेलेक्चुअल प्रॉपटी राइट्स बबस्ल्डंर्, इंडस्थिर्ल इथटे ट एंटोप दहल डाकघर के समीप, एसआईडीसीओ आरएमडी र्ोडाउर् एररर्ा एस. एम. रोड, एंटोप दहल, मम् ु बई- 400 037, िारत, फोर्: एडजसेन्ट टु ईर्ल फ्लाथक, जी. एस. टी. रोड, र्ार्न्डी चेन्र्ई - 600 032. (91) (22) 24123311 फ़ैक्स: (91) (22) 24123322 फोर्: (91)(44) 2250 2081-84 ई. मेल: cgpdtm@nic.in फ़ैक्स: (91)(44) 2250-2066 ई. मेल: chennai-patent@nic.in 2 तिा पुडुचेरी राज्र् क्षेत्र एवं संघ शाभसत क्षेत्र, लक्षिीप पेटेंट कार्ाालर्, िारत सरकार 5 पेटेंट कार्ाालर्, िारत सरकार बौविक संपिा िवर्, कोलकाता, (प्रिार् कार्ाालर्) एंटोप दहल डाकघर के समीप, बौविक संपिा िवर्, एस. एम. रोड, एंटोप दहल, मम् ु बई- 400 037, सीपी-2, सेक्टर- V, साल्ट लेक भसटी, फ़ैक्स: (91) (22) 24130387 फोर्: ई. मेल: Mumbai-patent@nic.in फ़ैक्स:/Fax: (91)(33) 2367 1988 फोर्: कोलकाता-700 091, िारत. (91) (22) 24137701 •र्ुजरात, महाराष्ट्ि, मध्र् प्रिे श, र्ोवा तिा छत्तीसर्ढ़ राज्र् क्षेत्र एवं संघ शाभसत क्षेत्र, िमर् तिा िीव, िािर और र्र्र हवेली (91)(33) 2367 1943/44/45/46/87 ई. मेल: kolkata-patent@nic.in . 3 आन्र प्रिे श, तेलंर्ार्ा, कर्ााटक, केरल, तभमलर्ाडु िारत का अवशेष क्षेत्र पेटेंट कार्ाालर्, िारत सरकार बौविक संपिा िवर्, प्लॉट सं. 32, सेक्टर- 14, द्वारका, र्ई दिल्ली- 110 075. फोर्: (91)(11) 2808 1921-25 फ़ैक्स: (91)(11) 2808 1920, 2808 1940 ई. मेल: delhi-patent@nic.in हररर्ाणा, दहमाचल प्रिे श, जम्मू तिा कश्मीर, पंजाब,राजथिार्, उत्तर प्रिे श, दिल्ली तिा उत्तरांचल राज्र् क्षेत्रों, एवं संघ शाभसत क्षेत्र चंडीर्ढ़ वेबसाइट: http://www.ipindia.nic.in www.patentoffice.nic.in पेटेंट अधिनर्र्म, 1970 तिा पेटेंट (संशोिर्) अधिनर्र्म, 2005 अिवा पेटेंट (संशोिर्) नर्र्म, 2006 द्वारा वांनछत सिी आवेिर्, सूचर्ाए, वववरण र्ा अन्र् िथतावेज़ र्ा कोई शुल्क पेटेंट कार्ाालर् के केवल उपर्ुक्त कार्ाालर् में थवीकृत होंर्े। शल् ु क: शल् ु क र्ा तो र्र्ि रूप में र्ा Controller of Patents के र्ाम में िे र् बैंक ड्राफ्ट र्ा चेक के द्वारा िेजी जा सकती है जो उसी थिार् के ककसी अर्ुसूधचत बैंक में प्रित्त हो जहााँ उपर्ुक्त कार्ाालर् स्थित है । The Patent Office Journal 18/12/2015 65540 SPECIAL NOTICE 18 Months publication as required under Section 11A of the Patents Act, 1970 as amended by the Patents (Amendment) Act, 2005. Notice is hereby given that any person at any time before the grant of Patent may give representation by way of opposition to the Controller of Patents at appropriate office on the ground and in a manner specified under section 25(1) of the Patents (Amendment) Act, 2005 read with Rule 55 of the Patents (Amendment) Rules, 2006. Notice is also given that if any interested person requests for copies of the complete specification, drawing and abstract of any application already published, the photocopy of the same can be supplied by the Patent Office as per the jurisdiction on payment of prescribed fees of Rs.8/- per page. If any further details are required to be obtained, the same can be provided by the respective Patent Offices on request. (Om Prakash Gupta) CONTROLLER GENERAL OF PATENTS, DESIGNS & TRADE MARKS The Patent Office Journal 18/12/2015 65541 SPECIAL NOTICE Under the new provision of the Patents Act, 1970 as amended by the Patents (Amendment) Act, 2005 and Rules there under, Publication of the matter relating to Patents in the Official Gazette of India Part III, Section 2 has been discontinued and instead The Official Journal of the Patent Office is being published containing all the activities of The Patent Office such as publication of all the patent applications after 18 th months , grant of patents & all other information in respect of the proceedings as required under the provisions of the Patents (Amendment) Act, 2005 and Rules thereunder on weekly basis on every Friday. The Journal is uploaded in the website every Friday. So Paper form and CD-ROM form of the Journal are discontinued from 01/01/2009. SPECIAL NOTICE Every effort is being taken to publish all the patent applications under section 11(A) of the Patents Act. However, if duplication of publication of any application is found, then earlier date of publication will be taken for the purpose of provisional protection for applicant and Patent Office will grant Patent not before six months from the date of second publication, provided that there is there is no third party representation. The Patent Office Journal 18/12/2015 65542 The Patent Office Journal 18/12/2015 65543 The Patent Office Journal 18/12/2015 65544 Early Publication: The following patent applications have been published under section 11A (2) of The Patents (Amendment) Act 2005 and rule 24A of The Patents (Amendment) Rules, 2006. Any person may file representation by way of opposition to the Controller of Patents at the appropriate office against the grant of the patent in the prescribed manner under section 25(1) of the Patents (Amendment) Act 2005 read with the rule 55 of The Patents (Amendment) Rules, 2006: (12) PATENT APPLICATION PUBLICATION (21) Application No.10903/DELNP/2015 A (19) INDIA (22) Date of filing of Application :28/11/2015 (43) Publication Date : 18/12/2015 (54) Title of the invention : VERTICAL AXIS WATER/WIND TURBINE MOTOR USING FLIGHT FEATHER OPENING/CLOSING WING SYSTEM (51) International classification :F03D3/06,F03B1/02 (71)Name of Applicant : (31) Priority Document No :2013110457 1)TAMATSU Yoshiji (32) Priority Date :25/05/2013 Address of Applicant :Room16Toyota Apartment1656 5Aza (33) Name of priority country :Japan OrokuNaha shi Okinawa 9010152 Japan (86) International Application No :PCT/JP2014/063758 (72)Name of Inventor : Filing Date :24/05/2014 1)TAMATSU Yoshiji (87) International Publication No :WO 2014/192664 (61) Patent of Addition to Application :NA Number :NA Filing Date (62) Divisional to Application Number :NA Filing Date :NA (57) Abstract : In order to enhance the startability of a vertical axis combined water/wind turbine motor composed of a drag type and a lift type starting performance is improved by releasing convex surface resistance produced by a drag type blade going against a fluid and increasing rotation torque by reduction in resistance during rotation at high speed higher than or equal to the speed of the fluid which is the characteristic of a lift type blade all wing surfaces of the drag type are naturally brought into an open state by the lift type blade rotation speed to thereby maintain lift type high speed rotation efficiency performance by reducing resistance at the center of the vertical axis combined water/wind turbine motor in a wide range of fluid speed area and danger when the fluid speed increases is avoided by producing a fully open state by rolling in flight feathers of a drag type wing surface configuration by decreasing the entire volume by folding wing surfaces to the rotation shaft side or by decreasing the entire structure and reducing resistance by eliminating passive surfaces by decreasing the wing area by drawing flight feathers of the wing surface toward the rotation center. No. of Pages : 47 No. of Claims : 10 The Patent Office Journal 18/12/2015 65545 (12) PATENT APPLICATION PUBLICATION (21) Application No.3648/DEL/2015 A (19) INDIA (22) Date of filing of Application :09/11/2015 (43) Publication Date : 18/12/2015 (54) Title of the invention : SITABY: THE POSTURE PROCTOR (51) International classification (31) Priority Document No (32) Priority Date (33) Name of priority country (86) International Application No Filing Date (87) International Publication No (61) Patent of Addition to Application Number Filing Date (62) Divisional to Application Number Filing Date (71)Name of Applicant : 1)DR.LOVI RAJ GUPTA :G06F7/04 Address of Applicant :JALANDHAR DELHI G.T. ROAD :NA (NH-1), PHAGWARA, PUNJAB, INDIA PIN-144411 Punjab :NA India :NA 2)MS.Y.PRASANTHI :NA 3)MR.M.SATISH REDDY :NA 4)MR.KUNAL PANCHAL : NA 5)MR.PANKAJ P SHINDE :NA (72)Name of Inventor : :NA 1)DR.LOVI RAJ GUPTA :NA 2)MS.Y.PRASANTHI :NA 3)MR.M.SATISH REDDY 4)MR.KUNAL PANCHAL 5)MR.PANKAJ P SHINDE (57) Abstract : Sitting is bliss to the human; it is posture which is most widely used by the people for work, travel, dinning, and entertainment. Almost for every action which does not primarily require locomotion and standing requires sitting. It comes with the curse as well, if the posture of sitting is erroneous and also if the length of sitting period gets extended which in todays context is happening gladly owing the work hours and need for working while sitting. These posture nuisances have raised the clinical disorders of back and spine largely. Each one Of us in the evening is sick of sitting wrongly or of sitting that extra hour. The need is to have a stance guardian, which in turn looks to.the posture in real time and alerts for correcting the posture. Also if one is sitting for long, the alert for standing and moving a couple of steps for apt blood circulation are there. The aforesaid menaces has resulted in fatal or near fata back and spine injuries and the clinician are unaware about the habitual stance and the wrongdoings of the patients.during sitting. SitAby is the solution to this all, a device mounted on the seat, be it a working or dinning chair, a car or an airplane seat, a perfect Internet of Things (IoT) device which is wireless for the ease of usage, intelligent, connected and has a strong and uniquely designed back end. The data is captured in real time from innovating designed data point arranged in a matrix, this is then transmitted to the data cloud where the archival and analysis is done and on the basis of the current postures, an alert, if needed, is sent to the user for stance correction. This data is also archived for future referencing, crafting exercises and procedures for better sitting. The data archival can be seen by the clinician and the physiotherapists for pinpointed diagnosis and redressal. SitAby is going to be a game changer in stance correction, ailment eradication and habit breaking of erroneous sitting, thus making society healthier and happier. No. of Pages : 9 No. of Claims : 12 The Patent Office Journal 18/12/2015 65546 (12) PATENT APPLICATION PUBLICATION (21) Application No.3851/DEL/2015 A (19) INDIA (22) Date of filing of Application :25/11/2015 (43) Publication Date : 18/12/2015 (54) Title of the invention : SOLAR CHARGE MANAGING SYSTEM AND METHOD THEREOF (51) International classification :H02J7/35 (71)Name of Applicant : (31) Priority Document No :NA 1)ASHOK KUMAR GUPTA (32) Priority Date :NA Address of Applicant :D-403, Sahara Plaza, Vikas Khand-1, (33) Name of priority country :NA Gomti Nagar, Lucknow-226010, Uttar Pradesh, India. Uttar (86) International Application No :NA Pradesh India Filing Date :NA 2)ASOK SEN (87) International Publication No : NA (72)Name of Inventor : (61) Patent of Addition to Application Number :NA 1)ASHOK KUMAR GUPTA Filing Date :NA 2)ASOK SEN (62) Divisional to Application Number :NA Filing Date :NA (57) Abstract : Exemplary embodiments of the present disclosure are directed towards solar charge managing system and method thereof. The system includes a charge controller unit electrically connected to a plurality of solar panels configured to control a charging action of two or more batteries comprising smart control logic and an inverter electrically connected to the batteries configured to receive a photovoltaic input and provide an alternating current output. No. of Pages : 15 No. of Claims : 10 The Patent Office Journal 18/12/2015 65547 (12) PATENT APPLICATION PUBLICATION (21) Application No.3914/DEL/2015 A (19) INDIA (22) Date of filing of Application :01/12/2015 (43) Publication Date : 18/12/2015 (54) Title of the invention : ARCHITECTURE AND DESIGN OF A NOVEL TOOL FOR INTELLIGENT GENERAL PURPOSE QUESTION ANSWERING SYSTEM (51) International classification :G06F17/50 (71)Name of Applicant : (31) Priority Document No :NA 1)POONAM TANWAR (32) Priority Date :NA Address of Applicant :FLAT NO. 904, TOWER-AIGBURTH (33) Name of priority country :NA (BT-12),OMAXE HEIGHT SOCIETY, SECTOR 86, (86) International Application No :NA FARIDABAD, HARYANA-121002, INDIA Haryana India Filing Date :NA (72)Name of Inventor : (87) International Publication No : NA 1)MS. POONAM TANWAR (61) Patent of Addition to Application Number :NA 2)DR.T. V. PRASAD Filing Date :NA 3)DR.KAMLESH DUTTA (62) Divisional to Application Number :NA Filing Date :NA (57) Abstract : Question answering systems (QAS) requires bonding/direct connectivity between Artificial Intelligence (AI), Knowledge Representation (KR), Information Retrieval (IR), Information Extraction (IE), Reasoning, etc. Now-a-days, QAS is applied to every walk of life like designing expert systems, semantic web, robotics, auto answering machine, etc. Research in the area of QAS provides an interface to the user for IR and IE. The objective of this QAS system is to provide an interactive environment with the real user. User can select the question from the pool of questionnaire and put up to.QAS on real-time basis also. QAS is an intelligent system that allows the user to ask simple as well as complex questions and gives the result not as link or paragraph but returns the exact answer without delay. System aimed to design the general QAS by using the Semantic Network and Script technique to acquire the knowledge and Natural Language Processing (NLP) to process the incoming knowledge. The idea was to improve the system performance and the retrieval efficiency. The implemented system was tested using 100 stored questions and 250 newly entered questions applied on different input collected from various sources like newspaper, internet and book, etc. The result of the QAS shows that the use of Semantic Network, Script and NLP could greatly improve the system performance. No. of Pages : 17 No. of Claims : 4 The Patent Office Journal 18/12/2015 65548 (12) PATENT APPLICATION PUBLICATION (21) Application No.4031/DEL/2015 A (19) INDIA (22) Date of filing of Application :10/12/2015 (43) Publication Date : 18/12/2015 (54) Title of the invention : DISPENSING WITH FUEL FILTER IN 4-WHEELERS (51) International classification :F02M37/04 (71)Name of Applicant : (31) Priority Document No :NA 1)ATAM TEJ ARORA (32) Priority Date :NA Address of Applicant :# 2390, BSNL HSG, SOCITY, (33) Name of priority country :NA CHANDIGARH (UT), PIN-160047 Chandigarh India (86) International Application No :NA (72)Name of Inventor : Filing Date :NA 1)ATAM TEJ ARORA (87) International Publication No : NA (61) Patent of Addition to Application Number :NA Filing Date :NA (62) Divisional to Application Number :NA Filing Date :NA (57) Abstract : ALL 4/MULTI-WHEELER VEHICLES RUNNING ON PETROl/DIESEL INVARIABLY MAKE USE OF FUEL FILTERS IN THE FUEL SUPPLY LINES LEADING TO ENGINE TO AVOID CONTAMINATION OF THE SAME SO AS NOT TO BLOCK ITS PASSAGE THROUGH CABURETTOR OR INJECTOR. THIS WHOLE PROCESS OF FILTERING THE FUEL CAN BE MADE SIMPLE AND ALSO VERY ECONOMICAL BY MAKING USE OF A NATURAL DECANTATION PROCESS CREATING AUTOMATIC FUEL FILTRATION WHICH SHALL NOT NEED ANY PHYSICAL FUEL FILTER IN THE ROUTE OF THE FUEL TO THE ENGINE. THE GIVEN SPECIFICATION DESCRIBES HOW THIS PROCESS OF DECANTATION OF FUEL CAM BE USED PRACTICALLY TO DISPENSE WITH THE FUEL FILTERS ALTOGETHER, WHAT TO TALK OF REPLACING IT DURING ANY SERVICING/REPAIR OF THE AUTOMOBILE. THOUGH FILTRATION/DECANTATION PROCESSES ARE SEEMINGLY OBVIOUS, THEY HAVE BEEN TYPICALLY DEPLOYED IN THIS INVENTION DISPENSING WITH THE FUEL FILTER. No. of Pages : 8 No. of Claims : 5 The Patent Office Journal 18/12/2015 65549 (12) PATENT APPLICATION PUBLICATION (21) Application No.3987/DEL/2015 A (19) INDIA (22) Date of filing of Application :08/12/2015 (43) Publication Date : 18/12/2015 (54) Title of the invention : MAGLEV TYRE (51) International classification :B61D15/12 (71)Name of Applicant : (31) Priority Document No :NA 1)VATAN CHAUDHARY (32) Priority Date :NA Address of Applicant :KHURJA, NEW SHIV PURI, (33) Name of priority country :NA STREET-10, (UP) BULANDSHAR-203131 Uttar Pradesh India (86) International Application No :NA (72)Name of Inventor : Filing Date :NA 1)VATAN CHAUDHARY (87) International Publication No : NA (61) Patent of Addition to Application Number :NA Filing Date :NA (62) Divisional to Application Number :NA Filing Date :NA (57) Abstract : Maglev tyre a type of mechanism which have ability to move any movable object it is independent in its own. It will not dependent on any fuel any external force like engine, gas or any polluted energy that harm to nature itll work on a clean energy like electricity. It is fully safe to environment there is no harmfull gas will released like (Carbon dioxide .... e.t.c) there will no vibration in movent like engine vibration therell be no sound in mechanism. If we talk about friction there is too much friction in engine and parts are damaged after some time in maglev tyre there is only air friction and that is minimum and itll also affect on our speed and there is a also no need for super charger, turbo charger or any expensive fuel and gases like nitrox ther is only need for electricity. This is the fully advanced technology that is based on simple mechanism in this technology there is no need for gears,fuels and clutch e.t.c. It is very simple to drive we can drive it as fast as we want there is no pollution. No. of Pages : 28 No. of Claims : 13 The Patent Office Journal 18/12/2015 65550 (12) PATENT APPLICATION PUBLICATION (21) Application No.3427/DEL/2015 A (19) INDIA (22) Date of filing of Application :23/10/2015 (43) Publication Date : 18/12/2015 (54) Title of the invention : FUEL CAP WARNING INDICATOR (51) International classification :B60K15/04, (71)Name of Applicant : (31) Priority Document No :NA 1)JNS INSTRUMENTS LIMITED (32) Priority Date :NA Address of Applicant :PLOT NO.-4, SECTOR-3, IMT (33) Name of priority country :NA MANESAR, GURGAON Haryana India (86) International Application No :NA (72)Name of Inventor : Filing Date :NA 1)RAJESH SINGH (87) International Publication No : NA 2)ARUN KUMAR SHARMA (61) Patent of Addition to Application Number :NA 3)ISHWAR SINGH Filing Date :NA (62) Divisional to Application Number :NA Filing Date :NA (57) Abstract : The present subject matter relates to a fuel cap warning indicator for automotive vehicles which mainly includes a fuel tank to receive fuel via a fuel inlet, a thread ended cylindrical tube inserted into the fuel inlet, a fuel cap screwed on the thread ended cylindrical tube, and a fuel tank door pivotally connected to an extended portion of the thread ended cylindrical tube to cover the fuel cap and the fuel tank. The arrangement for fuel cap warning indicator is also provided with a push switch compartment positioned beside the fuel inlet, wherein the push switch compartment includes a push switch provided within the push Switch compartment to get pushed downward by a lever via an integrated push pad protruding through a vertical gap in a door of the push switch compartment. The fuel cap warning indicator provided in a vehicle information display instrument is actuated by downward push of the push pad on unscrewing of the fuel cap. The present subject matter discloses a reliable, compact, less costly and a customers friendly fuel cap warning indicator that indicates unclosed or partially closed fuel cap for automotive vehicles. REFER : FIG. 3 No. of Pages : 18 No. of Claims : 10 The Patent Office Journal 18/12/2015 65551 (12) PATENT APPLICATION PUBLICATION (21) Application No.3918/DEL/2015 A (19) INDIA (22) Date of filing of Application :01/12/2015 (43) Publication Date : 18/12/2015 (54) Title of the invention : A SYSTEM AND METHOD FOR FACILITATING INTERPLANETARY DATA COMMUNICATION BETWEEN AT LEAST TWO SPATIAL ENTITIES (51) International classification :H04L29/08, (71)Name of Applicant : H04L12/24 1)HCL Technologies Limited :NA Address of Applicant :B-39, Sector 1, Noida 201301, Uttar :NA Pradesh, India Uttar Pradesh India :NA (72)Name of Inventor : :NA 1)SUNDARARAJ, Jayaramakrishnan :NA 2)DEY, Sourav : NA :NA :NA :NA :NA (31) Priority Document No (32) Priority Date (33) Name of priority country (86) International Application No Filing Date (87) International Publication No (61) Patent of Addition to Application Number Filing Date (62) Divisional to Application Number Filing Date (57) Abstract : Disclosed is a method for facilitating interplanetary data communication between at least two spatial entities is disclosed. In order to facilitate the interplanetary data communication, initially, data may be received from a plurality of orbital satellites orbiting around a first spatial entity. Upon receiving the data, at least one communication protocol may be determined. Subsequently, the data may be split into a plurality of data sub streams.Upon splitting the data, the plurality of data sub streams may be transmitted to one or more LEO orbital satellites. Subsequently, each LEO orbital satellite may be enabled to relay the plurality of data sub streams to a Multipath Forward Server (MPFS) and to CMDPS. Upon relaying the plurality of data sub streams, each data sub stream may be combined to derive combined data at the CMDPS. The combined data may then forward to a research center for further analysis. No. of Pages : 23 No. of Claims : 12 The Patent Office Journal 18/12/2015 65552 (12) PATENT APPLICATION PUBLICATION (21) Application No.3868/DEL/2015 A (19) INDIA (22) Date of filing of Application :26/11/2015 (43) Publication Date : 18/12/2015 (54) Title of the invention : A SYSTEM AND METHOD FOR FACILITATING FUEL CONSERVATION IN A VEHICLE (51) International classification :G05B13/02 (71)Name of Applicant : (31) Priority Document No :NA 1)HCL Technologies limited (32) Priority Date :NA Address of Applicant :B-39, Sector 1, Noida 201 301, Uttar (33) Name of priority country :NA Pradesh, India Uttar Pradesh India (86) International Application No :NA (72)Name of Inventor : Filing Date :NA 1)DHALIWAL, Jasbir Singh (87) International Publication No : NA (61) Patent of Addition to Application Number :NA Filing Date :NA (62) Divisional to Application Number :NA Filing Date :NA (57) Abstract : Disclosed is a system and method for facilitating fuel conservation in a vehicle. A registration module enables a plurality of vehicles to register with the system. Each vehicle being registered intends to physically connect with another vehicle. A data capturing module captures a cost to be incurred by each vehicle for connecting with the other vehicle as-well-as individual preferences associated with each vehicle. The display module displays, on a user device associated with a requesting vehicle, a list of set of vehicles along with the cost and the individual preferences. The selecting module selects a preferred vehicle, of the one or more vehicles, based upon the individual preferences and the cost. The preferred vehicle is adapted to physically connect with the requesting vehicle and share at least one of music and air-conditioning (AC) with the requesting vehicle based upon the music genre and the preferable temperature respectively. No. of Pages : 24 No. of Claims : 11 The Patent Office Journal 18/12/2015 65553 (12) PATENT APPLICATION PUBLICATION (21) Application No.3827/DEL/2015 A (19) INDIA (22) Date of filing of Application :24/11/2015 (43) Publication Date : 18/12/2015 (54) Title of the invention : ANALYSIS OF LIVER CANCER IN THE LIGHT OF RELIABILITY ESTIMATION WEIGHTED MAJORITY ALGORITHM & CONCEPT LEARNING THEORY (51) International classification :G06F19/00, (71)Name of Applicant : (31) Priority Document No :NA 1)DR.PRASUN CHAKRABARTI (32) Priority Date :NA Address of Applicant :SIR PADAMPAT SINGHANIA (33) Name of priority country :NA UNIVERSITY, UDAIPUR-313601 Rajasthan India (86) International Application No :NA 2)MR. MANISH TIWARI Filing Date :NA 3)DR.TULIKA CHAKRABARTI (87) International Publication No : NA (72)Name of Inventor : (61) Patent of Addition to Application Number :NA 1)DR.PRASUN CHAKRABARTI Filing Date :NA 2)MR.MANISH TIWARI (62) Divisional to Application Number :NA 3)DR.TULIKA CHAKRABARTI Filing Date :NA (57) Abstract : The reliability and mean time to failure of liver cancer testing system can be realized in the light of parallel system configuration. The factors leading to liver. cancer can be analyzed on the basis of Weighted Majority Algorithm. The effect of alcohol consumption leading to liver cancer can be sensed using the concept learning approach. No. of Pages : 7 No. of Claims : 3 The Patent Office Journal 18/12/2015 65554 (12) PATENT APPLICATION PUBLICATION (21) Application No.3932/DEL/2015 A (19) INDIA (22) Date of filing of Application :02/12/2015 (43) Publication Date : 18/12/2015 (54) Title of the invention : SMART GLASS CONTROL (51) International classification :A47L1/02 (71)Name of Applicant : (31) Priority Document No :NA 1)HCL Technologies Limited (32) Priority Date :NA Address of Applicant :B-39, Sector 1, Noida 201301, Uttar (33) Name of priority country :NA Pradesh, India Uttar Pradesh India (86) International Application No :NA (72)Name of Inventor : Filing Date :NA 1)WILSHER, Michael John (87) International Publication No : NA 2)LEWIS, Jeremy Brook (61) Patent of Addition to Application Number :NA Filing Date :NA (62) Divisional to Application Number :NA Filing Date :NA (57) Abstract : Disclosed is a method and system for controlling the opacity of smart glass in a vehicle. The method comprising, obtaining input data, wherein the input data comprises vehicle data, environment data and driver data and determining a state of the vehicle and a state of the driver of the vehicle based on the input data and predefined conditions. The method further comprising, generating a command signal for enabling a change in the opacity of at least a section of smart glass in the vehicle based on the state of the vehicle and the state the driver of the vehicle and changing selectively the opacity of at least a section of the smart glass using a control unit coupled with the processor. No. of Pages : 20 No. of Claims : 19 The Patent Office Journal 18/12/2015 65555 (12) PATENT APPLICATION PUBLICATION (21) Application No.10722/DELNP/2015 A (19) INDIA (22) Date of filing of Application :23/11/2015 (43) Publication Date : 18/12/2015 (54) Title of the invention : HEAT FLOW SENSOR (51) International classification :G01K1/14,F24J2/40,F24J2/46 (71)Name of Applicant : (31) Priority Document No :2013/0363 1)COCKERILL MAINTENANCE & INGENIERIE S.A. (32) Priority Date :23/05/2013 Address of Applicant :Avenue Greiner 1 B 4100 Seraing (33) Name of priority country :Belgium Belgium (86) International Application No :PCT/EP2014/056525 (72)Name of Inventor : Filing Date :01/04/2014 1)CARA Fabien (87) International Publication No :WO 2014/187598 2)RUDAZ Daniel (61) Patent of Addition to 3)DETHIER Alfred :NA Application Number :NA Filing Date (62) Divisional to Application :NA Number :NA Filing Date (57) Abstract : The present invention relates to a heat exchanger comprising a plurality of exchange tubes (1) mounted joined longitudinally in such a way as to create a front surface portion (4) creating an obstacle to an incident heat flow and at least one heat flow sensor (5) disposed in a support (12) located between two adjacent exchange tubes (1) characterised in that the support (12) of the heat flow sensor (5) is brazed to at least one of the two tubes (1) and is flattened on the side that is to be disposed at the front (4) with reference to the incident heat flow in such a way as to be able to be inserted between the two adjacent tubes (1) at the location of said local deformations (11). No. of Pages : 14 No. of Claims : 5 The Patent Office Journal 18/12/2015 65556 (12) PATENT APPLICATION PUBLICATION (21) Application No.10933/DELNP/2015 A (19) INDIA (22) Date of filing of Application :30/11/2015 (43) Publication Date : 18/12/2015 (54) Title of the invention : WORK VEHICLE CAB AND METHOD FOR MANUFACTURING SAME (51) International classification :B62D25/06,B60R21/13,E02F9/16 (71)Name of Applicant : (31) Priority Document No :NA 1)KOMATSU LTD. (32) Priority Date :NA Address of Applicant :2 3 6 Akasaka Minato ku Tokyo (33) Name of priority country :NA 1078414 Japan (86) International Application (72)Name of Inventor : :PCT/JP2015/069050 No 1)WADA Takeshi :01/07/2015 Filing Date 2)WATANABE Kentaro (87) International Publication :WO 2015/174552 No (61) Patent of Addition to :NA Application Number :NA Filing Date (62) Divisional to Application :NA Number :NA Filing Date (57) Abstract : A work vehicle cab (6) is provided with a standard frame (21) and a reinforced beam (22). The standard frame has a main frame (23) and a roof plate (44) and the main frame includes an upper left frame (34) and an upper right frame (37) which extend along the front/rear direction and are separated from each other in the left/right direction. The roof plate is provided on the top surface of the main frame and is attached to the upper left frame and the upper right frame. The reinforced beam is disposed over the roof plate is attached to the upper left frame and the upper right frame and has an upwardly protruding shape. No. of Pages : 31 No. of Claims : 17 The Patent Office Journal 18/12/2015 65557 (12) PATENT APPLICATION PUBLICATION (21) Application No.4012/DEL/2015 A (19) INDIA (22) Date of filing of Application :09/12/2015 (43) Publication Date : 18/12/2015 (54) Title of the invention : A SYSTEM AND METHOD FOR DYNAMICALLY MODIFYING SETTINGS OF A COMMUNICATION DEVICE (51) International classification :H04B1/38, (71)Name of Applicant : (31) Priority Document No :NA 1)HCL Technologies Limited (32) Priority Date :NA Address of Applicant :B-39, Sector 1, Noida 201 301, Uttar (33) Name of priority country :NA Pradesh, India Uttar Pradesh India (86) International Application No :NA (72)Name of Inventor : Filing Date :NA 1)SADASIVAM, SivaSakthivel (87) International Publication No : NA 2)CHAUDHARY, Vishal (61) Patent of Addition to Application Number :NA Filing Date :NA (62) Divisional to Application Number :NA Filing Date :NA (57) Abstract : Disclosed is a system for dynamically modifying settings of a communication device based on an activity state of a user of the communication device. A data capturing module captures values corresponding to a plurality of physiological parameters associated to a plurality of activity states of a user. The values may be captured by using one or more wearable devices worn by a user. A configuration module enables the user to configure one or more rules and one or more events, to be triggered, corresponding to each of the one or more rules for modifying settings of the communication device. An activity state determining module determines an activity state, in real-time, from the plurality of activity states. An event triggering module triggers an event, of the one or more events, based on a rule configured corresponding to the activity state in order to dynamically modify the settings of the communication device. No. of Pages : 23 No. of Claims : 12 The Patent Office Journal 18/12/2015 65558 (12) PATENT APPLICATION PUBLICATION (21) Application No.3795/DEL/2015 A (19) INDIA (22) Date of filing of Application :20/11/2015 (43) Publication Date : 18/12/2015 (54) Title of the invention : SOAPEN (51) International classification (31) Priority Document No (32) Priority Date (33) Name of priority country (86) International Application No Filing Date (87) International Publication No (61) Patent of Addition to Application Number Filing Date (62) Divisional to Application Number Filing Date (71)Name of Applicant : :B05C17/06, 1)ANAND AMANAT :NA Address of Applicant :N-176, PANCHSHEEL PARK,1ST :NA FLOOR,NEW DELHI-110017 (INDIA) Delhi India :NA 2)ISSAR SHUBHAM :NA 3)BYUN JUNHO :NA 4)AGRAWAL YOGITA : NA (72)Name of Inventor : :NA 1)ANAND AMANAT :NA 2)ISSAR SHUBHAM :NA 3)BYUN JUNHO :NA 4)AGRAWAL YOGITA (57) Abstract : SoaPen is a soap crayon which is markable on skin, and can be used to draw on the childs hand. The drawing turns into a soapy lather when the child wets and rubs their hands. Soapen has a triangular shape, so that the soap cartridge retains a drawing edge at all times. Further, the triangular form allows for the outer casing to be flat packable. This casing will be available in either polyethylene or cardboard. Once the casing is assembled, a sticker bearing illustrated user instructions for universal comprehensibility seals the casing in place. The casing is to be reused,. and the soap cartridges can be refilled over time. A pencil (or an object of similar dimension,) can be inserted through the hole in the bottom of the cartridge holder, to remove the residual stub of soap, prior to inserting a new cartridge. No. of Pages : 11 No. of Claims : 8 The Patent Office Journal 18/12/2015 65559 (12) PATENT APPLICATION PUBLICATION (21) Application No.3897/DEL/2015 A (19) INDIA (22) Date of filing of Application :30/11/2015 (43) Publication Date : 18/12/2015 (54) Title of the invention : A NOVEL NINE-PHASE SELF EXCITED INDUCTION GENERATOR (51) International classification :H02K19/28, (71)Name of Applicant : (31) Priority Document No :NA 1)DR.MOHD. FAISAL KHAN (32) Priority Date :NA Address of Applicant :ALIGARH MUSLIM UNIVERSITY, (33) Name of priority country :NA ALIGARH, U.P.-202002, INDIA. Uttar Pradesh India (86) International Application No :NA 2)DR.MOHD.RIZWAN KHAN Filing Date :NA (72)Name of Inventor : (87) International Publication No : NA 1)DR.MOHD. FAISAL KHAN (61) Patent of Addition to Application Number :NA 2)DR.MOHD. RIZWAN KHAN Filing Date :NA (62) Divisional to Application Number :NA Filing Date :NA (57) Abstract : This patent application is filed to report a novel nine-phase self excited induction generator (SEIG). Conventional variants of SEIGs existing in literature pertain to single phase, three phase and six phase. In this application a NINE-PHASE SEIG (NP-SEIG) prototype is developed. The performance of newly developed SEIG model is demonstrated for unity as well as inductive loads of 0.8 lagging power factor. The step by step mathematical model of NP-SEIG is developed by advancing the concepts of three and six phase models. In order to establish the veracity of proposed model beyond any doubt the computer simulation study is carried out by implementing the developed mathematical model on Matlab/Simulink concurrent to the experimental analysis on implemented prototype. A multi phase induction machine with open stator windings is utilized for experimental implementation of the invention. No. of Pages : 35 No. of Claims : 10 The Patent Office Journal 18/12/2015 65560 (12) PATENT APPLICATION PUBLICATION (21) Application No.4013/DEL/2015 A (19) INDIA (22) Date of filing of Application :09/12/2015 (43) Publication Date : 18/12/2015 (54) Title of the invention : SYSTEM AND METHOD FOR TESTING INTERNET OF THINGS NETWORK (51) International classification :H04L12/26 (71)Name of Applicant : (31) Priority Document No :NA 1)HCL Technologies Limited (32) Priority Date :NA Address of Applicant :B-39, Sector 1, Noida 201 301, Uttar (33) Name of priority country :NA Pradesh, India Uttar Pradesh India (86) International Application No :NA (72)Name of Inventor : Filing Date :NA 1)JAIN, Parveen Kumar (87) International Publication No : NA 2)RANGI, Vivek (61) Patent of Addition to Application Number :NA 3)MISHRA, Abhay Filing Date :NA 4)DHANYAMRAJU, S U M Prasad (62) Divisional to Application Number :NA Filing Date :NA (57) Abstract : The present disclosure relates to system(s) and method(s) for generating test data for testing an Internet of Things (IOT) network. Initially, the system is configured for receiving sensor ontology data of at least one sensor to be simulated for testing an Internet of things (IOT) network. The sensor ontology data may include a range of operation of the sensor and a frequency of operation of the sensor. Further, the system is configured for accepting a set of test scenarios for testing the IOT network. Furthermore, the system is configured for generating master test data for testing the IOT network, wherein the master test data comprises a set of test packages corresponding to the set of test scenario and the sensor ontology data. No. of Pages : 21 No. of Claims : 9 The Patent Office Journal 18/12/2015 65561 (12) PATENT APPLICATION PUBLICATION (21) Application No.3810/DEL/2015 A (19) INDIA (22) Date of filing of Application :20/11/2015 (43) Publication Date : 18/12/2015 (54) Title of the invention : BIOMETRIC CARD (B-CARD) (51) International classification (31) Priority Document No (32) Priority Date (33) Name of priority country (86) International Application No Filing Date (87) International Publication No (61) Patent of Addition to Application Number Filing Date (62) Divisional to Application Number Filing Date (71)Name of Applicant : :G06K19/06 1)Dr. Shashi Bhushan :NA Address of Applicant :Professor, Department of Information & :NA Technology, Chandigarh Engineering College, Landran, Mohali:NA 140307, Punjab Punjab India :NA 2)Jaspreet Singh :NA 3)Ishant Raju : NA 4)Nishant Raju :NA (72)Name of Inventor : :NA 1)Dr. Shashi Bhushan :NA 2)Jaspreet Singh :NA 3)Ishant Raju 4)Nishant Raju (57) Abstract : The present invention relates to the hardware consists of a Biometric Card (B-CARD) for authentication which includes fingerprint scanner embedded in it and a device named Mobile Card Authentication Device (MCAD). Biometric card has a thin fingerprint scanner to scan the fingerprint of individual. The main circuitry of fingerprint scanner is in the MCAD or in the ATM machine. One end of the card contains the fingerprint scanner and other end contains a copper strip that will connect the fingerprint scanner (which is in the card) to its main circuit inside the machine (MACD/ATM). There is an indicator in the card which acknowledges the user when it is connected to its main circuit. The MCAD is a mobile authentication device which connects the users card with the bank server through computer or mobile phone using their internet data connection available. Credentials of the card along with user fingerprint are sent in encrypted form to the bank server for the authentication through MCAD/ATM. This mechanism will ensure the actual presence of client while money transaction is made from the account. This B-Card can also be used for any secure and reliable online / card transactions. This hardware and methodology provides the reliable and secure authentication of the financial transaction made by the clients and will help in decreasing the financial frauds globally. B-CARD has the high commercial potential to replace the current ATM mechanism/procedure, online authentication or any other authentication technique/mechanism. No. of Pages : 10 No. of Claims : 9 The Patent Office Journal 18/12/2015 65562 (12) PATENT APPLICATION PUBLICATION (21) Application No.11096/DELNP/2015 A (19) INDIA (22) Date of filing of Application :04/12/2015 (43) Publication Date : 18/12/2015 (54) Title of the invention : METHOD FOR PURIFICATION OF 18F LABELED CHOLINE ANALOGUES (51) International classification :C07B59/00,A61K51/04 (71)Name of Applicant : (31) Priority Document No :61/830848 1)TRASIS S.A. (32) Priority Date :04/06/2013 Address of Applicant :Alle du VI Ao»t Sart Tilman B6a B (33) Name of priority country :U.S.A. 4000 Liege Belgium (86) International Application No :PCT/EP2014/061319 (72)Name of Inventor : Filing Date :02/06/2014 1)MORELLE Jean Luc (87) International Publication No :WO 2014/195249 2)OTABASHI Muhammad (61) Patent of Addition to Application 3)PHILIPPART Gauthier :NA Number 4)VOCCIA Samuel :NA Filing Date (62) Divisional to Application Number :NA Filing Date :NA (57) Abstract : The present invention relates to a method for purification of 18F labeled choline analogues in a solution injectable to a patient prepared using non gaseous synthesis paths comprising a step of solid phase extraction (SPE) purification using a solid support wherein the solid support used in the solid phase extraction purification has the characteristic to retain impurities and reagents from the solution but not the 18F labeled choline analogues. No. of Pages : 13 No. of Claims : 8 The Patent Office Journal 18/12/2015 65563 (12) PATENT APPLICATION PUBLICATION (21) Application No.4004/DEL/2015 A (19) INDIA (22) Date of filing of Application :09/12/2015 (43) Publication Date : 18/12/2015 (54) Title of the invention : FORMULATION AND PHARMACOLOGICAL SCREENING OF POLYPHYTO DISPERSIBLE TABLET AS ANTILITHOGENIC AGENT (51) International classification :B01F15/02, (71)Name of Applicant : (31) Priority Document No :NA 1)DR.N.V.SATHEESH MADHAV (32) Priority Date :NA Address of Applicant :FACULTY OF PHARMACY, DIT (33) Name of priority country :NA UNIVERSITY, DEHRADUN (UTTRAKHAND)-248009 (86) International Application No :NA Uttarakhand India Filing Date :NA 2)DR.KUMUD UPADHYAY (87) International Publication No : NA 3)MR.ABHISHEK BHARDWAJ (61) Patent of Addition to Application Number :NA (72)Name of Inventor : Filing Date :NA 1)DR.N.V.SATHEESH MADHAV (62) Divisional to Application Number :NA 2)DR.KUMUD UPADHYAY Filing Date :NA 3)MR.ABHISHEK BHARDWAJ (57) Abstract : This invention explores a process methodology for preparing potent polyphyto dispersible tablets for the treatment of Antilithatic. Initially the polyphyto mixture of Antilithatic agent was prepared by blending the suitable proportion of various Antilithatic plant part based on the novel ideal tree concept phenomenon different phytomixture were prepared by geometrical mixing and blending process later synthetic for its phytochemical standardization and in-vitro cell line, U.V. HPTLC, SEM Analysis, in-vitro, in-vivo activity for antilithiatic and the results were compiled with marked polyherbal formulation cystone 50/100 mg dose. The phyto dispersible tablets was prepared and evaluated for dispersibily for other parameter and result revealed significant and promising potent dosing level antilithiogenic activity. No. of Pages : 29 No. of Claims : 10 The Patent Office Journal 18/12/2015 65564 (12) PATENT APPLICATION PUBLICATION (21) Application No.1102/MUM/2015 A (19) INDIA (22) Date of filing of Application :28/03/2015 (43) Publication Date : 18/12/2015 (54) Title of the invention : Hard gelatin capsule manufacturing machine (51) International classification :B65B1/06 (71)Name of Applicant : (31) Priority Document No :NA 1)DBDS Robotics Pvt. Ltd (32) Priority Date :NA Address of Applicant :B-38, NICE AREA, SATPUR, Nashik, (33) Name of priority country :NA Maharashtra, India 422007 Maharashtra India (86) International Application No :PCT// (72)Name of Inventor : Filing Date :01/01/1900 1)Goldie Anand (87) International Publication No : NA (61) Patent of Addition to Application Number :NA Filing Date :NA (62) Divisional to Application Number :NA Filing Date :NA (57) Abstract : Disclosed herein, is a capsule manufacturing machine that includes a table section, an automatics section, a greaser section, a dipping section, an upper deck kiln and a lower deck kiln. Servo-driven components of all the sections help to control the capsule manufacturing machine. Servo-driven components of the table section continuously guide a plurality of pin bars so that the plurality of pin bars changes from their vertical position to horizontal position. Servo-driven components of the automatics section strips, trim and join shells of capsule bodies and caps of the plurality of pin bars. Servo-driven components of the dipping section dip the plurality of pin bars in a gelatin solution. Servo-driven components of the greaser section oil and clean the pins of the plurality of pin bars. No. of Pages : 17 No. of Claims : 3 The Patent Office Journal 18/12/2015 65565 (12) PATENT APPLICATION PUBLICATION (21) Application No.1103/MUM/2015 A (19) INDIA (22) Date of filing of Application :28/03/2015 (43) Publication Date : 18/12/2015 (54) Title of the invention : AUTO HEAD AND PIN BAR ASSEMBLY (51) International classification :B60D1/34 (71)Name of Applicant : (31) Priority Document No :NA 1)DBDS Robotics Pvt. Ltd (32) Priority Date :NA Address of Applicant :B-38, NICE AREA, SATPUR, Nashik, (33) Name of priority country :NA Maharashtra, India 422007 Maharashtra India (86) International Application No :PCT// (72)Name of Inventor : Filing Date :01/01/1900 1)goldie anand (87) International Publication No : NA (61) Patent of Addition to Application Number :NA Filing Date :NA (62) Divisional to Application Number :NA Filing Date :NA (57) Abstract : An automatics section for a capsule manufacturing machine includes a movable pin bar assembly, two non-movable auto heads and a non-movable joiner block assembly. The two non-movable auto heads include two sets of collets, two sets of knife bars and two sets of ejector rods. The non-movable joiner block assembly includes a set of joiner blocks. When the movable pin bar assembly reaches the end of its vertical upward movement, two sets of strippers which are positioned near to the two non-movable auto heads strip shells from pins of pin bars of a capsule body and a capsule cap. The two sets of collets receive the stripped shells and then they rotate against the two sets of knife bars to trim extended length of the shells. The two sets of ejector rods push the shells into the set of joiner blocks for joining to form a desired capsule. No. of Pages : 21 No. of Claims : 8 The Patent Office Journal 18/12/2015 65566 (12) PATENT APPLICATION PUBLICATION (21) Application No.1104/MUM/2015 A (19) INDIA (22) Date of filing of Application :28/03/2015 (43) Publication Date : 18/12/2015 (54) Title of the invention : Bar tilting guide system (51) International classification :B28B7/16 (71)Name of Applicant : (31) Priority Document No :NA 1)DBDS Robotics Pvt. Ltd (32) Priority Date :NA Address of Applicant :B-38, NICE AREA, SATPUR, Nashik, (33) Name of priority country :NA Maharashtra, India 422007 Maharashtra India (86) International Application No :PCT// (72)Name of Inventor : Filing Date :01/01/1900 1)Goldie anand (87) International Publication No : NA (61) Patent of Addition to Application Number :NA Filing Date :NA (62) Divisional to Application Number :NA Filing Date :NA (57) Abstract : A pin bar tilting guide system includes two cylindrical disks which are mounted on a front frame of a dipping section in a capsule manufacturing machine. The two cylindrical disks have grooves to receive pin bars of a capsule body and a capsule cap. The rotation of the two cylindrical disks results in rotation of the pin bars of the capsule body and the capsule cap. No. of Pages : 15 No. of Claims : 8 The Patent Office Journal 18/12/2015 65567 (12) PATENT APPLICATION PUBLICATION (21) Application No.2457/MUM/2014 A (19) INDIA (22) Date of filing of Application :30/11/2014 (43) Publication Date : 18/12/2015 (54) Title of the invention : AN IMPROVED DRUG-POLYMER COMPOSITION AND PROCESS OF PREPARATION THEREOF (51) International classification :C07F (71)Name of Applicant : 9/30 1)PATEL, Kirit Rambhai :NA Address of Applicant :2/A, Vijay Colony, Nr. Sardar Patel :NA Colony, Stadium Road, Naranpura, Ahmedabad Gujarat India :NA (72)Name of Inventor : :NA 1)PATEL, Kirit Rambhai :NA : NA :NA :NA :NA :NA (31) Priority Document No (32) Priority Date (33) Name of priority country (86) International Application No Filing Date (87) International Publication No (61) Patent of Addition to Application Number Filing Date (62) Divisional to Application Number Filing Date (57) Abstract : The present invention relates to an improved active or inactive pharmaceutical ingredient-polymer composition and process of preparation thereof. In particular, the present invention relates to an improved active or inactive pharmaceutical ingredient-polymer composition and process of preparation thereof wherein the monomer encapsulates particles of active or inactive pharmaceutical ingredient at molecular level and with controlled polymerization process the monomer turns into the said polymer coat over the said active or inactive pharmaceutical ingredient that facilitates the disclosed invention to be completed a single step process. No. of Pages : 44 No. of Claims : 23 The Patent Office Journal 18/12/2015 65568 (12) PATENT APPLICATION PUBLICATION (21) Application No.4463/MUM/2015 A (19) INDIA (22) Date of filing of Application :27/11/2015 (43) Publication Date : 18/12/2015 (54) Title of the invention : RESEARCH MODEL OF ADJUSTABLE CONCENTRIC TOWERS TO STUDY IMPACT OF TOWER SHADOW ON FLICKER INITIATED IN WIND TURBINE (51) International classification (31) Priority Document No (32) Priority Date (33) Name of priority country (86) International Application No Filing Date (87) International Publication No (61) Patent of Addition to Application Number Filing Date (62) Divisional to Application Number Filing Date (71)Name of Applicant : 1)DATTA SAMPATRAO CHAVAN Address of Applicant :AMRUT KAILASH NAGRI, C:F03D9/00, 203,S.NO.34/13A, AMBEGAON F03D7/04 BUDRUK, BEHIND BHARTI VIDYAPEETH, KATRAJ, PUNE :NA 411046 Maharashtra India :NA 2)Parashuram Balwant Karandikar :NA 3)Rajesh giri :NA 4)Puneet Singh :NA (72)Name of Inventor : : NA 1)DATTA SAMPATRAO CHAVAN :NA 2)Parashuram Balwant Karandikar :NA 3)Rajesh giri :NA 4)Puneet Singh :NA 5)Prerit bhatnagar 6)Yuvraj Singh 7)Abhishek Panda 8)Athul Raj (57) Abstract : This invention is about the scaled down facility i.e. research model to find the impact of tower shadow effect on voltage flicker initiated in the wind turbine output is developed. Concentric towers are developed using steel or any other suitable material pipes. The length of the pipe can be adjusted by sliding the pipe. Nut and bolts are used to fix the length of the pipe. Three types of towers with different pipe dimensions are available in the setup. No. of Pages : 17 No. of Claims : 4 The Patent Office Journal 18/12/2015 65569 (12) PATENT APPLICATION PUBLICATION (21) Application No.2977/MUM/2014 A (19) INDIA (22) Date of filing of Application :18/09/2014 (43) Publication Date : 18/12/2015 (54) Title of the invention : TECHNOLOGICAL DEVICE TO ASSIST USERS IN MANAGING THEIR EXERCISE REGIME (51) International classification :A63B71/00 (71)Name of Applicant : (31) Priority Document No :NA 1)Pratik Saraogi (32) Priority Date :NA Address of Applicant :1204 MELODY, KESAR HARMONY, (33) Name of priority country :NA SECTOR 6, KHARGHAR, NAVI MUMBAI 410210. (86) International Application No :PCT// MAHARASHTRA, INDIA. Maharashtra India Filing Date :01/01/1900 (72)Name of Inventor : (87) International Publication No : NA 1)Pratik Saraogi (61) Patent of Addition to Application Number :NA Filing Date :NA (62) Divisional to Application Number :NA Filing Date :NA (57) Abstract : The present invention is a wearable technological device which can monitor and track the exercise regime of the exerciser which includes capturing data on the exercises being followed, weight being lifted, repeating the exercises, the range of motion and the deviation around it, which with the help of algorithms and motion detectors set would alert the users and other such data. This device is connected wirelessly and will transfer data to a computer and the data can then analyzed for action to be taken such as change of exercise regime and / or other utilities. Further the present device is also used to gather information such as weights used, exercise time, number of repetitions/sets, biological or pathological information or data like heart rate, blood pressure, respiration rate, body fat level, hydration etc No. of Pages : 31 No. of Claims : 13 The Patent Office Journal 18/12/2015 65570 (12) PATENT APPLICATION PUBLICATION (21) Application No.4542/MUM/2015 A (19) INDIA (22) Date of filing of Application :02/12/2015 (43) Publication Date : 18/12/2015 (54) Title of the invention : SERVM (SWIVELING ELECTRONIC REAR VIEW MIRROR) (51) International classification :B60R 1/00 :NA :NA :NA :NA :NA : NA :NA :NA :NA :NA (71)Name of Applicant : 1)CHINMAY V JOSHI Address of Applicant :SHREELEELA, A-10, PCMC OFFICERS HSG. SOC., SEC 26, PRADHIKARAN, NIGDI, PUNE-411 044, MAHARASHTRA, INDIA. Maharashtra India 2)SHRINIVAS A. JORAPUR (72)Name of Inventor : 1)SHRINIVAS A. JORAPUR 2)CHINMAY V JOSHI (31) Priority Document No (32) Priority Date (33) Name of priority country (86) International Application No Filing Date (87) International Publication No (61) Patent of Addition to Application Number Filing Date (62) Divisional to Application Number Filing Date (57) Abstract : Efforts are to be taken to minimize the risks associated while driving to avoid accidents. Regarding rear view mirrors, it was observed that the current conventional rear view mirrors are inefficient to give the complete details of the traffic beside and behind his vehicle due to its restricted view angle inspite of the concaveness provided to it. Its greater extent of inefficiency is observed when the roads are twisting ie, while travelling through ghat sections, due to continuous turns, the current conventional rear view mirrors are not able to continuously provide the location of the vehicles on the tail as they tend to get laterally displaced at corners. Our invention will allow the driver to get a wider range of view angle of surrounding traffic and thus get. its better judgement which will inturn reduce the risk of occurrence of mishap to a great extent. Our invention involves swiveling of the rear view mirrors which can be actuated on pressing the button provided on the steering wheel. On pressing the button, the mirrors will swivel to, from current position to maximum external position slowly and then swivel back slowly to their original position when the button on steering wheel is released. The whole system is compact and doesnt require any extra space. This new invention can definitely be incorporated in the newly manufactured automobiles but also it can be mounted on the in use existing vehicles with small modifications. No. of Pages : 9 No. of Claims : 8 The Patent Office Journal 18/12/2015 65571 (12) PATENT APPLICATION PUBLICATION (21) Application No.4543/MUM/2015 A (19) INDIA (22) Date of filing of Application :02/12/2015 (43) Publication Date : 18/12/2015 (54) Title of the invention : INSIDE OVERTAKING MIRRORS. (51) International classification :B60R 1/00, B60R 21/00 :NA :NA :NA :NA :NA : NA :NA :NA :NA :NA (71)Name of Applicant : 1)SHRINIVAS JORAPUR Address of Applicant :FLAT NO.9, SWAMI ANGAN APPT., CDC-84, PURNANAGAR, CHINCHWAD, PUNE-411 019, MAHARASHTRA, INDIA Maharashtra India 2)CHINMAY JOSHI (72)Name of Inventor : 1)SHRINIVAS JORAPUR 2)CHINMAY JOSHI (31) Priority Document No (32) Priority Date (33) Name of priority country (86) International Application No Filing Date (87) International Publication No (61) Patent of Addition to Application Number Filing Date (62) Divisional to Application Number Filing Date (57) Abstract : A provision has been made for the drivers to overtake easily and without any worry and avoiding accidents.Often drivers are very anxious about overtaking and may sometimes loose cool and may constantly blow horn to front vehicles. And sometimes without knowing presence of the front left side vehicles and thus causing accidents.So to overcome this problem,2 simple mirrors(combination of concave and plane) should be in such a manner that we can see any sort of obstruction.The rays fall on mirror X(concave) followed by falling on mirror Y (plane) and thus reflected towards human eye.Thus we come to know what is there and whether to overtake or not and thus avoiding accidents.There is no need to depend on co driver for giving the instructions.This would help who drive alone.As per the dimensions of the vehicle,size,mirrors should be placed accordingly.As minors are being used instead of camera, the cost of system is negligible compared to cost of vehicle.Further to close down the mirrors, electronic adjustment can be done. And mirrors can easily replaced by a new one if any fails/breaks. No. of Pages : 7 No. of Claims : 3 The Patent Office Journal 18/12/2015 65572 (12) PATENT APPLICATION PUBLICATION (21) Application No.4427/MUM/2015 A (19) INDIA (22) Date of filing of Application :25/11/2015 (43) Publication Date : 18/12/2015 (54) Title of the invention : LABORATORY MODEL OF WIND TURBINE BLADE FITTING MECHANISM TO TEST VARIOUS BLADES (51) International classification (31) Priority Document No (32) Priority Date (33) Name of priority country (86) International Application No Filing Date (87) International Publication No (61) Patent of Addition to Application Number Filing Date (62) Divisional to Application Number Filing Date (71)Name of Applicant : 1)DATTA SAMPATRAO CHAVAN Address of Applicant :AMRUT KAILASH NAGRI, C:F03D1/00, 203,S.NO.34/13A, AMBEGAON BUDRUK, BEHIND BHARTI F03D7/00, VIDYAPEETH, KATRAJ, PUNE - 411046 Maharashtra India :NA 2)Parashuram Balwant Karandikar :NA 3)Puneet Singh :NA 4)Rajesh giri :NA (72)Name of Inventor : :NA 1)DATTA SAMPATRAO CHAVAN : NA 2)Parashuram Balwant Karandikar :NA 3)Puneet Singh :NA 4)Rajesh giri :NA 5)Abhishek Panda :NA 6)Yuvraj Singh 7)Prerit Bhatnagar 8)Athul Raj (57) Abstract : In this invention two blade fitting mechanism are developed. In these mechanisms various types of blades can be fitted. The pitch angle of the blade can also be varied.In the first mechanism, cylinders are welded to the hub. Another cylinder with small diameters is welded to a metallic square strip, which is welded to the blade with one square plate. This small cylinder is concentric to the cylinder which is welded to the hub. Blade can be fixed to the small cylinder using nut and bolt arrangement. The blade can be changed. The blade of desired shape can be fixed to the cylinder. The pitch angle of the blade can be changed by rotating the concentric cylinder. The holes are drilled along the length of both the cylinders. The holes are also drilled along the periphery of the cylinder. The pitch angle can be fixed by nut and bolts passing through the holes of the cylinders.In the second mechanism three brackets are mounted on to the hub using nut and bolt, they can be adjusted according to the required pitch angle. The blades will be then connected to the bracketsusing 2 nuts and 2 bolts, which will be fixed throughout the experimentation. The pitch angle for all three blades is kept constant. This mechanism can be placed in the laboratory test setup. Artificial wind can be created using the blower fans. The impact of blade shape and pitch angle on the output voltage flicker can be observed on digital storage oscilloscope. No. of Pages : 24 No. of Claims : 5 The Patent Office Journal 18/12/2015 65573 (12) PATENT APPLICATION PUBLICATION (21) Application No.4464/MUM/2015 A (19) INDIA (22) Date of filing of Application :27/11/2015 (43) Publication Date : 18/12/2015 (54) Title of the invention : RESEARCH MODEL OF MULTIPLE TOWERS FIXING ARRANGEMENT TO ASSESS IMPACT OF WAKE EFFECT IN A WIND FARM (51) International classification (31) Priority Document No (32) Priority Date (33) Name of priority country (86) International Application No Filing Date (87) International Publication No (61) Patent of Addition to Application Number Filing Date (62) Divisional to Application Number Filing Date (71)Name of Applicant : 1)DATTA SAMPATRAO CHAVAN Address of Applicant :AMRUT KAILASH NAGRI, C:G01S17/95, 203,S.NO.34/13A, AMBEGAON F03D 11/00 BUDRUK, BEHIND BHARTI VIDYAPEETH, KATRAJ, PUNE :NA 411046 Maharashtra India :NA 2)Parashuram Balwant Karandikar :NA 3)Puneet Singh :NA 4)Rajesh giri :NA (72)Name of Inventor : : NA 1)DATTA SAMPATRAO CHAVAN :NA 2)Parashuram Balwant Karandikar :NA 3)Puneet Singh :NA 4)Rajesh giri :NA 5)Yuvraj Singh 6)Prerit bhatnagar 7)Abhishek Panda 8)Athul Raj (57) Abstract : This invention is related to study the impact of wake effect on the flicker initiated in the wind turbine voltage and other power quality parameters. In the test setup there is a provision of number of various types of towers in the test setup. Tower height and tower placement can be done on scaled down basis. Laboratory grade model of part of wind farm is proposed for prediction of voltage flicker and other power quality parameters of actual wind farm. The angle of the tower which is fixed behind the every fitted tower is can be changed. For fixing the tower at a particular angle the cylindrical slots are provided. The towers can be fixed in the cylindrical slots. The protractor is painted at the bottom surface of the test setup. The angle between the towers can be easily measured. The impact of wake effect on the flicker initiated in the output voltage of the wind turbine can be recorded for different angles between the towers with respect to the tower which is placed in front of the towers. The wake effect can be studied for different wind speeds. The wind speed can be varied by using blower fans and speed regulators. Results regarding voltage flicker and other power quality parameters can give idea of their values in onsite situation with same angle and other situations. No. of Pages : 18 No. of Claims : 4 The Patent Office Journal 18/12/2015 65574 (12) PATENT APPLICATION PUBLICATION (21) Application No.4478/MUM/2015 A (19) INDIA (22) Date of filing of Application :30/11/2015 (43) Publication Date : 18/12/2015 (54) Title of the invention : ULTRA HIGH VALUE RESISTOR AS HIGH VOLTAGE NETWORK COMPONENT (51) International classification :H01C 17/00 :NA :NA :NA :NA :NA : NA :NA :NA :NA :NA (71)Name of Applicant : 1)SANJAY D KEMKAR Address of Applicant :701/C,PINNACLE BLDG, VASANT OSCAR COMPLEX, LBS MARG, MULUND(W), MUMBAI, PIN-400080. Maharashtra India (72)Name of Inventor : 1)SANJAY D KEMKAR 2)SANJANA KEMKAR 3)MILIND VAIDYA (31) Priority Document No (32) Priority Date (33) Name of priority country (86) International Application No Filing Date (87) International Publication No (61) Patent of Addition to Application Number Filing Date (62) Divisional to Application Number Filing Date (57) Abstract : Present invention is for making ultra high value resistor as AC electrical network component for industrial application. This device will be useful for AC high voltage application as its value obtained is moderately high. The materials used for making high / ultra high value of resistors are colloidal suspensions made of fine nano particles. Passive ultra high value resistors have been designed. Their range was of order of thousands of mega ohms and nanofluid suspension comprises of nano particles with dimensions in the nanometer range comprises of various volumetric concentrations up to at least 24%. Very high value resistor have been fabricated and used as high potential sensing device. Extensive measurements have been carried out at 300 K as the device is likely to be used more in this temperature range. In industry, use of value of resistance is widely used because of potential drops involved in those applications. Therefore instead of conductivity the resistance parameter is used wherever necessary when referred to device as a component. No. of Pages : 24 No. of Claims : 8 The Patent Office Journal 18/12/2015 65575 (12) PATENT APPLICATION PUBLICATION (21) Application No.4013/MUM/2015 A (19) INDIA (22) Date of filing of Application :23/10/2015 (43) Publication Date : 18/12/2015 (54) Title of the invention : AUTOMATIC SUGARCANE JUICE EXTRACTOR (51) International classification :B30B (71)Name of Applicant : 9/00 1)Nilkantha Dashrath Gadakh :NA Address of Applicant :Sukene Road, At/Post-Chandori, Tal:NA Niphad, Dist-Nashik Maharashtra India :NA (72)Name of Inventor : :NA 1)Nilkantha Dashrath Gadakh :NA : NA :NA :NA :NA :NA (31) Priority Document No (32) Priority Date (33) Name of priority country (86) International Application No Filing Date (87) International Publication No (61) Patent of Addition to Application Number Filing Date (62) Divisional to Application Number Filing Date (57) Abstract : An automatic sugarcane juice extractor has storage space for storing pieces of sugarcane, hopper with feeding mechanism for automatic feeding of pieces of sugarcane from diameter of 20 to 50mm into juice extractor. Juice extractor providing three stages of squeezing in single pass of sugarcane. One roller in final stage is adjustably mounted respective to adjacent crushing roller and its position is controlled through roller gap manipulator according to diameter of sugarcane. Diameter of Sugarcane which is going to feed in juice extractor is measured and control system manipulate roller gap in final stage very soon. Control system can adjusted for maximum juice extraction efficiency irrespective to diameter and variety of sugarcane. Crushing rollers are enclosed with covers and closure completely even when sugarcane is passing through rollers. Also automatic feeding helps to extract juice from sugarcane without manual handling of sugarcane and making juice extraction extremely safe and hygienic. No. of Pages : 19 No. of Claims : 10 The Patent Office Journal 18/12/2015 65576 (12) PATENT APPLICATION PUBLICATION (21) Application No.4566/MUM/2015 A (19) INDIA (22) Date of filing of Application :03/12/2015 (43) Publication Date : 18/12/2015 (54) Title of the invention : HELICAL ANTENNA LOADED IN A TRIANGULAR CAVITY FOR AEROSPACE COMMUNICATION (51) International classification :H01Q 1/00, H01Q 11/00 :NA :NA :NA :NA :NA : NA :NA :NA :NA :NA (71)Name of Applicant : 1)THAKUR COLLEGE OF ENGINEERING&TECHONOLOGY Address of Applicant :SHYAMSUNDAR THAKUR MARG,THAKUR VILLAGE,KANDIVALI EAST,MUMBAI400101 Maharashtra India (72)Name of Inventor : 1)DR.VINITKUMAR JAYAPRAKASH DONGRE 2)DR. B.K MISHRA (31) Priority Document No (32) Priority Date (33) Name of priority country (86) International Application No Filing Date (87) International Publication No (61) Patent of Addition to Application Number Filing Date (62) Divisional to Application Number Filing Date (57) Abstract : In one of the important aspect of the invention it is provided that a compact size antenna/s for aerospace communication, the helical antenna is enclosed in a triangular cavity, the shape of the cavity has an effect on the electromagnetic radiation from and to the antenna. The triangular cavity has designed in order to confine the electrical field of helical antenna which results is the multi band operation and higher power handling capacity of the antenna, the dimensions of the cavity and the helix is determined for multiband operation of the communication which is determined by measurement of Reflection coefficient; No. of Pages : 9 No. of Claims : 7 The Patent Office Journal 18/12/2015 65577 (12) PATENT APPLICATION PUBLICATION (21) Application No.1105/MUM/2015 A (19) INDIA (22) Date of filing of Application :28/03/2015 (43) Publication Date : 18/12/2015 (54) Title of the invention : Drop chute conveyor (51) International classification :B65G11/08 (71)Name of Applicant : (31) Priority Document No :NA 1)DBDS Robotics Pvt. Ltd (32) Priority Date :NA Address of Applicant :B-38, NICE AREA, SATPUR, Nashik, (33) Name of priority country :NA Maharashtra, India 422007 Maharashtra India (86) International Application No :PCT// (72)Name of Inventor : Filing Date :01/01/1900 1)Goldie anand (87) International Publication No : NA (61) Patent of Addition to Application Number :NA Filing Date :NA (62) Divisional to Application Number :NA Filing Date :NA (57) Abstract : Disclosed herein, is a drop chute conveyor system that improves the productivity of a capsule manufacturing unit by increasing the speed of formation of the capsules. The drop chute conveyor system includes joiner blocks, a hopper and a conveyor belt. Capsules ejected from the joiner blocks fall onto the conveyor belt via the hopper. The presence of the hopper removes the risk of loss and wastage of capsules due to physical damage. No. of Pages : 13 No. of Claims : 6 The Patent Office Journal 18/12/2015 65578 (12) PATENT APPLICATION PUBLICATION (21) Application No.1106/MUM/2015 A (19) INDIA (22) Date of filing of Application :28/03/2015 (43) Publication Date : 18/12/2015 (54) Title of the invention : Radial guide table section (51) International classification :B23Q9/00 (71)Name of Applicant : (31) Priority Document No :NA 1)DBDS Robotics Pvt. Ltd (32) Priority Date :NA Address of Applicant :B-38, NICE AREA, SATPUR, Nashik, (33) Name of priority country :NA Maharashtra, India 422007 Maharashtra India (86) International Application No :PCT// (72)Name of Inventor : Filing Date :01/01/1900 1)Goldie anand (87) International Publication No : NA (61) Patent of Addition to Application Number :NA Filing Date :NA (62) Divisional to Application Number :NA Filing Date :NA (57) Abstract : A table section for a capsule manufacturing machine includes two receiving tables, two sets of block chains, two bar lifters, four bar positioners, two radial guides and a bar pusher. The two receiving tables move in vertical reciprocating motion to receive pin bars and place them on to the two sets of block chains. The two bar lifters lifts each of the pin bar and places them adjacent to the two radial guides. The four bar positioners that are present below the two radial guides, drag the pin bars on to the two radial guides. The pin bars turn from a vertical position to a horizontal position as it covers a curvilinear path on the two radial guides. The bar pusher that is positioned above the two radial guides pushes the pin bars into an automatics section of the capsule manufacturing machine. No. of Pages : 20 No. of Claims : 10 The Patent Office Journal 18/12/2015 65579 (12) PATENT APPLICATION PUBLICATION (21) Application No.1107/MUM/2015 A (19) INDIA (22) Date of filing of Application :28/03/2015 (43) Publication Date : 18/12/2015 (54) Title of the invention : Capsule gripping system (51) International classification :B29C65/02 (71)Name of Applicant : (31) Priority Document No :NA 1)DBDS Robotics Pvt. Ltd (32) Priority Date :NA Address of Applicant :B-38, NICE AREA, SATPUR, Nashik, (33) Name of priority country :NA Maharashtra, India 422007 Maharashtra India (86) International Application No :PCT// (72)Name of Inventor : Filing Date :01/01/1900 1)Goldie anand (87) International Publication No : NA (61) Patent of Addition to Application Number :NA Filing Date :NA (62) Divisional to Application Number :NA Filing Date :NA (57) Abstract : Disclosed herein is a gripper system used for effectively pulling off gelatin capsule halves solidified onto a set of pin bars. The gripper system includes a shaft assembly and a pair of manifold assemblies which periodically reciprocates along a predefined axis so as to peel off the gelatin capsule halves from the pin bars. The shaft assembly includes a first and second shaft whereas each of the pairs of manifold assemblies include a pair of manifold holding blocks, a set of stripping jaws and a manifold. The first shaft and the pairs of manifold holding blocks periodically reciprocates in a direction perpendicular to one another. The set of stripping jaws holds onto the capsule halves so as to strip them off the pin bars and insert the stripped capsule halves into a series of collets. No. of Pages : 16 No. of Claims : 6 The Patent Office Journal 18/12/2015 65580 (12) PATENT APPLICATION PUBLICATION (21) Application No.4456/MUM/2015 A (19) INDIA (22) Date of filing of Application :27/11/2015 (43) Publication Date : 18/12/2015 (54) Title of the invention : SHANTILEX FOUNTAIN PIPE. (51) International classification :A01G 25/06 :NA :NA :NA :NA :NA : NA :NA :NA :NA :NA (71)Name of Applicant : 1)MR. VIJAY SHANTILAL GUNDECHA Address of Applicant :3046, SHANTILEX, PARSHWANATH MARG, BARSHI DIST, SOLAPUR-413401, MAHARASHTRA, INDIA Maharashtra India (72)Name of Inventor : 1)MR. VIJAY SHANTILAL GUNDECHA (31) Priority Document No (32) Priority Date (33) Name of priority country (86) International Application No Filing Date (87) International Publication No (61) Patent of Addition to Application Number Filing Date (62) Divisional to Application Number Filing Date (57) Abstract : The Invention is aimed to give irrigation solution for poor and economically backward farmers. Invention is helpful to assist micro irrigation. It gives liberty to user of using the pipe wherever they wish to do irrigation of farm.lt is foldable,easy to carry and economically affordable to purchase.In less amount of water quantity,less electricity farmers can grow their crops,plants and earn income. It will help general farmers to invest minimum amount of money for their irrigation need compare to current irrigation systems like drip pvc or sprinkler pvc irrigation. No. of Pages : 12 No. of Claims : 7 The Patent Office Journal 18/12/2015 65581 (12) PATENT APPLICATION PUBLICATION (21) Application No.3343/MUM/2015 A (19) INDIA (22) Date of filing of Application :31/08/2015 (43) Publication Date : 18/12/2015 (54) Title of the invention : METHOD AND SYSTEM TO CONVERT NATURAL LANGUAGE SENTENCES INTO PARTIAL LAMBDA EXPRESSIONS (51) International classification :G06F17/28, G06F17/27 :NA :NA :NA :NA :NA : NA :NA :NA :NA :NA (71)Name of Applicant : 1)ABHISHEK MISHRA Address of Applicant :J1003, PUDUMJEE GREENS, NEAR ADITYA BIRLA HOSPITAL, THERAGON, CHINCWAD411033 Maharashtra India (72)Name of Inventor : 1)ABHISHEK MISHRA (31) Priority Document No (32) Priority Date (33) Name of priority country (86) International Application No Filing Date (87) International Publication No (61) Patent of Addition to Application Number Filing Date (62) Divisional to Application Number Filing Date (57) Abstract : A Natural Language Processing (NLP) based method and system to convert natural language sentences into lambda expressions is provided. The method includes entering a plurality of sentences described in natural language, tokenizing each word in the plurality of sentences, categorizing the words into parts of speech (POS), parsing the tokenized word with parts of speech (POS), recognizing entity in the words in said each word in said plurality of sentences, combining recognized entity with POS to obtain words, which are represented as nodes, generating a graphical representation of the nodes using a directed acyclic graph (DAG) and converting the DAG into a partial lambda expressions. No. of Pages : 23 No. of Claims : 8 The Patent Office Journal 18/12/2015 65582 (12) PATENT APPLICATION PUBLICATION (21) Application No.4547/MUM/2015 A (19) INDIA (22) Date of filing of Application :02/12/2015 (43) Publication Date : 18/12/2015 (54) Title of the invention : AN INTEGRATED SENSING AND LEARNING SCHEME USING UNSUPERVISED LEARNING OUTLINE PERFORMING ENHANCED DYNAMIC SPECTRUM ALLOCATION FOR AREAL TIME COGNITIVE RADIO NETWORK (51) International classification :H04W 16/00, H04W 72/00 :NA :NA :NA :NA :NA : NA :NA :NA :NA :NA (71)Name of Applicant : 1)MS.MITHRA VENKATESAN Address of Applicant :201, F2 SHELDON, SUKHWANI CAMPUS PHASE-2, VALLABH NAGAR, PIMPRI, PUNE-411 008, MAHARASHTRA, INDIA. Maharashtra India (72)Name of Inventor : 1)MS.MITHRA VENKATESAN 2)DR.A.V KULKARNI (31) Priority Document No (32) Priority Date (33) Name of priority country (86) International Application No Filing Date (87) International Publication No (61) Patent of Addition to Application Number Filing Date (62) Divisional to Application Number Filing Date (57) Abstract : The present invention is an integrated sensing and learning outline leading to Dynamic Spectrum Allocation towards a real time Cognitive Radio system. In present embodiment, weight based decision making algorithm using double threshold technique is used considering dynamic locations of the user which shows improvement in sensing performance. In present embodiment, the learning is accomplished using unsupervised learning schema of self organizing technique which results in superior learning outline. Subsequently, the integrated sensing and learning schema aids in improved Dynamic Spectrum Allocation using Particle Swarm Optimization. The present embodiment can be extended with increased number of nodes for real life large scale situations. No. of Pages : 17 No. of Claims : 9 The Patent Office Journal 18/12/2015 65583 (12) PATENT APPLICATION PUBLICATION (21) Application No.3264/MUMNP/2015 A (19) INDIA (22) Date of filing of Application :17/11/2015 (43) Publication Date : 18/12/2015 (54) Title of the invention : EFFICIENT CODING OF AUDIO SCENES COMPRISING AUDIO OBJECTS (51) International classification :G10L19/008 (71)Name of Applicant : (31) Priority Document No :61/827246 1)DOLBY INTERNATIONAL AB (32) Priority Date :24/05/2013 Address of Applicant :Apollo Building 3E Herikerbergweg 1 (33) Name of priority country :U.S.A. 35 NL 1101 CN Amsterdam Netherlands (86) International Application No :PCT/EP2014/060733 (72)Name of Inventor : Filing Date :23/05/2014 1)PURNHAGEN Heiko (87) International Publication No :WO 2014/187990 2)KJOERLING Kristofer (61) Patent of Addition to Application 3)HIRVONEN Toni :NA Number 4)VILLEMOES Lars :NA Filing Date 5)BREEBAART Dirk Jeroen (62) Divisional to Application Number :NA 6)SAMUELSSON Leif Jonas Filing Date :NA (57) Abstract : inter aliaThere is provided encoding and decoding methods for encoding and decoding of object based audio. An exemplary encoding method includes calculating M downmix signals by forming combinations of N audio objects wherein M=N and calculating parameters which allow reconstruction of a set of audio objects formed on basis of the N audio objects from the M downmix signals. The calculation of the M downmix signals is made according to a criterion which is independent of any loudspeaker configuration. No. of Pages : 63 No. of Claims : 27 The Patent Office Journal 18/12/2015 65584 (12) PATENT APPLICATION PUBLICATION (21) Application No.4289/MUM/2015 A (19) INDIA (22) Date of filing of Application :09/11/2015 (43) Publication Date : 18/12/2015 (54) Title of the invention : INSECT REPELLENT STRIP HOLDER (51) International classification :A47B91/14, F16M13/02 :NA :NA :NA :NA :NA : NA :NA :NA :NA :NA (71)Name of Applicant : 1)JYOTHY LABORATORIES LIMITED Address of Applicant :Ujala House RamaKrishna Mandir Road Kondivita, Andheri East Mumbai - Maharashtra 400059, India Maharashtra India (72)Name of Inventor : 1)MR, Jyothy 2)KAMATH, Sunil 3)RAO, Ananth 4)MAJUMDAR, Arunabha 5)MADASU, Rajaji 6)K, Radhakrishnan (31) Priority Document No (32) Priority Date (33) Name of priority country (86) International Application No Filing Date (87) International Publication No (61) Patent of Addition to Application Number Filing Date (62) Divisional to Application Number Filing Date (57) Abstract : The subject matter described herein relates to a holder (100) for holding an insect repellent strip (302). The holder (100) includes a sheet blank (102) having a plurality of lateral creases (104, 106, 108, 110). The plurality of lateral creases (104, 106, 108, 110) provided on the sheet blank (102) allows the sheet blank (102) to get folded to form a rectangular tube-like structure having a plurality of walls (202, 204, 206, 208, 210). Further, the holder (100) includes a strip holding member (122) for holding the insect repellent strip (302). The strip holding member (122) is provided on one of the plurality of walls (202, 204, 206, 208, 210) of the holder (100). The strip holding member (122) comprises a groove and a metal rivet disposed on the groove. No. of Pages : 14 No. of Claims : 12 The Patent Office Journal 18/12/2015 65585 (12) PATENT APPLICATION PUBLICATION (21) Application No.2741/MUM/2015 A (19) INDIA (22) Date of filing of Application :20/07/2015 (43) Publication Date : 18/12/2015 (54) Title of the invention : A PERIODONTAL BUR AND FILE (51) International classification :A61C 3/00, A61C 5/00 :NA :NA :NA :NA :NA : NA :NA :NA :NA :NA (71)Name of Applicant : 1)ROSHAN UDHAORAO SAKHARKAR Address of Applicant :PLOT NUMBER 110 , DR MAHALLE CLINIC LINE, NEW SUBHEDAR LAYOUT, POST: AYODHYA NAGAR, NAGPUR 440024, MAHARASHTRA, INDIA Maharashtra India (72)Name of Inventor : 1)ROSHAN UDHAORAO SAKHARKAR (31) Priority Document No (32) Priority Date (33) Name of priority country (86) International Application No Filing Date (87) International Publication No (61) Patent of Addition to Application Number Filing Date (62) Divisional to Application Number Filing Date (57) Abstract : A periodontal sheath bur and file for a dental instrument, said element configured to provide for abrasive action on gingival wall of periodontal pocket and for cleaning, polishing action on tooth surface without abrading or damaging it, said element comprising: at least a sheath head configured to ensconce an operative distal tip of said dental instrument, characterised in that, said sheath comprising one of a plurality of features on its external surface, said feature configured to provide abrading action on gingival wall of periodontal pocket and cleaning , polishing action on tooth surface without damaging it ; and at least an attachment for holding said sheath at one end . No. of Pages : 52 No. of Claims : 56 The Patent Office Journal 18/12/2015 65586 (12) PATENT APPLICATION PUBLICATION (21) Application No.1168/KOL/2015 A (19) INDIA (22) Date of filing of Application :18/11/2015 (43) Publication Date : 18/12/2015 (54) Title of the invention : A MULTI-LEVEL STRUCTURE FOR SOLAR POWER GENERATION (51) International classification :H01G9/20 (71)Name of Applicant : (31) Priority Document No :NA 1)BIDYUT K. BHATTACHARYYA (32) Priority Date :NA Address of Applicant :Professor, Dept. of Electrical (33) Name of priority country :NA Engineering, National Institute of Technology, Agartala, Jirania, (86) International Application No :PCT// Tripura (West) India Filing Date :01/01/1900 2)SATHEESH REDDY JULAKANTI (87) International Publication No : NA (72)Name of Inventor : (61) Patent of Addition to Application Number :NA 1)BIDYUT K. BHATTACHARYYA Filing Date :NA 2)HOTA VENKATA SOMA SAI PHANI KIRAN (62) Divisional to Application Number :NA 3)ANTARIKSHA SARKAR Filing Date :NA 4)SATHEESH REDDY JULAKANTI (57) Abstract : A MULTI-LEVEL STRUCTURE FOR SOLAR POWER GENERATION The present invention deals with a multi-level structure comprising at least one central stationary trunk associated with one or more solar panels, for providing exposure through electronic tracking system. The invention presented shows a structural modification in installation of solar panels in contrast to the generally followed unit installation either on ground or on roof-tops. The solar PV units are proposed to be installed on step altitude varying layered sections which rise from the ground platform around a central supporting structure. Differences in heights of each layer are similar to branches of a tree. This layered mode of installing the PV’s gives freedom for up to three different movements which currently is practiced up to two rotations. No. of Pages : 26 No. of Claims : 10 The Patent Office Journal 18/12/2015 65587 (12) PATENT APPLICATION PUBLICATION (21) Application No.1255/KOL/2015 A (19) INDIA (22) Date of filing of Application :07/12/2015 (43) Publication Date : 18/12/2015 (54) Title of the invention : A NEW MEMBRANE INTEGRATED CLOSED LOOP SYSTEM FOR TREATING COMPLEX INDUSTRIAL WASTEWATER TOWARDS RECOVERY AND REUSE (51) International classification :C02F1/72 (71)Name of Applicant : (31) Priority Document No :NA 1)PAL, Parimal (32) Priority Date :NA Address of Applicant :Environment and Membrane (33) Name of priority country :NA Technology Laboratory, Department of Chemical Engineering, (86) International Application No :PCT// National Institute of Technology, Durgapur 713209, West Bengal, Filing Date :01/01/1900 India. (87) International Publication No : NA (72)Name of Inventor : (61) Patent of Addition to Application Number :NA 1)PAL, Parimal Filing Date :NA (62) Divisional to Application Number :NA Filing Date :NA (57) Abstract : The present disclosure provides a system for treating wastewater containing contaminant species, wherein the system can include: (a) a forward osmosis (FO) module including a FO feed chamber and a FO draw chamber separated by a forward osmosis membrane, wherein a feed of wastewater flows into the FO feed chamber, and a draw solution containing a draw solute flows through the FO draw chamber to induce a net flow of the wastewater feed through the membrane into the draw solution and thereby separating the wastewater from its contaminant species; and (b) a nanofiltration module for separating the draw solution and water from a diluted draw solution discharged from the FO draw chamber, supplying the separated draw solution to the FO draw chamber of the FO module again, and discharging the separated water to outside. According to embodiments, the forward osmosis membrane of the FO module can be a flat sheet membrane that remains in a horizontal plane on a perforated support in such a manner that the wastewater feed and the draw solution flow tangentially in counter-current directions along the top and bottom surfaces of the membrane respectively. No. of Pages : 32 No. of Claims : 14 The Patent Office Journal 18/12/2015 65588 Publication After 18 Months: The following Patent Applications have been published under Section 11A (3) of The Patents (Amendment) Act, 2005. Any Person may file representation by way of opposition to the Controller of Patents at the appropriate office against the grant of the patent in the prescribed manner under section 25(1) of the Patents (Amendment) Act, 2005 read with the rule 55 of The Patents (Amendment) Rules, 2006: (12) PATENT APPLICATION PUBLICATION (21) Application No.1566/DEL/2014 A (19) INDIA (22) Date of filing of Application :10/06/2014 (43) Publication Date : 18/12/2015 (54) Title of the invention : CATIONIC LIPID CORDIARIMIDE HYBRID COMPOUNDS AND A PROCESS FOR PREPARATION THEREOF (51) International classification (31) Priority Document No (32) Priority Date (33) Name of priority country (86) International Application No Filing Date (87) International Publication No (61) Patent of Addition to Application Number Filing Date (62) Divisional to Application Number Filing Date (71)Name of Applicant : :A61K9/68 1)COUNCIL OF SCIENTIFIC & INDUSTRIAL :NA RESEARCH :NA Address of Applicant :ANUSANDHAN BHAWAN, RAFI :NA MARG, NEW DELHI - 110001, INDIA. Delhi India :NA (72)Name of Inventor : :NA 1)BATHULA SURENDAR REDDY : NA 2)VKK DURGA RAO :NA 3)KOMAL SHARMA :NA 4)M PRATHAP REDDY :NA 5)DIBYENDU BANERJEE :NA 6)DEEPENDRA KUMAR SINGH (57) Abstract : The present invention relates to the cationic lipid cordiaroimide hybrid compounds of formula I. The present invention provides a process for preparation of these compounds is also being elaborated. The compounds described provides anticancerous activity against cell lines including PC-3 (prostate cancer), HepG2 (liver cancer), MCF-7 (breast cancer) and NIH/3T3 (non cancer) cells. The compound was also capable of inducing caspase-3 mediated apoptosis in HepG2 cells by arresting the cell cycle in the Gl phase. Furthermore, the compound exhibited DNA ligase I inhibition. The present class of cationic lipid cordiarimide hybrids is likely to find specific use in developing novel targeted therapies for liver and prostate cancers. No. of Pages : 42 No. of Claims : 9 The Patent Office Journal 18/12/2015 65589 (12) PATENT APPLICATION PUBLICATION (21) Application No.2762/DEL/2012 A (19) INDIA (22) Date of filing of Application :05/09/2012 (43) Publication Date : 18/12/2015 (54) Title of the invention : A PROCESS FOR THE PRODUCTION OF SULBACTAM SODIUM (51) International classification :C07C (71)Name of Applicant : (31) Priority Document No :NA 1)VARDHMAN CHEMTECH LIMITED (32) Priority Date :NA Address of Applicant :SCO-350-352 Sector 34-A Chandigarh (33) Name of priority country :NA (INDIA). Chandigarh India (86) International Application No :NA (72)Name of Inventor : Filing Date :NA 1)GUJRAL Rajinder Singh (87) International Publication No : NA 2)VIG Ashwani (61) Patent of Addition to Application Number :NA Filing Date :NA (62) Divisional to Application Number :NA Filing Date :NA (57) Abstract : Penicillanic acid 1 1-dioxide and esters thereof such as Sulbactam Sodium are used as antibacterial agents and also enhance the effectiveness of several -lactam antibiotics against many -lactamase producing bacteria. A process for the production of crystal of Sulbactam Sodium is disclosed here involving reaction of sulbactam acid and sodium salt in the presence of HCL and NaCl in an organic medium. No. of Pages : 14 No. of Claims : 10 The Patent Office Journal 18/12/2015 65590 (12) PATENT APPLICATION PUBLICATION (21) Application No.4982/DELNP/2015 A (19) INDIA (22) Date of filing of Application :09/06/2015 (43) Publication Date : 18/12/2015 (54) Title of the invention : NUCLEOTIDE SEQUENCE ENCODING HOMEOBOX- LEUCINE ZIPPER PROTEIN HAT22 (HDZIP PROTEIN 22) FROM CORCHORUS OLITORIUS AND CORCHORUS CAPSULARIS AND METHODS OF USE (51) International classification :A01H5/00,C12N15/82 (71)Name of Applicant : (31) Priority Document No :61/908444 1)BANGLADESH JUTE RESEARCH INSTITUTE (32) Priority Date :25/11/2013 Address of Applicant :Manik Mia Avenue, Dhaka ,1207 (33) Name of priority country :U.S.A. Bangladesh (86) International Application No :PCT/US2014/066772 (72)Name of Inventor : Filing Date :21/11/2014 1)ALAM ,Maqsudul (87) International Publication No :WO 2015/077538 2)ISLAM, Mohammed, Shahidul; (61) Patent of Addition to Application 3)AHMED, Borhan; :NA Number 4)HAQUE,Mohammed, Samiul; :NA Filing Date 5)ALAM, Mohammed, Monjurul; (62) Divisional to Application Number :NA Filing Date :NA (57) Abstract : The present invention relates to the isolated polynucleotide encoding homeobox -leucine zipper protein HAT22 (HD -ZIP protein 22) from the plants and and corresponding polypeptide derived thereof. The present invention also relates to the plants having modulated expression of a nucleic acid encoding a homeobox- leucine zipper HAT22 polypeptide or a homologue thereof , which has the ability to modify , preferably to increase/enhance the fiber length, plant height, and/or plant biomass. More specifically , the invention relates to polypeptides having homeobox- leucine zipper protein HAT22 activity , polynucleotides encoding these polypeptides, and methods of making and using these polynucleotides and polypeptides. The present invention further provides vectors, expression constructs and host cells comprising and/or consisting of the nucleotide sequences of the homeobox- leucine zipper protein HAT22 (HD- ZIP protein 22). The invention also provides methods for producing the said protein and methods for modifying the said protein in order to improve their desirable characteristics. The said protein of the invention can be used in a variety of ways , including increasing/enhancing the fiber length ,height and biomass of plants and fiber yield. No. of Pages : 33 No. of Claims : 14 The Patent Office Journal 18/12/2015 65591 (12) PATENT APPLICATION PUBLICATION (21) Application No.4983/DELNP/2015 A (19) INDIA (22) Date of filing of Application :09/06/2015 (43) Publication Date : 18/12/2015 (54) Title of the invention : ENHANCER OF ZESTE HOMOLOG 2 INHIBITORS (51) International classification :C07D213/56 (71)Name of Applicant : (31) Priority Document No :61/736645 1)GLAXOSMITHKLINE LLC (32) Priority Date :13/12/2012 Address of Applicant :2711 Centerville Road, Suite 400, (33) Name of priority country :U.S.A. Wilmington, DE 19808 U.S.A. (86) International Application No :PCT/US2013/074558 (72)Name of Inventor : Filing Date :12/12/2013 1)KNIGHT ,Steven, David (87) International Publication No :WO 2014/107277 2)MILLER, William, Henry (61) Patent of Addition to Application 3)NEWLANDER ,Kenneth Allen :NA Number 4)DONATELLI ,Carla, A. :NA Filing Date (62) Divisional to Application Number :NA Filing Date :NA (57) Abstract : This invention relates to novel compounds according to Formula (I) which are inhibitors of Enhancer of Zeste Homolog 2 (EZH2) , to pharmaceutical compositions containing them to processes for their preparation , and to their use in therapy for the treatment of cancers. Epigenetic modifications play an important role in the regulation of many cellular processes including cell proliferation , differentiation , and cell survival. Global epigenetic modifications are common in cancer , and include global changes in DNA and/or histone methylation , dysregulation of non- coding RNAs and nucleosome remodeling leading to aberrant activation or inactivation of oncogenes, tumor suppressors and signaling pathways. No. of Pages : 104 No. of Claims : 26 The Patent Office Journal 18/12/2015 65592 (12) PATENT APPLICATION PUBLICATION (21) Application No.4984/DELNP/2015 A (19) INDIA (22) Date of filing of Application :09/06/2015 (43) Publication Date : 18/12/2015 (54) Title of the invention : PRESS- FORMING METHOD (51) International (71)Name of Applicant : :B21D22/30,B21D22/28,B21K21/16 classification 1)NIPPON STEEL & SUMITOMO METAL (31) Priority Document No :2013001834 CORPORATION (32) Priority Date :09/01/2013 Address of Applicant :6- 1, Marunouchi 2 -chome, Chiyoda (33) Name of priority country :Japan ku ,Tokyo 100-8071 Japan (86) International (72)Name of Inventor : :PCT/JP2013/084846 Application No 1)YAMAGATA Mitsuharu :26/12/2013 Filing Date 2)YAMAMOTO Shuji (87) International Publication 3)WADA Yasuhiro :WO 2014/109240 No (61) Patent of Addition to :NA Application Number :NA Filing Date (62) Divisional to :NA Application Number :NA Filing Date (57) Abstract : An inner punch (11), an outer punch (12) and a die (13) are arranged on the same central axis (10). The outer punch (12) is arranged so as to leave a first space (S1), which is bigger than the plate thickness (T) of a cup vertical wall section (A2) , from the inner punch (11) in the radial direction perpendicular to the central axis (10). Also, a punch shoulder R section (12A) that opens up as said section gets closer to the die (13) side is formed on the die (13) side of the inner peripheral surface of the outer punch (12). In a state where a second space (S2) is present between the outer peripheral surface of the inner punch (11) and the inner peripheral surface of the cup vertical wall section (A2) , a cup bottom section (A15) is sandwiched between the inner punch (11) and the die (13) , and drawing is carried out in which , whilst the outer punch (12) is made to come into contact with the cup vertical wall section (A2) from the punch shoulder R section (12A), the cup vertical wall section (A2) is pushed into the outer peripheral surface side of the inner punch (11) and reduced in diameter , thus causing surplus material to flow into a cup shoulder section (A1) and thicken same. No. of Pages : 50 No. of Claims : 7 The Patent Office Journal 18/12/2015 65593 (12) PATENT APPLICATION PUBLICATION (21) Application No.4985/DELNP/2015 A (19) INDIA (22) Date of filing of Application :09/06/2015 (43) Publication Date : 18/12/2015 (54) Title of the invention : POWER SUPPLY SYSTEM FOR VEHICLE , VEHICLE EQUIPPED WITH SAME, AND METHOD FOR CONTROLLING POWER SUPPLY SYSTEM FOR VEHICLE (51) International classification :B60L11/18,B60L3/00,H02J7/00 (71)Name of Applicant : (31) Priority Document No :NA 1)TOYOTA JIDOSHA KABUSHIKI KAISHA (32) Priority Date :NA Address of Applicant :1, Toyota- cho ,Toyota- shi ,Aichi 471(33) Name of priority country :NA 8571 Japan (86) International Application No :PCT/JP2012/083411 (72)Name of Inventor : Filing Date :25/12/2012 1)SUGIYAMA Yoshinobu (87) International Publication No :WO 2014/102892 (61) Patent of Addition to :NA Application Number :NA Filing Date (62) Divisional to Application :NA Number :NA Filing Date (57) Abstract : A power supply system for a vehicle (100) comprises: a main battery (MB); an auxiliary battery (AB); a DC- DC convertor (31); and a control device (50). The DC- DC convertor (31) can perform bidirectional power conversion between the main battery (MB) and the auxiliary battery (AB). When a preliminarily determined period has passed after a stop command is input to the power supply system , the control device (50) performs charging and discharging control for charging either one of the main battery (MB) and the auxiliary battery (AB) while discharging the other of the main battery (MB) and the auxiliary battery (AB) using the DC- DC convertor (31) on the basis of the results of comparing the charging state of the main battery (MB) with the charging state of the auxiliary battery (AB). No. of Pages : 32 No. of Claims : 15 The Patent Office Journal 18/12/2015 65594 (12) PATENT APPLICATION PUBLICATION (21) Application No.4986/DELNP/2015 A (19) INDIA (22) Date of filing of Application :09/06/2015 (43) Publication Date : 18/12/2015 (54) Title of the invention : ABSORBENT ARTICLE WITH PROFILED ACQUISITION DISTRIBUTION SYSTEM (51) International classification :A61F13/537 (71)Name of Applicant : (31) Priority Document No :12196348.2 1)THE PROCTER & GAMBLE COMPANY (32) Priority Date :10/12/2012 Address of Applicant :One Procter & Gamble Plaza, (33) Name of priority country :EPO Cincinnati ,Ohio 45202 U.S.A. (86) International Application No :PCT/US2013/074088 (72)Name of Inventor : Filing Date :10/12/2013 1)BIANCHI, Ernesto ,Gabriel (87) International Publication No :WO 2014/093323 2)SCHNEIDER ,Manuela ,Ines (61) Patent of Addition to Application 3)BAQUER ,MOLAS ,Gemma :NA Number 4)LE, Nguyen Huynh -Trang :NA Filing Date (62) Divisional to Application Number :NA Filing Date :NA (57) Abstract : An absorbent article (20) having an absorbent core comprising at least 80% of superabsorbent polymers (SAP) by weight of its absorbent material. An acquisition -distribution system (ADS) (50) is at least partially disposed between the absorbent core and the topsheet. The ADS extends in the longitudinal direction of the absorbent article at least from a point A1 disposed at a distance D from the front edge to a point A2 disposed at a distance D from the back edge of the article , D being equal to 32% of the length L of the article. The ADS has a basis weight which may be at least 20% lower at the point A2 than at the point A1. No. of Pages : 49 No. of Claims : 15 The Patent Office Journal 18/12/2015 65595 (12) PATENT APPLICATION PUBLICATION (21) Application No.4987/DELNP/2015 A (19) INDIA (22) Date of filing of Application :09/06/2015 (43) Publication Date : 18/12/2015 (54) Title of the invention : ROTARY FLUID MACHINE (51) International classification :F01D11/08,F01D5/20,F01D11/02 (71)Name of Applicant : (31) Priority Document No :NA 1)MITSUBISHI HITACHI POWER SYSTEMS LTD. (32) Priority Date :NA Address of Applicant :3- 1, Minatomirai 3- Chome ,Nishi- ku, (33) Name of priority country :NA Yokohama -shi ,Kanagawa 220-8401 Japan (86) International Application (72)Name of Inventor : :PCT/JP2012/082353 No 1)NISHIJIMA Noriyo :13/12/2012 Filing Date 2)ENDO Akira (87) International Publication 3)YAMAGUCHI Kazuyuki :WO 2014/091599 No (61) Patent of Addition to :NA Application Number :NA Filing Date (62) Divisional to Application :NA Number :NA Filing Date (57) Abstract : Provided is a rotary fluid machine whereby the rate of decrease of the circumferential -direction speed of a leakage fluid in a clearance channel can be reduced , thereby reducing unstable fluid forces. This steam turbine has the following: a clearance channel (15) formed between the outer surface of a rotor- blade cover (6) and the inner surfaces of grooves (14) in a casing (1); annular sealing fins (17A through 17D) that are provided on the rotor -blade- cover (6) side of the clearance channel (15) and are laid out at intervals in a rotoraxis direction; and friction- increasing sections (specifically , rough surfaces (19A through 19E)) provided along the entire circumferential -direction extent of the rotor- blade- cover (6) side of the clearance channel (15). No. of Pages : 58 No. of Claims : 7 The Patent Office Journal 18/12/2015 65596 (12) PATENT APPLICATION PUBLICATION (21) Application No.1596/DEL/2014 A (19) INDIA (22) Date of filing of Application :12/06/2014 (43) Publication Date : 18/12/2015 (54) Title of the invention : BI-LAYER TABLET FORMULATIONS OF CYCLOPHOSPHAMIDE AND CAPECITABINE AND HIGHLY FRACTIONATED METRONOMIC ADMINISTRATION THEREOF (51) International classification :C12N 5/02 (71)Name of Applicant : (31) Priority Document No :NA 1)SANOFI-SYNTHELABO (INDIA) LIMITED (32) Priority Date :NA Address of Applicant :GIDC, Plot No. L-121, Phase III-A, (33) Name of priority country :NA Verna Industrial Estate, Verna- 403722, Goa, India India (86) International Application No :PCT// (72)Name of Inventor : Filing Date :01/01/1900 1)KUM PRASAD (87) International Publication No : NA (61) Patent of Addition to Application Number :NA Filing Date :NA (62) Divisional to Application Number :NA Filing Date :NA (57) Abstract : The present invention relates to a convenient and stable bi-layer oral tablet formulation of cyclophosphamide and capecitabine. The methods of preparation of these formulations are described herein. Moreover, such formulations are useful for metronomic administration to treat cancer, e.g., breast cancer. No. of Pages : 56 No. of Claims : 42 The Patent Office Journal 18/12/2015 65597 (12) PATENT APPLICATION PUBLICATION (21) Application No.4990/DELNP/2015 A (19) INDIA (22) Date of filing of Application :09/06/2015 (43) Publication Date : 18/12/2015 (54) Title of the invention : GOODS RECEIPT METHOD AND APPARATUS, AND WIRELESS RECEIPT TERMINAL (51) International classification :G06Q10/08 (71)Name of Applicant : (31) Priority Document No :201210453738.4 1)ZTE CORPORATION (32) Priority Date :13/11/2012 Address of Applicant :ZTE Plaza, Keji Road South Hi- Tech (33) Name of priority country :China Industrial Park ,Nanshan Shenzhen ,Guangdong 518057 China (86) International Application No :PCT/CN2013/082956 (72)Name of Inventor : Filing Date :04/09/2013 1)WANG, Wei (87) International Publication No :WO 2014/075496 2)YANG, Peng (61) Patent of Addition to Application 3)JIANG, Xiaohua :NA Number :NA Filing Date (62) Divisional to Application Number :NA Filing Date :NA (57) Abstract : The present invention relates to a good receipt method and apparatus, and a wireless receipt terminal. A goods receipt method , configured on a wireless receipt terminal, comprises: obtaining first verification information of goods to be received; interacting with a mobile terminal to obtain second verification information saved on the mobile terminal the second verification information being verification information corresponding to first goods and sent by a server to the mobile terminal; and performing a receipt confirmation operation according to the first verification information and the second verification information. The present invention has the following beneficial effects: goods can be received by using a mobile terminal , which is convenient , and goods logistics information can be checked in real time ,which achieves desirable practicability. No. of Pages : 31 No. of Claims : 19 The Patent Office Journal 18/12/2015 65598 (12) PATENT APPLICATION PUBLICATION (21) Application No.4991/DELNP/2015 A (19) INDIA (22) Date of filing of Application :09/06/2015 (43) Publication Date : 18/12/2015 (54) Title of the invention : COMPRESSOR MOUNTING BASE PLATE (51) International classification :F25D23/00,F25D21/14 (71)Name of Applicant : (31) Priority Document No :4897/CHE/2012 1)DOW GLOBAL TECHNOLOGIES LLC (32) Priority Date :23/11/2012 Address of Applicant :2040 Dow Center, Midland, MI 48674 (33) Name of priority country :India U.S.A. (86) International Application No :PCT/US2013/070884 (72)Name of Inventor : Filing Date :20/11/2013 1)LOKHANDE ,Ashishkumar S. (87) International Publication No :WO 2014/081755 2)BIJJARGI ,Onkareshwar V. (61) Patent of Addition to Application 3)TAWDE ,Nilesh :NA Number 4)MALUNJKAR, Gulab N. :NA Filing Date 5)DIENA, Paolo (62) Divisional to Application Number :NA Filing Date :NA (57) Abstract : An elongated non- metal, non corrosive compressor mounting base plate structure including: (I) a base plate (40) segment having a top surface and a bottom surface ,said base plate segment further comprising four vertical sidewalls (54) disposed perpendicular to the horizontal plane of the base plate and integral with the base plate segment , one vertical sidewall disposed on each of the four sides of the base plate segment and along the perimeter of the top surface of the base plate segment forming a base plate tray member; wherein the base plate segment is adapted for receiving a compressor on the top surface of the base plate segment within the area of the base plate segment surrounded by the four vertical sidewalls; (II) a means (56) for receiving and removably affixing a compressor to the top surface of the base plate segment; and (III) a reinforcement means integral with said base plate segment; wherein said reinforcement means includes at least two elongated transverse reinforcement segments integral with the base plate segment , one transverse reinforcement segment at each of the transverse sides of the base plate segment; said reinforcement means being adapted for providing the compressor mounting base plate structure with sufficient strength and rigidity such that the compressor mounting base plate structure can withstand deformation a load from the weight of the compressor; and wherein the compressor mounting base plate structure comprises a non -metal, non corrosive structure. In an optional preferred embodiment , the above compressor mounting base plate structure may include (IV) at least one load bearing/load distributing structure; (V) a drip tray member which can be integrally or removably attached to the above compressor mounting base plate; and/or (VI) a repositioning means such as wheel members. No. of Pages : 45 No. of Claims : 27 The Patent Office Journal 18/12/2015 65599 (12) PATENT APPLICATION PUBLICATION (21) Application No.4992/DELNP/2015 A (19) INDIA (22) Date of filing of Application :09/06/2015 (43) Publication Date : 18/12/2015 (54) Title of the invention : EXHAUST GAS TURBOCHARGER (51) International classification :F02B37/24,F01D17/14 (71)Name of Applicant : (31) Priority Document No :102012022930.5 1)BORGWARNER INC. (32) Priority Date :23/11/2012 Address of Applicant :Patent Department, 3850 Hamlin Road, (33) Name of priority country :Germany Auburn Hills, MI 48326 U.S.A. (86) International Application No :PCT/US2013/069971 (72)Name of Inventor : Filing Date :14/11/2013 1)METZ ,Dietmar (87) International Publication No :WO 2014/081602 (61) Patent of Addition to Application :NA Number :NA Filing Date (62) Divisional to Application Number :NA Filing Date :NA (57) Abstract : The present invention relates to an exhaus-t gas turbocharger (1) having a turbine (2) which has a turbine wheel (3) surrounded by an inflow duct (4), and having a VTG cartridge (5), which VTG cartridge has a disc (6) and a vane bearing ring (7) , which delimit the inflow duct (4) , and which VTG cartridge has a multiplicity of vanes (8) which are arranged in the inflow duct (4) and which are mounted in the vane bearing ring (7) by way of rotatable vane shafts (9), which vane shafts are connected to vane levers (10) , the lever heads (11) of which engage into associated grooves (12) in an adjusting ring (13) which surrounds the vane bearing ring (7) ,on the outside; and having a radial bearing between the adjusting ring (13) and the vane bearing ring (7) , wherein two min -flow stops (25 , 26) are arranged , with a selectable angular spacing ( a) with respect to one another , on the vane bearing ring (7). No. of Pages : 14 No. of Claims : 5 The Patent Office Journal 18/12/2015 65600 (12) PATENT APPLICATION PUBLICATION (21) Application No.1570/DEL/2014 A (19) INDIA (22) Date of filing of Application :10/06/2014 (43) Publication Date : 18/12/2015 (54) Title of the invention : FORMULATION FOR TARGETED DELIVERY OF ANTICANCER COMPOUND (51) International classification :A61K 31/74 :NA :NA :NA :NA :NA : NA :NA :NA : :01/01/1900 (71)Name of Applicant : 1)COUNCIL OF SCIENTIFIC & INDUSTRIAL RESEARCH Address of Applicant :ANUSANDHAN BHAWAN, RAFI MARG, NEW DELHI - 110001, INDIA. Delhi India (72)Name of Inventor : 1)BHARAT KUMAR MAJETI 2)PRIYA PRAKASH KARMALI 3)DIPANKAR PRAMANIK 4)ARABINDA CHAUDHARI (31) Priority Document No (32) Priority Date (33) Name of priority country (86) International Application No Filing Date (87) International Publication No (61) Patent of Addition to Application Number Filing Date (62) Divisional to Application Number Filed on (57) Abstract : The present invention provides synthesis of a novel series of cationic lipopeptides with integrin-binding RGD functionalities. The invention also provides phenomenally high L27 (transformed S180, mouse sarcoma cells) cell tropic gene transfer properties of these novel RGD-lipopeptides. Since L27 cell surface contains over expressed integrins, the present class of lipopeptides with integrinbinding RGD ligands are likely to find future applications in targeting anti-cancer genes/drugs to the endothelial cells of tumor vasculatures (possessing over expressed integrins). No. of Pages : 32 No. of Claims : 15 The Patent Office Journal 18/12/2015 65601 (12) PATENT APPLICATION PUBLICATION (21) Application No.4994/DELNP/2015 A (19) INDIA (22) Date of filing of Application :09/06/2015 (43) Publication Date : 18/12/2015 (54) Title of the invention : NON -FRIED POTATO CHIPS AND PRODUCTION METHOD THEREFOR (51) International classification :A23L1/217 (71)Name of Applicant : (31) Priority Document No :2012258352 1)NISSIN FOODS HOLDINGS CO., LTD. (32) Priority Date :27/11/2012 Address of Applicant :1- 1, Nishinakajima 4 -chome (33) Name of priority country :Japan ,Yodogawa -ku ,Osaka- shi ,Osaka 532-8524 Japan (86) International Application No :PCT/JP2013/006939 (72)Name of Inventor : Filing Date :26/11/2013 1)ONISHI ,Atsushi (87) International Publication No :WO 2014/083837 2)MIYAZAKI ,Yoshifumi (61) Patent of Addition to Application 3)TANAKA ,Mitsuru :NA Number :NA Filing Date (62) Divisional to Application Number :NA Filing Date :NA (57) Abstract : The purpose o the present invention is to provide a production method that obtains non-fried potato chips having a low fat content as a result of being produced without being Med in oil, and not being inferior in flavor or texture t o potato ch i s produce a by flying in oil. This production method for potato chips i s characterized by including a step in which sliced potato i s heated by superheated vapor, then a high-temperature, high-speed air flow of at least 100 °C i s blown thereupon to heat treat same. No. of Pages : 18 No. of Claims : 7 The Patent Office Journal 18/12/2015 65602 (12) PATENT APPLICATION PUBLICATION (21) Application No.4995/DELNP/2015 A (19) INDIA (22) Date of filing of Application :09/06/2015 (43) Publication Date : 18/12/2015 (54) Title of the invention : METHOD AND APPARATUS FOR ENCAPSULATION OF MOTION PICTURE EXPERTS GROUP MEDIA TRANSPORT ASSETS IN INTERNATIONAL ORGANIZATION FOR STANDARDIZATION BASE MEDIA FILES (51) International classification :H04N21/235,H04N7/24 (71)Name of Applicant : (31) Priority Document No :61/731360 1)SAMSUNG ELECTRONICS CO. ,LTD. (32) Priority Date :29/11/2012 Address of Applicant :129, Samsung- ro, Yeongtong- gu, (33) Name of priority country :U.S.A. Suwon- si, Gyeonggi- do 443- 742 Republic of Korea (86) International Application No :PCT/KR2013/010932 (72)Name of Inventor : Filing Date :28/11/2013 1)BOUAZIZI ,Imed (87) International Publication No :WO 2014/084643 2)LIM ,Young -Kwon (61) Patent of Addition to Application 3)BHAT ,Kong Posh :NA Number :NA Filing Date (62) Divisional to Application Number :NA Filing Date :NA (57) Abstract : An apparatus includes receive path circuitry configured to receive a Motion Picture Experts Group (MPEG) Media Transport (MMT) container and a processing device configured to identify locations of one or more media fragment units (MFUs) in the MMT container using a hint track within the MMT container. Another apparatus includes transmit path circuitry configured to transmit an MMT container and a processing device configured to identify locations of one or more MFUs in the MMT container using a hint track within the MMT container. No. of Pages : 20 No. of Claims : 15 The Patent Office Journal 18/12/2015 65603 (12) PATENT APPLICATION PUBLICATION (21) Application No.4996/DELNP/2015 A (19) INDIA (22) Date of filing of Application :09/06/2015 (43) Publication Date : 18/12/2015 (54) Title of the invention : APPARATUS AND METHOD FOR PERFORMING MULTI -VIEW DISPLAY (51) International classification :H04N21/43,H04N21/4227 (71)Name of Applicant : (31) Priority Document No :1020120135407 1)SAMSUNG ELECTRONICS CO., LTD. (32) Priority Date :27/11/2012 Address of Applicant :129 ,Samsung -ro, Yeongtong- gu, (33) Name of priority country :Republic of Korea Suwon- si, Gyeonggi -do 443- 742 Republic of Korea (86) International Application No :PCT/KR2013/010533 (72)Name of Inventor : Filing Date :20/11/2013 1)SEO ,Je -hwan (87) International Publication No :WO 2014/084539 2)YANG ,Geun- sam (61) Patent of Addition to Application 3)LEE ,Seung -bok :NA Number 4)HA, Tae -hyeun :NA Filing Date (62) Divisional to Application Number :NA Filing Date :NA (57) Abstract : A display apparatus is provided, including a video processor configured to process video data of contents , a display configured to display content views using the video data processed by the video processor , a communication unit configured to communicate with an external device which is paired with the display apparatus, and a control unit configured to assign a remote control right to a content view corresponding to the remote control right switching command from among the content views based on whether the remote control right switching command is received from the external device. If a remote control signal is received , the control unit performs an operation corresponding to the remote control signal with respect to the content view having the remote control right. No. of Pages : 43 No. of Claims : 15 The Patent Office Journal 18/12/2015 65604 (12) PATENT APPLICATION PUBLICATION (21) Application No.4997/DELNP/2015 A (19) INDIA (22) Date of filing of Application :09/06/2015 (43) Publication Date : 18/12/2015 (54) Title of the invention : AN ELECTRIC COOLING SYSTEM (51) International classification :F25D23/00,F25B49/02 (71)Name of Applicant : (31) Priority Document No :BR 10 2012 031607 2 1)WHIRLPOOL S.A. (32) Priority Date :11/12/2012 Address of Applicant :Av. das Na§µes Unidas, 12.995 ,32° (33) Name of priority country :Brazil andar, Brooklin Novo, CEP: 04578- 000 S£o Paulo, SP Brazil (86) International Application No :PCT/BR2013/000554 (72)Name of Inventor : Filing Date :11/12/2013 1)J.H. KALLUF, Flavio (87) International Publication No :WO 2014/089655 2)VON FRHAUF, Felipe Augusto (61) Patent of Addition to Application :NA Number :NA Filing Date (62) Divisional to Application Number :NA Filing Date :NA (57) Abstract : The present invention relates to an electric cooling system (1) comprising at least one low power transformer (3) provided with a primary electric terminal (5) and a secondary electric terminal (6) , a cooling equipment (7) fed by a network voltage (2) , and a hermetic compressor provided with a pressure relief system (8). The electric cooling system (1 ) is configured so that the low power transformer (3) is electrically connectable to the cooling equipment (7) and to the hermetic compressor provided with a pressure relief system (8) , wherein the primary electric terminal (5) is electrically connectable to the cooling equipment (7) and the secondary electric terminal (6) is electrically connectable to the hermetic compressor provided with the pressure relief system (8). No. of Pages : 21 No. of Claims : 12 The Patent Office Journal 18/12/2015 65605 (12) PATENT APPLICATION PUBLICATION (21) Application No.5003/DELNP/2015 A (19) INDIA (22) Date of filing of Application :09/06/2015 (43) Publication Date : 18/12/2015 (54) Title of the invention : SYSTEMS AND METHODS FOR DIFFERENTIAL PAIR IN PAIR SKEW DETERMINATION AND COMPENSATION (51) International classification :H04L7/00 (71)Name of Applicant : (31) Priority Document No :13/720283 1)DELL PRODUCTS L.P. (32) Priority Date :19/12/2012 Address of Applicant :One Dell Way, Round Rock ,TX 78682 (33) Name of priority country :U.S.A. 2244 U.S.A. (86) International Application No :PCT/US2013/047000 (72)Name of Inventor : Filing Date :21/06/2013 1)LAMBERT, Timothy, M. (87) International Publication No :WO 2014/098991 2)PATEL ,Bhavesh ,Govindbhai (61) Patent of Addition to Application 3)MUTNURY, Bhyrav ,M. :NA Number :NA Filing Date (62) Divisional to Application Number :NA Filing Date :NA (57) Abstract : In accordance with embodiments of the present disclosure, an information handling system may include a processor, a first information handling resource communicatively coupled to the processor , and a second information handling resource communicatively coupled to the processor and the first information handling resource. The first information handling resource and the second information handling resource may be configured to, in concert determine an optimum delay between opposite polarity signals for differential signals communicated from the first information handling resource to the second information handling resource via a path comprising a differential pair and transmit data from the first information handling resource to the second information handling resource via the path by inserting a delay into one of the opposite polarity signals equal to the optimum delay. No. of Pages : 22 No. of Claims : 9 The Patent Office Journal 18/12/2015 65606 (12) PATENT APPLICATION PUBLICATION (21) Application No.5004/DELNP/2015 A (19) INDIA (22) Date of filing of Application :09/06/2015 (43) Publication Date : 18/12/2015 (54) Title of the invention : CLOUD BASED STREAMING DATA RECEIVER AND PERSISTER (51) International classification :G06F7/00 (71)Name of Applicant : (31) Priority Document No :13/763520 1)DELL ,INC. (32) Priority Date :08/02/2013 Address of Applicant :One Dell Way, MS RR1- 33, Round (33) Name of priority country :U.S.A. Rock ,TX 78682 U.S.A. (86) International Application No :PCT/US2013/046277 2)MANDAL, Kaniska Filing Date :18/06/2013 (72)Name of Inventor : (87) International Publication No :WO 2014/123564 1)MANDAL ,Kaniska (61) Patent of Addition to Application :NA Number :NA Filing Date (62) Divisional to Application Number :NA Filing Date :NA (57) Abstract : The present system receives streaming raw data and inserts context into the raw data. The context raw data may be partitioned into sub- batches and transmitted to a data receiver and persister. The raw data may include context information as well as child -parent information to assist with persisting data. The context may be used to place the data in buckets without analysis of the data , thereby saving time and resources while storing the data batches No. of Pages : 23 No. of Claims : 21 The Patent Office Journal 18/12/2015 65607 (12) PATENT APPLICATION PUBLICATION (21) Application No.5005/DELNP/2015 A (19) INDIA (22) Date of filing of Application :09/06/2015 (43) Publication Date : 18/12/2015 (54) Title of the invention : VACUUM INTERRUPTER AND A VACUUM BREAKER WITH THE VACUUM INTERRUPTER (51) International classification :H01H33/664,H01H33/66 (71)Name of Applicant : (31) Priority Document No :201210544572.7 1)EATON CORPORATION (32) Priority Date :14/12/2012 Address of Applicant :1000 Eaton Boulevard, Cleveland ,Ohio (33) Name of priority country :China 44122 U.S.A. (86) International Application No :PCT/CN2013/088030 (72)Name of Inventor : Filing Date :28/11/2013 1)YU, Li (87) International Publication No :WO 2014/090089 (61) Patent of Addition to Application :NA Number :NA Filing Date (62) Divisional to Application Number :NA Filing Date :NA (57) Abstract : The present invention provides a vacuum interrupter (100, 100 ) comprising: a housing (1); a static contact (4) accommodated in the housing (1); a moving contact (5) accommodated in the housing (1) , the moving contact being movable so as to be jointed to or separated from the static contact (5); a conductive base (12) secured in the housing (1), the conductive base (12) maintaining electric connection to the moving contact (5); a flexible electric connection structure accommodated in the housing (1) and for connecting the moving contact (5) and the conductive base (12); and an operating mechanism for operating the moving contact (5) to move the moving contact (5). Te present invention further provides a vacuum breaker with the vacuum interrupter. No. of Pages : 34 No. of Claims : 17 The Patent Office Journal 18/12/2015 65608 (12) PATENT APPLICATION PUBLICATION (21) Application No.5006/DELNP/2015 A (19) INDIA (22) Date of filing of Application :09/06/2015 (43) Publication Date : 18/12/2015 (54) Title of the invention : BEVERAGE PRODUCTION DEVICE USING CENTRIFUGATION FOR EXTRACTING A LIQUID COMPRISING HEAT LOSS COMPENSATING MEANS (51) International classification :A47J31/22 (71)Name of Applicant : (31) Priority Document No :12196773.1 1)NESTEC S.A. (32) Priority Date :12/12/2012 Address of Applicant :Av. Nestl 55, CH- 1800 Vevey (33) Name of priority country :EPO Switzerland (86) International Application No :PCT/EP2013/076172 (72)Name of Inventor : Filing Date :11/12/2013 1)PERENTES, Alexandre (87) International Publication No :WO 2014/090850 2)YOAKIM, Alfred (61) Patent of Addition to Application 3)COLANTONIO, Jean- Luc :NA Number 4)STAUB ,Andreas :NA Filing Date (62) Divisional to Application Number :NA Filing Date :NA (57) Abstract : Beverage production device for preparing a liquid extract by interaction between a liquid and food ingredients to form the liquid extract by effect of centrifugation of the liquid passing through the ingredients comprising: a brewing unit (2) for receiving the food ingredients , a collecting unit (18) for collecting the liquid extract centrifuged outside the centrifugal unit driving means connected to the centrifugal unit for driving the centrifugal unit in rotation, liquid supply means being connected to the centrifugal unit to supply liquid in the centrifugal unit, wherein the collecting unit (18) comprises a heater (10) for heating the liquid supplied in the centrifugal unit , said heater (10) being further arranged to heat the liquid extract after it leaves the brewing unit (2). No. of Pages : 24 No. of Claims : 15 The Patent Office Journal 18/12/2015 65609 (12) PATENT APPLICATION PUBLICATION (21) Application No.1949/DEL/2012 A (19) INDIA (22) Date of filing of Application :25/06/2012 (43) Publication Date : 18/12/2015 (54) Title of the invention : A SYNERGISTIC PHARMACEUTICAL COMPOSITION USEFUL FOR THE TREATMENT OF LUNG CANCER (51) International classification (31) Priority Document No (32) Priority Date (33) Name of priority country (86) International Application No Filing Date (87) International Publication No (61) Patent of Addition to Application Number Filing Date (62) Divisional to Application Number Filing Date (71)Name of Applicant : 1)COUNCIL OF SCIENTIFIC & INDUSTRIAL RESEARCH Address of Applicant :ANUSANDHAN BHAWAN, RAFI MARG, NEW DELHI - 110001, INDIA Delhi India :A61K 2)VISVA-BHARATI :NA (72)Name of Inventor : :NA 1)MANTU BHUYAN :NA 2)PRANAB RAM BHATTACHARYYA :NA 3)PRANAB KUMAR BARUAH :NA 4)NABIN CHANDRA BARUA : NA 5)PARUCHURI GANGADHAR RAO :NA 6)SUSHMITA BHATTACHARYA :NA 7)RAKESH KUNDU :NA 8)PRIYAJIT CHATTERJEE :NA 9)SOMA SEAL 10)SANDEEP MUKHERJEE 11)SUMAN DASGUPTA 12)SUDIPTA MOITRA 13)SHELLEY BHATTACHARYA 14)SAMIR BHATTACHARYA (57) Abstract : The present invention relates to a synergistic pharmaceutical composition comprising Compound C2 (Neo-isopulegol), C3 (Isopulegol) and C4 (Citronellol) derived from herbal seed extract of Litsea cubeba useful for the treatment of lung cancer. The present invention also relates to the activity of compounds C2 cr C3 or C4 either alone or in combination in killing of A549 lung cancer cells. No. of Pages : 30 No. of Claims : 5 The Patent Office Journal 18/12/2015 65610 (12) PATENT APPLICATION PUBLICATION (21) Application No.2375/DEL/2010 A (19) INDIA (22) Date of filing of Application :01/10/2010 (43) Publication Date : 18/12/2015 (54) Title of the invention : SELF-SUSTAINED BIO-DIGESTER FOR ONBOARD DEGRADATION OF HUMAN WASTE (51) International classification :C05F3/00 (71)Name of Applicant : (31) Priority Document No :NA 1)DIRECTOR GENERAL, DEFENCE RESEARCH & (32) Priority Date :NA DEVELOPMENT ORGANIZATION (33) Name of priority country :NA Address of Applicant :MINISTRY OF DEFENCE, (86) International Application No :NA GOVERNMENT OF INDIA, ROOM NO. 348, B-WING, DRDO Filing Date :NA BHAVAN, RAJAJI MARG, NEW DELHI:- 110 011 Delhi India (87) International Publication No :NA (72)Name of Inventor : (61) Patent of Addition to Application Number :NA 1)DEV VRAT KAMBOJ Filing Date :NA 2)LOKENDRA SINGH (62) Divisional to Application Number :NA 3)VICHITRA KUMAR GANGWAR Filing Date :NA 4)RAJAGOPALAN VIJAYARAGHAVAN (57) Abstract : This invention relates to the field of human waste handling, treatment and disposal in mobile public carriers. In particular the invention is directed to a self- sustained bio-digester for onboard degradation of human waste. Said bio-digester comprising at least three components; - biological treatment component, - chemical treatment component; and - non-biodegradable materials elimination component No. of Pages : 22 No. of Claims : 14 The Patent Office Journal 18/12/2015 65611 (12) PATENT APPLICATION PUBLICATION (21) Application No.4706/DELNP/2012 A (19) INDIA (22) Date of filing of Application :28/05/2012 (43) Publication Date : 18/12/2015 (54) Title of the invention : METHOD FOR DIAGNOSING MALIGNANT TUMOR (51) International classification :G01N21/64 (71)Name of Applicant : (31) Priority Document No :2009-285492 1)SEKISUI MEDICAL CO. LTD. (32) Priority Date :16/12/2009 Address of Applicant :13-5 Nihonbashi 3-chome Chuo-ku (33) Name of priority country :Japan Tokyo 103-0027 Japan (86) International Application No :PCT/JP2010/072521 (72)Name of Inventor : Filing Date :15/12/2010 1)HIROYUKI EBINUMA (87) International Publication No :WO 2011/074594 2)KOHEI TAKUBO (61) Patent of Addition to Application 3)MASANAO MATSUO :NA Number 4)ISAMU FUKAMACHI :NA Filing Date 5)HIDEAKI BUJO (62) Divisional to Application Number :NA 6)CHIAKI NAKASEKO Filing Date :NA 7)YASUSHI SAITO (57) Abstract : Provided are a method for determining the presence of a malignant tumor or the severity thereof, selecting a therapeutic method therefor or evaluating the effect of said therapeutic method, or estimating the recurrence risk of said malignant tumor or the presence or absence of the recurrence of the same, and a diagnostic kit for the same purposes. The method for determining the presence of a malignant tumor or the severity thereof, selecting a therapeutic method therefor or evaluating the effect of said therapeutic method, or estimating the recurrence risk of said malignant tumor or the presence or absence of the recurrence of the same is characterized by comprising: a step (1) for measuring the concentration and/or quantity of soluble LR11 in a sample originating in a subject; and a step (2) for comparing the measurement data with the measurement data of soluble LR11 obtained from a group of normal subjects. No. of Pages : 41 No. of Claims : 11 The Patent Office Journal 18/12/2015 65612 (12) PATENT APPLICATION PUBLICATION (21) Application No.5013/DELNP/2015 A (19) INDIA (22) Date of filing of Application :10/06/2015 (43) Publication Date : 18/12/2015 (54) Title of the invention : SUBSURFACE IMAGING RADAR (51) International classification :G01S7/292,G01S13/04 (71)Name of Applicant : (31) Priority Document No :NA 1)SAAB AB (32) Priority Date :NA Address of Applicant :S -581 88 Linkping Sweden (33) Name of priority country :NA (72)Name of Inventor : (86) International Application No :PCT/SE2012/051414 1)HELLSTEN, Hans Filing Date :17/12/2012 (87) International Publication No :WO 2014/098660 (61) Patent of Addition to Application :NA Number :NA Filing Date (62) Divisional to Application Number :NA Filing Date :NA (57) Abstract : A method and system for obtaining SAR images with reduced or eliminated surface clutter to detect subsurface targets , the method comprising the following steps: - selecting a first frequency and an incidence angle for the radar signal such that the ratio of surface backscattering to subsurface target backscattering is significantly larger for vertical polarization than for horizontal -obtaining vertically and horizontally polarized SAR images based on the same SAR path exploiting the selected first frequency and viewing angle weighting and differencing the vertically and horizontally polarized SAR images so that the surface backscattering completely cancels between the two images and only the combination of the target backscattering components remains. No. of Pages : 34 No. of Claims : 15 The Patent Office Journal 18/12/2015 65613 (12) PATENT APPLICATION PUBLICATION (21) Application No.5014/DELNP/2015 A (19) INDIA (22) Date of filing of Application :10/06/2015 (43) Publication Date : 18/12/2015 (54) Title of the invention : CH3 DOMAIN VARIANT PAIR INDUCING FORMATION OF HETERODIMER OF HEAVY CHAIN CONSTANT REGION OF ANTIBODY AT HIGH EFFICIENCY , METHOD FOR PREPARING SAME AND USE THEREOF (51) International (71)Name of Applicant : :C12N15/13,C07K16/18,C07K16/46 classification 1)AJOU UNIVERSITY INDUSTRY ACADEMIC (31) Priority Document No :1020120135586 COOPERATION FOUNDATION (32) Priority Date :27/11/2012 Address of Applicant :(Woncheon -dong) 206, World cup- ro, (33) Name of priority country :Republic of Korea Yeongtong -gu, Suwon- si, Gyeonggi -do 443 -749 Republic of (86) International Korea :PCT/KR2013/010861 Application No (72)Name of Inventor : :27/11/2013 Filing Date 1)KIM ,Yong Sung (87) International Publication 2)CHOI ,Hye Ji :WO 2014/084607 No 3)SUNG, Eun Sil (61) Patent of Addition to :NA Application Number :NA Filing Date (62) Divisional to :NA Application Number :NA Filing Date (57) Abstract : The present invention relates to a CH3 domain variant pair of an antibody, to a method for preparing same, and to a use thereof, wherein a mutation is induced in the CH3 domain so as to improve a yield of forming a heterodimer heavy chain constant region of an antibody. The CH3 domain heterodimer according to the present invention, forms a heterodimer heavy chain constant region with a high efficiency of 90 to 95% or more and also has outstanding heat stability. A heterodimer heavy chain constant region including the CH3 domain heterodimer can construct a bispecific monoclonal antibody which simultaneously recognizes two kinds of antigens. The CH3 domain heterodimer of the present invention and the bispecific antibody or fusion protein of an antibody constant region comprising same can be usefully applied to the treatment or prevention of a disease associated with a target antigen or a target protein. No. of Pages : 107 No. of Claims : 27 The Patent Office Journal 18/12/2015 65614 (12) PATENT APPLICATION PUBLICATION (21) Application No.1669/DEL/2009 A (19) INDIA (22) Date of filing of Application :11/08/2009 (43) Publication Date : 18/12/2015 (54) Title of the invention : A PROCESS AND AN APPARATUS FOR HYDROFORMING A TUBE, AND A METHOD OF ASSEMBLING THEREOF (51) International classification :B21D (71)Name of Applicant : (31) Priority Document No :NA 1)THE DIRECTOR GENERAL DEFENCE RESEARCH & (32) Priority Date :NA DEVELOPMENT ORGANIZATION [DRDO] (33) Name of priority country :NA Address of Applicant :Ministry of Defence Govt. of India (86) International Application No :NA Room No. 348 B-wing DRDO Bhawan Rajaji Marg New Delhi Filing Date :NA Delhi India (87) International Publication No : NA (72)Name of Inventor : (61) Patent of Addition to Application Number :NA 1)P. RAMACHANDRA RAO Filing Date :NA 2)M. K. HADA (62) Divisional to Application Number :NA Filing Date :NA (57) Abstract : The present invention relates to a process known as hydroforming•, more particularly relates to tube hydroforming, wherein a process for hydroforming a tube (1) made of a ductile material, said process comprising acts of providing a die (2) having an interior surface of a shape to which the tube (1) is desired to have hydroformed part of outer surface of the tube (1), filling predetermined quantity of mixture of sand and oil into the tube (1), emplacing the filled tube (1) within said die (2) and closing the die (2), and applying pressure in interior surface of the tube (1) to conform the tube (1) to the inner surface of the closed die (2) for obtaining hydroformed tube. Figure 3 No. of Pages : 25 No. of Claims : 10 The Patent Office Journal 18/12/2015 65615 (12) PATENT APPLICATION PUBLICATION (21) Application No.1669/DEL/2012 A (19) INDIA (22) Date of filing of Application :31/05/2012 (43) Publication Date : 18/12/2015 (54) Title of the invention : A SYSTEM FOR GENERATING REFRESHABLE TACTILE TEXT AND GRAPHICS (51) International classification :G06F (71)Name of Applicant : 1/10 1)INDIAN INSTITUTE OF TECHNOLOGY, DELHI :NA Address of Applicant :HAUZ KHAS, NEW DELHI-110016 :NA Delhi India :NA (72)Name of Inventor : :NA 1)RAO PARIGI VEDANTI MADHUSUDHAN :NA 2)JAIN PRANAY : NA 3)SINGHAL ANSHUL :NA 4)BALAKRISHNAN MEENAKSHI :NA 5)GUPTA KSHITIJ :NA :NA (31) Priority Document No (32) Priority Date (33) Name of priority country (86) International Application No Filing Date (87) International Publication No (61) Patent of Addition to Application Number Filing Date (62) Divisional to Application Number Filing Date (57) Abstract : The present invention discloses a refreshable tactile display device for displaying tactile forms including Braille characters and planar graphics. The device comprises a plurality of electronic units, a cooling unit (18), and a filter (19). The electronic unit comprises a plurality of Braille dots (2b, 20a), a plurality of tactile elements (2), an upper structure element ( l ), a wire housing (6), and a lower structure element (7). Each of the tactile elements (2) includes a shape memory alloy wire (3), crimp terminals (4) at both ends of said wire (3) and a pair of concentric parallel compression springs (5). The invention uses shape memory alloy to selectively project and retain Braille dots, for use in modular tactile displays of multiple character rows that form the primary tactile output devices. No. of Pages : 27 No. of Claims : 22 The Patent Office Journal 18/12/2015 65616 (12) PATENT APPLICATION PUBLICATION (21) Application No.2092/DEL/2011 A (19) INDIA (22) Date of filing of Application :25/07/2011 (43) Publication Date : 18/12/2015 (54) Title of the invention : A WATER BORNE ADHESIVE BINDER FOR ADHERING AND ENCAPSULATING PLARIZATION MAINTAINING OPTICAL FIBRE (51) International classification (31) Priority Document No (32) Priority Date (33) Name of priority country (86) International Application No Filing Date (87) International Publication No (61) Patent of Addition to Application Number Filing Date (62) Divisional to Application Number Filing Date :C08L :NA :NA :NA :NA :NA :NA :NA :NA :NA :NA (71)Name of Applicant : 1)DIRECTOR GENERAL, DEFENCE RESEARCH & DEVELOPMENT ORGANISATION Address of Applicant :MINISTRY OF DEFENCE, GOVT OF INDIA, ROOM NO 348, B-WING, DRDO BHAWAN, RAJAJI MARG, NEW DELHI-110105. INDIA Delhi India (72)Name of Inventor : 1)NORI KRISHNAMURTI 2)JAGANNATH NAYAK 3)PRADEEP KUMAR 4)BADRI RAMESH BABU 5)MD. AZEEMUDDIN (57) Abstract : An optical fibre package comprising an adhesive for coating optical fibers comprising part A and part B wherein Part A is an aqueous polymeric emulsion of 2- ethylhexylacrylate or butyl acrylate and acrylic acid or methacrylic acid and Part-B is polyvinylbutyral dissolved in isopropyl alcohol. The said system imparts stability to the optical fiber on long range exposure thereby improving performance. No. of Pages : 18 No. of Claims : 13 The Patent Office Journal 18/12/2015 65617 (12) PATENT APPLICATION PUBLICATION (21) Application No.5028/DELNP/2015 A (19) INDIA (22) Date of filing of Application :10/06/2015 (43) Publication Date : 18/12/2015 (54) Title of the invention : DEVICE AND METHOD FOR CONFIGURATING ALMOST BLANK SUBFRAME ,AND HETEROGENEOUS WIRELESS COMMUNICATION NETWORK (51) International classification :H04W72/04 (71)Name of Applicant : (31) Priority Document No :201210495977.6 1)SONY CORPORATION (32) Priority Date :28/11/2012 Address of Applicant :1 7 1 Konan Minato ku Tokyo 108 0075 (33) Name of priority country :China Japan (86) International Application No :PCT/CN2013/086308 (72)Name of Inventor : Filing Date :31/10/2013 1)CUI Qimei (87) International Publication No :WO 2014/082518 2)TIAN Hui (61) Patent of Addition to Application 3)WANG Meng :NA Number 4)TIAN Peng :NA Filing Date 5)GAO Liqi (62) Divisional to Application Number :NA Filing Date :NA (57) Abstract : The disclosed relates to a device and method for configurating almost blank subframe , and a heterogeneous wireless communication network. The device comprises: a first information acquisition unit for acquiring first information , wherein the first information relates to the index that indicates the communication quality of the user terminal served by an aggressor base station; a second information acquisition unit for acquiring second information , wherein the second information relates to the index that indicates the interference degree of user terminal interfered by the aggressor base station; an configuration unit for configurating ,based on the first information and second information, the almost blank subframe sent by the aggressor base station by adjusting at least one of the almost blank subframe silence rate and the power decrease amount. The disclosed technical solution improves the overall performance of the heterogeneous wireless communication network. No. of Pages : 43 No. of Claims : 20 The Patent Office Journal 18/12/2015 65618 (12) PATENT APPLICATION PUBLICATION (21) Application No.1374/DEL/2010 A (19) INDIA (22) Date of filing of Application :14/06/2010 (43) Publication Date : 18/12/2015 (54) Title of the invention : A NUCLEAR MAGNETIC RESONANCE (NMR) INSTRUMENT CONFIGURABLE FOR OBSERVING FLUORINE NUCLEUS (51) International classification :G01R33/36 (71)Name of Applicant : (31) Priority Document No :NA 1)DIRECTOR GENERAL, DEFENCE RESEARCH & (32) Priority Date :NA DEVELOPMENT ORGANISATION (33) Name of priority country :NA Address of Applicant :DRDO, MINISTRY OF DEFENCE, (86) International Application No :NA ROOM NO. 348, B-WING, DRDO BHAVAN, RAJAJI MARG, Filing Date :NA NEW DELHI-110011 (INDIA); Delhi India (87) International Publication No :NA (72)Name of Inventor : (61) Patent of Addition to Application Number :NA 1)SHARMA, MAMTA Filing Date :NA 2)SURYANARAYANA, MALLADI VENKATA SATYA (62) Divisional to Application Number :NA 3)RAZA, SYED KALBEY Filing Date :NA (57) Abstract : A Nuclear Magnetic Resonance (NMR) instrument configurable for observing Fluorine nucleus. The NMR instrument comprises a selective amplifier, a broadband amplifier, at least a first preamplifier and a second preamplifier adaptable to be coupled to the selective amplifier and the broadband amplifier respectively and an observer probe having an inner coil and an outer coil. The selective amplifier amplifies a first Radio Frequency (RF) signal. The first preamplifier is adaptable to amplify and pass the first RF signal and the second preamplifier is adaptable to amplify and pass a second RF signal amplified by the broadband amplifier. The improvement in the NMR instrument comprises the second preamplifier being configured to amplify and pass the first RF signal. The second preamplifier is connected to the selective amplifier for receiving the first RF signal and to the outer coil of the probe to supply the first RF signal thereto for observing the Fluorine nucleus. No. of Pages : 23 No. of Claims : 10 The Patent Office Journal 18/12/2015 65619 (12) PATENT APPLICATION PUBLICATION (21) Application No.1623/DEL/2014 A (19) INDIA (22) Date of filing of Application :16/06/2014 (43) Publication Date : 18/12/2015 (54) Title of the invention : ETS-1 IDENTIFYING POLYNUCLEOTIDE SEQUENCE (51) International classification :C07K14/47 (71)Name of Applicant : (31) Priority Document No :NA 1)NATIONAL INSTITUTE OF PHARMACEUTICAL (32) Priority Date :NA EDUCATION & RESEARCH (NIPER) (33) Name of priority country :NA Address of Applicant :Sector-67, S.A.S. Nagar, Punjab-160 (86) International Application No :NA 062, India; Punjab India Filing Date :NA (72)Name of Inventor : (87) International Publication No : NA 1)TIKOO, Kulbhushan (61) Patent of Addition to Application Number :NA 2)KAUR, Jasmine Filing Date :NA (62) Divisional to Application Number :NA Filing Date :NA (57) Abstract : The present invention provides a novel polynucleotide sequence comprising SEQ ID NO. 1. Said sequence is an aptamer. SEQ ID NO 1: 5™ CUGGGGUUAUGAGGUUUCCGGGGAA 3™ The sequence can be used for targeted delivery of pharmaceutical agents to the organs, tissues and cells in a diseased state. The present invention provides a polynucleotide sequence which specifically identifies the transcription factor Ets-1 in malignant cells. No. of Pages : 41 No. of Claims : 18 The Patent Office Journal 18/12/2015 65620 (12) PATENT APPLICATION PUBLICATION (21) Application No.2589/DEL/2012 A (19) INDIA (22) Date of filing of Application :21/08/2012 (43) Publication Date : 18/12/2015 (54) Title of the invention : NOVEL PHARMACEUTICAL FORMULATION FOR MOUTH DISSOLVING TABLET OF CEFIXIME (51) International classification :A61K (71)Name of Applicant : (31) Priority Document No :NA 1)ATUL KUMAR GUPTA (32) Priority Date :NA Address of Applicant :M.M. COLLEGE OF PHARMACY, (33) Name of priority country :NA M.M. UNIVERSITY, MULLANA, HARYANA-133207, INDIA (86) International Application No :NA Haryana India Filing Date :NA (72)Name of Inventor : (87) International Publication No : NA 1)ATUL KUMAR GUPTA (61) Patent of Addition to Application Number :NA 2)ASHOK KUMAR Filing Date :NA 3)DINA NATH MISHRA (62) Divisional to Application Number :NA 4)SHAILENDRA KUMAR SINGH Filing Date :NA (57) Abstract : This invention relates to a mouth dissolving tablet of Cefixime or pharmaceutically acceptable salts thereof comprising granules of Cefixime, Mannitol and Citric Acid wherein granules are prepared by wet granulation method using sucrose solution as binder. No. of Pages : 9 No. of Claims : 7 The Patent Office Journal 18/12/2015 65621 (12) PATENT APPLICATION PUBLICATION (21) Application No.5019/DELNP/2015 A (19) INDIA (22) Date of filing of Application :10/06/2015 (43) Publication Date : 18/12/2015 (54) Title of the invention : NON- STAINING TOOTHPASTE (51) International classification :A61K8/29,A61Q11/00,A61K8/49 (71)Name of Applicant : (31) Priority Document No :NA 1)COLGATE -PALMOLIVE COMPANY (32) Priority Date :NA Address of Applicant :300 Park Avenue, New York ,New (33) Name of priority country :NA York 10022 U.S.A. (86) International Application (72)Name of Inventor : :PCT/US2012/071137 No 1)SZEWCZYK ,Gregory :21/12/2012 Filing Date 2)PATEL ,Neeta Atul (87) International Publication 3)JOGUN ,Suzanne :WO 2014/098881 No (61) Patent of Addition to :NA Application Number :NA Filing Date (62) Divisional to Application :NA Number :NA Filing Date (57) Abstract : The present invention relates to a dentifrice which does not excessively stain toothbrush bristles , for example , a pigmented toothpaste formulations having a pigment system which comprises (i) a dissolvable or disintegratable film comprising one or more releasable pigments which are released during brushing , and (ii) titanium dioxide , wherein the level of titanium dioxide is 0.01- 0.375% by weight of the toothpaste; together with methods of making and using the same. No. of Pages : 10 No. of Claims : 11 The Patent Office Journal 18/12/2015 65622 (12) PATENT APPLICATION PUBLICATION (21) Application No.5020/DELNP/2015 A (19) INDIA (22) Date of filing of Application :10/06/2015 (43) Publication Date : 18/12/2015 (54) Title of the invention : ORAL CARE COMPOSITION (51) International (71)Name of Applicant : :A61K8/27,A61Q11/00,A61K33/30 classification 1)COLGATE -PALMOLIVE COMPANY (31) Priority Document No :NA Address of Applicant :300 Park Avenue, New York ,New (32) Priority Date :York 10022 U.S.A. (33) Name of priority country :PCT (72)Name of Inventor : (86) International Application 1)HAO, Zhigang :PCT/US2012/070497 No 2)YANG ,Ying :19/12/2012 Filing Date 3)LIU, Zhiqiang (87) International Publication 4)XU ,Guofeng :WO 2014/098817 No 5)VINCENTI, Paul Joseph (61) Patent of Addition to :NA Application Number :NA Filing Date (62) Divisional to Application :NA Number :NA Filing Date (57) Abstract : Provided herein is an oral care composition comprising an orally -acceptable aqueous vehicle and an antimicrobial ingredient , wherein the antimicrobial ingredient comprises a zinc ascorbylphosphate and methods for treating or preventing a disease or disorder of the oral cavity using the oral care compositions disclosed herein. No. of Pages : 22 No. of Claims : 16 The Patent Office Journal 18/12/2015 65623 (12) PATENT APPLICATION PUBLICATION (21) Application No.5021/DELNP/2015 A (19) INDIA (22) Date of filing of Application :10/06/2015 (43) Publication Date : 18/12/2015 (54) Title of the invention : SIMULATOR (51) International classification :G09B9/00 (71)Name of Applicant : (31) Priority Document No :12196769.9 1)MOOG BV (32) Priority Date :12/12/2012 Address of Applicant :NL- 2150 AD Nieuw Vennep (33) Name of priority country :EPO Netherlands (86) International Application No :PCT/EP2013/051678 (72)Name of Inventor : Filing Date :29/01/2013 1)WARMERDAM ,Jean- Paul (87) International Publication No :WO 2013/050626 2)HORDIJK, Jan (61) Patent of Addition to Application 3)HOOGENDOORN ,Hanjo :NA Number :NA Filing Date (62) Divisional to Application Number :NA Filing Date :NA (57) Abstract : A movement simulator [100] has at least three translational degrees of freedom and has at least three actuator assemblies [106 , 108 , 110] each of which having a four bar parallelogram / trapezoidal link arrangement. A stiffener [214] is also disclosed. No. of Pages : 27 No. of Claims : 15 The Patent Office Journal 18/12/2015 65624 (12) PATENT APPLICATION PUBLICATION (21) Application No.1616/DEL/2014 A (19) INDIA (22) Date of filing of Application :16/06/2014 (43) Publication Date : 18/12/2015 (54) Title of the invention : DIRECT CONVERSION OF A FUEL POWERED REAR WHEEL DRIVE VEHICLE TO A BATTERY POWERED ELECTRIC VEHICLE (51) International classification :B60K6/20 (71)Name of Applicant : (31) Priority Document No :NA 1)SINGAL, CHANDER MOHAN (32) Priority Date :NA Address of Applicant :45C, BB-BLOCK, JANAK PURI, (33) Name of priority country :NA NEW DELHI-110058, INDIA. Delhi India (86) International Application No :NA (72)Name of Inventor : Filing Date :NA 1)SINGAL, CHANDER MOHAN (87) International Publication No : NA (61) Patent of Addition to Application Number : Filed on :01/01/1900 (62) Divisional to Application Number :NA Filing Date :NA (57) Abstract : Detailed technological design and method thereof is given for directly converting a fuel powered four wheeled rear wheel drive vehicle to a battery powered controllable speed electric vehicle, by first removing all the fuel related and variable gears related subassemblies from the vehicle and then incorporating in it, in a properly matched and integrated manner, a rechargeable dc battery bank made from automotive rechargeable dc batteries, a squirrel cage three phase ac induction motor, a dc to three phase ac variable frequency variable voltage inverter, and other requisite subassemblies designed specially for this purpose to complete this conversion . No. of Pages : 55 No. of Claims : 7 The Patent Office Journal 18/12/2015 65625 (12) PATENT APPLICATION PUBLICATION (21) Application No.5022/DELNP/2015 A (19) INDIA (22) Date of filing of Application :10/06/2015 (43) Publication Date : 18/12/2015 (54) Title of the invention : MEDICAL CONTAINER PACKAGE, AND MEDICAL CONTAINER MANAGEMENT METHOD (51) International classification :A61J3/00,A61J1/05,G09F3/00 (71)Name of Applicant : (31) Priority Document No :2012269855 1)LINTEC CORPORATION (32) Priority Date :10/12/2012 Address of Applicant :23 23 Honcho Itabashi ku Tokyo (33) Name of priority country :Japan 1730001 Japan (86) International Application No :PCT/JP2013/082760 (72)Name of Inventor : Filing Date :06/12/2013 1)MITSUHASHI Masafumi (87) International Publication No :WO 2014/092004 2)MURAKAMI Takakazu (61) Patent of Addition to :NA Application Number :NA Filing Date (62) Divisional to Application :NA Number :NA Filing Date (57) Abstract : A medical container package (10) is provided with: identification information labels (50) having provided thereto donor identification information (BC) that is assigned to each of a plurality of donors of medical fluids; and blood bags (20) (medical containers) for accommodating the medical fluids. The medical container package (10) is characterized in that the medical containers have , provided thereto, donor identification information having the same content as the donor identification information provided to identification information media. No. of Pages : 56 No. of Claims : 3 The Patent Office Journal 18/12/2015 65626 (12) PATENT APPLICATION PUBLICATION (21) Application No.5023/DELNP/2015 A (19) INDIA (22) Date of filing of Application :10/06/2015 (43) Publication Date : 18/12/2015 (54) Title of the invention : METHOD FOR ACTIVATING A MOBILE DEVICE IN A NETWORK AND ASSOCIATED DISPLAY DEVICE AND SYSTEM (51) International classification :G06F3/01,H04L29/08,G06F3/03 (71)Name of Applicant : (31) Priority Document No :1262179 1)THOMSON LICENSING (32) Priority Date :17/12/2012 Address of Applicant :1- 5, rue Jeanne d'Arc, F- 92130 Issy (33) Name of priority country :France les- Moulineaux France (86) International Application (72)Name of Inventor : :PCT/EP2013/076660 No 1)DORE, Renaud :16/12/2013 Filing Date 2)DEMOULIN, Vincent (87) International Publication 3)PLISSONNEAU ,Frdric :WO 2014/095691 No (61) Patent of Addition to :NA Application Number :NA Filing Date (62) Divisional to Application :NA Number :NA Filing Date (57) Abstract : The purpose of the invention is a method for activating a mobile device in a network comprising at least one display device being coupled to a sensor. This method is characterised by the fact that it comprises: detecting the mobile device via the sensor coupled to the display device; displaying a device representative of the detected mobile device , called a virtual device , on the display device such that the position of the virtual device on the display screen is linked to the position of the mobile device in the capture field of the sensor; activating the mobile device in the network when a determined action is applied by the user to the mobile device. Another purpose of the invention is a display device and a system implementing the method. No. of Pages : 20 No. of Claims : 14 The Patent Office Journal 18/12/2015 65627 (12) PATENT APPLICATION PUBLICATION (21) Application No.5024/DELNP/2015 A (19) INDIA (22) Date of filing of Application :10/06/2015 (43) Publication Date : 18/12/2015 (54) Title of the invention : AFFIXATION METHOD AND MANAGEMENT METHOD (51) International classification :G09F3/10,A61J1/14,A61J3/00 (71)Name of Applicant : (31) Priority Document No :2012269856 1)LINTEC CORPORATION (32) Priority Date :10/12/2012 Address of Applicant :23 23 Honcho Itabashi ku Tokyo (33) Name of priority country :Japan 1730001 Japan (86) International Application No :PCT/JP2013/082761 (72)Name of Inventor : Filing Date :06/12/2013 1)MITSUHASHI Masafumi (87) International Publication No :WO 2014/092005 2)MURAKAMI Takakazu (61) Patent of Addition to :NA Application Number :NA Filing Date (62) Divisional to Application :NA Number :NA Filing Date (57) Abstract : Provided is an affixation method in which identification information labels (50) provided with donor identification information (BC) that is assigned to each of a plurality of donors are respectively affixed to a plurality of blood- collection vessels (30) having ,accommodated therein, medical fluids donated from the donors. The affixation method is characterized in that the plurality of blood -collection vessels (30) are disposed side by side and a number of the identification information labels (50) in a state of being separably connected to each other is affixed to the plurality of blood- collection vessels (30) disposed side by side , said number corresponding to the number of the blood -collection vessels (30). No. of Pages : 57 No. of Claims : 2 The Patent Office Journal 18/12/2015 65628 (12) PATENT APPLICATION PUBLICATION (21) Application No.5025/DELNP/2015 A (19) INDIA (22) Date of filing of Application :10/06/2015 (43) Publication Date : 18/12/2015 (54) Title of the invention : CIRCULAR NEEDLE APPLIER (51) International classification (31) Priority Document No (32) Priority Date (33) Name of priority country (86) International Application No Filing Date (87) International Publication No (61) Patent of Addition to Application Number Filing Date (62) Divisional to Application Number Filing Date (71)Name of Applicant : 1)ETHICON ENDO- SURGERY, INC. :A61B17/04,A61B17/06 Address of Applicant :4545 Creek Road, Cincinnati ,Ohio :61/736682 45242 U.S.A. :13/12/2012 (72)Name of Inventor : :U.S.A. 1)MARTIN ,David T. :PCT/US2013/074866 2)WOODARD ,James A. ,Jr. :13/12/2013 3)WHITE, William J. :WO 2014/093742 4)HABERSTICH, Wells D. 5)ZEINER ,Mark S. :NA 6)BRICKNER, Aaron J. :NA 7)PRENGER, Daniel J. :NA 8)CICHOCKI, Frank R. :NA 9)NERING ,Thomas 10)MORGAN, Jerome R. 11)REYHAN, Mehmet (57) Abstract : A surgical suturing system comprises a reusable shaft having a proximal end and a distal end the distal end has a receiver and a rotary drive. A reusable actuator is connected to the proximal end of the shaft. A disposable cartridge is adapted to be attached to and detached from the receiver. The cartridge comprises an arced track an arced needle positioned in the track having a leading end and a trailing end a length of suture connected to the trailing end , a reciprocating needle driver operative to engage and move the needle in the arced circular track, and a transmission operatively connected to the needle driver having a rotary input adapted to couple to the rotary drive. The reusable shaft and actuator may be autoclavable. No. of Pages : 81 No. of Claims : 136 The Patent Office Journal 18/12/2015 65629 (12) PATENT APPLICATION PUBLICATION (21) Application No.1557/DEL/2012 A (19) INDIA (22) Date of filing of Application :22/11/2012 (43) Publication Date : 18/12/2015 (54) Title of the invention : AN IMPROVED PROCESS FOR PADDY PARBOILING (51) International classification :B62D (71)Name of Applicant : (31) Priority Document No :NA 1)PAWAN KAMRA (32) Priority Date :NA Address of Applicant :FLAT NO. 102 B, GH-30, SEC. 20, (33) Name of priority country :NA PKL, HARYANA Haryana India (86) International Application No :NA (72)Name of Inventor : Filing Date :NA 1)PAWAN KAMRA (87) International Publication No :NA (61) Patent of Addition to Application Number :NA Filing Date :NA (62) Divisional to Application Number :NA Filing Date :NA (57) Abstract : The present invention relates to an improved process of the preparation of parboiled rice. The invention relates to a paddy parboiling process wherein Mechanical High Frequency Simple Harmonic Motion induced Vibrational Energy (MHFSHMV Energy) in a fluid media is used to complete the gelatinization of starch in the rice kernel. A particular example of MHFSHMV Energy which can be used is high intensity sonication energy. The invention further relates to qualitative and quantitative improvement in parboiled rice by the invented process. No. of Pages : 7 No. of Claims : 10 The Patent Office Journal 18/12/2015 65630 (12) PATENT APPLICATION PUBLICATION (21) Application No.1625/DEL/2014 A (19) INDIA (22) Date of filing of Application :16/06/2014 (43) Publication Date : 18/12/2015 (54) Title of the invention : A PHYTOCHEMICAL RICH HERBAL EXTRACT AND PROCESS OF EXTRACTION THEREOF (51) International classification :A23L (71)Name of Applicant : 1/275 1)THE REGISTRAR, GRAPHIC ERA UNIVERSITY :NA Address of Applicant :566/6, Bell Road, Clement Town, :NA Dehradun 248002, Uttarakhand, India Delhi India :NA (72)Name of Inventor : :PCT// 1)KUMAR, Navin :01/01/1900 2)GAUTAM, Pankaj : NA 3)MISRA, Kshipra :NA 4)TULSWANI, Raj, Kumar :NA 5)GUPTA, Payal :NA 6)JOSHI, Swati :NA 7)PAINULY, Sakshi (31) Priority Document No (32) Priority Date (33) Name of priority country (86) International Application No Filing Date (87) International Publication No (61) Patent of Addition to Application Number Filing Date (62) Divisional to Application Number Filing Date (57) Abstract : The present invention relates to a phytochemical(s) rich herbal extract. In particular, the invention provides a flavonoid and phenolics rich extract from plant(s) belonging to family comprising but not limited to Elaeocarpaceae. The invention also provides an effective process for obtaining phytochemical(s), particularly flavonoid and phenolic rich herbal extract with efficient anti-Candida and antioxidant properties. No. of Pages : 28 No. of Claims : 16 The Patent Office Journal 18/12/2015 65631 (12) PATENT APPLICATION PUBLICATION (21) Application No.5031/DELNP/2015 A (19) INDIA (22) Date of filing of Application :10/06/2015 (43) Publication Date : 18/12/2015 (54) Title of the invention : IMAGE PROCESSING DEVICE AND IMAGE PROCESSING METHOD (51) International classification :H04N19/30,H04N19/124 (71)Name of Applicant : (31) Priority Document No :2012275775 1)SONY CORPORATION (32) Priority Date :18/12/2012 Address of Applicant :1- 7- 1, Konan, Minato- ku ,Tokyo (33) Name of priority country :Japan 1080075 Japan (86) International Application No :PCT/JP2013/081406 (72)Name of Inventor : Filing Date :21/11/2013 1)SATO Kazushi (87) International Publication No :WO 2014/097816 (61) Patent of Addition to Application :NA Number :NA Filing Date (62) Divisional to Application Number :NA Filing Date :NA (57) Abstract : [Problem] In multilayer coding , to increase encoding efficiency by re -using , among layers, a parameter pertaining to quantization. [Solution] Provided is an image processing device provided with: a control unit that , on the basis of a first quantization parameter offset set to the color difference component of a first layer, sets a second quantization parameter offset for the color difference component of a second layer decoded while referring to the first layer; and an inverse quantization unit that performs inverse quantization on transform coefficient data for the color difference component of the second layer by means of a quantization parameter calculated using the second quantization parameter offset set by the control unit. No. of Pages : 149 No. of Claims : 20 The Patent Office Journal 18/12/2015 65632 (12) PATENT APPLICATION PUBLICATION (21) Application No.5032/DELNP/2015 A (19) INDIA (22) Date of filing of Application :10/06/2015 (43) Publication Date : 18/12/2015 (54) Title of the invention : NUTRIENT ENRICHED MEDIA FOR hUTC GROWTH (51) International classification :C12N5/00,C12N5/073 (71)Name of Applicant : (31) Priority Document No :13/715532 1)DEPUY SYNTHES PRODUCTS, INC. (32) Priority Date :14/12/2012 Address of Applicant :325 Paramount Drive, Raynham (33) Name of priority country :U.S.A. ,Massachusetts 02767 U.S.A. (86) International Application No :PCT/US2013/074615 (72)Name of Inventor : Filing Date :12/12/2013 1)BHATIA, Ravinder (87) International Publication No :WO 2014/093598 2)HONG, L.S. Klaudyne (61) Patent of Addition to Application 3)OZTURK, Sadettin S. :NA Number 4)KAMARAJU, Venkat H. :NA Filing Date (62) Divisional to Application Number :NA Filing Date :NA (57) Abstract : This invention provides for methods of growing anchorage -dependent cells (e.g. hUTC) in culture medium comprising amino acids , vitamins, salts nucleosides , insulin, transferrin , ethanolamine and sodium selenium , wherein the culture medium is supplemented with serum. The method further comprises addition of a serum -free nutrient solution comprising amino acids, vitamins , salts nucleosides , insulin , transferrin ,ethanolamine and sodium selenium. The invention also provides for culture media and serum- free nutrient solutions for growing anchorage -dependent cells. No. of Pages : 107 No. of Claims : 22 The Patent Office Journal 18/12/2015 65633 (12) PATENT APPLICATION PUBLICATION (21) Application No.5033/DELNP/2015 A (19) INDIA (22) Date of filing of Application :10/06/2015 (43) Publication Date : 18/12/2015 (54) Title of the invention : GEAR CUTTER WITH RADIAL ADJUSTABILITY OF SQUARE OR RECTANGULAR STICK BLADES (51) International classification :B23F21/12,B23F21/22,B23C5/24 (71)Name of Applicant : (31) Priority Document No :61/737525 1)THE GLEASON WORKS (32) Priority Date :14/12/2012 Address of Applicant :1000 University Avenue, P.O Box (33) Name of priority country :U.S.A. 22970, Rochester, NY 14692- 2970 U.S.A. (86) International Application (72)Name of Inventor : :PCT/US2013/074227 No 1)STADTFELD ,Hermann, J. :11/12/2013 Filing Date 2)NORSELLI ,Anthony ,J. (87) International Publication :WO 2014/093411 No (61) Patent of Addition to :NA Application Number :NA Filing Date (62) Divisional to Application :NA Number :NA Filing Date (57) Abstract : A bevel gear manufacturing face cutter head (20) for face hobbing and face milling wherein the cutter head comprises blade positioning slots (20) having a four sided shaped cross- section and positive blade seating surfaces (22 , 24) and having the capability to clamp cutting blades (8) tight to the positive blade seating surfaces and to adjust the cutting blades radially after they are preclamped and axially located. No. of Pages : 31 No. of Claims : 18 The Patent Office Journal 18/12/2015 65634 (12) PATENT APPLICATION PUBLICATION (21) Application No.5034/DELNP/2015 A (19) INDIA (22) Date of filing of Application :10/06/2015 (43) Publication Date : 18/12/2015 (54) Title of the invention : RADIOFREQUENCY SIGNAL RECEIVER TO BE PROVIDED ON A SATELLITE (51) International classification :H04B7/185 (71)Name of Applicant : (31) Priority Document No :12/03404 1)THALES (32) Priority Date :14/12/2012 Address of Applicant :45 rue de Villiers, F- 92200 Neuilly sur (33) Name of priority country :France Seine France (86) International Application No :PCT/EP2013/075790 (72)Name of Inventor : Filing Date :06/12/2013 1)NASTA ,Rodolphe (87) International Publication No :WO 2014/090699 2)POPULUS, Thierry (61) Patent of Addition to Application :NA Number :NA Filing Date (62) Divisional to Application Number :NA Filing Date :NA (57) Abstract : The invention relates to a radiofrequency signal receiver (1) to be provided on a satellite, including: a control device (100) at the frequency of the receiver , which enables the reception frequency of the receiver to be controlled on the basis of a frequency command (104); a band- pass filter- type filtering assembly comprising a band- pass, referred to as the filtering assembly band -pass , having a controllable bandwidth capable of having a set of values ,the filtering assembly (107) enabling the bandwidth of a first signal (SI) to be limited , said first signal representing the input signal of the receiver at the bandwidth of the filtering assembly; a control means enabling the band- pass width of the filtering assembly to be controlled on the basis of a filtering bandwidth command; and a means (111) for acquiring power enabling a measurement of the strength of the first signal to be output , at the output of same from the filtering assembly (107). No. of Pages : 29 No. of Claims : 20 The Patent Office Journal 18/12/2015 65635 (12) PATENT APPLICATION PUBLICATION (21) Application No.1655/DEL/2012 A (19) INDIA (22) Date of filing of Application :31/05/2012 (43) Publication Date : 18/12/2015 (54) Title of the invention : PROCESS FOR THE SYNTHESIS, FRACTIONATION AND DRY FORMULATION OF SITE SPECIFIC MONO PEGYLATED INTERFERON ALPHA MOLECULE (51) International classification :C07C (71)Name of Applicant : (31) Priority Document No :NA 1)VIKRANT INSTITUTE OF TECHNOLOGY & (32) Priority Date :NA MANAGEMENT (33) Name of priority country :NA Address of Applicant :CENTRE OF INNOVATION (86) International Application No :NA TECHNOLOGY KRISHNA NAGAR, GOLA KA MANDIR, Filing Date :NA GWALIOR-474005, INDIA Madhya Pradesh India (87) International Publication No : NA (72)Name of Inventor : (61) Patent of Addition to Application Number :NA 1)PRAKASH SINGH BISEN Filing Date :NA 2)SANJAY KUMAR SINGH (62) Divisional to Application Number :NA Filing Date :NA (57) Abstract : This invention relates to a process for t]le preparation of monopegzlated interferon alpha molecule comprising the steps of treating MPEG-SC with IFN alpha at a pH of 6.5 at about 4.C for about 1 hour to obtain a mixture of the uncoupled pEG-IFN and coupled PEG-IFN, separating the coupled PEG-IFN by precipitation with ammonium sulphate and centrifugation to obtain a pellet, dissolving the pellet in phosphate buffer to obtain a solution, subjecting the solution to repeated steps of precipitation with ammonium sulphate and centrifugation to obtain PEG-IFN. No. of Pages : 28 No. of Claims : 10 The Patent Office Journal 18/12/2015 65636 (12) PATENT APPLICATION PUBLICATION (21) Application No.1941/DEL/2012 A (19) INDIA (22) Date of filing of Application :25/06/2012 (43) Publication Date : 18/12/2015 (54) Title of the invention : PROCESS FOR THE PREPARATIONS OF DEXKETOPROFEN TROMETHAMINE (51) International classification :C07C (71)Name of Applicant : (31) Priority Document No :NA 1)SAURAV CHEMICALS LTD., (32) Priority Date :NA Address of Applicant :PLOT NO. 370, INDUSTRIAL AREA (33) Name of priority country :NA PHASE - II, PANCHKULA (HARYANA), INDIA. Haryana India (86) International Application No :NA (72)Name of Inventor : Filing Date :NA 1)PARVEEN GOYAL (87) International Publication No : NA 2)BALDEV RAJ BANSAL (61) Patent of Addition to Application Number :NA 3)RAJESH KUMAR KAUSHIK Filing Date :NA 4)SUMANYU SAHOO (62) Divisional to Application Number :NA Filing Date :NA (57) Abstract : The present invention relates generally to a novel process for the preparation of dexketoprofen-n-octyl-d-glucamine salt and the preparation of dexketoprofen tromethamine salt Form-B. Furthermore this invention also relates to novel process for preparation of dexketoprofen tromethamine Form-B from Form-A. No. of Pages : 16 No. of Claims : 11 The Patent Office Journal 18/12/2015 65637 (12) PATENT APPLICATION PUBLICATION (21) Application No.5036/DELNP/2015 A (19) INDIA (22) Date of filing of Application :10/06/2015 (43) Publication Date : 18/12/2015 (54) Title of the invention : WATERPROOF ASSEMBLY AND CELLULAR PHONE (51) International (71)Name of Applicant : :H04M1/02,H01H13/06,H01H13/02 classification 1)ZTE CORPORATION (31) Priority Document No :201220612843.3 Address of Applicant :ZTE Plaza, Keji Road South, Hi- Tech (32) Priority Date :19/11/2012 Industrial Park, Nanshan Shenzhen, Guangdong 518057 China (33) Name of priority country :China (72)Name of Inventor : (86) International Application 1)GU Haibing :PCT/CN2013/081579 No 2)WANG ,Lijun :15/08/2013 Filing Date (87) International Publication :WO 2014/075474 No (61) Patent of Addition to :NA Application Number :NA Filing Date (62) Divisional to Application :NA Number :NA Filing Date (57) Abstract : Disclosed are a waterproof assembly and a cellular phone provided with the waterproof assembly. The waterproof assembly comprises a shell and a waterproof plug , wherein the shell is provided thereon with an opening; the bottom of the opening is recessed inwardly to form an accommodation part; the bottom of the opening is also provided with an elastic film; and the elastic film is provided thereon with an open hole. The waterproof plug includes a sealing part for being inserted into the accommodation part; the diameter of the sealing part is greater than the diameter of the open hole; and when the waterproof plug is inserted into the opening ,the sealing part is located in the accommodation part ,and the elastic film is adhered to the outer wall of the sealing part. The present utility model improves the yield of cellular phones , reduces the production cost of the cellular phone and thus makes it more suitable for industrial production. No. of Pages : 12 No. of Claims : 7 The Patent Office Journal 18/12/2015 65638 (12) PATENT APPLICATION PUBLICATION (21) Application No.5037/DELNP/2015 A (19) INDIA (22) Date of filing of Application :10/06/2015 (43) Publication Date : 18/12/2015 (54) Title of the invention : SULPHATED CHELATING AGENTS (51) International (71)Name of Applicant : :C07C305/04,C07C305/10,C07C303/24 classification 1)WARDOYO, Haryanto (31) Priority Document Address of Applicant :PuspitaLoka H-2/12A Sekt. Ill BSD :P 00 2012 01174 No City, RT.003/005, Kel. Lengkong Gudang, Kecamatan Serpong, (32) Priority Date :18/12/2012 Tangerang Indonesia (33) Name of priority (72)Name of Inventor : :Indonesia country 1)WARDOYO, Haryanto (86) International :PCT/ID2013/000009 Application No :22/11/2013 Filing Date (87) International :WO 2014/097284 Publication No (61) Patent of Addition to :NA Application Number :NA Filing Date (62) Divisional to :NA Application Number :NA Filing Date (57) Abstract : This invention refers to a series of substances according to formula (I): and its synthesis process. The subtances according to formula I above, known as sulphated chelating agents have the ability to enlarge/loosen simple cell membranes or common organic membranes. Furthermore , these subtances have the potential as biocides raw material , with very low toxicity to mammals. These features make the substances of this invention become very useful on many applications. No. of Pages : 48 No. of Claims : 14 The Patent Office Journal 18/12/2015 65639 (12) PATENT APPLICATION PUBLICATION (21) Application No.5038/DELNP/2015 A (19) INDIA (22) Date of filing of Application :10/06/2015 (43) Publication Date : 18/12/2015 (54) Title of the invention : METHOD FOR MANUFACTURING A PART BY MELTING POWDER, THE POWDER PARTICLES REACHING THE BATH IN A COLD STATE (51) International classification :B22F3/105,B29C67/00 (71)Name of Applicant : (31) Priority Document No :1203257 1)SNECMA (32) Priority Date :30/11/2012 Address of Applicant :2 boulevard du Gnral Martial Valin, F(33) Name of priority country :France 75015 Paris France (86) International Application No :PCT/FR2013/052905 2)MBDA FRANCE Filing Date :29/11/2013 (72)Name of Inventor : (87) International Publication No :WO 2014/083291 1)COLIN, Christophe (61) Patent of Addition to Application 2)MAISONNEUVE, Julie :NA Number 3)SAUSSEREAU ,Grard :NA Filing Date (62) Divisional to Application Number :NA Filing Date :NA (57) Abstract : The invention relates to a method of manufacturing a part , involving the following steps: (a) providing a material in the form of powder particles (60), (b) heating a first quantity of the powder to a temperature higher than the melting point TF of said layer using a high energy beam (95) and forming , at the surface of a support member (80) a first bath comprising this melted powder and a portion of the support member (80), (c) heating ,likewise , a second quantity of the powder and forming , at the surface of the support member (80) a second bath comprising this melted powder downstream of the first bath , (d) repeating step (c) until a first layer (10) of the part is formed on the support member (80) , (e) heating , likewise , an [n]f quantity of the powder , and forming an [n]f bath comprising in part this melted powder above a portion of the first layer (10) , (f) heating, likewise , an [n+1]f quantity of powder, and forming an [n+1]f bath comprising in part this melted powder downstream of the [n]f bath above a portion of the first layer (10), (g) repeating step (f) in order to form a second layer (20) of the part above the first layer (10) , (h) repeating steps (e) to (g) for each layer located above an already formed layer until the part has reached substantially the final form thereof. The particles (60) of powder reach each of the baths at a temperature significantly lower than the bath temperature. No. of Pages : 24 No. of Claims : 6 The Patent Office Journal 18/12/2015 65640 (12) PATENT APPLICATION PUBLICATION (21) Application No.1567/DEL/2014 A (19) INDIA (22) Date of filing of Application :10/06/2014 (43) Publication Date : 18/12/2015 (54) Title of the invention : CARBON-COPPER COMPOSITE AND A PROCESS FOR PREPARATION THEREOF (51) International classification (31) Priority Document No (32) Priority Date (33) Name of priority country (86) International Application No Filing Date (87) International Publication No (61) Patent of Addition to Application Number Filing Date (62) Divisional to Application Number Filing Date (71)Name of Applicant : 1)COUNCIL OF SCIENTIFIC & INDUSTRIAL :H01L23/373 RESEARCH :NA Address of Applicant :ANUSANDHAN BHAWAN, RAFI :NA MARG, NEW DELHI - 110001, INDIA. Delhi India :NA (72)Name of Inventor : :NA 1)BHATIA GOPAL :NA 2)KUMAR ANIL : NA 3)KUMAR RAJEEV :NA 4)SENGUPTA PINAKI RANJAN :NA 5)KAUR MANDEEP :NA 6)RAMAN VASANTHA :NA 7)DHAR AJAY 8)KUMARI SAROJ (57) Abstract : The present invention provides an improved process for the production of high density-high strength carbon-copper composite. The process comprises coating the electrolytic copper powder with coal tar pitch by dissolving in a suitable organic solvent like toluene, tar oil etc at the temperature of 100-130°C and heat treating at 450-480°C in inert atmosphere for 2-5hr and ball milling for 5-1 Ohr. This coated copper powder is mixed in different proportions (copper to carbon ratio of 1.0-1.5) with self-sintering green coke powder which is prepared by heat treatment of suitable coal tar pitch in an inert gas such as high purity nitrogen, at a temperature in the range of 450-500°C followed by its ball milling into a fine powder. The carboncopper composite powders with and without pitch coating are then moulded into plates and blocks in separate lots using conventional hydraulic press or isostatic press and carbonized to in an inert atmosphere, to get the high density high strength carbon-copper composites. The properties such as bulk density and bending strength were found to be superior from the pitch coated copper based carbon-copper composite in comparison to carbon-copper composite products prepared from copper without pitch coating. The bulk density of the product so developed by the process of present invention is found to be in the range of 2.8-3.38g/cm3, bending strength in the range of 118-160MPa and electrical resistivity in the range of 0.50- 1.50mQcm. No. of Pages : 16 No. of Claims : 8 The Patent Office Journal 18/12/2015 65641 (12) PATENT APPLICATION PUBLICATION (21) Application No.1568/DEL/2014 A (19) INDIA (22) Date of filing of Application :10/06/2014 (43) Publication Date : 18/12/2015 (54) Title of the invention : CHIRAL AMINES, A PROCESS FOR PREPARATION AND USE THEREOF (51) International classification :C07C221/00 (71)Name of Applicant : (31) Priority Document No :NA 1)COUNCIL OF SCIENTIFIC & INDUSTRIAL (32) Priority Date :NA RESEARCH (33) Name of priority country :NA Address of Applicant :ANUSANDHAN BHAWAN, RAFI (86) International Application No :NA MARG, NEW DELHI - 110001, INDIA. Delhi India Filing Date :NA (72)Name of Inventor : (87) International Publication No : NA 1)NABIN CHANDRA BARUA (61) Patent of Addition to Application Number :NA 2)BISHWAJIT SAIKIA Filing Date :NA 3)PREETISMITA BORAH (62) Divisional to Application Number :NA 4)GAKUL BAISHYA Filing Date :NA (57) Abstract : Described herein is the general synthesis of chiral amine from vinyl nitro compounds using Josiphos catalyst. The process is applied to develop a novel route to Sitagliptin, the only DPP-IV inhibitors marketed in India. No. of Pages : 35 No. of Claims : 8 The Patent Office Journal 18/12/2015 65642 (12) PATENT APPLICATION PUBLICATION (21) Application No.5040/DELNP/2015 A (19) INDIA (22) Date of filing of Application :10/06/2015 (43) Publication Date : 18/12/2015 (54) Title of the invention : METHOD FOR OPERATING A DEVICE FOR PROVIDING A LIQUID ADDITIVE (51) International classification :F01N3/20 (71)Name of Applicant : (31) Priority Document No :10 2012 111 919.8 1)EMITEC GESELLSCHAFT (32) Priority Date :07/12/2012 FREMISSIONSTECHNOLOGIE MBH (33) Name of priority country :Germany Address of Applicant :Hauptstrae 128, 53797 Lohmar (86) International Application No :PCT/EP2013/073450 Germany Filing Date :08/11/2013 (72)Name of Inventor : (87) International Publication No :WO 2014/086553 1)BRCK, Rolf (61) Patent of Addition to Application 2)HODGSON, Jan :NA Number :NA Filing Date (62) Divisional to Application Number :NA Filing Date :NA (57) Abstract : The invention relates to a method for operating a device (1) for providing a liquid additive (26), comprising a conveying path (2), along which the liquid additive (26) is conveyed. The conveying path (2) has at least one first section (3) , which forms a heat conduction line (25) from a heating unit (23) of the device into a tank (19) for the liquid additive (26). The conveying path (2) is further provided with at least one second section (27), in which a freeze -sensitive component (28) is arranged. In the method , a liquid additive (26) is initially conveyed along the conveying path (2) of the device (1). Subsequently , the conveyance of liquid additive (26) is stopped. Next , a partial emptying of the conveying path (2) takes place, wherein in the at least one first section (3) of the conveying path (2) , liquid additive (26) remains , whereas the at least one second section (27) is emptied. No. of Pages : 28 No. of Claims : 13 The Patent Office Journal 18/12/2015 65643 (12) PATENT APPLICATION PUBLICATION (21) Application No.5041/DELNP/2015 A (19) INDIA (22) Date of filing of Application :10/06/2015 (43) Publication Date : 18/12/2015 (54) Title of the invention : PROTECTIVE CAP FOR A DEVICE (51) International (71)Name of Applicant : :A61M5/315,A61M5/32,A61M5/42 classification 1)IN.TOOL APS (31) Priority Document No :PA 2012 70698 Address of Applicant :Krogholmen 9, DK- 2840 Holte (32) Priority Date :13/11/2012 Denmark (33) Name of priority country :Denmark (72)Name of Inventor : (86) International Application 1)THOMSEN, Jakob Dahl :PCT/DK2013/050375 No :13/11/2013 Filing Date (87) International Publication :WO 2014/075685 No (61) Patent of Addition to :NA Application Number :NA Filing Date (62) Divisional to Application :NA Number :NA Filing Date (57) Abstract : The invention regards a protective cap for a delivery system said cap comprising a tip part releasably attached to a main part, wherein the tip part and the main part together form an elongated body with a closed tip end , and the main part comprises at least one means for assisting the use of the delivery system. No. of Pages : 56 No. of Claims : 80 The Patent Office Journal 18/12/2015 65644 (12) PATENT APPLICATION PUBLICATION (21) Application No.1605/DEL/2014 A (19) INDIA (22) Date of filing of Application :13/06/2014 (43) Publication Date : 18/12/2015 (54) Title of the invention : SYSTEMS AND METHODS FOR MANAGING CALL CONNECTIONS FROM NON-ORIGINATING NODES IN NETWORKS (51) International classification :H04W76/02, (71)Name of Applicant : (31) Priority Document No :NA 1)CIENA CORPORATION (32) Priority Date :NA Address of Applicant :7035 Ridge Road Hanover, MD 21076, (33) Name of priority country :NA USA U.S.A. (86) International Application No :NA (72)Name of Inventor : Filing Date :NA 1)KHAN, Waseem Reyaz (87) International Publication No : NA 2)SHARMA, Piyush (61) Patent of Addition to Application Number :NA 3)GEORGE, Alwyn Joy Filing Date :NA 4)KANNAN, Rajagopalan (62) Divisional to Application Number :NA Filing Date :NA (57) Abstract : A method includes receiving a request for an operation on a non-originating node of a connection; determining information associated with the connection on a link of the non-originating node; and signaling an originating node by the non-originating node based on the information and the operation to perform call connection management on the connection. A network and node are also disclosed. The method, network, and node enable non-originating nodes in control planes such as Automatically Switched Optical Network (ASON), Generalized Multi-Protocol Label Switching (GMPLS), and Optical Signaling and Routing Protocol (OSRP) to perform call connection management through signaling to the originating node. No. of Pages : 36 No. of Claims : 20 The Patent Office Journal 18/12/2015 65645 (12) PATENT APPLICATION PUBLICATION (21) Application No.1606/DEL/2014 A (19) INDIA (22) Date of filing of Application :13/06/2014 (43) Publication Date : 18/12/2015 (54) Title of the invention : SYSTEMS AND METHODS FOR DETECTING AND PROPAGATING RESIZABILITY INFORMATION OF ODUFLEX CONNECTIONS (51) International classification :H04L29/06, (71)Name of Applicant : (31) Priority Document No :NA 1)CIENA CORPORATION (32) Priority Date :NA Address of Applicant :7035 Ridge Road Hanover, MD 21076, (33) Name of priority country :NA USA U.S.A. (86) International Application No :NA (72)Name of Inventor : Filing Date :NA 1)JUNEJA, Kapil (87) International Publication No : NA 2)TULI, Pallavi (61) Patent of Addition to Application Number :NA 3)SAREEN, Jatin Filing Date :NA 4)KHAN, Waseem Reyaz (62) Divisional to Application Number :NA 5)KANNAN, Rajagopalan Filing Date :NA (57) Abstract : A method for detecting and propagating resizability information of an Optical channel Data Unit flex (ODUflex) connection includes including resizability information in overhead associated with the ODUflex connection, wherein the resizability information comprises a number of available tributary slots and whether the ODUflex connection supports hitless adjustment; and adjusting the resizability information based on a change on a line concurrently with the change in line available bandwidth. A network and network element are also described. The systems and methods include a generic solution to communicate in real time, the resizability information of an ODUflex connection utilizing the associated data path to carry it with almost no involvement of the management/control plane. No. of Pages : 35 No. of Claims : 20 The Patent Office Journal 18/12/2015 65646 (12) PATENT APPLICATION PUBLICATION (21) Application No.2554/DEL/2012 A (19) INDIA (22) Date of filing of Application :17/02/2013 (43) Publication Date : 18/12/2015 (54) Title of the invention : A NOVEL FORMULATION USEFUL IN CANCER CHEMOTHERAPY. (51) International classification (31) Priority Document No (32) Priority Date (33) Name of priority country (86) International Application No Filing Date (87) International Publication No (61) Patent of Addition to Application Number Filing Date (62) Divisional to Application Number Filing Date (71)Name of Applicant : 1)COUNCIL OF SCIENTIFIC & INDUSTRIAL RESEARCH Address of Applicant :ANUSANDHAN BHAWAN, RAFI :A61K MARG, NEW DELHI-110001, INDIA Delhi India :NA (72)Name of Inventor : :NA 1)DILIP MANIKRAO MONDHE :NA 2)SUBHASH CHANDRA TANEJA :NA 3)SURRINDER KOUL :NA 4)JAGDISH KUMAR DHAR : NA 5)AJIT KUMAR SAXENA :NA 6)RAKESH KAMAL JOHRI :NA 7)ZAHOOR AHMAD WANI :NA 8)SAMAR SINGH ANDOTRA :NA 9)SUBHASH CHANDER SHARMA 10)SURJEET SINGH 11)PREM NARAYAN GUPTA 12)RAM ASREY VISHWAKARMA (57) Abstract : The present invention discloses a formulation, comprising a natural isolate 3α, 24-dihydroxyurs-12-ene of formula 1 isolated from Boswellia sps., and cisplatin, useful in the treatment of cancer. The natural isolate itself displays significant anti cancer activity and in combination with cisplatin both display strong synergism which results in significant reduction of therapeutic doses of cisplatin as well as of 3α, 24-dihydroxyurs-12-ene. The pharmaceutical preparation provided, according to the invention is intended to show lower toxicity and therefore, to be well tolerated by the patients. No. of Pages : 28 No. of Claims : 10 The Patent Office Journal 18/12/2015 65647 (12) PATENT APPLICATION PUBLICATION (21) Application No.5048/DELNP/2015 A (19) INDIA (22) Date of filing of Application :10/06/2015 (43) Publication Date : 18/12/2015 (54) Title of the invention : CELL- REACTIVE , LONG -ACTING ,OR TARGETED COMPSTATIN ANALOGS AND RELATED COMPOSITIONS AND METHODS (51) International classification :C07K7/00,A61K38/04,C12N5/00 (71)Name of Applicant : (31) Priority Document No :61/727094 1)APELLIS PHARMACEUTICALS, INC. (32) Priority Date :15/11/2012 Address of Applicant :6400 Westwind Way, Suite A, (33) Name of priority country :U.S.A. Crestwood, Kentucky 40014 U.S.A. (86) International Application (72)Name of Inventor : :PCT/US2013/070417 No 1)FRANCOIS, Cedric :15/11/2013 Filing Date 2)DESCHATELETS, Pascal (87) International Publication :WO 2014/078731 No (61) Patent of Addition to :NA Application Number :NA Filing Date (62) Divisional to Application :NA Number :NA Filing Date (57) Abstract : In some aspects, the present invention provides cell- reactive compstatin analogs and compositions comprising cell -reactive compstatin analogs. In some aspects , the invention further provides methods of using cell reactive compstatin analogs , e.g. , treat a complement- mediated disorder, e.g., to inhibit complement- mediated damage to a cell , tissue , or organ. In some aspects, the invention provides long -acting compstatin analogs and compositions comprising long -acting compstatin analogs. In some aspects , the invention further provides methods of using long- acting compstatin analogs , e.g., to treat a complement- mediated disorder, e.g., to inhibit complement- mediated damage to a cell , tissue, or organ. In some aspects, the invention provides targeted compstatin analogs and compositions comprising targeted compstatin analogs. In some aspects , the invention further provides methods of using targeted compstatin analogs e.g., to treat a complement- mediated disorder, e.g., to inhibit complement- mediated damage to a cell ,tissue, or organ. No. of Pages : 204 No. of Claims : 175 The Patent Office Journal 18/12/2015 65648 (12) PATENT APPLICATION PUBLICATION (21) Application No.5050/DELNP/2015 A (19) INDIA (22) Date of filing of Application :10/06/2015 (43) Publication Date : 18/12/2015 (54) Title of the invention : HAPTIC USER INTERFACE DEVICE FOR SURGICAL SIMULATION SYSTEM (51) International classification :G09B23/28 (71)Name of Applicant : (31) Priority Document No :13152558.6 1)SURGICAL SCIENCE SWEDEN AB (32) Priority Date :24/01/2013 Address of Applicant :Haraldsgatan 5, S- 413 14 Gteborg (33) Name of priority country :EPO Sweden (86) International Application No :PCT/EP2014/051118 (72)Name of Inventor : Filing Date :21/01/2014 1)JOHANSSON ,Christer (87) International Publication No :WO 2014/114636 2)LARSSON ,Anders (61) Patent of Addition to Application 3)NYSTR–M, Mattias :NA Number :NA Filing Date (62) Divisional to Application Number :NA Filing Date :NA (57) Abstract : A haptic user interface device (1) for a surgical simulation system (2) comprising a frame (11) having a fixed base (12), a neck portion (15) rotatable around a first axis (A) in relation to the base (12) , and a suspension portion (16) rotatable around a second axis (B) in relation to the neck portion (15), an instrument (10) having a rigid shaft (21) suspended by the suspension portion (16) so as to be pivotable around the first axis (A) and the second axis (B), a first and second actuator (14 , 17) mounted on the frame (11) and arranged to provide force feedback to a user when rotating the instrument (10) around the first axis (A) and the second axis (B). The first and second actuators are mounted on the neck portion (15). No. of Pages : 16 No. of Claims : 9 The Patent Office Journal 18/12/2015 65649 (12) PATENT APPLICATION PUBLICATION (21) Application No.5051/DELNP/2015 A (19) INDIA (22) Date of filing of Application :10/06/2015 (43) Publication Date : 18/12/2015 (54) Title of the invention : ROTARY COMPRESSOR AND REFRIGERATION CYCLE DEVICE (51) International (71)Name of Applicant : :F04C18/356,F04C23/00,F04C29/00 classification 1)TOSHIBA CARRIER CORPORATION (31) Priority Document No :2013066006 Address of Applicant :72- 34, Horikawa -cho ,Saiwai- ku (32) Priority Date :27/03/2013 ,Kawasaki- shi ,Kanagawa 2128585 Japan (33) Name of priority country :Japan (72)Name of Inventor : (86) International 1)AOKI ,Toshimasa :PCT/JP2013/079430 Application No 2)KATO, Hisataka :30/10/2013 Filing Date 3)HATAYAMA, Masahiro (87) International Publication 4)KAWABE, Isao :WO 2014/155803 No 5)HASEGAWA, Keiichi (61) Patent of Addition to :NA Application Number :NA Filing Date (62) Divisional to :NA Application Number :NA Filing Date (57) Abstract : The compressor mechanism unit of this rotary compressor is provided with a cylinder having a cylinder chamber ,a roller housed inside of the cylinder chamber, a first and second vane which abut against the roller to partition the inside of the cylinder chamber into a compression side and a suction side, and one biasing member which biases the first and second vane towards the roller. On both ends along the axial direction of the rotating shaft on the rear end of the first vane , first vane- side mounting units are provided which have the same dimension in the axial direction. On both ends along the axial direction of the rotating shaft on the rear end of the second vane , second vane- side mounting units are provided which have the same dimension in the axial direction, and the first and second vanes are mounted on the biasing member through intermediary of the first and second vane -side mounting units. No. of Pages : 31 No. of Claims : 7 The Patent Office Journal 18/12/2015 65650 (12) PATENT APPLICATION PUBLICATION (21) Application No.5052/DELNP/2015 A (19) INDIA (22) Date of filing of Application :10/06/2015 (43) Publication Date : 18/12/2015 (54) Title of the invention : MIXED ALCOHOL FUELS FOR INTERNAL COMBUSTION ENGINES, FURNACES, BOILERS, KILNS AND GASIFIERS (51) International classification :C10L1/182 (71)Name of Applicant : (31) Priority Document No :11/060,169 1)STANDARD ALCOHOL COMPANY OF AMERICA, (32) Priority Date :17/02/2005 INC. (33) Name of priority country :U.S.A. Address of Applicant :14111 County Road 240, Durango, CO (86) International Application No :PCT/US2005/005326 81301-6332, United States of America; U.S.A. Filing Date :18/02/2005 (72)Name of Inventor : (87) International Publication No : NA 1)JIMESON, Robert, M. (61) Patent of Addition to Application 2)RADOSEVICH, Mark, C. :NA Number 3)STEVENS, Rex, R. :NA Filing Date (62) Divisional to Application Number :6909/DELNP/2007 Filed on :06/09/2007 (57) Abstract : Mixed alcohol formulas can be used as a fuel additive in gasoline, diesel, jet fuel, aviation gasoline, heating oil, bunker oil, coal, petroleum coke or as a neat fuel in and of itself. The mixed alcohols formulations can contain Cl-C5 alcohols, or in the alternative, C1C8 alcohols or higher C1-Clo alcohols in order to boost energy content. The C1-C5 mixed alcohols contain more ethanol than methanol with declining amounts of propanol, butanol and pentanol. C1-C8 mixed alcohols contain the same, with declining amounts of hexanol, heptanol and octanol. C1-C10 mixed alcohols contain the same, with declining amounts of nananol and decanol. Synthetically produced mixed alcohol formulas feature higher octane and energy densities than either MTBE or fermented grain ethanol; more stable Reid Vapor Pressure blending characteristics; and increased soluablizing effects on condensate water. The primary benefits of mixed alcohols are increased combustion efficiencies, reduced emissions profiles and low production costs. No. of Pages : 35 No. of Claims : 4 The Patent Office Journal 18/12/2015 65651 (12) PATENT APPLICATION PUBLICATION (21) Application No.5053/DELNP/2015 A (19) INDIA (22) Date of filing of Application :11/06/2015 (43) Publication Date : 18/12/2015 (54) Title of the invention : COMPOSITIONS AND METHODS FOR DIAGNOSING THYROID TUMORS (51) International classification :C12Q1/68 (71)Name of Applicant : (31) Priority Document No :61/730391 1)PONTIFICIA UNIVERSIDAD CATOLICA DE CHILE (32) Priority Date :27/11/2012 Address of Applicant :Av. Libertador Bernardo O´Higgins N° (33) Name of priority country :U.S.A. 340, Santiago, 3580000 Chile (86) International Application No :PCT/US2013/071970 (72)Name of Inventor : Filing Date :26/11/2013 1)GONZALEZ DIAZ ,Hernan Eugenio (87) International Publication No :WO 2014/085434 2)VARGAS SALAS ,Sergio (61) Patent of Addition to Application 3)MARTINEZ SOLIS ,Jose Rodrigo Waldemar :NA Number :NA Filing Date (62) Divisional to Application Number :NA Filing Date :NA (57) Abstract : The present invention provides dignostic assays for identifying thyroid cancer in a biological sample , including a fine needle aspirate, as well as related compositions and kits useful in practicing the methods of the invention. No. of Pages : 95 No. of Claims : 57 The Patent Office Journal 18/12/2015 65652 (12) PATENT APPLICATION PUBLICATION (21) Application No.5054/DELNP/2015 A (19) INDIA (22) Date of filing of Application :11/06/2015 (43) Publication Date : 18/12/2015 (54) Title of the invention : DEVICE FOR REDUCING THE LOAD ON A SUPPORTING STRUCTURE , IN PARTICULAR AN INERTIAL ENERGY ACCUMULATING DEVICE (51) International classification :F03G7/00 (71)Name of Applicant : (31) Priority Document No :2010039 1)S4 ENERGY B.V. (32) Priority Date :21/12/2012 Address of Applicant :6, Westplein, NL- 3016 BM Rotterdam (33) Name of priority country :Netherlands Netherlands (86) International Application No :PCT/NL2013/050913 (72)Name of Inventor : Filing Date :18/12/2013 1)DE VRIES, Carl Maria (87) International Publication No :WO 2014/098584 (61) Patent of Addition to Application :NA Number :NA Filing Date (62) Divisional to Application Number :NA Filing Date :NA (57) Abstract : The invention relates to a device (10) for reducing the load on a supporting structure comprising a housing(12) defining a chamber(19), at least one object (28) having a first face (34) and a substantially opposite second face(32) mounted in the chamber(19) by means of the supporting structure and is displaceable relative to the housing (12) leaving free a gap (38) provided with a seal(46) separating a first section (70) and a second section (72) of the chamber (19), an exposing means (42; 92) for exposing at least the first face (34) to a gas pressure, thereby generating an upward differential pressure force at least partially compensating the object weight, wherein the seal (46) is supported by a movable part (44) of the housing (12) and the device (10) further comprises a means (48) for adjusting the position of at least said movable part (44). No. of Pages : 17 No. of Claims : 15 The Patent Office Journal 18/12/2015 65653 (12) PATENT APPLICATION PUBLICATION (21) Application No.5042/DELNP/2015 A (19) INDIA (22) Date of filing of Application :10/06/2015 (43) Publication Date : 18/12/2015 (54) Title of the invention : METHOD AND SYSTEM FOR MARKING AN ITEM AN ITEM SO MARKED AND A METHOD AND SYSTEM FOR AUTHENTICATING A MARKED ITEM (51) International classification :G06Q30/00 (71)Name of Applicant : (31) Priority Document No :12199158.2 1)SICPA HOLDING SA (32) Priority Date :21/12/2012 Address of Applicant :Avenue de Florissant 41, CH -1008 (33) Name of priority country :EPO Prilly Switzerland (86) International Application No :PCT/EP2013/077692 (72)Name of Inventor : Filing Date :20/12/2013 1)SETO, Myron (87) International Publication No :WO 2014/096362 2)MAK ,Kok Weng (61) Patent of Addition to Application 3)MONNARD, Ren Henri :NA Number :NA Filing Date (62) Divisional to Application Number :NA Filing Date :NA (57) Abstract : A method of marking and authenticating a manufactured item ,comprising providing the manufactured item with a visible anticounterfeiting indicium , marking with marking means the manufactured item with a visible alphanumeric string , marking with marking means the manufactured item with visible marking time data ,and transmitting with data transmission and control means marking time data marked on the manufactured item and the alphanumeric string marked on the manufactured item. The method further comprises with computer database control means , receiving the transmitted marking time data and the transmitted alphanumeric string and storing in association in a database marking time information corresponding with the received marking time data marked on the manufactured item and alphanumeric information corresponding with the received alphanumeric string marked on the manufactured item. The method further comprises checking authenticity of the anti- counterfeiting indicium provided on the manufactured item , interrogating the database with the alphanumeric string read from the manufactured item to obtain marking time information for the manufactured item and comparing the marking time information with marking time data read from the manufactured item to determine if they match. The method comprises determining the manufactured item as authentic if criteria are met, the criteria including that the checking step reveals an authentic anti- counterfeiting indicium and the comparing step determines a match. No. of Pages : 65 No. of Claims : 32 The Patent Office Journal 18/12/2015 65654 (12) PATENT APPLICATION PUBLICATION (21) Application No.5043/DELNP/2015 A (19) INDIA (22) Date of filing of Application :10/06/2015 (43) Publication Date : 18/12/2015 (54) Title of the invention : MEDIUM CONVEYANCE DEVICE AND MEDIUM PROCESSING DEVICE (51) International classification :G07D9/00 (71)Name of Applicant : (31) Priority Document No :2012274939 1)OKI ELECTRIC INDUSTRY CO., LTD. (32) Priority Date :17/12/2012 Address of Applicant :1 -7 -12 Toranomon, Minato- ku ,Tokyo (33) Name of priority country :Japan 1058460 Japan (86) International Application No :PCT/JP2013/080830 (72)Name of Inventor : Filing Date :14/11/2013 1)HIRATSUKA, Shuuichi (87) International Publication No :WO 2014/097786 2)TOSAKA ,Yoshiyuki (61) Patent of Addition to Application :NA Number :NA Filing Date (62) Divisional to Application Number :NA Filing Date :NA (57) Abstract : The present invention provides a medium processing device which can be easily assembled with a simple configuration , while conductivity therefor is ensured. Specifically , disposed in a roller conveyance unit are: a non- conductive upper- side conveyance guide which forms one side face of a paper currency conveyance path and which has an internal space; a conductive frame which retains the upper side conveyance guide; a pressing spring which applies a pressing force which biases a press roller toward a drive roller; and a conductive support shaft , locations in the fore- aft direction near both end parts in the longitudinal direction being aligned by the upper side conveyance guide , said support shaft supporting a press spring near the center part in the longitudinal direction , and abutting a horizontal direction upper end face of the frame upon receiving recoil generated toward a direction away from the paper currency conveyance path in response to the pressing force. No. of Pages : 54 No. of Claims : 8 The Patent Office Journal 18/12/2015 65655 (12) PATENT APPLICATION PUBLICATION (21) Application No.5044/DELNP/2015 A (19) INDIA (22) Date of filing of Application :10/06/2015 (43) Publication Date : 18/12/2015 (54) Title of the invention : MONEY DISPENSING UNIT AND GAMING MACHINE HAVING A MONEY DISPENSING UNIT (51) International classification :G07F17/32,G08B13/14,G07C9/00 (71)Name of Applicant : (31) Priority Document No :10 2012 111 080.8 1)NOVOMATIC AG (32) Priority Date :16/11/2012 Address of Applicant :Wiener Strasse 158, A- 2352 (33) Name of priority country :Germany Gumpoldskirchen Austria (86) International Application (72)Name of Inventor : :PCT/EP2013/073534 No 1)SEIS, Berthold :12/11/2013 Filing Date 2)SCHUSTER, Marius (87) International Publication :WO 2014/076043 No (61) Patent of Addition to :NA Application Number :NA Filing Date (62) Divisional to Application :NA Number :NA Filing Date (57) Abstract : The invention relates to a money dispensing unit (23) , comprising an electric motor (25) , a control device (24) , which has a storage unit (32) , wherein the electric motor (25) is coupled to the control device (24) by means of a controllable switch (26) and can be activated with current/voltage by means of the switch (26) in order to dispense money; and wherein the control device (24) is provided and designed to provide a code; and a comparison module (28) for receiving the code and comparing the code with a predefined code , wherein if the received code is identical to the known code , the switch (26) can be activated in order to supply voltage to the electric motor (25) in order to dispense money. No. of Pages : 18 No. of Claims : 4 The Patent Office Journal 18/12/2015 65656 (12) PATENT APPLICATION PUBLICATION (21) Application No.1924/DEL/2012 A (19) INDIA (22) Date of filing of Application :22/06/2012 (43) Publication Date : 18/12/2015 (54) Title of the invention : METHODS AND SYSTEMS FOR GREEN ELECTRORAL (51) International classification :A47J (71)Name of Applicant : (31) Priority Document No :NA 1)KUNWAR DEEP NARAYAN (32) Priority Date :NA Address of Applicant :C/O GBPEC, PAURI, GARHWAL, (33) Name of priority country :NA UTTARAKHAND Uttarakhand India (86) International Application No :NA (72)Name of Inventor : Filing Date :NA 1)K. D. NARAYAN (87) International Publication No : NA (61) Patent of Addition to Application Number :NA Filing Date :NA (62) Divisional to Application Number :NA Filing Date :NA (57) Abstract : The system will be used for this method with modification as per the use of the election agencies world wide. The system will be developed with according to the requirement of the particular regional language. If talked about India, the methods and systems will be developed in English, Hindi and any other regional language like Tamil, Telgu, Oria, Punjabi or in case of USA it will be on US English and Spanish/any other regional language in Latin America/ south America/ North America or in English in European counties or in French, German or any other language in the globe for those will adopt this method and having democratic values. No. of Pages : 13 No. of Claims : 10 The Patent Office Journal 18/12/2015 65657 (12) PATENT APPLICATION PUBLICATION (21) Application No.2139/DEL/2010 A (19) INDIA (22) Date of filing of Application :08/09/2010 (43) Publication Date : 18/12/2015 (54) Title of the invention : ELISA KIT (51) International classification :C07D233/76, C07D233/74 :NA :NA :NA :NA :NA :NA :NA :NA :NA :NA (71)Name of Applicant : 1)DIRECTOR GENERAL, DEFENCE RESEARCH & DEVELOPMENT ORGANIZATION Address of Applicant :MINISTRY OF DEFENCE, GOVERNMENT OF INDIA, ROOM NO. 348, B-WING, DRDO BHAVAN, RAJAJI MARG, NEW DELHI-110 011 INDIA. Delhi India (72)Name of Inventor : 1)JYOTI SHUKLA 2)MANMOHAN PARIDA 3)PUTCHA VENKATA LAKSHMANA RAO (31) Priority Document No (32) Priority Date (33) Name of priority country (86) International Application No Filing Date (87) International Publication No (61) Patent of Addition to Application Number Filing Date (62) Divisional to Application Number Filing Date (57) Abstract : The present invention discloses a kit for diagnosing Japanese Encephalitis Virus in a sample from a subject comprising: isolated Polyclonal capture antibodies specific for Japanese Encephalitis Virus NS1 protein antigen attached to a solid support, said antibodies are capable of capturing immunogenic fragments of NS1 protein in said sample and isolated monoclonal detector Antibody specific for Japanese Encephalitis Virus NS1 protein antigen. The detector antibodies when added to sample are capable of binding to said captured immunogenic fragments of NS1 protein. Enzyme labeled secondary antibody is used for color development. No. of Pages : 21 No. of Claims : 10 The Patent Office Journal 18/12/2015 65658 (12) PATENT APPLICATION PUBLICATION (21) Application No.5070/DELNP/2015 A (19) INDIA (22) Date of filing of Application :11/06/2015 (43) Publication Date : 18/12/2015 (54) Title of the invention : LOCK DEVICE (51) International classification :E05B85/24,B60N2/44,E05B83/00 (71)Name of Applicant : (31) Priority Document No :2012271339 1)SHIROKI CORPORATION (32) Priority Date :12/12/2012 Address of Applicant :2, Kirihara- cho ,Fujisawa- shi, (33) Name of priority country :Japan Kanagawa 2520811 Japan (86) International Application (72)Name of Inventor : :PCT/JP2013/083257 No 1)BAN Masahiro :11/12/2013 Filing Date 2)SAKURAI Takayuki (87) International Publication 3)SUZUKI Hiroyuki :WO 2014/092134 No (61) Patent of Addition to :NA Application Number :NA Filing Date (62) Divisional to Application :NA Number :NA Filing Date (57) Abstract : In order to address the problem of providing a lock device having a simple configuration , a lock device includes a base (51) , a first rotary member (57), a second rotary member (61) , a first elastic member (71), and a second elastic member (73). One of the first elastic member (71) and the second elastic member (73) has an edge part that is fixed , protrusions (51b , 51e) , which protrude in the direction parallel to the rotation axis of the first rotary member (57), are either provided to the base (51) or one to the first rotary member (57) and one to the second rotary member (61) , and the length by which the protrusions (51b, 51e) protrude in the rotation axis direction is longer than the length of one of the first elastic member (71) and the second elastic member (73) in the rotation axis direction. No. of Pages : 39 No. of Claims : 5 The Patent Office Journal 18/12/2015 65659 (12) PATENT APPLICATION PUBLICATION (21) Application No.5071/DELNP/2015 A (19) INDIA (22) Date of filing of Application :11/06/2015 (43) Publication Date : 18/12/2015 (54) Title of the invention : METHODS FOR REDUCING ASPHALT PAVEMENT THICKNESS , INCREASING AGGREGATE TO- AGGREGATE CONTACT OF ASPHALT PAVING MATERIALS , AND IMPROVING LOW TEMPERATURE CRACKING PERFORMANCE OF ASPHALT PAVING MATERIALS (51) International classification :E01C7/18,C04B26/02 (71)Name of Applicant : (31) Priority Document No :61/746750 1)HONEYWELL INTERNATIONAL INC. (32) Priority Date :28/12/2012 Address of Applicant :Patent Services M/S AB/2B, 101 (33) Name of priority country :U.S.A. Columbia Road, P. O. Box 2245, Morristown ,New Jersey 07962 (86) International Application No :PCT/US2013/073973 2245 U.S.A. Filing Date :10/12/2013 (72)Name of Inventor : (87) International Publication No :WO 2014/105410 1)HACKER, Scott (61) Patent of Addition to Application 2)KOSTELANSKY, Cynthia :NA Number 3)RUAN ,Yonghong :NA Filing Date (62) Divisional to Application Number :NA Filing Date :NA (57) Abstract : Methods for reducing asphalt pavement thickness, for fabricating asphalt paving material with increased aggregate- to- aggregate contact points and for fabricating asphalt paving materials with improved low temperature cracking performance are provided. A method for reducing asphalt pavement thickness includes combining a base asphalt, an oxidized polyolefin , and an aggregate to form an asphalt paving material. A layer of the asphalt paving material is deposited on a substrate layer and compacted to a thickness that is less than a thickness of a compacted asphalt paving material formed of the aggregate and the base asphalt with no oxidized polyolefin while achieving the same amount or less of high temperature rutting than the compacted asphalt paving material formed of the aggregate and the base asphalt with no oxidized polyolefin. No. of Pages : 23 No. of Claims : 10 The Patent Office Journal 18/12/2015 65660 (12) PATENT APPLICATION PUBLICATION (21) Application No.2482/DEL/2011 A (19) INDIA (22) Date of filing of Application :30/08/2011 (43) Publication Date : 18/12/2015 (54) Title of the invention : A PROCESS FOR THE PREPARATION OF LUBRICATING GREASE PREPARED FROM POLYLEFINIC MATERIAL (51) International classification :C08L (71)Name of Applicant : (31) Priority Document No :NA 1)DIRECTOR GENERAL, DEFENCE RESEARCH & (32) Priority Date :NA DEVELOPMENT ORGANISATION (33) Name of priority country :NA Address of Applicant :MINISTRY OF DEFENCE, ROOM (86) International Application No :NA NO. 348, B-WING, DRDO BHAWAN, RAJAJI MARG, NEW Filing Date :NA DELHI-110011 (INDIA). Delhi India (87) International Publication No :NA (72)Name of Inventor : (61) Patent of Addition to Application Number :NA 1)FAHIMUDDIN Filing Date :NA 2)BHATNAGAR, RAJESH (62) Divisional to Application Number :NA 3)NANDI, TANDRA Filing Date :NA 4)RAO, KONDEPUDI UDAYA BHASKER (57) Abstract : A method for preparing grease from polyolefinic material comprising: (i) adding a stabilizer to a mineral oil; (ii) adding a metal soap to reaction mixture of step (i); (iii) raising the temperature of mixture of step (ii); (iv) adding a polyolefinic material to mixture of step (iii) to form a homogeneous mixture; (v) cooling homogeneous mixture of step (iv); (vi) adding additives to mixture of step (v); and (vii) cooling the mixture of step (vi) to room temperature to obtain grease. No. of Pages : 10 No. of Claims : 14 The Patent Office Journal 18/12/2015 65661 (12) PATENT APPLICATION PUBLICATION (21) Application No.5060/DELNP/2015 A (19) INDIA (22) Date of filing of Application :11/06/2015 (43) Publication Date : 18/12/2015 (54) Title of the invention : MODULAR FRAMES FOR ARRANGEMENT AND ORIENTATION OF GEOMETRIC SOLIDS (51) International (71)Name of Applicant : :A63H33/04,A63H33/06,A63H33/10 classification 1)HARAMEIN, Nassim (31) Priority Document No :13/677216 Address of Applicant :PO Box 764, Holualoa, Hawaii 96725 (32) Priority Date :14/11/2012 U.S.A. (33) Name of priority (72)Name of Inventor : :U.S.A. country 1)HARAMEIN ,Nassim (86) International :PCT/US2013/070174 Application No :14/11/2013 Filing Date (87) International :WO 2014/078582 Publication No (61) Patent of Addition to :NA Application Number :NA Filing Date (62) Divisional to :NA Application Number :NA Filing Date (57) Abstract : Modular frames for instructional use that provide secure mounts for geometric solids are presented. Some contemplated modular frames can be assembled into three dimensional modular devices and are particularly suitable for instructional purposes. Modular devices comprising two or more frames could be coupled via a clip in two or more different configurations. Containers including conductive material and configured to provide a Faraday cage around their contents are also provided. No. of Pages : 56 No. of Claims : 37 The Patent Office Journal 18/12/2015 65662 (12) PATENT APPLICATION PUBLICATION (21) Application No.5061/DELNP/2015 A (19) INDIA (22) Date of filing of Application :11/06/2015 (43) Publication Date : 18/12/2015 (54) Title of the invention : DIALYSIS COMPOSITION (51) International (71)Name of Applicant : :A61K9/08,A61K47/02,A61K47/12 classification 1)GAMBRO LUNDIA AB (31) Priority Document No :12514477 Address of Applicant :P.O. Box 10101, SE -220 10 Lund (32) Priority Date :18/12/2012 Sweden (33) Name of priority country :Sweden (72)Name of Inventor : (86) International Application 1)FORSB„CK ,Gunita :PCT/EP2013/077019 No 2)HANCOCK, Viktoria :18/12/2013 Filing Date 3)WIESLANDER ,Anders (87) International Publication 4)LINDEN ,Torbjrn :WO 2014/095953 No (61) Patent of Addition to :NA Application Number :NA Filing Date (62) Divisional to Application :NA Number :NA Filing Date (57) Abstract : The present invention relates to an acid concentrate dialysis composition an acid concentrate dialysis composition comprising a mixture of citric acid and citrate , having pH of less than 3.0 , wherein the total concentration of citrate is between 35 mM and 450 mM ,and wherein the amount of citric acid is more than 50 % of the total concentration of citrate. The acid concentrate dialysis composition is to be combined to form a dialysis solution having a total concentration of citrate of between 1 and 6 mM. No. of Pages : 48 No. of Claims : 17 The Patent Office Journal 18/12/2015 65663 (12) PATENT APPLICATION PUBLICATION (21) Application No.5062/DELNP/2015 A (19) INDIA (22) Date of filing of Application :11/06/2015 (43) Publication Date : 18/12/2015 (54) Title of the invention : MOTOR VEHICLE DOOR LOCK (51) International (71)Name of Applicant : :E05B81/16,E05B81/14,E05B81/06 classification 1)KIEKERT AKTIENGESELLSCHAFT (31) Priority Document No :10 2012 111 298.3 Address of Applicant :Hseler Platz 2, 42579 Heiligenhaus (32) Priority Date :22/11/2012 Germany (33) Name of priority country :Germany (72)Name of Inventor : (86) International Application 1)BARMSCHEIDT ,Christian :PCT/DE2013/000701 No :22/11/2013 Filing Date (87) International Publication :WO 2014/079411 No (61) Patent of Addition to :NA Application Number :NA Filing Date (62) Divisional to Application :NA Number :NA Filing Date (57) Abstract : The object of the invention is a motor vehicle door lock, comprising a locking mechanism , an actuating lever chain (12 , 13, 14) and a drive (4 , 5) for electrically opening the locking mechanism. According to the invention , an additional drive (7 , 8) is provided, which optionally transfers the actuating lever chain (12 , 13 ,14) in its locked position and only then generates an opening signal for the drive (4 , 5) for electrically opening the locking mechanism. No. of Pages : 14 No. of Claims : 10 The Patent Office Journal 18/12/2015 65664 (12) PATENT APPLICATION PUBLICATION (21) Application No.5063/DELNP/2015 A (19) INDIA (22) Date of filing of Application :11/06/2015 (43) Publication Date : 18/12/2015 (54) Title of the invention : MOTOR VEHICLE DOOR LOCK (51) International (71)Name of Applicant : :E05B81/14,E05B81/06,E05B77/02 classification 1)KIEKERT AKTIENGESELLSCHAFT (31) Priority Document No :10 2012 111 288.6 Address of Applicant :Hseler Platz 2, 42579 Heiligenhaus (32) Priority Date :22/11/2012 Germany (33) Name of priority country :Germany (72)Name of Inventor : (86) International Application 1)BARMSCHEIDT Christian :PCT/DE2013/000702 No :22/11/2013 Filing Date (87) International Publication :WO 2014/079412 No (61) Patent of Addition to :NA Application Number :NA Filing Date (62) Divisional to Application :NA Number :NA Filing Date (57) Abstract : The object of the present invention is a motor vehicle door lock , comprising a locking mechanism and an electrical drive (4, 5) for electrically opening the locking mechanism. According to the invention , a complementary drive (7 , 8) is provided in addition to the electrical drive (4 , 5) for electrically opening the locking mechanism. With the aid of the electrical drive (4 ,5), the additional drive (7 , 8) releases for the purpose of electrically opening the locking mechanism , a mechanical safety mechanism of the respective electrical drive (4 , 5) , which is formed by a blocking element (2). No. of Pages : 12 No. of Claims : 10 The Patent Office Journal 18/12/2015 65665 (12) PATENT APPLICATION PUBLICATION (21) Application No.5064/DELNP/2015 A (19) INDIA (22) Date of filing of Application :11/06/2015 (43) Publication Date : 18/12/2015 (54) Title of the invention : HOOK PART (51) International classification :A47B91/02 (71)Name of Applicant : (31) Priority Document No :20 2012 012 380.7 1)TEGOMETALL INTERNATIONAL AG (32) Priority Date :21/12/2012 Address of Applicant :Industriestrae, CH -8574 Lengwil (33) Name of priority country :Germany Switzerland (86) International Application No :PCT/EP2013/077373 (72)Name of Inventor : Filing Date :19/12/2013 1)BOHNACKER ,Ulrich (87) International Publication No :WO 2014/096190 (61) Patent of Addition to Application :NA Number :NA Filing Date (62) Divisional to Application Number :NA Filing Date :NA (57) Abstract : The present invention relates to a hook part for connecting a foot part (2) to a column (3) in a shelving system , typically as part of store fittings. The hook part is assembled in a layer- like manner from at least two sheet metal parts (20 , 30) , wherein the upper side of the hook part is formed by the upper side of a first sheet metal -part (20), whereas the lower side of the hook part is formed by the lower side of a second sheet metal part (30). The front portion (11) of the hook part is designed to be fastened to the foot part , whereas the rear portion (13) of the hook part is designed to be fastened to the column. In the layer like structure, lateral parts (21 , 22) of the first sheet metal part and lateral parts (31 , 32) of the second sheet- metal part , which in each case belong to the rear portion are respectively folded upwardly and downwardly in order to allow the rear portion ,to be latched into the correspondingly formed hole in the column (3). No. of Pages : 12 No. of Claims : 14 The Patent Office Journal 18/12/2015 65666 (12) PATENT APPLICATION PUBLICATION (21) Application No.2575/DEL/2012 A (19) INDIA (22) Date of filing of Application :21/08/2012 (43) Publication Date : 18/12/2015 (54) Title of the invention : A SEAL ASSEMBLY SOLUTION FOR AUTOMOTIVE TRANSMISSION, DRIVELINE AND FRONT AXLE (51) International classification :B61K (71)Name of Applicant : (31) Priority Document No :NA 1)ESCORTS LIMITED, AGRI MACHINERY GROUP (32) Priority Date :NA Address of Applicant :18/4, MATHURA ROAD, (33) Name of priority country :NA FARIDABAD-121 007 (INDIA), Haryana India (86) International Application No :NA (72)Name of Inventor : Filing Date :NA 1)NEERAJ VIJ (87) International Publication No : NA 2)YASH PAL GRAMNI (61) Patent of Addition to Application Number :NA 3)BALVIR SINGH Filing Date :NA (62) Divisional to Application Number :NA Filing Date :NA (57) Abstract : This invention relates to a Seal Assembly for Automotive Transmission, Driveline and Front axle comprising of a seal guide constituting a tubular member, starting diameter of which is less than seal lip diameter and end diameter of which is such that, it can rest completely on the mating component. The invention is associated with the following advantageous features:- - Significant improvement in productivity as compared to conventional use of dowels as guide during seal assembly. - Atleast four times improvement in comparison to conventional arrangement. - Prevention of seal lip overturning during assembly. No. of Pages : 10 No. of Claims : 7 The Patent Office Journal 18/12/2015 65667 (12) PATENT APPLICATION PUBLICATION (21) Application No.5076/DELNP/2015 A (19) INDIA (22) Date of filing of Application :11/06/2015 (43) Publication Date : 18/12/2015 (54) Title of the invention : APPEARANCE ENHANCER FOR RUBBER COMPOSITIONS WITH ANTIDEGRADANTS (51) International classification :C08L67/00,C08L21/00,C08L7/00 (71)Name of Applicant : (31) Priority Document No :61/745831 1)BRIDGESTONE AMERICAS TIRE OPERATIONS, LLC (32) Priority Date :26/12/2012 Address of Applicant :535 Marriott Drive, Nashville, TN (33) Name of priority country :U.S.A. 37214 U.S.A. (86) International Application (72)Name of Inventor : :PCT/US2013/075428 No 1)BALNIS, Craig :16/12/2013 Filing Date (87) International Publication :WO 2014/105488 No (61) Patent of Addition to :NA Application Number :NA Filing Date (62) Divisional to Application :NA Number :NA Filing Date (57) Abstract : The addition of a polyester resin comprising a copolymer of maleic anhydride or maleic acid and a linear or branched polyol , to a rubber composition provides a black , glossy appearance on the outer, exposed surface. The rubber composition may be formed into a tire sidewall component of a tire. No. of Pages : 21 No. of Claims : 15 The Patent Office Journal 18/12/2015 65668 (12) PATENT APPLICATION PUBLICATION (21) Application No.5077/DELNP/2015 A (19) INDIA (22) Date of filing of Application :11/06/2015 (43) Publication Date : 18/12/2015 (54) Title of the invention : IMPROVEMENTS IN AND RELATING TO RADAR (51) International classification :H01Q21/00,G01S3/38,G01S3/40 (71)Name of Applicant : (31) Priority Document No :1222830.0 1)BAE SYSTEMS PLC (32) Priority Date :18/12/2012 Address of Applicant :6 Carlton Gardens, London SW1Y 5AD (33) Name of priority country :U.K. U.K. (86) International Application (72)Name of Inventor : :PCT/GB2013/053262 No 1)CLARK ,Marcus ,Edward :12/12/2013 Filing Date 2)WILLS, Robert (87) International Publication :WO 2014/096778 No (61) Patent of Addition to :NA Application Number :NA Filing Date (62) Divisional to Application :NA Number :NA Filing Date (57) Abstract : An antenna system (1) comprises a directional antenna (2) adapted to rotate through a range of directions in azimuth. It is responsive to radio- frequency (RF) signals received from directions within the range of directions in azimuth. A receiver (7) is arranged to receive the RF signals from the antenna within a signal frequency response band of the receiver and to provide a corresponding output for signal processing. A signal filter (11) is operable to block the output from the receiver when the frequency of the RF signal lies at a frequency within the signal frequency response band of the receiver and a detector unit (8) is arranged to apply the signal filter when the directional antenna is directed to a predetermined azimuth at which an interference source is located and to not apply the signal filter otherwise. No. of Pages : 15 No. of Claims : 10 The Patent Office Journal 18/12/2015 65669 (12) PATENT APPLICATION PUBLICATION (21) Application No.5078/DELNP/2015 A (19) INDIA (22) Date of filing of Application :11/06/2015 (43) Publication Date : 18/12/2015 (54) Title of the invention : FOAM PART, IN PARTICULAR FOR A VEHICLE SEAT, AND METHOD AND TOOL FOR PRODUCING A FOAM PART (51) International classification :B60N2/70 (71)Name of Applicant : (31) Priority Document No :10 2013 000 244.3 1)JOHNSON CONTROLS GMBH (32) Priority Date :04/01/2013 Address of Applicant :Industriestrasse 20 -30, 51399 (33) Name of priority country :Germany Burscheid Germany (86) International Application No :PCT/EP2013/077630 (72)Name of Inventor : Filing Date :20/12/2013 1)HUGUES, Laurent (87) International Publication No :WO 2014/106592 2)HILGER, Karsten (61) Patent of Addition to Application 3)RIEZLER, Bernhard :NA Number 4)STEINMEIER, Horst :NA Filing Date 5)BENAMAR ,Mohsin (62) Divisional to Application Number :NA Filing Date :NA (57) Abstract : The invention relates to a foam part (5 , 105, 205 , 305) , in particular for a vehicle seat , comprising a first foam layer (11 , 111 , 211 , 311) facing a user and a second foam layer (21 , 221) facing away from the user , wherein the first foam layer (11 , 111 ,211 , 311) has a hardness and/or density that is different from the hardness or density of the second foam layer (21, 221). According to the invention, the first foam layer (11 , 111 , 211, 311) comprises several comfort tubes (50, 150, 250, 350) facing the user. The invention further relates to a method for producing such a foam part (5, 105, 205 , 305) , wherein in a first step the first foam layer (11 , 111 , 211 , 311) having the comfort tubes (50 , 150, 250 , 350) is foamed and in a second step the second foam layer (21 221) is foamed. The invention further relates to a tool (500) for producing a foam part (5 , 105 , 205 ,305) according to the invention , comprising a bottom part (510), a frame (520) , and a top part (530). No. of Pages : 33 No. of Claims : 15 The Patent Office Journal 18/12/2015 65670 (12) PATENT APPLICATION PUBLICATION (21) Application No.5079/DELNP/2015 A (19) INDIA (22) Date of filing of Application :11/06/2015 (43) Publication Date : 18/12/2015 (54) Title of the invention : CONTROL DEVICE FOR HYBRID VEHICLE (51) International classification :B60W10/06,B60K6/48,B60K6/54 (71)Name of Applicant : (31) Priority Document No :NA 1)TOYOTA JIDOSHA KABUSHIKI KAISHA (32) Priority Date :NA Address of Applicant :1, Toyota -cho ,Toyota- shi ,Aichi (33) Name of priority country :NA 4718571 Japan (86) International Application (72)Name of Inventor : :PCT/JP2012/083750 No 1)SUGIMURA Toshio :26/12/2012 Filing Date 2)KUWAHARA Seiji (87) International Publication 3)TSUTSUMI Takahiko :WO 2014/102946 No 4)MINAMIKAWA Koki (61) Patent of Addition to 5)SATO Shun :NA Application Number :NA Filing Date (62) Divisional to Application :NA Number :NA Filing Date (57) Abstract : In an event where a K0 clutch (34) is forcibly released (in an event of K0 heat failure) with clutch temperature (TK0) of the K0 clutch (34) exceeding an engagement prohibition temperature (TK01) when switching to an engine traveling mode the engine rotation speed (NE) is controlled such that rotation speeds (NE and NMG) before and after the release of the K0 clutch (34) are synchronized. Thus , a shock is reduced when transitioning to the engine- traveling mode by engaging the K0 clutch (34) after the temperature has dropped. Consequently , torque compensation is no longer needed when the clutch is engaged , there is no need to secure any compensating torque (Ta) when a driving force for traveling is generated by a motor generator (MG) in an event of K 0 heat failure , the motorgenerator can be used for traveling until its maximum torque (TMGmax) is reached, and a driver can be prevented from experiencing an uncomfortable feeling due to the insufficiency of driving force. No. of Pages : 25 No. of Claims : 2 The Patent Office Journal 18/12/2015 65671 (12) PATENT APPLICATION PUBLICATION (21) Application No.5096/DELNP/2015 A (19) INDIA (22) Date of filing of Application :11/06/2015 (43) Publication Date : 18/12/2015 (54) Title of the invention : WORK MACHINE (51) International classification :E02F9/08 (71)Name of Applicant : (31) Priority Document No :201220633085.3 1)CATERPILLAR INC. (32) Priority Date :26/11/2012 Address of Applicant :100 N.E. Adams Street, Peoria,IL (33) Name of priority country :China 61629- 9510 U.S.A. (86) International Application No :PCT/US2013/070576 (72)Name of Inventor : Filing Date :18/11/2013 1)HAN ,Congchong (87) International Publication No :WO 2014/081665 2)ANDERSON, Steven, K. (61) Patent of Addition to Application 3),Benjamin ,. :NA Number :NA Filing Date (62) Divisional to Application Number :NA Filing Date :NA (57) Abstract : The present invention relates to a work machine comprising a hood cover, a shunt tank disposed inside the hood cover ,and a support member independent of the hood cover and adapted to support the shunt tank, the shunt tank being separated from the hood cover in an operating state of the work machine and detachably fixed to the support member, wherein the hood cover is provided with a fitting structure adapted for fitting a connector , and the shunt tank is provided with a connecting structure which is configured to form a detachable connection by means of the connector and the fitting structure on the hood cover No. of Pages : 15 No. of Claims : 7 The Patent Office Journal 18/12/2015 65672 (12) PATENT APPLICATION PUBLICATION (21) Application No.5097/DELNP/2015 A (19) INDIA (22) Date of filing of Application :11/06/2015 (43) Publication Date : 18/12/2015 (54) Title of the invention : ENCHANCED CARBON DIOXIDE -BASED GEOTHERMAL ENERGY GENERATION SYSTEMS AND METHODS (51) International classification :E21B43/24,E21B43/16 (71)Name of Applicant : (31) Priority Document No :61/725270 1)RANDOLPH, Jimmy Bryan (32) Priority Date :12/11/2012 Address of Applicant :4610 Blaisdell Avenue, Minneapolis, (33) Name of priority country :U.S.A. Minnesota 554 1 U.S.A. (86) International Application No :PCT/US2013/069680 (72)Name of Inventor : Filing Date :12/11/2013 1)RANDOLPH ,Jimmy Bryan (87) International Publication No :WO 2014/075071 (61) Patent of Addition to Application :NA Number :NA Filing Date (62) Divisional to Application Number :NA Filing Date :NA (57) Abstract : A system comprises one or more injection wells for accessing one or more underground reservoirs, the one or more reservoirs being at one or more first temperatures and containing at least one native fluid. The native fluid can include a solution comprising methane. Each of the one or more injection wells have an injection well reservoir opening in fluid communication with at least one of the one or more reservoirs. The system further includes one or more production wells , each having a production well reservoir opening in fluid communication with at least one of the one or more reservoirs. A working -fluid supply system provides a non water based working fluid to the one or more injection wells at a second temperature lower than the first temperatures. Exposure of the non- water based working fluid to the native fluid causes at least a portion of the methane to come out of solution with the native fluid to form a production fluid of at least a portion of the non- water based working fluid and the portion of the methane. Exposure of the mixture to the first temperatures heats the production fluid to a third temperature that is higher than the second temperature. The production fluid can enter one or more of the production well reservoir openings. An energy recovery apparatus in fluid communication with the one or more productions wells converts energy contained in the production fluid to electricity , heat, or a combinations thereof. No. of Pages : 93 No. of Claims : 39 The Patent Office Journal 18/12/2015 65673 (12) PATENT APPLICATION PUBLICATION (21) Application No.5098/DELNP/2015 A (19) INDIA (22) Date of filing of Application :11/06/2015 (43) Publication Date : 18/12/2015 (54) Title of the invention : METHOD FOR CARRYING OUT TRANSACTIONS (51) International (71)Name of Applicant : :G06Q20/38,G06Q40/02,G06Q30/06 classification 1)GIESEN ,Heinz (31) Priority Document No :10 2012 220 774.0 Address of Applicant :Kettelerstrae 24, 48147 M¼nster (32) Priority Date :14/11/2012 Germany (33) Name of priority (72)Name of Inventor : :Germany country 1)GIESEN ,Heinz (86) International :PCT/EP2013/071495 Application No :15/10/2013 Filing Date (87) International :WO 2014/075862 Publication No (61) Patent of Addition to :NA Application Number :NA Filing Date (62) Divisional to :NA Application Number :NA Filing Date (57) Abstract : The invention relates to a method for carrying out transactions between a number of subscribers , wherein a unique pseudonym is assigned to each of the subscribers wherein the assignment of a pseudonym to a subscriber and the transaction data relating to the subscriber are stored on a notary server. No. of Pages : 34 No. of Claims : 13 The Patent Office Journal 18/12/2015 65674 (12) PATENT APPLICATION PUBLICATION (21) Application No.5099/DELNP/2015 A (19) INDIA (22) Date of filing of Application :11/06/2015 (43) Publication Date : 18/12/2015 (54) Title of the invention : FAULT DIAGNOSIS DEVICE FOR EXHAUST PURIFICATION SYSTEM (51) International classification :F01N3/20,F01N3/02,F01N3/08 (71)Name of Applicant : (31) Priority Document No :2012272648 1)TOYOTA JIDOSHA KABUSHIKI KAISHA (32) Priority Date :13/12/2012 Address of Applicant :1, Toyota- cho, Toyota -shi ,Aichi (33) Name of priority country :Japan 4718571 Japan (86) International Application No :PCT/JP2013/083365 (72)Name of Inventor : Filing Date :12/12/2013 1)KIDOKORO, Toru (87) International Publication No :WO 2014/092159 2)MATSUMOTO, Arifumi (61) Patent of Addition to 3)TAKAOKA ,Kazuya :NA Application Number 4)NISHIJIMA ,Hirokazu :NA Filing Date 5)HAGIMOTO ,Taiga (62) Divisional to Application 6)TERUI, Yuki :NA Number 7)UOZUMI ,Akifumi :NA Filing Date (57) Abstract : The present invention addresses the problem of more reliably diagnosing faults in an exhaust purification system provided with both a selective reduction function and a filtering function. In order resolve said problem , the present invention is configured in such a manner that , in a fault diagnosis device for an exhaust purification system provided with both a selective reduction function and a filtering function , a NOx purification rate when the exhaust purification system is normal is calculated on the basis of an estimated value for the amount of particulate matter (PM) deposited or trapped in the exhaust purification system, and an estimated value for the ratio of NO2 in the exhaust that flows into the exhaust purification system; and the exhaust purification system is determined as being faulty if the difference between the calculation results and the actual NOx purification rate is greater than a threshold value. No. of Pages : 41 No. of Claims : 4 The Patent Office Journal 18/12/2015 65675 (12) PATENT APPLICATION PUBLICATION (21) Application No.5080/DELNP/2015 A (19) INDIA (22) Date of filing of Application :11/06/2015 (43) Publication Date : 18/12/2015 (54) Title of the invention : CONSTANT ENVELOPE SIGNAL GENERATION METHOD AND DEVICE , AND RECEIVING METHOD AND DEVICE FOR DOUBLE -FREQUENCY FOUR -COMPONENT SPREAD SPECTRUM SIGNALS (51) International classification :H04J1/00 (71)Name of Applicant : (31) Priority Document No :201210484613.8 1)TSINGHUA UNIVERSITY (32) Priority Date :23/11/2012 Address of Applicant :Qinghuayuan Haidian District Beijing (33) Name of priority country :China 100084 China (86) International Application No :PCT/CN2013/087732 (72)Name of Inventor : Filing Date :22/11/2013 1)YAO Zheng (87) International Publication No :WO 2014/079390 2)LU Mingquan (61) Patent of Addition to Application :NA Number :NA Filing Date (62) Divisional to Application Number :NA Filing Date :NA (57) Abstract : Proposed are a constant envelope multiplexing signal generation method , generation device , receiving method and receiving device for double- frequency four- component spread spectrum signals. According to the method , four baseband spread spectrum signals s1(t) , s2(t) , s3(t) and s4(t) can be respectively modulated onto two frequency points fi and f2, so as to generate a constant envelope multiplexing signal at a radio- frequency carrier frequency of f=(f+f)/2, wherein si(t) and s2(t) are modulated onto fi and the carrier phases thereof are orthogonal to each other , and s3(t) and s4(t) are modulated onto f2 and the carrier phases thereof are orthogonal to each other , where f1 is greater than f2. The method comprises: determining the ratio of powers to be allocated for four baseband spread spectrum signals s1(t), s2(t), s3(t) and s4(t) in a constant envelope multiplexing signal; storing an additional phase lookup table , the additional phase lookup table comprising additional phases of a same phase baseband component I(t) and an orthogonal baseband component Q(t) of the constant envelop multiplexing signal; querying the additional phase lookup table so as to obtain an additional phase ¸ of a time period to which the current moment belongs; and according to the obtained additional phase ¸, generating the same phase baseband component I(t) and the orthogonal baseband component Q(t) of the constant envelope multiplexing signal , and generating a multiplexing signal SRF(t) having a constant envelope. No. of Pages : 47 No. of Claims : 17 The Patent Office Journal 18/12/2015 65676 (12) PATENT APPLICATION PUBLICATION (21) Application No.5081/DELNP/2015 A (19) INDIA (22) Date of filing of Application :11/06/2015 (43) Publication Date : 18/12/2015 (54) Title of the invention : DIHYDROPYRAZOLE GPR40 MODULATORS (51) International (71)Name of Applicant : :C07D405/14,C07D401/12,C07D405/12 classification 1)BRISTOL -MYERS SQUIBB COMPANY (31) Priority Document Address of Applicant :Route 206 and Province Line Road, :61/727262 No Princeton, New Jersey 08543 U.S.A. (32) Priority Date :16/11/2012 (72)Name of Inventor : (33) Name of priority 1)ELLSWORTH, Bruce ,A. :U.S.A. country 2)SHI ,Jun (86) International 3)EWING ,William R. :PCT/US2013/070216 Application No 4)JURICA ,Elizabeth, A. :15/11/2013 Filing Date 5)HERNANDEZ, Andres, S. (87) International 6)WU ,Ximao :WO 2014/078611 Publication No 7)GU, Zhengxiang (61) Patent of Addition to 8)HONG, Zhenqiu :NA Application Number 9)OCONNOR, Stephen ,P. :NA Filing Date (62) Divisional to :NA Application Number :NA Filing Date (57) Abstract : The present invention provides compounds of Formula (I): (Formula (I) , or a stereoisomer , or a pharmaceutically acceptable salt thereof , wherein all of the variables are as defined herein. These compounds are GPR40 G protein -coupled receptor modulators which may be used as medicaments. No. of Pages : 271 No. of Claims : 11 The Patent Office Journal 18/12/2015 65677 (12) PATENT APPLICATION PUBLICATION (21) Application No.5082/DELNP/2015 A (19) INDIA (22) Date of filing of Application :11/06/2015 (43) Publication Date : 18/12/2015 (54) Title of the invention : DIHYDROPYRAZOLE GPR40 MODULATORS (51) International (71)Name of Applicant : :C07D401/12,C07D401/14,A61P3/10 classification 1)BRISTOL- MYERS SQUIBB COMPANY (31) Priority Document No :61/727262 Address of Applicant :Route 206 and Province Line Road, (32) Priority Date :16/11/2012 Princeton ,New Jersey 08543 U.S.A. (33) Name of priority (72)Name of Inventor : :U.S.A. country 1)ELLSWORTH ,Bruce A. (86) International 2)SHI, Jun; :PCT/US2013/070215 Application No 3)EWING, William R. :15/11/2013 Filing Date 4)JURICA ,Elizabeth A. (87) International 5)HERNANDEZ ,Andres S. :WO 2014/078610 Publication No 6)WU ,Ximao (61) Patent of Addition to :NA Application Number :NA Filing Date (62) Divisional to :NA Application Number :NA Filing Date (57) Abstract : The present invention provides compounds of Formula (I): or a stereoisomer , or a pharmaceutically acceptable salt thereof, wherein all of the variables are as defined herein. These compounds are GPR40 G protein- coupled receptor modulators which may be used as medicaments. No. of Pages : 184 No. of Claims : 15 The Patent Office Journal 18/12/2015 65678 (12) PATENT APPLICATION PUBLICATION (21) Application No.5083/DELNP/2015 A (19) INDIA (22) Date of filing of Application :11/06/2015 (43) Publication Date : 18/12/2015 (54) Title of the invention : DIHYDROPYRAZOLE GPR40 MODULATORS (51) International (71)Name of Applicant : :C07D231/06,C07D231/08,C07D401/10 classification 1)BRISTOL- MYERS SQUIBB COMPANY (31) Priority Document Address of Applicant :P.O. Box 4000, Route 206 and :61/727191 No ProvinceLine Road, Princeton ,New Jersey 08543- 4000 U.S.A. (32) Priority Date :16/11/2012 (72)Name of Inventor : (33) Name of priority 1)HERNANDEZ, Andres S. :U.S.A. country 2)ELLSWORTH, Bruce A. (86) International 3)EWING ,William R. :PCT/US2013/070209 Application No 4)CHEN, Bin :15/11/2013 Filing Date (87) International :WO 2014/078608 Publication No (61) Patent of Addition to :NA Application Number :NA Filing Date (62) Divisional to :NA Application Number :NA Filing Date (57) Abstract : The present invention provides compounds of Formula (I): or a stereoisomer ,or a pharmaceutically acceptable salt thereof , wherein all of the variables are as defined herein. These compounds are GPR40 G protein -coupled receptor modulators which may be used as medicaments. No. of Pages : 170 No. of Claims : 15 The Patent Office Journal 18/12/2015 65679 (12) PATENT APPLICATION PUBLICATION (21) Application No.5084/DELNP/2015 A (19) INDIA (22) Date of filing of Application :11/06/2015 (43) Publication Date : 18/12/2015 (54) Title of the invention : PYRROLIDINE GPR40 MODULATORS (51) International (71)Name of Applicant : :C07D401/14,C07D401/12,C07D487/04 classification 1)BRISTOL- MYERS SQUIBB COMPANY (31) Priority Document Address of Applicant :Route 206 and Province Line Road, :61/727253 No Princeton ,NJ 08543- 4000 U.S.A. (32) Priority Date :16/11/2012 (72)Name of Inventor : (33) Name of priority 1)ELLSWORTH ,Bruce, A. :U.S.A. country 2)JURICA ,Elizabeth, A. (86) International 3)SHI ,Jun :PCT/US2013/070213 Application No 4)EWING ,William, R. :15/11/2013 Filing Date 5)YE,, Xiang- Yang (87) International 6)WU ,Ximao :WO 2014/078609 Publication No 7)ZHU ,Yeheng (61) Patent of Addition to 8)SUN, Chongqing :NA Application Number :NA Filing Date (62) Divisional to :NA Application Number :NA Filing Date (57) Abstract : The present invention provides compounds of Formula (I): or a stereoisomer, or a pharmaceutically acceptable salt thereof , wherein all of the variables are as defined herein. These compounds are GPR40 G protein -coupled receptor modulators which may be used as medicaments. No. of Pages : 276 No. of Claims : 15 The Patent Office Journal 18/12/2015 65680 (12) PATENT APPLICATION PUBLICATION (21) Application No.5085/DELNP/2015 A (19) INDIA (22) Date of filing of Application :11/06/2015 (43) Publication Date : 18/12/2015 (54) Title of the invention : USING MIXTURES OF E/Z ISOMERS TO OBTAIN QUANTITATIVELY SPECIFIC PRODUCTS BY COMBINING ASYMMETRIC HYDROGENATION AND ISOMERIZATION (51) International (71)Name of Applicant : :C07C45/62,C07C45/67,C07C49/04 classification 1)DSM IP ASSETS B.V. (31) Priority Document No :12197857.1 Address of Applicant :Het Overloon 1, NL- 6411 Te Heerlen (32) Priority Date :18/12/2012 Netherlands (33) Name of priority country :EPO (72)Name of Inventor : (86) International Application 1)BONRATH, Werner :PCT/EP2013/077246 No 2)NETSCHER ,Thomas :18/12/2013 Filing Date 3)MEDLOCK, Jonathan Alan (87) International Publication 4)STEMMLER, Ren Tobias :WO 2014/096107 No 5)VERZIJL, Gerardus Karel Maria (61) Patent of Addition to 6)VRIES, DE, Andreas Hendrikus Maria :NA Application Number :NA Filing Date (62) Divisional to Application :NA Number :NA Filing Date (57) Abstract : The present invention relates to a process of manufacturing compound having stereogenic centres from a mixture of E/Z isomers of unsaturated compounds having prochiral double bonds. The hydrogenation product has a specific desired configuration at the stereogenic centres. The process involves an asymmetric hydrogenation and an isomerization step. The process is very advantageous in that it forms the desired chiral product from a mixture of stereoisomers of the starting product in an efficient way. No. of Pages : 98 No. of Claims : 17 The Patent Office Journal 18/12/2015 65681 (12) PATENT APPLICATION PUBLICATION (21) Application No.1607/DEL/2014 A (19) INDIA (22) Date of filing of Application :13/06/2014 (43) Publication Date : 18/12/2015 (54) Title of the invention : SYSTEMS AND METHODS FOR STATISTICAL MULTIPLEXING WITH OTN AND DWDM (51) International classification :H04J14/02 (71)Name of Applicant : (31) Priority Document No :NA 1)CIENA CORPORATION (32) Priority Date :NA Address of Applicant :7035 Ridge Road Hanover, MD 21076, (33) Name of priority country :NA USA U.S.A. (86) International Application No :NA (72)Name of Inventor : Filing Date :NA 1)PRAKASH, Anurag (87) International Publication No : NA 2)CHHILLAR, Mohit (61) Patent of Addition to Application Number :NA Filing Date :NA (62) Divisional to Application Number :NA Filing Date :NA (57) Abstract : A method includes profiling user-network interface (UNI) ports including Optical channel Data Unit flex (ODUflex) in a network; and adapting network-network interface (NNI) ports comprising ODUflex based on the profiling using a max-flow routing criterion. A network includes a plurality of network elements; a plurality of links interconnecting the plurality of network elements, wherein the plurality of links includes Layer 0 Dense Wave Division Multiplexing (DWDM) bandwidth and Layer 1 Optical Transport Network (OTN) bandwidth; and a control plane operating between the plurality of network elements; wherein the Layer 0 DWDM bandwidth and the Layer 1 OTN bandwidth is statistically multiplexed using the control plane and manager based on monitoring bandwidth usage thereon over time. No. of Pages : 51 No. of Claims : 20 The Patent Office Journal 18/12/2015 65682 (12) PATENT APPLICATION PUBLICATION (21) Application No.2591/DEL/2012 A (19) INDIA (22) Date of filing of Application :21/08/2012 (43) Publication Date : 18/12/2015 (54) Title of the invention : CENTRALIZED BASEBAND PROCESSING OF BASE STATIONS (51) International classification :H04N (71)Name of Applicant : (31) Priority Document No :NA 1)ALCATEL-LUCENT (32) Priority Date :NA Address of Applicant :3 avenue Octave Grard 75007 PARIS (33) Name of priority country :NA France (86) International Application No :NA (72)Name of Inventor : Filing Date :NA 1)BHAUMIK Sourjya (87) International Publication No : NA 2)PREETH CHANDRABOSE Shoban (61) Patent of Addition to Application Number :NA 3)JATAPROLU Manjunath Kashyap Filing Date :NA 4)MURALIDHAR Anand (62) Divisional to Application Number :NA 5)SRINIVASAN Vikram Filing Date :NA 6)KUMAR Gautam (57) Abstract : Systems and methods for realizing centralized architecture to enable efficient processing of multiple different base stations in a radio access network (RAN) are described. According to the present subject matter the system(s) implement the described method(s) for centralized processing of base stations by one or more computing resources. The method includes identifying at least one base station for centralized processing of baseband signals based on identification parameters and assessing at least one possible processing configuration for a centralized computing resource based on real time processing constraints associated with one or more computing resources of the centralized computing resource. The method further includes partitioning the at least one identified base station to form one or more super base stations based on the assessed possible processing configuration based on variable size bin packing algorithm; and processing the one or more super base stations in the at least one assessed processing configuration. <<To be published with Fig. 2>> No. of Pages : 35 No. of Claims : 12 The Patent Office Journal 18/12/2015 65683 (12) PATENT APPLICATION PUBLICATION (21) Application No.5100/DELNP/2015 A (19) INDIA (22) Date of filing of Application :11/06/2015 (43) Publication Date : 18/12/2015 (54) Title of the invention : ELECTRIC MACHINE WITH A STATOR AND A ROTOR (51) International classification :H02K3/52,H02K3/38 (71)Name of Applicant : (31) Priority Document No :10 2012 224 150.7 1)ROBERT BOSCH GMBH (32) Priority Date :21/12/2012 Address of Applicant :Postfach 30 02 20, 70442 Stuttgart (33) Name of priority country :Germany Germany (86) International Application No :PCT/EP2013/076318 (72)Name of Inventor : Filing Date :12/12/2013 1)AUMANN ,Christian (87) International Publication No :WO 2014/095549 2)PIERSON ,Andrew (61) Patent of Addition to Application 3)HUBER, Michael :NA Number :NA Filing Date (62) Divisional to Application Number :NA Filing Date :NA (57) Abstract : The invention concerns an electric machine with a stator and a rotor , comprising a plate stack with a plurality of superposed plates with windings which can be energized. Disposed at at least one end of the plate stack is an insulating plate. Furthermore, insulating strips are provided on the plate stack , between adjacent windings, which are supported on radially protruding shoulders on the insulating plate. No. of Pages : 13 No. of Claims : 10 The Patent Office Journal 18/12/2015 65684 (12) PATENT APPLICATION PUBLICATION (21) Application No.5101/DELNP/2015 A (19) INDIA (22) Date of filing of Application :11/06/2015 (43) Publication Date : 18/12/2015 (54) Title of the invention : HELICAL BROACH (51) International classification :B23F21/26,B23D43/00 (71)Name of Applicant : (31) Priority Document No :2013026275 1)MITSUBISHI HEAVY INDUSTRIES, LTD. (32) Priority Date :14/02/2013 Address of Applicant :16- 5, Konan 2- chome, Minato- ku (33) Name of priority country :Japan ,Tokyo 1088215 Japan (86) International Application No :PCT/JP2014/050889 (72)Name of Inventor : Filing Date :20/01/2014 1)KATSUKI ,Yasuhito (87) International Publication No :WO 2014/125872 (61) Patent of Addition to Application :NA Number :NA Filing Date (62) Divisional to Application Number :NA Filing Date :NA (57) Abstract : The finishing part (4) of this helical broach (1) is formed by a first finishing shell (20) and a second finishing shell (30) which are divided in the axial direction , and is obtained by forming a first finishing blade (50), which comprises a prescribed tooth shape helix angle (a) and a first blade groove helix angle (i), on the aforementioned first finishing shell (20) and forming a second finishing blade (60) , which comprises the aforementioned prescribed tooth shape helix angle (a) and a second blade groove helix angle (2) which differs from the aforementioned first blade groove helix angle (i) , on the aforementioned second finishing shell (30). No. of Pages : 30 No. of Claims : 3 The Patent Office Journal 18/12/2015 65685 (12) PATENT APPLICATION PUBLICATION (21) Application No.5102/DELNP/2015 A (19) INDIA (22) Date of filing of Application :11/06/2015 (43) Publication Date : 18/12/2015 (54) Title of the invention : LOCKING ARRANGEMENT CARTON BLANK AND METHOD (51) International (71)Name of Applicant : :B65D71/14,B65D71/16,B65D5/00 classification 1)MEADWESTVACO PACKAGING SYSTEMS, LLC (31) Priority Document No :61/735176 Address of Applicant :501 South 5th Street, Richmond, (32) Priority Date :10/12/2012 Virginia 23219- 0501 U.S.A. (33) Name of priority country :U.S.A. (72)Name of Inventor : (86) International Application 1)BATES ,Aaron ,L :PCT/US2013/073768 No 2)MILLER, Bobby, L ,Jr :08/12/2013 Filing Date 3)NA (87) International Publication :WO 2014/093185 No (61) Patent of Addition to :NA Application Number :NA Filing Date (62) Divisional to Application :NA Number :NA Filing Date (57) Abstract : A locking arrangement secures together first and second panels. The arrangement includes locking tabs (54 , 56 ,58) projecting from an end edge (64) of the first panel (12) and locking slits (50a , 50b , 50c) in the second panel (28). Each locking slit is provided for receiving a respective one of the locking tabs. The locking tabs and the locking slits are engageable by relative sliding movement with each other. At least one of the locking tabs and locking slits is configured to secure the first and second panels in a first overlapping position while at least another one of the locking tabs and locking slits is configured to secure the first and second panels in a second overlapping position. No. of Pages : 41 No. of Claims : 22 The Patent Office Journal 18/12/2015 65686 (12) PATENT APPLICATION PUBLICATION (21) Application No.5090/DELNP/2015 A (19) INDIA (22) Date of filing of Application :11/06/2015 (43) Publication Date : 18/12/2015 (54) Title of the invention : BACKUP POWER SUPPLY CONTROL (51) International classification :H02M5/00 (71)Name of Applicant : (31) Priority Document No :NA 1)SCHNEIDER ELECTRIC IT CORPORATION (32) Priority Date :NA Address of Applicant :132 Fairgrounds Road, West Kingston, (33) Name of priority country :NA RI 02892 U.S.A. (86) International Application No :PCT/US2012/067017 (72)Name of Inventor : Filing Date :29/11/2012 1)HUI JUNG ,Chen (87) International Publication No :WO 2014/084830 2)CHEN -JUI ,Shen (61) Patent of Addition to Application :NA Number :NA Filing Date (62) Divisional to Application Number :NA Filing Date :NA (57) Abstract : According to one aspect , embodiments of the invention provide an uninterruptible power supply (UPS) system comprising an input configured to receive input AC power , an output configured to provide output AC power to a load, a DC power source coupled to a DC bus ,an inverter having an input coupled to the DC bus and an output coupled to the output of the UPS system, the inverter configured to receive DC power at the input from the DC bus and provide AC power having a voltage to the output and a controller coupled to the output of the inverter and configured to operate the inverter based on an average voltage of the AC power at the output of the inverter. No. of Pages : 20 No. of Claims : 20 The Patent Office Journal 18/12/2015 65687 (12) PATENT APPLICATION PUBLICATION (21) Application No.5091/DELNP/2015 A (19) INDIA (22) Date of filing of Application :11/06/2015 (43) Publication Date : 18/12/2015 (54) Title of the invention : TREATMENT OF PULMONARY DISEASE (51) International (71)Name of Applicant : :A61K31/575,A61P11/00,A61P11/06 classification 1)INTERCEPT PHARMACEUTICALS ,INC. (31) Priority Document No :61/730749 Address of Applicant :18 Desbrosses Street, New York ,NY (32) Priority Date :28/11/2012 10013 U.S.A. (33) Name of priority (72)Name of Inventor : :U.S.A. country 1)PRUZANSKI ,Mark (86) International 2)ADORIN,I Luciano :PCT/US2013/072038 Application No :26/11/2013 Filing Date (87) International :WO 2014/085474 Publication No (61) Patent of Addition to :NA Application Number :NA Filing Date (62) Divisional to :NA Application Number :NA Filing Date (57) Abstract : The present invention relates to methods of treating ,reducing the risk of , preventing , or alleviating a symptom of a pulmonary disease or condition , reducing or suppressing inflammation in the lung , and promoting lung repair , by using a compound of formula (A): or a pharmaceutically acceptable salt thereof. No. of Pages : 77 No. of Claims : 20 The Patent Office Journal 18/12/2015 65688 (12) PATENT APPLICATION PUBLICATION (21) Application No.5092/DELNP/2015 A (19) INDIA (22) Date of filing of Application :11/06/2015 (43) Publication Date : 18/12/2015 (54) Title of the invention : TRANSPORTER (51) International classification :B60P1/02 (71)Name of Applicant : (31) Priority Document No :1221298.1 1)MMD DESIGN & CONSULTANCY LIMITED (32) Priority Date :27/11/2012 Address of Applicant :Cotes Park Lane Cotes Park Industrial, (33) Name of priority country :U.K. Estate, Somercotes, Derbyshire, DE55 4NJ U.K. (86) International Application No :PCT/GB2013/053112 (72)Name of Inventor : Filing Date :26/11/2013 1)BARBER ,Richard (87) International Publication No :WO 2014/083323 (61) Patent of Addition to Application :NA Number :NA Filing Date (62) Divisional to Application Number :NA Filing Date :NA (57) Abstract : A transporter for the transport of a large payload across an uneven ground surface is described. The transporter has a body (4); ground contacting transport means below the body , provided with drive means (1 ,2) to move the body across a ground surface in use; a payload support module (5) to support a payload above the body in use; and a plurality of elongate extendable elevators (6) each having a first articulated joint (17) with the body at a first end and a second articulated joint (13) with the payload support module at a second end. It is characterised in that each of the plurality of elongate extendable elevators is independently operable so as to enable the elongate extendable elevators (6) together to vary both the height and the attitude of the payload relative to the body; and in that at least one of each of the first (17) or second (13) articulated joints comprises a rotationally restricted joint that allows the elongate extendable elevator (6) to pivot relative to an axis orthogonal to its elongate direction but acts to prevent its rotation about an axis parallel to its elongate direction. The elongate extendable elevators are the means both by which the payload is lifted and by which the attitude of the payload is adjusted to enable it to balance. No. of Pages : 27 No. of Claims : 23 The Patent Office Journal 18/12/2015 65689 (12) PATENT APPLICATION PUBLICATION (21) Application No.5093/DELNP/2015 A (19) INDIA (22) Date of filing of Application :11/06/2015 (43) Publication Date : 18/12/2015 (54) Title of the invention : METHODS FOR PREPARING RUTHENIUM CARBENE COMPLEXES AND PRECURSORS THERETO (51) International classification :B01J37/00 (71)Name of Applicant : (31) Priority Document No :61/731815 1)ELEVANCE RENEWABLE SCIENCES INC. (32) Priority Date :30/11/2012 Address of Applicant :2501 Davey Road, Woodridge, IL (33) Name of priority country :U.S.A. 60517 U.S.A. (86) International Application No :PCT/US2013/071724 (72)Name of Inventor : Filing Date :25/11/2013 1)KUNZ ,Linda, A. (87) International Publication No :WO 2014/085340 2)COHEN ,Steven, A. (61) Patent of Addition to Application :NA Number :NA Filing Date (62) Divisional to Application Number :NA Filing Date :NA (57) Abstract : Methods of preparing ruthenium carbene complex precursors are disclosed herein. In some embodiments , the methods include reacting a ruthenium refinery salt with an L- type ligand and a reducing agent to form the ruthenium carbene complex precursor. Methods of preparing a ruthenium vinylcarbene complex are also disclosed. In some embodiments , preparing a ruthenium carbene complex includes converting a ruthenium carbene complex precursor into a ruthenium carbene complex having a structure (PR1R2R3)2CI2Ru=CH- R4, wherein R1, R2, R3, and R4 are defined herein. No. of Pages : 50 No. of Claims : 76 The Patent Office Journal 18/12/2015 65690 (12) PATENT APPLICATION PUBLICATION (21) Application No.5094/DELNP/2015 A (19) INDIA (22) Date of filing of Application :11/06/2015 (43) Publication Date : 18/12/2015 (54) Title of the invention : BATTERY WITH ELECTROLYTE MIXING DEVICE (51) International classification :H01M2/38 (71)Name of Applicant : (31) Priority Document No :10 2012 023 314.0 1)IQ POWER LICENSING AG (32) Priority Date :28/11/2012 Address of Applicant :Metallstrasse 9, CH- 6304 Zug (33) Name of priority country :Germany Switzerland (86) International Application No :PCT/DE2013/000092 2)SULLIVAN, Charles, Robert Filing Date :20/02/2013 (72)Name of Inventor : (87) International Publication No :WO 2014/082612 1)SULLIVAN ,Charles ,Robert (61) Patent of Addition to Application :NA Number :NA Filing Date (62) Divisional to Application Number :NA Filing Date :NA (57) Abstract : The invention relates to a battery comprising liquid electrolyte, which is preferably used in moving vehicles , wherein the battery has the following features: a battery housing (1) comprising side walls (3 ,4) , a housing floor (2) and a cover, a liquid electrolyte (6), the level (7) of which is within predetermined tolerance limits (7a , 7b) , electrodes (5) , a flow channel plate (8) being arranged at least on one side wall (3) so as to form a flow channel (9), wherein the upper end of said flow channel (9) serves as an exhaust port (9a), a mixing vessel (10) comprising a mixing vessel floor (12) and mixing vessel side walls (11a , 11b , 11c) being arranged above the electrodes (5) , wherein the mixing vessel side wall adjoining the exhaust port (9a) is formed as an overflow (13) , the mixing vessel floor (12) being located below the minimum level (7b) for the liquid electrode (6), which minimum level is provided for operational reasons , and at least one floor opening (14) being provided in the mixing vessel floor (12). No. of Pages : 23 No. of Claims : 5 The Patent Office Journal 18/12/2015 65691 (12) PATENT APPLICATION PUBLICATION (21) Application No.5072/DELNP/2015 A (19) INDIA (22) Date of filing of Application :11/06/2015 (43) Publication Date : 18/12/2015 (54) Title of the invention : TABLETS WITH IMPROVED ACCEPTANCE AND GOOD STORAGE STABILITY (51) International (71)Name of Applicant : :A61K9/20,A61K31/00,A61P33/10 classification 1)BAYER ANIMAL HEALTH GMBH (31) Priority Document No :12198101.3 Address of Applicant :51368 Leverkusen Germany (32) Priority Date :19/12/2012 (72)Name of Inventor : (33) Name of priority country :EPO 1)KANIKANTI ,Venkata -Rangarao (86) International Application 2)HAMANN ,Hans -J¼rgen :PCT/EP2013/076878 No 3)SCHULTE, Georg :17/12/2013 Filing Date 4)BILLIAN, Patrick (87) International Publication :WO 2014/095845 No (61) Patent of Addition to :NA Application Number :NA Filing Date (62) Divisional to Application :NA Number :NA Filing Date (57) Abstract : The present invention relates to tablets for animals with improved acceptance and good storage stability. No. of Pages : 15 No. of Claims : 13 The Patent Office Journal 18/12/2015 65692 (12) PATENT APPLICATION PUBLICATION (21) Application No.5073/DELNP/2015 A (19) INDIA (22) Date of filing of Application :11/06/2015 (43) Publication Date : 18/12/2015 (54) Title of the invention : PPAR -SPARING THIAZOLIDINEDIONES AND COMBINATIONS FOR THE TREATMENT OF NEURODEGENERATIVE DISEASES (51) International (71)Name of Applicant : :A61K31/426,A61K31/4439,A61P25/28 classification 1)METABOLIC SOLUTIONS DEVELOPMENT (31) Priority Document COMPANY LLC :61/735634 No Address of Applicant :161 East Michigan Avenue ,4th Floor, (32) Priority Date :11/12/2012 Kalamazoo, MI 49007 U.S.A. (33) Name of priority (72)Name of Inventor : :U.S.A. country 1)COLCA ,Gerard, R. (86) International 2)KLETZIEN, Rolf F. :PCT/US2013/073254 Application No :05/12/2013 Filing Date (87) International :WO 2014/093114 Publication No (61) Patent of Addition to :NA Application Number :NA Filing Date (62) Divisional to :NA Application Number :NA Filing Date (57) Abstract : The present invention relates to PPARy- sparing compounds and pharmaceutical compositions formulated with such compounds that are useful for treating , delaying the onset of , or reducing the symptoms of a neurodegenerative disorder including Huntington s disease, epilepsy , AMS ,and MS. No. of Pages : 150 No. of Claims : 19 The Patent Office Journal 18/12/2015 65693 (12) PATENT APPLICATION PUBLICATION (21) Application No.5074/DELNP/2015 A (19) INDIA (22) Date of filing of Application :11/06/2015 (43) Publication Date : 18/12/2015 (54) Title of the invention : PROCESS FOR THE SYNTHESIS OF AN (E)-STILBENE DERIVATIVE OF FORMULA (VI)• (51) International classification :C07C37/055 (71)Name of Applicant : (31) Priority Document No :06/53178 1)WEYLCHEM LAMOTTE S.A.S. (32) Priority Date :28/07/2006 Address of Applicant :Rue du Flottage, B.P. 1, 60350 Trosly (33) Name of priority country :France Breuil, France, France (86) International Application No :PCT/EP2007/057650 (72)Name of Inventor : Filing Date :25/07/2007 1)ALAIN SCHOUTEETEN (87) International Publication No :WO 2008/012321 2)SEBASTIEN JUS (61) Patent of Addition to Application 3)JEAN-CLAUDE VALLEJOS :NA Number :NA Filing Date (62) Divisional to Application Number :560/DELNP/2009 Filed on :23/01/2009 (57) Abstract : Process for the synthesis of an (E)-stilbene derivative of formula (VI) in which A represents hydrogen or an OR2 group, and Rt, R2, Ri and RT2 represent, independently of one another, a linear or branched alkyl group comprising from 1 to 6 carbon atoms or an aralkyl group including from 7 to 16 carbon atoms which is optionally substituted by one or more alkoxy or halogen groups, it also being possible for Ri and R2 to form a hydrocarbon chain of structure -(CH2)n- with n =1 to 3, characterized in that a compound of formula (IV) in which A, Ri, R2, Ri and R2 are as defined above, is reacted as synthetic intermediate with an aryisulphonylhydrazide to obtain an aryisulphonylhydrazone of formula (VII) % in which A, Ri, R2, Ri and R2 are as defined above and Ar represents a phenyl or o-, m- or ptolylgroup, then one makes react the arylsul phony Ihydrazone thus formed with a base, to obtain the aforementioned (E)-stilbene derivative of formula (VI). No. of Pages : 45 No. of Claims : 6 The Patent Office Journal 18/12/2015 65694 (12) PATENT APPLICATION PUBLICATION (21) Application No.5075/DELNP/2015 A (19) INDIA (22) Date of filing of Application :11/06/2015 (43) Publication Date : 18/12/2015 (54) Title of the invention : TURBOMACHINE , AND FLOW CONDUCTING ELEMENT FOR A TURBOMACHINE (51) International classification :F04D29/42,F04D29/44 (71)Name of Applicant : (31) Priority Document No :13154649.1 1)SULZER MANAGEMENT AG (32) Priority Date :08/02/2013 Address of Applicant :Neuwiesenstrasse 15, CH -8401 (33) Name of priority country :EPO Winterthur Switzerland (86) International Application No :PCT/EP2014/051176 (72)Name of Inventor : Filing Date :22/01/2014 1)RODRIGUES, Arnaldo (87) International Publication No :WO 2014/122016 (61) Patent of Addition to Application :NA Number :NA Filing Date (62) Divisional to Application Number :NA Filing Date :NA (57) Abstract : The invention relates to a turbomachine (1) , in particular a pump or turbine , comprising an impeller (2) which is arranged in an impeller area (3) of a housing (4) of the turbomachine (1) in a rotatable manner about a rotational axis (A). In order to exchange energy between a flow energy of a flowing fluid (F) and a mechanical rotational energy , the fluid (F) can be fed to the housing (4) of the turbomachine such that the fluid can be brought into fluidic contact with the impeller (2) so as to exchange energy and can be discharged again out of the housing (4) of the turbomachine. According to the invention , a flow conducting element (5 , 51 ,52) which runs about the rotational axis (A) in a circumferential direction (U) of the impeller (2) is provided in the impeller area (3) between an inner wall (31) of the impeller area (3) and the impeller (2) such that the impeller (2) is surrounded by the flow conducting element (5 ,51 ,52) with a specifiable axial width (B). The invention further relates to a flow conducting element (5, 51 ,52) for a turbomachine (1). No. of Pages : 33 No. of Claims : 15 The Patent Office Journal 18/12/2015 65695 (12) PATENT APPLICATION PUBLICATION (21) Application No.5783/DELNP/2012 A (19) INDIA (22) Date of filing of Application :28/06/2012 (43) Publication Date : 18/12/2015 (54) Title of the invention : REFLECTIVE ANODE STRUCTURE FOR A FIELD EMISSION LIGHTING ARRANGEMENT (51) International classification :H01J63/02 (71)Name of Applicant : (31) Priority Document No :09180339.5 1)LIGHTLAB SWEDEN AB (32) Priority Date :22/12/2009 Address of Applicant :–stermalmstorg 1 SE-114 42 Stockholm (33) Name of priority country :EPO Sweden (86) International Application No :PCT/EP2010/068420 (72)Name of Inventor : Filing Date :29/11/2010 1)HU Qiu Hong (87) International Publication No :WO 2011/076523 (61) Patent of Addition to Application :NA Number :NA Filing Date (62) Divisional to Application Number :NA Filing Date :NA (57) Abstract : The present invention relates to a field emission lighting arrangement (100) comprising a first field emission cathode (106) an anode structure (102) comprising a phosphor layer (108) and an evacuated envelope inside of which the anode structure (102) and the first field emission cathode are arranged wherein the anode structure (102) is configured to receive electrons emitted by the first field emission cathode (106) when a voltage is applied between the anode structure and the first field emission cathode and to reflect light generated by the phosphor layer (108) out from the evacuated chamber. Advantages of the invention include lower power consumption as well as an increase in light output of the field emission lighting arrangement (100). No. of Pages : 16 No. of Claims : 15 The Patent Office Journal 18/12/2015 65696 (12) PATENT APPLICATION PUBLICATION (21) Application No.5029/DELNP/2015 A (19) INDIA (22) Date of filing of Application :10/06/2015 (43) Publication Date : 18/12/2015 (54) Title of the invention : PROCESS FOR REMOVING LIGHT COMPONENTS FROM AN ETHYLENE STREAM (51) International classification :C07C7/04,C07C1/24,C07C11/04 (71)Name of Applicant : (31) Priority Document No :12290437.8 1)TOTAL RESEARCH & TECHNOLOGY FELUY (32) Priority Date :13/12/2012 Address of Applicant :Zone Industrielle C, B -7181 Seneffe (33) Name of priority country :EPO Belgium (86) International Application 2)IFP ENERGIES NOUVELLES :PCT/EP2013/076609 No (72)Name of Inventor : :13/12/2013 Filing Date 1)VERMEIREN ,Walter (87) International Publication 2)BOUTROT, Catherine :WO 2014/091015 No 3)ARRATIA ,Manuela (61) Patent of Addition to :NA Application Number :NA Filing Date (62) Divisional to Application :NA Number :NA Filing Date (57) Abstract : The present invention is a process for removing light components from an ethylene stream comprising : a) providing a dried ethylene stream (A) comprising essentially ethylene , ethane , CO , CO2 , H2, CH4 , C3+ hydrocarbons and optionally oxygenates , b) sending said stream (A) to a stripper (also referred to as a demethanizer) to produce - an overhead stream comprising essentially ethylene, CO , H2 and CH4,- a bottom stream comprising essentially ethylene ,ethane , CO2 , C3+ hydrocarbons and optionally oxygenates, wherein , the gaseous phase on top of the stripper is condensed in a heat exchanger cooled by a refrigerant stream to get a first gaseous phase and a first liquid phase, in a preferred embodiment the refrigerant stream consists of one or more C3 or C4 hydrocarbons advantageously it consists of liquid and gaseous propane or propylene the first gaseous phase is condensed in a heat exchanger cooled by liquid ethane or liquid ethylene to get a second gaseous phase referred to as the overhead stream comprising essentially ethylene CO, H2 and CH4 and a second liquid phase, the first and second liquid phases are the reflux of the stripper. No. of Pages : 4 No. of Claims : 19 The Patent Office Journal 18/12/2015 65697 (12) PATENT APPLICATION PUBLICATION (21) Application No.5030/DELNP/2015 A (19) INDIA (22) Date of filing of Application :10/06/2015 (43) Publication Date : 18/12/2015 (54) Title of the invention : PROBE FOR DETERMINING THE LEVEL OF THE LIQUID PHASE OF LIQUIFIED PETROLEUM GASES AND OTHER LIQUEFIED GASES STORED IN PRESSURISED CYLINDERS (51) International classification :G01F23/30 (71)Name of Applicant : (31) Priority Document No :P201201261 1)PUERTA BLANCO ,Enrique (32) Priority Date :20/12/2012 Address of Applicant :C/ Montes y Martn Baro 8- 5ºC, E(33) Name of priority country :Spain 47008 Valladolid Spain (86) International Application No :PCT/ES2013/000244 (72)Name of Inventor : Filing Date :05/11/2013 1)PUERTA BLANCO ,Enrique (87) International Publication No :WO 2014/096472 (61) Patent of Addition to Application :NA Number :NA Filing Date (62) Divisional to Application Number :NA Filing Date :NA (57) Abstract : The invention relates to a probe for determining the level of the liquid phase of liquefied petroleum gases (LPG) and other liquefied gases stored in pressurised cylinders. The cylinder contains a buoy that floats on the liquid phase and a magnet joined to the buoy , said magnet maintaining the necessary orientation and distance to the cylinder wall either by means of a guide housed inside the cylinder or a rocking mechanism that associates the movement of the buoy at one of its ends with a movement of the magnet at the other end , in both cases allowing the intensity of the magnetic field produced by the magnet to be measured from the exterior using a smartphone with a Hall sensor , the latter being used to associate the position of the magnet with the height of the liquid phase by means of a scale provided on the exterior of the cylinder or directly using the measurement obtained. A different embodiment comprises the use of a hollow flexible rod filled with viscoelastic material and a pressure transducer. No. of Pages : 18 No. of Claims : 2 The Patent Office Journal 18/12/2015 65698 (12) PATENT APPLICATION PUBLICATION (21) Application No.5660/DELNP/2012 A (19) INDIA (22) Date of filing of Application :25/06/2012 (43) Publication Date : 18/12/2015 (54) Title of the invention : MODULATION OF EPIDERMAL GROWTH FACTOR RECEPTOR LIGANDS (51) International (71)Name of Applicant : :A61K31/7105,A61K48/00,A61P35/00 classification 1)THE UNIVERSITY OF WESTERN AUSTRALIA (31) Priority Document No :2009905758 Address of Applicant :Nedlands Western Australia 6907 (32) Priority Date :24/11/2009 Australia (33) Name of priority (72)Name of Inventor : :Australia country 1)LEEDMAN Peter Jeffery (86) International 2)GILES Keith Michael :PCT/AU2010/001577 Application No 3)KALINOWSKI Felicity Caris :24/11/2010 Filing Date (87) International :WO 2011/063455 Publication No (61) Patent of Addition to :NA Application Number :NA Filing Date (62) Divisional to :NA Application Number :NA Filing Date (57) Abstract : The present invention relates to a method for modulating the expression and/or activity of an epidermal growth factor receptor (EGFR) ligand in a cell or tissue the method comprising contacting the cell or tissue with a miR 7 miRNA a precursor or variant thereof a miRNA comprising a seed region comprising the sequence GGAAGA or an antagonist of any such miRNA. No. of Pages : 50 No. of Claims : 33 The Patent Office Journal 18/12/2015 65699 (12) PATENT APPLICATION PUBLICATION (21) Application No.5794/DELNP/2012 A (19) INDIA (22) Date of filing of Application :28/06/2012 (43) Publication Date : 18/12/2015 (54) Title of the invention : SIGNALLING REPORT TRANSMISSION IN CARRIER AGGREGATION (51) International classification :H04W72/04 (71)Name of Applicant : (31) Priority Document No :NA 1)NOKIA SIEMENS NETWORKS OY (32) Priority Date :NA Address of Applicant :Karaportti 3 FIN 02610 Espoo Finland (33) Name of priority country :NA (72)Name of Inventor : (86) International Application No :PCT/EP2010/054699 1)SEBIRE Benoist Pierre Filing Date :09/04/2010 (87) International Publication No :WO 2011/124263 (61) Patent of Addition to Application :NA Number :NA Filing Date (62) Divisional to Application Number :NA Filing Date :NA (57) Abstract : A user equipment (10) prepares a signalling report in response to receiving a control element for activation/deactivation of component carriers to be used by the user equipment (10) for communication in a cellular communications network system and transmits the signalling report. No. of Pages : 15 No. of Claims : 11 The Patent Office Journal 18/12/2015 65700 (12) PATENT APPLICATION PUBLICATION (21) Application No.5795/DELNP/2012 A (19) INDIA (22) Date of filing of Application :28/06/2012 (43) Publication Date : 18/12/2015 (54) Title of the invention : HIGH FREQUENCY MULTI VOLTAGE AND MULTI BRIGHTNESS LED LIGHTING DEVICES AND SYSTEMS AND METHODS OF USING SAME (51) International classification :H05B37/00 (71)Name of Applicant : (31) Priority Document No :61/284927 1)LYNK LABS INC. (32) Priority Date :28/12/2009 Address of Applicant :2511 Technology Drive Suite 108 Elgin (33) Name of priority country :U.S.A. IL 60123 9323 U.S.A. (86) International Application No :PCT/US2010/062235 (72)Name of Inventor : Filing Date :28/12/2010 1)MISKIN Michael (87) International Publication No :WO 2011/082168 2)KOTTRITSCH Robert L. (61) Patent of Addition to Application :NA Number :NA Filing Date (62) Divisional to Application Number :NA Filing Date :NA (57) Abstract : A system and method transforming AC voltage to a high frequency AC voltage and providing the high frequency AC voltage to an AC LED circuit or rectifying the high frequency circuit to a DC voltage and providing the DC voltage to a DC LED circuit. No. of Pages : 36 No. of Claims : 42 The Patent Office Journal 18/12/2015 65701 (12) PATENT APPLICATION PUBLICATION (21) Application No.5056/DELNP/2015 A (19) INDIA (22) Date of filing of Application :11/06/2015 (43) Publication Date : 18/12/2015 (54) Title of the invention : REACTOR FOR PERFORMING AN AUTOTHERMAL GAS- PHASE DEHYDROGENATION (51) International classification :B01J8/04,B01J19/24,C07C5/48 (71)Name of Applicant : (31) Priority Document No :12196666.7 1)BASF SE (32) Priority Date :12/12/2012 Address of Applicant :67056 Ludwigshafen Germany (33) Name of priority country :EPO (72)Name of Inventor : (86) International Application No :PCT/EP2013/076154 1)OLBERT, Gerhard Filing Date :11/12/2013 2)TELLAECHE HERRANZ ,Carlos (87) International Publication No :WO 2014/090841 3)ASPRION, Norbert (61) Patent of Addition to 4)WECK ,Alexander :NA Application Number 5)DAHLHOFF, Ellen :NA Filing Date (62) Divisional to Application :NA Number :NA Filing Date (57) Abstract : The invention relates to a reactor (1) in the form of a cylinder with a vertical longitudinal axis, for performing an autothermal gas phase dehydrogenation of a hydrocarbon -containing gas stream (2) with an oxygen- containing gas stream (3) , obtaining a reaction gas mixture, on a heterogeneous catalyst , which is designed as monolith (4), wherein one or more catalytically active zones (5) are arranged in the interior of the reactor (1) , each zone comprising a packing of monoliths (4) stacked one next to another and/or one on top of another and wherein a mixing zone (6) with fixed installations is provided upstream of each catalytically active zone (5). The reactor has: - one or more feeder lines (7) at the lower end thereof for the hydrocarbon- containing gas stream (2) to be dehydrogenated; - one or more feeder lines (9) that can be regulated independently of one another for the oxygen containing gas stream (3) flowing into each of the mixing zones (6) , each feeder line (9) feeding one or more distributors (10); - and one or more discharge lines (11) at the upper end of the reactor (1) for the reaction gas mixture from the autothermal gas -phase dehydrogenation, wherein the interior wall of the reactor (1) is furnished with a continuous insulation layer (13, 14 , 15) and wherein the accessibility of one or each of the plurality of catalytically active zones (5) from outside the reactor is guaranteed via - one or more manholes (12) , or wherein one or each of the plurality of catalytically active zones (5) , each comprising a respective packing of monoliths stacked one next to another and/or one on top of an other including - the mixing zone (6) with fixed installations provided upstream of each catalytically active zone (5) -the one or more feeder lines (9) controllable independently of one another - and the one or more distributors (10) that are each fed via a respective feeder line (9) , are constructed as a structural element (24) that can be individually installed or uninstalled. No. of Pages : 38 No. of Claims : 18 The Patent Office Journal 18/12/2015 65702 (12) PATENT APPLICATION PUBLICATION (21) Application No.5057/DELNP/2015 A (19) INDIA (22) Date of filing of Application :11/06/2015 (43) Publication Date : 18/12/2015 (54) Title of the invention : MONITORING METHOD AND DEVICE (51) International (71)Name of Applicant : :B29C47/92,B29C47/00,B29C47/08 classification 1)WINDM–LLER & H–LSCHER KG (31) Priority Document No :10 2012 110 911.7 Address of Applicant :M¼nsterstr. 50, Lengerich 49525 (32) Priority Date :13/11/2012 Germany (33) Name of priority country :Germany (72)Name of Inventor : (86) International Application 1)BACKMANN ,Martin :PCT/EP2013/070061 No 2)MIDDELBERG ,Gerhard :26/09/2013 Filing Date 3)BUSSMANN ,Markus (87) International Publication 4)MINNERUP, Jens :WO 2014/075842 No (61) Patent of Addition to :NA Application Number :NA Filing Date (62) Divisional to Application :NA Number :NA Filing Date (57) Abstract : The invention relates to a monitoring method for monitoring the energy requirement of an extrusion installation (10) having the following steps of: - setting a balancing limit (20), in the balance space (22) of which the extrusion installation (10) is located ,monitoring at least one energy flow (30) into the balance space (22),- monitoring a feed flow (40) of granules into the extrusion installation (10),-determining the relationship between the at least one energy flow (30) and the feed flow (40). No. of Pages : 16 No. of Claims : 9 The Patent Office Journal 18/12/2015 65703 (12) PATENT APPLICATION PUBLICATION (21) Application No.5058/DELNP/2015 A (19) INDIA (22) Date of filing of Application :11/06/2015 (43) Publication Date : 18/12/2015 (54) Title of the invention : CONFIGURATIONS AND METHODS FOR AMBIENT AIR VAPORIZERS AND COLD UTILIZATION (51) International classification :F17C7/04,F17C9/04 (71)Name of Applicant : (31) Priority Document No :13/674722 1)FLUOR TECHNOLOGIES CORPORATION (32) Priority Date :12/11/2012 Address of Applicant :3 Polaris Way, Aliso Viejo ,California (33) Name of priority country :U.S.A. 92698 U.S.A. (86) International Application No :PCT/US2013/069480 (72)Name of Inventor : Filing Date :11/11/2013 1)MAK ,John (87) International Publication No :WO 2014/075010 (61) Patent of Addition to Application :NA Number :NA Filing Date (62) Divisional to Application Number :NA Filing Date :NA (57) Abstract : An ambient air LNG vaporizer has a housing that encloses the exchanger conduits and provides a stream of refrigerated air to a blower to so convey refrigerated air to one or more remote refrigerated air consumers. The temperature of the refrigerated air is maintained using a control circuit that adjusts an operational parameter of an ambient air intake control device of the housing and/or the blower. No. of Pages : 21 No. of Claims : 20 The Patent Office Journal 18/12/2015 65704 (12) PATENT APPLICATION PUBLICATION (21) Application No.5792/DELNP/2012 A (19) INDIA (22) Date of filing of Application :28/06/2012 (43) Publication Date : 18/12/2015 (54) Title of the invention : J591 MINIBODIES AND CYS DIABODIES FOR TARGETING HUMAN PROSTATE SPECIFIC MEMBRANE ANTIGEN (51) International (71)Name of Applicant : :A61K39/395,C12P21/04,G01N33/574 classification 1)IMAGINAB INC. (31) Priority Document No :61/266134 Address of Applicant :419 Hindry Avenue Unit E Inglewood (32) Priority Date :02/12/2009 CA 90301 U.S.A. (33) Name of priority (72)Name of Inventor : :U.S.A. country 1)HO David (86) International 2)OLAFSON Tove :PCT/US2010/058803 Application No 3)LIPMAN Arye :02/12/2010 Filing Date (87) International :WO 2011/069019 Publication No (61) Patent of Addition to :NA Application Number :NA Filing Date (62) Divisional to :NA Application Number :NA Filing Date (57) Abstract : In one embodiment a minibody monomer that binds PSMA is provided. The minibody monomer is encoded by a nucleotide sequence comprising from N terminus to C terminus an scFv sequence that can bind PSMA an artificial hinge sequence and a human IgG CH3 sequence. In another embodiment a CysDB monomer that binds PSMA is provided. The CysDB monomer may be encoded by a nucleotide sequence comprising from N terminus to C terminus an scFv sequence that can bind PSMA and a cysteine tail. In other embodiments methods for diagnosing or treating a cancer associated with PSMA expression in a subject are provided. No. of Pages : 98 No. of Claims : 20 The Patent Office Journal 18/12/2015 65705 (12) PATENT APPLICATION PUBLICATION (21) Application No.5016/DELNP/2015 A (19) INDIA (22) Date of filing of Application :10/06/2015 (43) Publication Date : 18/12/2015 (54) Title of the invention : VALVE PERMITTING MIXING IN A DRUG DELIVERY DEVICE (51) International (71)Name of Applicant : :A61M5/28,A61M5/24,A61M5/315 classification 1)BECTON ,DICKINSON AND COMPANY (31) Priority Document No :61/729824 Address of Applicant :One Becton Drive, Franklin Lakes ,New (32) Priority Date :26/11/2012 Jersey 07417 U.S.A. (33) Name of priority country :U.S.A. (72)Name of Inventor : (86) International Application 1)FERRITER, Matthew :PCT/US2013/070935 No 2)MARTIN ,Frank :20/11/2013 Filing Date 3)SULLIVAN ,Vincent J. (87) International Publication 4)DANHOF, Scott N. :WO 2014/081785 No 5)HASSENPFLUG, Eric G. (61) Patent of Addition to :NA Application Number :NA Filing Date (62) Divisional to Application :NA Number :NA Filing Date (57) Abstract : A valve (10) for permitting mixing of at least two components within a barrel (12) is provided including a stopper (20) configured for slidable liquid- tight engagement with an inner surface (13) of the barrel ,The stopper is moveable between a first position and a second position and includes a proximal end (22) , a distal end (24) , and a channel (26) extending therebetween. The valve further includes a stationary body (30) comprising a base (32) and a stem (34), the stem being disposed within the channel of the stopper when the stopper is in the second position. When the stopper is in the first position , there is a liquid -tight seal in the channel , such that fluid flow through the channel is prevented. Movement of the stopper to the second position terminates the liquid -tight seal, thereby establishing fluid communication through the channel. A drug containing device and assembly for delivering a reconstituted drug are also provided herein. No. of Pages : 23 No. of Claims : 24 The Patent Office Journal 18/12/2015 65706 (12) PATENT APPLICATION PUBLICATION (21) Application No.5017/DELNP/2015 A (19) INDIA (22) Date of filing of Application :10/06/2015 (43) Publication Date : 18/12/2015 (54) Title of the invention : ORAL CARE IMPLEMENT HAVING PRESSURE SENSOR AND METHOD OF FORMING THE SAME (51) International classification :A46B15/00,A61C17/16 (71)Name of Applicant : (31) Priority Document No :201210596539.9 1)COLGATE PALMOLIVE COMPANY (32) Priority Date :21/12/2012 Address of Applicant :300 Park Avenue, New York ,New (33) Name of priority country :China York 10022 U.S.A. (86) International Application No :PCT/US2013/032766 (72)Name of Inventor : Filing Date :18/03/2013 1)BLOCH ,Brian (87) International Publication No :WO 2014/098950 2)LIEBERWIRTH, Lars Ralf Rainer (61) Patent of Addition to Application :NA Number :NA Filing Date (62) Divisional to Application Number :NA Filing Date :NA (57) Abstract : A toothbrush having a pressure sensor. In one embodiment, the invention can be a toothbrush comprising: a handle; a head; a plurality of tooth cleaning elements mounted to and extending from a front surface of the head; a printed circuit board located within the head ,the printed circuit board having a front surface and a rear surface; a pressure sensor operably coupled to a front surface of the printed circuit board , wherein pressure applied to the plurality of tooth cleaning elements is transmitted to the pressure sensor; and a light source attached to a rear surface of the printed circuit board ,wherein the light source is illuminated upon the pressure sensor being subjected to a pressure that exceeds a predetermined threshold. No. of Pages : 34 No. of Claims : 19 The Patent Office Journal 18/12/2015 65707 (12) PATENT APPLICATION PUBLICATION (21) Application No.5018/DELNP/2015 A (19) INDIA (22) Date of filing of Application :10/06/2015 (43) Publication Date : 18/12/2015 (54) Title of the invention : CONTROLLED DELIVERY WHITENING COMPOSITIONS (51) International classification :A61Q11/00,A61K8/24,A61K8/22 (71)Name of Applicant : (31) Priority Document No :NA 1)COLGATE PALMOLIVE COMPANY (32) Priority Date :NA Address of Applicant :300 Park Avenue, New York ,New (33) Name of priority country :NA York 10022 U.S.A. (86) International Application (72)Name of Inventor : :PCT/US2012/071187 No 1)PAPPAS, Iraklis :21/12/2012 Filing Date 2)PILCH, Shira (87) International Publication 3)MALONEY, Venda Porter :WO 2014/098888 No 4)SIMON, Eric (61) Patent of Addition to :NA Application Number :NA Filing Date (62) Divisional to Application :NA Number :NA Filing Date (57) Abstract : Described herein are dual component oral care systems comprising a first component comprising a peroxygen compound and having a first pH and a second component comprising at least one salt of a weak mono or polyprotic acid and having a second pH wherein the second pH is higher than the first pH and is less than 10.0 wherein when combined the first and second components form a toothwhitening composition having a pH of greater than 6.0 and less than 10.0 is provided. No. of Pages : 23 No. of Claims : 35 The Patent Office Journal 18/12/2015 65708 (12) PATENT APPLICATION PUBLICATION (21) Application No.648/DEL/2009 A (19) INDIA (22) Date of filing of Application :30/03/2009 (43) Publication Date : 18/12/2015 (54) Title of the invention : A SLIDING MECHANISM, A SYSTEM FOR LAUNCHING OF MISSILE AND A METHOD THEREOF (51) International classification (31) Priority Document No (32) Priority Date (33) Name of priority country (86) International Application No Filing Date (87) International Publication No (61) Patent of Addition to Application Number Filing Date (62) Divisional to Application Number Filing Date (71)Name of Applicant : 1)THE DIRECTOR GENERAL DEFENCE RESEARCH & DEVELOPMENT ORGANIZATION [DRDO] :B62J Address of Applicant :Ministry of Defence Govt. of India :NA Room No. 348 B-wing DRDO Bhawan Rajaji Marg New Delhi :NA Delhi India :NA (72)Name of Inventor : :NA 1)SIDDALINGAPPA GURUPRASAD :NA 2)SHREEDHAR ARAVIND KATTI : NA 3)ALASANI PRASAD GOUD :NA 4)VIKAS NARAYAN WAGHMARE :NA 5)SANJAY KUMAR :NA 6)ATUL GUPTA :NA 7)RAVINDRA SUDHAKAR KHIRE 8)TUSHAR KANT SANTOSH 9)BIMAL GAUTAM 10)PARAS RAM (57) Abstract : The invention relates to system for launchers more particularly relates to a sliding mechanism and a system for mobile launchers on a ground surface, wherein a sliding mechanism comprising a beam (16) comprising plurality of sliders (18 and 181) on one surface and is hinged to a platform on other surface; plurality of saddles (22 and 24) mounted onto the beam (16) and are adapted to slide on the sliders (18 and 181); a tube (34) having an opening fixed to the saddle (22) at one end and an end cap (40) at other end; and an actuator (46) connected to the tube (34) through a piston (44) and rod (36) and is hinged at one end on the beam (16), wherein said piston (44) actuation contacts the rod (36) with end cap (40) of the tube (34) to slide saddles (22 and 24) on the sliders (18 and.181). Figures 1 and 4 No. of Pages : 21 No. of Claims : 19 The Patent Office Journal 18/12/2015 65709 (12) PATENT APPLICATION PUBLICATION (21) Application No.5010/DELNP/2015 A (19) INDIA (22) Date of filing of Application :10/06/2015 (43) Publication Date : 18/12/2015 (54) Title of the invention : PROCESS FOR PRODUCING COPOLYMERS OF PROPYLENE (51) International classification :C08F210/06,C08L23/14 (71)Name of Applicant : (31) Priority Document No :12199688.8 1)BOREALIS AG (32) Priority Date :28/12/2012 Address of Applicant :Wagramer Strasse 17 -19, A- 1220 (33) Name of priority country :EPO Vienna Austria (86) International Application No :PCT/EP2013/077274 (72)Name of Inventor : Filing Date :19/12/2013 1)ALASTALO, Kauno (87) International Publication No :WO 2014/102128 2)LILJA ,Johanna (61) Patent of Addition to Application 3)LESKINEN ,Pauli :NA Number :NA Filing Date (62) Divisional to Application Number :NA Filing Date :NA (57) Abstract : The present invention is directed to a process of polymerizing propylene in at least three stages. In the first, and optionally in the second , polymerization stage propylene , ethylene and at least one alpha- olefin having from 4 to 10 carbon atoms are introduced into the polymerization reactors as fresh monomer feeds. In the third polymerization stage propylene and optionally ethylene is introduced as fresh monomer feed. No. of Pages : 24 No. of Claims : 15 The Patent Office Journal 18/12/2015 65710 (12) PATENT APPLICATION PUBLICATION (21) Application No.5011/DELNP/2015 A (19) INDIA (22) Date of filing of Application :10/06/2015 (43) Publication Date : 18/12/2015 (54) Title of the invention : METHOD AND RADIO NETWORK NODE FOR MANAGING A REQUEST FOR A RADIO ACCESS BEARER (51) International (71)Name of Applicant : :H04W72/04,H04W28/18,H04W76/02 classification 1)TELEFONAKTIEBOLAGET L M ERICSSON (PUBL) (31) Priority Document No :NA Address of Applicant :SE -164 83 Stockholm Sweden (32) Priority Date :NA (72)Name of Inventor : (33) Name of priority 1)HURD ,Magnus :NA country 2)KARLSSON ,Robert (86) International 3)PHAN, Mai -Anh :PCT/SE2012/051404 Application No 4)WANG ,Xiaoling :17/12/2012 Filing Date (87) International :WO 2014/098658 Publication No (61) Patent of Addition to :NA Application Number :NA Filing Date (62) Divisional to :NA Application Number :NA Filing Date (57) Abstract : A method and a radio network node (110) for managing a request for a radio access bearer are disclosed. The radio network node (110) determines (201 ) a first value relating to utilization of radio resources in a first set of subframes. The first set of subframes includes a second set of subframes , dedicated for transmission by the radio network node (110) to multiple radio communication devices (120 , 121 ) , and a third set of subframes. The radio network node (110) determines (202) a second value relating to utilization of radio resources in the third set of subframes. The radio network node (110) receives (203) the request. The radio network node (110) obtains (204) an indication relating to a capability of a radio communication device (120) to receive transmission in one or more of the second set of subframes. The radio network node (110) determines (205) a response to the request based on the first value , the second value and the indication. The radio network node (110) sends (206) the response to the network node (140 , 150 , 160). No. of Pages : 32 No. of Claims : 26 The Patent Office Journal 18/12/2015 65711 (12) PATENT APPLICATION PUBLICATION (21) Application No.5012/DELNP/2015 A (19) INDIA (22) Date of filing of Application :10/06/2015 (43) Publication Date : 18/12/2015 (54) Title of the invention : THERAPEUTIC CD47 ANTIBODIES (51) International (71)Name of Applicant : :C07K16/28,C07K16/46,A61K39/395 classification 1)VASCULOX, INC. (31) Priority Document No :61/736301 Address of Applicant :4320 Forest Park Ave., Suite 303, St. (32) Priority Date :12/12/2012 Louis, MO 63108 U.S.A. (33) Name of priority (72)Name of Inventor : :U.S.A. country 1)FRAZIER ,William ,A. (86) International 2)MANNING ,Pamela ,T. :PCT/US2013/074766 Application No 3)FREY, Gerhard :12/12/2013 Filing Date 4)CHANG ,Hwai Wen (87) International :WO 2014/093678 Publication No (61) Patent of Addition to :NA Application Number :NA Filing Date (62) Divisional to :NA Application Number :NA Filing Date (57) Abstract : Provided are monoclonal antibodies and antigen-binding fragments thereof that bind to, and inhibit the activity of, CD47, as well as monoclonal antibodies and antigen binding fragments thereof that compete with the former for binding to CD47. Also provided are combinations of any of the foregoing. Such antibody compounds are variously effective in 1) treating tissue ischemia and ischemiareperfusion injury (IRI) in the setting of organ preservation and transplantation, pulmonary hypertension, sickle cell disease, myocardial infarction, stroke, and other instances of surgery and/or trauma in which IRI is a component of pathogenesis; 2) in treating autoimmune and inflammatory diseases; and 3) as anti-cancer agents that are toxic to susceptible cancer cells, promoting (increasing) their phagocytic uptake and clearance,and/or directly killing such cells. No. of Pages : 166 No. of Claims : 22 The Patent Office Journal 18/12/2015 65712 (12) PATENT APPLICATION PUBLICATION (21) Application No.6941/DELNP/2015 A (19) INDIA (22) Date of filing of Application :06/08/2015 (43) Publication Date : 18/12/2015 (54) Title of the invention : CLUTCH MECHANISM FOR ENERGY STORAGE DEVICE AND GAS INSULATED CIRCUIT BREAKER THEREOF (51) International (71)Name of Applicant : :F16D11/12,H01H3/30,H01H33/28 classification 1)SIEMENS AKTIENGESELLSCHAFT (31) Priority Document No :201310160896.5 Address of Applicant :Wittelsbacherplatz 2 80333 M¼nchen (32) Priority Date :03/05/2013 Germany (33) Name of priority country :China (72)Name of Inventor : (86) International Application 1)HUANG Guo Qiang :PCT/EP2014/058815 No 2)JI Cun Dong :30/04/2014 Filing Date 3)TAO Yuan Ming (87) International Publication :WO 2014/177609 No (61) Patent of Addition to :NA Application Number :NA Filing Date (62) Divisional to Application :NA Number :NA Filing Date (57) Abstract : Clutch mechanism for energy storage device and gas insulated circuit breaker thereof The present invention relates to a clutch mechanism for an energy storage device comprising a loading gear a driving gear a one way bearing a sleeve and a gear shaft comprising a gear portion and a clutch portion. The gear shaft comprises multiple spheres and a push rod and an elastic element which are located in a cavity of the gear shaft. The push rod comprises a groove and can slide in the axial direction of the gear shaft. A pressure block is fixed to the driving gear the pressure block being able to push the push rod to slide in the axial direction of the gear shaft so as to unlock or lock the sleeve and the gear shaft. The present invention also relates to a gas insulated circuit breaker employing such a clutch mechanism. The clutch mechanism and gas insulated circuit breaker thereof of the present invention achieve convenient and reliable mechanical isolation of a motive power device from an energy storage device once storage of energy is complete at a comparatively low cost. No. of Pages : 19 No. of Claims : 10 The Patent Office Journal 18/12/2015 65713 (12) PATENT APPLICATION PUBLICATION (21) Application No.4988/DELNP/2015 A (19) INDIA (22) Date of filing of Application :09/06/2015 (43) Publication Date : 18/12/2015 (54) Title of the invention : LOCAL AIR CLEANER (51) International classification :F24F7/06,F24F11/04 (71)Name of Applicant : (31) Priority Document No :2012268614 1)KOKEN LTD. (32) Priority Date :07/12/2012 Address of Applicant :7 Yonban cho Chiyoda ku Tokyo (33) Name of priority country :Japan 1028459 Japan (86) International Application No :PCT/JP2013/082497 (72)Name of Inventor : Filing Date :03/12/2013 1)SUZUKI Taketo (87) International Publication No :WO 2014/088007 2)NITTA Kozo (61) Patent of Addition to Application 3)FUJISHIRO Yuki :NA Number 4)KAKINUMA Tomoyuki :NA Filing Date 5)SATO Takahiro (62) Divisional to Application Number :NA Filing Date :NA (57) Abstract : A local air cleaner (1) is configured in such a manner that a uniform current of cleaned air discharged from an air current opening surface (23) and contacts an air contact surface (W) and flow to the outside of an open region , thereby maintaining the insides of a guide (3) and the open region at a cleanliness level higher than that of the remaining region. The local air cleaner (1) is provided with at least one of a device for measuring pressure within the guide (3) and pressure within a push hood (2), a device for measuring the level of cleanliness in the guide (3) or the open region , or a device for measuring the gap between the guide (3) and the air contact surface (W). In order to ensure the level of cleanliness , the local air cleaner (1) controls the flow speed of a uniform current of cleaned air discharged from the air current opening surface (23), the control being performed on the basis of the measurement result in such a manner that the flow speed can be accelerated or decelerated. No. of Pages : 35 No. of Claims : 4 The Patent Office Journal 18/12/2015 65714 (12) PATENT APPLICATION PUBLICATION (21) Application No.4989/DELNP/2015 A (19) INDIA (22) Date of filing of Application :09/06/2015 (43) Publication Date : 18/12/2015 (54) Title of the invention : HYBRID DRIVE (51) International (71)Name of Applicant : :B60W10/115,B60W10/02,B60W10/08 classification 1)KHADEEV ,Ravil Gafiyevitch (31) Priority Document Address of Applicant :ul. Gagarina, 44- 86, Obninsk, :2013110776 No Kaluzhskaya oblast ,249034 Russia (32) Priority Date :12/03/2013 (72)Name of Inventor : (33) Name of priority 1)KHADEEV, Ravil ,Gafiyevitch :Russia country (86) International :PCT/RU2014/000014 Application No :14/01/2014 Filing Date (87) International :WO 2014/142707 Publication No (61) Patent of Addition to :NA Application Number :NA Filing Date (62) Divisional to :NA Application Number :NA Filing Date (57) Abstract : The invention relates to mechanical engineering in the transport industry. Two differential mechanisms (4 , 12) each having one input and two outputs , are connected in series in a transmission. The input of the first differential mechanism (4) is connected to a motor , and one of the outputs of said first differential mechanism is connected to the input of the second differential (12). A generator rotor (2) is located on the shaft of the motor, which shaft is connected to the input of the first differential (4), and is connected to said shaft. A generator stator (3) is connected to the second output of the first differential (4) and is capable of rotating about an axis. A clutch (8) capable of being connected to the transmission box and of transforming the differential into a reduction gear is also connected to the second output. A rotation of the shaft is transmitted from the output of the first differential (4) to the input of the second differential device (12), the input and two outputs of which are arranged concentrically on a common axis. One output of the second differential is connected to a driven shaft (15) , while the second output is connected to a disk (10) of a controllable high performance slip clutch , the reciprocal disk (11) of which is connected to the input of this differential (12). No. of Pages : 11 No. of Claims : 5 The Patent Office Journal 18/12/2015 65715 (12) PATENT APPLICATION PUBLICATION (21) Application No.5723/DELNP/2012 A (19) INDIA (22) Date of filing of Application :26/06/2012 (43) Publication Date : 18/12/2015 (54) Title of the invention : PROCESS FOR PREPARING BENZAZEPINE COMPOUNDS OR SALTS THEREOF (51) International classification :C07D 223/16 (71)Name of Applicant : (31) Priority Document No :2005-254744 1)OTSUKA PHARMACEUTICAL CO., LTD. (32) Priority Date :02/09/2005 Address of Applicant :9, KANDATSUKASA-CHO 2(33) Name of priority country :Japan CHOME, CHIYODA-KU, TOKYO 101-8535 (JP) Japan (86) International Application No :PCT/JP2006/317804 (72)Name of Inventor : Filing Date :01/09/2006 1)TORISAWA, YASUHIRO (87) International Publication No :WO 2007/026971 2)ABE, KAORU (61) Patent of Addition to Application 3)MUGURUMA, YASUAKI :NA Number 4)FUJITA, SHIGEKAZU :NA Filing Date 5)OGAWA, HIDENORI (62) Divisional to Application Number :1507/DELNP/2008 6)UTSUMI, NAOTO Filed on :21/02/2008 7)MIYAKE, MASAHIRO (57) Abstract : This invention provides a process for preparing benzazepine compounds of the formula (1): wherein X1is a halogen atom, R1and R2are a lower alkyl group, or salts thereof as well as intermediate benzoic acid compounds in high yield and high purity on industrial scale, which are useful as an intermediate for preparing a pharmaceutically active 2,3,4,5-tetrahydro-1H-1-benzazepine compound having vasopressin antagonistic activity. No. of Pages : 42 No. of Claims : 2 The Patent Office Journal 18/12/2015 65716 (12) PATENT APPLICATION PUBLICATION (21) Application No.6950/DELNP/2015 A (19) INDIA (22) Date of filing of Application :06/08/2015 (43) Publication Date : 18/12/2015 (54) Title of the invention : WELDING WIRE FOR FE 36NI ALLOY (51) International (71)Name of Applicant : :C22C38/00,B23K35/30,C22C19/03 classification 1)APERAM (31) Priority Document No :NA Address of Applicant :12C rue Guillaume Kroll L 1882 (32) Priority Date :NA Luxembourg Luxembourg (33) Name of priority country :NA (72)Name of Inventor : (86) International Application 1)REYDET Jean-Louis :PCT/FR2013/050224 No 2)ROY Jean Louis :01/02/2013 Filing Date 3)PANIER Roland Andr (87) International Publication :WO 2014/118442 No (61) Patent of Addition to :NA Application Number :NA Filing Date (62) Divisional to Application :NA Number :NA Filing Date (57) Abstract : The invention concerns a welding wire intended to be used for welding together portions of parts made from Fe 36Ni alloy. This welding wire is made from an alloy comprising in % by weight: 38.6% = Ni+Co = 45.0%; traces = Co = 0.50%; 2.25% = Ti+Nb = 0.8667 x (Ni+Co) 31.20% if 38.6% = Ni+Co = 40.33%; 2.25% = Ti+Nb = 3.75% if 40.33% = Ni+Co = 41.4%; 0.4167 x (Ni+Co) 15.0% = Ti+Nb = 3.75% if 41.4% = Ni+Co = 45.0%; traces = Nb = 0.50%; 0.01% = Mn = 0.30%; 0.01% = Si = 0.25%; traces = C = 0.05%; traces = Cr = 0.50% the remainder consisting of iron and inevitable impurities resulting from production. No. of Pages : 28 No. of Claims : 23 The Patent Office Journal 18/12/2015 65717 (12) PATENT APPLICATION PUBLICATION (21) Application No.4979/DELNP/2015 A (19) INDIA (22) Date of filing of Application :09/06/2015 (43) Publication Date : 18/12/2015 (54) Title of the invention : COMMUNICATION DEVICE RESTRAINING MEANS AND METHOD THEREOF (51) International classification :A45F5/02,A45F5/00,A45C13/20 (71)Name of Applicant : (31) Priority Document No :1220347.7 1)PHONECATCHER LIMITED (32) Priority Date :12/11/2012 Address of Applicant :24 Spring Close Avenue, Richmond (33) Name of priority country :U.K. Hill, Leeds Yorkshire LS9 8RR U.K. (86) International Application (72)Name of Inventor : :PCT/GB2013/052971 No 1)HINDLE, Stuart :12/11/2013 Filing Date (87) International Publication :WO 2014/072745 No (61) Patent of Addition to :NA Application Number :NA Filing Date (62) Divisional to Application :NA Number :NA Filing Date (57) Abstract : The present invention relates to a restraining device to restrain movement of a portable communication device , the device comprising a restraining mechanism which is centrifugally actuated such that a centrifugal force caused by rotation of the cord dispenser ,when above a predetermined centrifugal force, actuates the restraining mechanism to thereby restrain rotation of the cord dispenser and prevent dispensing of the cord such that the portable communication device is prevented from sustaining damage when dropped. Further provided is a method of restraining movement of a portable communication device using a restraining device of the invention. No. of Pages : 31 No. of Claims : 48 The Patent Office Journal 18/12/2015 65718 (12) PATENT APPLICATION PUBLICATION (21) Application No.4980/DELNP/2015 A (19) INDIA (22) Date of filing of Application :09/06/2015 (43) Publication Date : 18/12/2015 (54) Title of the invention : PROCESSES FOR THE PREPARATION OF 4- AMINO -3 -HALO -6 (SUBSTITUTED)PICOLINATES AND 4- AMINO-5- FLUORO -3 -HALO -6 - (SUBSTITUTED)PICOLINATES (51) International classification (31) Priority Document No (32) Priority Date (33) Name of priority country (86) International Application No Filing Date (87) International Publication No (61) Patent of Addition to Application Number Filing Date (62) Divisional to Application Number Filing Date (71)Name of Applicant : 1)DOW AGROSCIENCES LLC :A01N43/40 Address of Applicant :9330 Zionsville Road, Indianapolis, IN :61/736830 46268 U.S.A. :13/12/2012 2)JOHNSON, Peter Lee :U.S.A. 3)RENGA,James M. :PCT/US2013/074604 4)GIAMPIETRO, Natalie C. :12/12/2013 5)WHITEKER, Gregory T. :WO 2014/093591 6)GALLIFORD, Christopher :NA (72)Name of Inventor : :NA 1)JOHNSON, Peter Lee 2)RENGA, James M. :NA 3)GIAMPIETRO, Natalie C. :NA 4)WHITEKER ,Gregory T. 5)GALLIFORD ,Christopher (57) Abstract : 4- Amino- 3- chloro- 6- (substituted)picolinates are prepared from difluoroacetic acid or trifluoroacetic acid tritylamine or -t butylamine as a protecting group, a 3, 3- dialkoxyprop- 1 -yne and a substituted methylene amine by a series of steps. Provided herein are processes for the preparation of 4- amino -5- fluoro- 3 -halo -6- (substituted)picolinates and 4- amino -3- halo- 6(substituted)picolinates. More particularly , provided herein are processes for the preparation of- 4- amino- 5- fluoro- 3 -halo- 6 (substituted)picolinates and- 4- amino- 3 -halo- 6 - (substituted)picolinates from a non- pyridine source. These picolinates are useful as herbicides. No. of Pages : 81 No. of Claims : 6 The Patent Office Journal 18/12/2015 65719 (12) PATENT APPLICATION PUBLICATION (21) Application No.4981/DELNP/2015 A (19) INDIA (22) Date of filing of Application :09/06/2015 (43) Publication Date : 18/12/2015 (54) Title of the invention : PROCESS FOR THE PREPARATION OF 4- AMINO -5- FLUORO -3 -CHLORO -6(SUBSTITUTED)PICOLINATES (51) International classification :A01N43/40 (71)Name of Applicant : (31) Priority Document No :61/736841 1)DOW AGROSCIENCES LLC (32) Priority Date :13/12/2012 Address of Applicant :9330 Zionsville Road, Indianapolis ,IN (33) Name of priority country :U.S.A. 46268 U.S.A. (86) International Application No :PCT/US2013/074575 2)GIAMPIETRO, Natalie C. Filing Date :12/12/2013 3)RENGA, James (87) International Publication No :WO 2014/093580 (72)Name of Inventor : (61) Patent of Addition to Application 1)GIAMPIETRO, Natalie C. :NA Number 2)RENGA ,James M. :NA Filing Date (62) Divisional to Application Number :NA Filing Date :NA (57) Abstract : 4 -Amino- 5- fluoro- 3- chloro- 6- (substituted)picolinates are prepared from trifluoroacetic acid , p- methoxyaniline , a C1- C4 alkyl propiolate and a substituted methylene amine by a series of steps. In particular, provided herein are processes for the preparation of 4amino- 5- fluoro -3- chloro- 6 -(substituted)picolinates from a non- pyridine source without a metal assisted coupling and without fluorination with an expensive fluorinating agent. These picolinates are useful as herbicides. No. of Pages : 23 No. of Claims : 5 The Patent Office Journal 18/12/2015 65720 (12) PATENT APPLICATION PUBLICATION (21) Application No.6954/DELNP/2015 A (19) INDIA (22) Date of filing of Application :06/08/2015 (43) Publication Date : 18/12/2015 (54) Title of the invention : LIQUID PERMEABLE PRIMARY DRESSING WITH A SILICONE COATING (51) International classification :A61F13/02,A61F13/00 (71)Name of Applicant : (31) Priority Document No :10 2013 100 157.2 1)RIESINGER Birgit (32) Priority Date :09/01/2013 Address of Applicant :Raesfeldstrae 67 48149 M¼nster (33) Name of priority country :Germany Germany (86) International Application No :PCT/EP2014/050331 (72)Name of Inventor : Filing Date :09/01/2014 1)RIESINGER Birgit (87) International Publication No :WO 2014/108476 (61) Patent of Addition to Application :NA Number :NA Filing Date (62) Divisional to Application Number :NA Filing Date :NA (57) Abstract : The invention relates to a liquid permeable primary dressing in a web form having pores perforations or honeycomb grid structures which allow the liquid to pass. Said dressing also comprises a coating made of a material containing silicone. No. of Pages : 27 No. of Claims : 14 The Patent Office Journal 18/12/2015 65721 (12) PATENT APPLICATION PUBLICATION (21) Application No.6955/DELNP/2015 A (19) INDIA (22) Date of filing of Application :06/08/2015 (43) Publication Date : 18/12/2015 (54) Title of the invention : SURFACE MODIFIED METALLIC FOAM BODY PROCESS FOR ITS PRODUCTION AND USE THEREOF (51) International classification :B01J37/02,B01J37/08,B01J37/18 (71)Name of Applicant : (31) Priority Document No :13154293.8 1)ALANTUM EUROPE GMBH (32) Priority Date :06/02/2013 Address of Applicant :Raiffeisenallee 6 82041 Oberhacing (33) Name of priority country :EPO Germany (86) International Application (72)Name of Inventor : :PCT/EP2014/052285 No 1)RADIVOJEVIC Dejan :06/02/2014 Filing Date 2)NAUMANN Dirk (87) International Publication 3)SABERI Shadi :WO 2014/122194 No 4)BAE Jungsuk (61) Patent of Addition to 5)POSS Ren :NA Application Number :NA Filing Date (62) Divisional to Application :NA Number :NA Filing Date (57) Abstract : The invention relates to a surface modified metallic foam body containing an unmodified core and an alloy skin obtainable by a process comprising the steps: (a) providing a metallic foam body comprising a first metallic material; (b) applying a second metallic material which is different from the first metallic material and which contains a first metallic compound that is leachable as such and/or that can be transformed by alloying into a second metallic compound that is leachable and different from the first metallic compound on a surface of the metallic foam body(a) by coating the surface of the metallic foam body with an organic binder and a powder of the second metallic material; (c) forming an alloy skin of the metallic foam body obtained in step (b) by alloying the first metallic material and the second metallic material; and (d) treating the alloyed metallic foam body obtained in step (c) with an agent that is capable of leaching out the leachable first and/or second metallic compound from the alloy skin of the metallic foam body to leach out at least a part of the first and/or the second metallic compound from the alloy skin of the metallic foam body; wherein the thickness of the alloy skin is in the range of up to 50 µm as determined by electron microscopy. The invention moreover relates to a process for the production of the surface modified metallic foam body and a use of the surface modified metallic foam body. No. of Pages : 22 No. of Claims : 11 The Patent Office Journal 18/12/2015 65722 (12) PATENT APPLICATION PUBLICATION (21) Application No.5026/DELNP/2015 A (19) INDIA (22) Date of filing of Application :10/06/2015 (43) Publication Date : 18/12/2015 (54) Title of the invention : COATED PIGMENTS FOR COLORING PVC (51) International classification :C09C1/22,C09C1/24,C08K9/02 (71)Name of Applicant : (31) Priority Document No :12197078.4 1)LANXESS DEUTSCHLAND GMBH (32) Priority Date :13/12/2012 Address of Applicant :Kennedyplatz 1, 50569 Kln Germany (33) Name of priority country :EPO (72)Name of Inventor : (86) International Application No :PCT/EP2013/076585 1)CHLOPEK ,Krzysztof Filing Date :13/12/2013 2)MEISEN, Ulrich (87) International Publication No :WO 2014/091008 3)K–NIG ,Ralf Gerhard (61) Patent of Addition to :NA Application Number :NA Filing Date (62) Divisional to Application :NA Number :NA Filing Date (57) Abstract : The invention relates to a coated pigment for coloring PVC. No. of Pages : 26 No. of Claims : 21 The Patent Office Journal 18/12/2015 65723 (12) PATENT APPLICATION PUBLICATION (21) Application No.5027/DELNP/2015 A (19) INDIA (22) Date of filing of Application :10/06/2015 (43) Publication Date : 18/12/2015 (54) Title of the invention : ELECTROLYZER APPARATUS AND METHOD OF MAKING IT (51) International classification :C25B11/02,C25B1/10,C02F1/461 (71)Name of Applicant : (31) Priority Document No :13/747238 1)GTA, INC. (32) Priority Date :22/01/2013 Address of Applicant :11403 Morgan Overlook Drive, (33) Name of priority country :U.S.A. Knoxville, TN 37931 U.S.A. (86) International Application (72)Name of Inventor : :PCT/US2013/068136 No 1)GREENBAUM, Elias :01/11/2013 Filing Date (87) International Publication :WO 2014/116318 No (61) Patent of Addition to :NA Application Number :NA Filing Date (62) Divisional to Application :NA Number :NA Filing Date (57) Abstract : An apparatus for the electrolytic splitting of water into hydrogen and oxygen gases is disclosed. The apparatus comprises: (i) a first hemi -enclosure; (ii) a second hemi- enclosure; (iii) a diaphragm electrode array positioned between the first hemi- enclosure and the second hemi- enclosure comprising: (a) a diaphragm, that passes ions and impedes the passage of gases , comprising a first side and a second opposed side; (b) a first plurality of electrodes in a first vicinity of the first side of the diaphragm; and (c) a second plurality of electrodes in a second vicinity of the second opposed side of the diaphragm; (iv) a fastener, for leak -tight fastening of the first hemienclosure , the diaphragm electrode array , and the second hemi- enclosure ,whereby a leak- tight enclosure is formed; (v) contacts for electrically powering the first and second pluralities of electrodes , and; (vi) pathways configured to remove hydrogen and oxygen gases from the enclosure. No. of Pages : 61 No. of Claims : 25 The Patent Office Journal 18/12/2015 65724 (12) PATENT APPLICATION PUBLICATION (21) Application No.6945/DELNP/2015 A (19) INDIA (22) Date of filing of Application :06/08/2015 (43) Publication Date : 18/12/2015 (54) Title of the invention : PNEUMATIC TIRE CARCASS HAVING AIR BLOCKING STABILIZING FABRIC SYSTEM (71)Name of Applicant : 1)MILLIKEN & COMPANY Address of Applicant :920 Milliken Road M 495 Spartanburg (51) International classification :B60C9/11,B60C9/08,B60C9/02 South Carolina 29303 U.S.A. (31) Priority Document No :61/761471 2)PESCHEK Johann (32) Priority Date :06/02/2013 3)DUYTSCHAEVER Yves (33) Name of priority country :U.S.A. 4)CATTEAU Franck (86) International Application No :PCT/US2014/013302 5)EL MAJID Ines Filing Date :28/01/2014 6)NAIR Sujith (87) International Publication No :WO 2014/123715 7)PUTHILLATH Padmakumar (61) Patent of Addition to 8)ULLAL Purushothama K. :NA Application Number (72)Name of Inventor : :NA Filing Date 1)PESCHEK Johann (62) Divisional to Application 2)DUYTSCHAEVER Yves :NA Number 3)CATTEAU Franck :NA Filing Date 4)EL MAJID Ines 5)NAIR Sujith 6)PUTHILLATH Padmakumar 7)ULLAL Purushothama K. (57) Abstract : A pneumatic tire carcass having a radial direction and a circumferential direction. The tire carcass comprises at least one ply of stabilizing fabric and an air blocking layer attached to the stabilizing fabric. The stabilizing fabric contains a plurality of reinforcing yarns and is disposed within the carcass such that the reinforcing yarns are arranged in the radial direction of the carcass. The reinforcing yarns comprise monoaxially drawn tape elements having a rectangular cross section an upper surface and a lower surface. The tape elements contain at least a first layer having a draw ratio of at least about 5 a modulus of at least about 2 GPa and a density of at least 0.85 g/cm3. The first layer contains a polymer selected from the group consisting of polyamide polyester co polymers and mixtures thereof. No. of Pages : 50 No. of Claims : 15 The Patent Office Journal 18/12/2015 65725 (12) PATENT APPLICATION PUBLICATION (21) Application No.6946/DELNP/2015 A (19) INDIA (22) Date of filing of Application :06/08/2015 (43) Publication Date : 18/12/2015 (54) Title of the invention : A WIND TURBINE COMPONENT HAVING AN OPTICAL FIBRE WIND SENSOR (51) International classification :G01P5/02 (71)Name of Applicant : (31) Priority Document No :NA 1)VESTAS WIND SYSTEMS A/S (32) Priority Date :NA Address of Applicant :Hedeager 42 8200 Aarhus N Denmark (33) Name of priority country :NA (72)Name of Inventor : (86) International Application No :PCT/DK2013/050041 1)LEVI Chee Kang Filing Date :15/02/2013 2)ANG Jia Liang (87) International Publication No :WO 2014/124646 (61) Patent of Addition to Application :NA Number :NA Filing Date (62) Divisional to Application Number :NA Filing Date :NA (57) Abstract : The application relates to a wind turbine component 18 having an optical fibre sensor 10 arranged to detect the wind speed over the surface of the component. In one embodiment the optical fibre sensor 10 has a light loss portion 15 that allows some of the light transmitted in the core 11 of the optical fibre to escape. The amount that the optical fibre bends in the air flow across the surface causes the effective surface area of the light loss portion 15 to increase or decrease. With increased or decreased surface area of the light loss portion more or less light is lost from the fibre. The intensity of the light transmitted in the fibre can therefore be used as a measure of the amount of bending and therefore as a measure of the air flow s speed. In other embodiments the optical fibre can comprise optical gratings such as Fibre Bragg Gratings or Long Period Gratings. Further embodiments use interferometry to measure the extension of the optical fibre. No. of Pages : 22 No. of Claims : 15 The Patent Office Journal 18/12/2015 65726 (12) PATENT APPLICATION PUBLICATION (21) Application No.6947/DELNP/2015 A (19) INDIA (22) Date of filing of Application :06/08/2015 (43) Publication Date : 18/12/2015 (54) Title of the invention : COMBINED ELECTROCHEMICAL AND CHEMICAL ETCHING PROCESSES FOR GENERATION OF POROUS SILICON PARTICULATES (51) International classification :H01L21/76 (71)Name of Applicant : (31) Priority Document No :61/749636 1)WILLIAM MARSH RICE UNIVERSITY (32) Priority Date :07/01/2013 Address of Applicant :6100 Main Street Houston TX 77005 (33) Name of priority country :U.S.A. U.S.A. (86) International Application No :PCT/US2014/010438 2)LOCKHEED MARTIN CORPORATION Filing Date :07/01/2014 (72)Name of Inventor : (87) International Publication No :WO 2014/107704 1)BISWAL Sibani L. (61) Patent of Addition to Application 2)WONG Michael S. :NA Number 3)THAKUR Madhuri :NA Filing Date 4)SINSABAUGH Steven L. (62) Divisional to Application Number :NA Filing Date :NA (57) Abstract : Embodiments of the present disclosure pertain to methods of preparing porous silicon particulates by: (a) electrochemically etching a silicon substrate where electrochemical etching comprises exposure of the silicon substrate to an electric current density and where electrochemical etching produces a porous silicon film over the silicon substrate; (b) separating the porous silicon film from the silicon substrate where the separating comprises a gradual increase of the electric current density in sequential increments; (c) repeating steps (a) and (b) a plurality of times; (d) electrochemically etching the silicon substrate in accordance with step (a) to produce a porous silicon film over the silicon substrate; (e) chemically etching the porous silicon film and the silicon substrate; and (f) splitting the porous silicon film and the silicon substrate to form porous silicon particulates. Further embodiments of the present disclosure pertain to the formed porous silicon particulates and anode materials that contain them. No. of Pages : 37 No. of Claims : 47 The Patent Office Journal 18/12/2015 65727 (12) PATENT APPLICATION PUBLICATION (21) Application No.5066/DELNP/2015 A (19) INDIA (22) Date of filing of Application :11/06/2015 (43) Publication Date : 18/12/2015 (54) Title of the invention : METHOD FOR PRODUCING CARBOXAMIDES (51) International classification :C07D231/14 (71)Name of Applicant : (31) Priority Document No :12356026.0 1)BAYER CROPSCIENCE AG (32) Priority Date :13/11/2012 Address of Applicant :Alfred- Nobel -Strasse 50, 40789 (33) Name of priority country :EPO Monheim Germany (86) International Application No :PCT/EP2013/073378 (72)Name of Inventor : Filing Date :08/11/2013 1)LINDNER, Werner (87) International Publication No :WO 2014/076007 2)PAZENOK, Sergii (61) Patent of Addition to Application 3)VOLZ ,Frank :NA Number :NA Filing Date (62) Divisional to Application Number :NA Filing Date :NA (57) Abstract : The present invention relates to a process for the preparation of carboxamide derivatives of formula (I) R N O N N CF 2 H C H 3 F starting from 1- methyl- 3- difluormethyl .5 -fluoro -1H- pyrazole- 4- carbonyl halides in absence of an acid acceptor. No. of Pages : 14 No. of Claims : 6 The Patent Office Journal 18/12/2015 65728 (12) PATENT APPLICATION PUBLICATION (21) Application No.5067/DELNP/2015 A (19) INDIA (22) Date of filing of Application :11/06/2015 (43) Publication Date : 18/12/2015 (54) Title of the invention : IMPROVED PROCESS FOR THE PREPARATION OF|N- CYANO- S- [1 - (PYRIDIN- 3- YL)ETHYL] -S -METHYLSULFILIMINES (51) International classification :C07D213/34 (71)Name of Applicant : (31) Priority Document No :61/735612 1)DOW AGROSCIENCES LLC (32) Priority Date :11/12/2012 Address of Applicant :9330 Zionsville Road, Indianapolis, IN (33) Name of priority country :U.S.A. 46268 U.S.A. (86) International Application No :PCT/US2013/074006 2)GONZALEZ, Michael A. Filing Date :10/12/2013 3)MEECE, Chad (87) International Publication No :WO 2014/093276 4)CHEN, Xiaoyun (61) Patent of Addition to Application (72)Name of Inventor : :NA Number 1)GONZALEZ, Michael A. :NA Filing Date 2)MEECE, Chad (62) Divisional to Application Number :NA 3)CHEN ,Xiaoyun Filing Date :NA 4)DAN, Florin (57) Abstract : Cyano- substituted sulfilimines are produced efficiently and in high yield from the corresponding sulfides , cyanamide and hypochlorite by adding the sulfide to a solution of the cyanamide and hypochlorite in the presence of a nitrile solvent while maintaining the pH from about 8 to about 12. No. of Pages : 11 No. of Claims : 8 The Patent Office Journal 18/12/2015 65729 (12) PATENT APPLICATION PUBLICATION (21) Application No.5068/DELNP/2015 A (19) INDIA (22) Date of filing of Application :11/06/2015 (43) Publication Date : 18/12/2015 (54) Title of the invention : ANHYDROUS POWDER TO LIQUID PARTICLES (51) International classification :B01J13/02 (71)Name of Applicant : (31) Priority Document No :13/719649 1)JOHNSON & JOHNSON CONSUMER COMPANIES, (32) Priority Date :19/12/2012 INC. (33) Name of priority country :U.S.A. Address of Applicant :199 Grandview Road, Skillman ,NJ (86) International Application No :PCT/US2013/075714 08558 U.S.A. Filing Date :17/12/2013 (72)Name of Inventor : (87) International Publication No :WO 2014/099946 1)FASSIH, Ali (61) Patent of Addition to Application 2)SUN ,Ying :NA Number :NA Filing Date (62) Divisional to Application Number :NA Filing Date :NA (57) Abstract : A powder comprising core/shell particles having an average particle size of less than 1000 microns , each particle comprising: 1 ) a liquid core that is substantially free of water and comprises a polar liquid having a percent surface polarity of at least 24% , and 2) a shell comprising hydrophobic particles , is provided. No. of Pages : 54 No. of Claims : 31 The Patent Office Journal 18/12/2015 65730 (12) PATENT APPLICATION PUBLICATION (21) Application No.5069/DELNP/2015 A (19) INDIA (22) Date of filing of Application :11/06/2015 (43) Publication Date : 18/12/2015 (54) Title of the invention : PROCESSES FOR PREPARING EPOXIDIZED POLYMERS (51) International classification :C08K3/18,C08C19/06,C08J5/00 (71)Name of Applicant : (31) Priority Document No :61/736656 1)LANXESS BUTYL PTE. LTD. (32) Priority Date :13/12/2012 Address of Applicant :1265 Vidal Street South, Sarnia, (33) Name of priority country :U.S.A. Ontario N7T 7M2 Canada (86) International Application (72)Name of Inventor : :PCT/CA2013/001017 No 1)NGUYEN ,Paul :11/12/2013 Filing Date 2)DAVIDSON ,Gregory ,J., E. (87) International Publication No :WO 2014/089674 3)STEEVENSZ ,Richard (61) Patent of Addition to :NA Application Number :NA Filing Date (62) Divisional to Application :NA Number :NA Filing Date (57) Abstract : The present invention is directed to a process for preparing epoxidized polymers. The process comprises reacting an unsaturated polymer with hydrogen peroxide in the presence of a polymer support having a sulfonic acid group. The present invention is also directed to an epoxidized halogenated- polymer which comprises repeating units derived from at least one isoolefin monomer and repeating units derived from at least one diolefinic monomer, and one or more allylic halide groups and one or more oxirane functional groups in the polymer backbone. No. of Pages : 27 No. of Claims : 26 The Patent Office Journal 18/12/2015 65731 (12) PATENT APPLICATION PUBLICATION (21) Application No.6963/DELNP/2015 A (19) INDIA (22) Date of filing of Application :07/08/2015 (43) Publication Date : 18/12/2015 (54) Title of the invention : METHOD FOR PRODUCING NITROALKANES IN A MICROSTRUCTURED REACTOR (51) International classification :C07C201/08,C07C205/02 (71)Name of Applicant : (31) Priority Document No :13166644.8 1)BASF SE (32) Priority Date :06/05/2013 Address of Applicant :67056 Ludwigshafen Germany (33) Name of priority country :EPO (72)Name of Inventor : (86) International Application No :PCT/EP2014/058437 1)B–HLING Ralf Filing Date :25/04/2014 2)HAYER Michael (87) International Publication No :WO 2014/180678 3)REHFINGER Alwin (61) Patent of Addition to Application 4)SCHELPER Michael :NA Number 5)MELDER Johann Peter :NA Filing Date 6)ERNST Martin (62) Divisional to Application Number :NA 7)TELES Joaquim Henrique Filing Date :NA (57) Abstract : The invention relates to a method for producing nitroalkanes by reacting at least one alkane with at least one nitrating agent in the gas phase wherein the nitration is carried out in a microstructured reaction zone having parallel channels with hydraulic diameters of less than 2.5 mm and a total specific inner surface area of more than 1600 m /m and wherein the alkane and the nitrating agent are conveyed through the reaction zone in gaseous form under a pressure of 1 bar to 20 bar and reacted at a temperature of 150°C to 650°C and the reaction products are cooled and discharged downstream of the reaction zone and wherein the at least one nitrating agent is fed distributed over two to ten feed points along the reaction zone. No. of Pages : 15 No. of Claims : 10 The Patent Office Journal 18/12/2015 65732 (12) PATENT APPLICATION PUBLICATION (21) Application No.6964/DELNP/2015 A (19) INDIA (22) Date of filing of Application :07/08/2015 (43) Publication Date : 18/12/2015 (54) Title of the invention : A HUMAN EXTERNAL URINARY INCONTINENCE TREATMENT METHOD AND DEVICE (51) International (71)Name of Applicant : :A61F5/453,A61F5/455,A61F5/443 classification 1)GR DOME MEDICAL LTD. (31) Priority Document No :61/988219 Address of Applicant :Derech Hayam Street 209 Apartment 49 (32) Priority Date :04/05/2014 Haifa 34890 Israel (33) Name of priority country :U.S.A. (72)Name of Inventor : (86) International Application 1)LANIADO Amir :PCT/IL2014/000039 No :14/08/2014 Filing Date (87) International Publication :WO 2015/170307 No (61) Patent of Addition to :NA Application Number :NA Filing Date (62) Divisional to Application :NA Number :NA Filing Date (57) Abstract : The present invention relates to an external urinary incontinence treatment a device and a method of deploying an external urinary incontinence treatment device that minimizes the inconvenience of fastening and fixating a urine receiving component to the genital region and to the skin surrounding the urethral orifice of a treated patient. The device comprises: a urine receiving component a tube a receiving component supporting element a tube locking system a genital region connection component and a genital region anchoring element. The tube connects and communicates freely with the urine receiving component and is inserted through the receiving component supporting element. The tube also communicates with said tube locking system and is able to move vertically the receiving component supporting element when said tube locking system is deactivated. The tube is fixated in its movement at a desired position along the length of said tube when said tube locking system is activated. The device receiving component supporting element is connected to the genital region connection component and with the tube locking system. The genital region connection component is connected to the genital region anchoring element. In deployment of the device the genital region anchoring element is reversibly connected to the skin of the genital region of the treated patient and urine receiving component is connected to the skin surrounding the urethral orifice of the treated patient when the tube is moved towards the genital region of the patient. The tube is reversibly fixated in place by the tube locking system after urine receiving component is adjusted and fastened to the skin surrounding the urethral orifice of the patient in a urine leak free connection while applying the minimal required pressure thus causing the treated patient minimal inconvenience. The tube lucking system can be easily deactivated and reactivated to adjust the connection of the receiving component to the skin surrounding the urethral orifice in accordance to changing body postures of the patient. No. of Pages : 16 No. of Claims : 14 The Patent Office Journal 18/12/2015 65733 (12) PATENT APPLICATION PUBLICATION (21) Application No.1601/DEL/2014 A (19) INDIA (22) Date of filing of Application :12/06/2014 (43) Publication Date : 18/12/2015 (54) Title of the invention : A METHOD OF EXPLOSIVE WELDING OF ALUMNIUM ALLOY TO STEEL (51) International classification (31) Priority Document No (32) Priority Date (33) Name of priority country (86) International Application No Filing Date (87) International Publication No (61) Patent of Addition to Application Number Filing Date (62) Divisional to Application Number Filing Date :B23K 20/08 :NA :NA :NA :NA :NA : NA :NA :NA :NA :NA (71)Name of Applicant : 1)DIRECTOR GENERAL, DEFENCE RESEARCH & DEVELOPMENT ORGANISATION (DRDO) Address of Applicant :Ministry of Defence, Govt of India, Room No. 348, B Wing, DRDO Bhawan, Rajaji Marg, New Delhi 110105, India; Delhi India (72)Name of Inventor : 1)RAYCHAUDHURI, Tushar Kanti 2)BALKISHAN, Pal Dinesh Kumar 3)SRIVASTAVA, Niraj 4)KUMAR, Rajeev 5)UPADHYAY, Abhishek 6)KANOJIA, Deepak 7)SINGH, Manjit (57) Abstract : The invention relates to a method for explosive welding of Aluminium alloy to steel, comprising of placing a flyer plate having a reverse side and an obverse side, made of Aluminium alloy at a pre-determined standoff distance from the surface of a base plate made of steel with obverse side of the flyer plate facing the base plate, the flyer plate having a proximal and a distal end; placing explosive composition comprising trimonite and common salt on at least a portion of a surface of the reverse side of flyer plate; and initiating detonation of the explosive composition on the proximal end, thereby causing a detonation to travel towards the distal end, thereby generating a jet to clean the obverse side surface of the flyer plate and the surface of the base plate and generating adequate kinetic energy for flyer plate to weld with the base plate. No. of Pages : 31 No. of Claims : 14 The Patent Office Journal 18/12/2015 65734 (12) PATENT APPLICATION PUBLICATION (21) Application No.5103/DELNP/2015 A (19) INDIA (22) Date of filing of Application :11/06/2015 (43) Publication Date : 18/12/2015 (54) Title of the invention : PROCESSING DEVICE WITH ADDRESS TRANSLATION PROBING AND METHODS (51) International classification :G06F12/10 (71)Name of Applicant : (31) Priority Document No :13/723379 1)ADVANCED MICRO DEVICES, INC. (32) Priority Date :21/12/2012 Address of Applicant :One AMD Place, Sunnyvale ,California (33) Name of priority country :U.S.A. 94085 U.S.A. (86) International Application No :PCT/US2013/075711 (72)Name of Inventor : Filing Date :17/12/2013 1)HSU, Lisa (87) International Publication No :WO 2014/099943 2)JAYASENA, Nuwan (61) Patent of Addition to Application 3)KEGEL ,Andrew :NA Number 4)BECKMANN, Bradford M. :NA Filing Date (62) Divisional to Application Number :NA Filing Date :NA (57) Abstract : A data processing device is provided that employs multiple translation look- aside buffers (TLBs) associated with respective processors that are configured to store selected address translations of a page table of a memory shared by the processors. The processing device is configured such that when an address translation is requested by a processor and is not found in the TLB associated with that processor , another TLB is probed for the requested address translation. The probe across to the other TLB may occur in advance of a walk of the page table for the requested address or alternatively a walk can be initiated concurrently with the probe. Where the probe successfully finds the requested address translation , the page table walk can be avoided or discontinued. No. of Pages : 31 No. of Claims : 46 The Patent Office Journal 18/12/2015 65735 (12) PATENT APPLICATION PUBLICATION (21) Application No.5104/DELNP/2015 A (19) INDIA (22) Date of filing of Application :11/06/2015 (43) Publication Date : 18/12/2015 (54) Title of the invention : IRAK INHIBITORS AND USES THEREOF (51) International classification (31) Priority Document No (32) Priority Date (33) Name of priority country (86) International Application No Filing Date (87) International Publication No (61) Patent of Addition to Application Number Filing Date (62) Divisional to Application Number Filing Date (71)Name of Applicant : :A61K31/519 1)NIMBUS IRIS, INC. :61/751000 Address of Applicant :25 First Street ,Suite 404, Cambridge, :10/01/2013 MA 02141 U.S.A. :U.S.A. (72)Name of Inventor : :PCT/US2014/010652 1)GREENWOOD ,Jeremy, Robert :08/01/2014 2)HARRIMAN ,Geraldine, C. :WO 2014/110114 3)KAPELLER -LIBERMANN ,Rosana :NA 4)MASSE ,Craig ,E. :NA 5)ROBINSON, Shaughnessy 6)ROMERO, Donna ,L. :NA 7)SHELLEY ,Mee :NA 8)WESTER ,Ronald, T. (57) Abstract : The present invention provides compounds compositions thereof and methods of using the same. The search for new therapeutic agents has been greatly aided in recent years by a better understanding of the structure of enzymes and other bi-omolecules associated with diseases. One important class of enzymes that has been the subject of extensive study is the protein kinase family. No. of Pages : 194 No. of Claims : 20 The Patent Office Journal 18/12/2015 65736 (12) PATENT APPLICATION PUBLICATION (21) Application No.5105/DELNP/2015 A (19) INDIA (22) Date of filing of Application :11/06/2015 (43) Publication Date : 18/12/2015 (54) Title of the invention : CONFIGURABLE COMMUNICATIONS CONTROLLER (51) International classification :H04L29/02 (71)Name of Applicant : (31) Priority Document No :13/723960 1)ATI TECHNOLOGIES ULC (32) Priority Date :21/12/2012 Address of Applicant :One Commerce Valley Drive E., (33) Name of priority country :U.S.A. Markham, Ontario L3T7X6 Canada (86) International Application No :PCT/CA2013/050987 (72)Name of Inventor : Filing Date :18/12/2013 1)BARBIERO, Natale (87) International Publication No :WO 2014/094164 2)CARUK ,Gordon (61) Patent of Addition to Application :NA Number :NA Filing Date (62) Divisional to Application Number :NA Filing Date :NA (57) Abstract : A communications controller includes a physical interface and an internal transmit and receive circuit. The physical interface has a port for connection to a communication medium , an input, and an output , and operates to receive a first sequence of data bits from the input and to transmit the first sequence of data bits to the port, and to receive a second sequence of data bits from the port and to conduct said second sequence of data bits to the output. The internal transmit and receive circuit is coupled to the physical interface , and has an internal architecture to conduct a first plurality of symbols at a first rate in a low frequency mode and a second plurality of symbols at a second rate in a low latency mode , wherein the first plurality is greater in number than the second plurality , and the second rate is higher than the first rate. No. of Pages : 33 No. of Claims : 39 The Patent Office Journal 18/12/2015 65737 (12) PATENT APPLICATION PUBLICATION (21) Application No.6982/DELNP/2015 A (19) INDIA (22) Date of filing of Application :07/08/2015 (43) Publication Date : 18/12/2015 (54) Title of the invention : A SIMULATED CIGARETTE (51) International (71)Name of Applicant : :B65D83/32,A24F47/00,A61M15/00 classification 1)KIND CONSUMER LIMITED (31) Priority Document No :1305494.5 Address of Applicant :79 Clerkenwell Road London Greater (32) Priority Date :26/03/2013 London EC1R 5AR U.K. (33) Name of priority (72)Name of Inventor : :U.K. country 1)HEARN Alex (86) International 2)GUPTA Ritika :PCT/GB2014/050939 Application No 3)GONZALEZ CAMPOS Rene Mauricio :25/03/2014 Filing Date 4)NYEIN Khine Zaw (87) International Publication :WO 2014/155093 No (61) Patent of Addition to :NA Application Number :NA Filing Date (62) Divisional to :NA Application Number :NA Filing Date (57) Abstract : A simulated cigarette having a generally cylindrical cigarette like housing (1) with a main axis the housing containing a reservoir (4) of a pressurised inhalable composition. The reservoir (4) has a reservoir outlet at one end which is selectively closed by an outlet valve (5). The simulated cigarette further comprises a tube (20) with a through bore (21) extending along a substantial portion of the reservoir (4) from the vicinity of the reservoir outlet such that composition flows into a tube bore inlet and along the tube bore to the reservoir outlet. The tube inlet end is retained such that the axis passes through the inlet end and so that the tube bore inlet is positioned in the axial sense in the central 50% of the volume of the reservoir. No. of Pages : 17 No. of Claims : 13 The Patent Office Journal 18/12/2015 65738 (12) PATENT APPLICATION PUBLICATION (21) Application No.5039/DELNP/2015 A (19) INDIA (22) Date of filing of Application :10/06/2015 (43) Publication Date : 18/12/2015 (54) Title of the invention : A METHOD FOR THE ADDITIVE MANUFACTURING OF A PART BY SELECTIVE MELTING OR SELECTIVE SINTERING OF OPTIMISED- COMPACTNESS POWDER BEDS USING A HIGH ENERGY BEAM (51) International classification :B22F3/105,B29C67/00 (71)Name of Applicant : (31) Priority Document No :1203196 1)MBDA FRANCE (32) Priority Date :27/11/2012 Address of Applicant :37 boulevard de Montmorency, F(33) Name of priority country :France 75016 Paris France (86) International Application No :PCT/FR2013/052867 2)SNECMA Filing Date :27/11/2013 (72)Name of Inventor : (87) International Publication No :WO 2014/083277 1)COLIN ,Christophe (61) Patent of Addition to Application 2)MOTTIN, Jean -Baptiste :NA Number 3)KIRSCHNER ,La«titia :NA Filing Date 4)SAUSSEREAU, Grard (62) Divisional to Application Number :NA Filing Date :NA (57) Abstract : The invention concerns a method for manufacturing a part by the selective melting or selective sintering of powder beds using a high energy beam comprising the following steps: (a) providing a material in the form of powder particles (60), (b) depositing a first layer (10) of powder on a support member (80) , (c) scanning at least one region of said first layer (10) with the beam (95) in order to heat the powder locally in said region to a temperature higher than the sintering temperature of said powder , such that the particles of said melted or sintered powder from said region form at least one single -piece component (15) ,(d) depositing a second layer (20) of powder on said first layer (10) , (e) scanning at least one region of said second layer (20) with the beam (95) in order to heat the powder in said region to a temperature higher than the sintering temperature of said powder, such that the particles of said melted or sintered powder form at least a second single piece component (25), (f) repeating steps (d) and (e) for each new powder layer to be deposited above a preceding layer until the part is completely formed. Typically, the powder has a multimodal particle size distribution. No. of Pages : 32 No. of Claims : 16 The Patent Office Journal 18/12/2015 65739 (12) PATENT APPLICATION PUBLICATION (21) Application No.6972/DELNP/2015 A (19) INDIA (22) Date of filing of Application :07/08/2015 (43) Publication Date : 18/12/2015 (54) Title of the invention : SURGICAL INSTRUMENT WITH ARTICULATION LOCK HAVING A DETENTING BINARY SPRING (51) International classification :A61B17/00,A61B17/29 (71)Name of Applicant : (31) Priority Document No :13/780162 1)ETHICON ENDO SURGERY INC. (32) Priority Date :28/02/2013 Address of Applicant :4545 Creek Road Cincinnati Ohio (33) Name of priority country :U.S.A. 45242 U.S.A. (86) International Application No :PCT/US2014/016211 (72)Name of Inventor : Filing Date :13/02/2014 1)FANELLI Nicholas (87) International Publication No :WO 2014/133776 2)GAGEL Jeffrey C. (61) Patent of Addition to Application 3)ZERKLE Jason E. :NA Number 4)SIMMS Robert J. :NA Filing Date (62) Divisional to Application Number :NA Filing Date :NA (57) Abstract : A apparatus includes a shaft an end effector an articulation joint and a locking feature. The end effector is pivotable from a first position to a second position. The end effector is aligned with a longitudinal axis of the shaft in the first position and angled relative to the longitudinal axis of the shaft in the second position. The articulation joint couples the shaft with the end effector and pivots the end effector from the first position to the second position. The locking feature is coupled with the articulation joint and translates from a proximal position to a distal position. The locking feature locks the articulation joint when the locking feature is in the distal position. No. of Pages : 54 No. of Claims : 20 The Patent Office Journal 18/12/2015 65740 (12) PATENT APPLICATION PUBLICATION (21) Application No.6973/DELNP/2015 A (19) INDIA (22) Date of filing of Application :07/08/2015 (43) Publication Date : 18/12/2015 (54) Title of the invention : UNIVERSAL LENGTH SCREW DESIGN AND CUTTING INSTRUMENT (51) International classification :A61B17/86,A61B17/88 (71)Name of Applicant : (31) Priority Document No :13/789944 1)DEPUY SYNTHES PRODUCTS LLC. (32) Priority Date :08/03/2013 Address of Applicant :325 Paramount Drive Raynham (33) Name of priority country :U.S.A. Massachusetts 02767 U.S.A. (86) International Application No :PCT/US2014/018894 (72)Name of Inventor : Filing Date :27/02/2014 1)APPENZELLER Andreas (87) International Publication No :WO 2014/137724 2)FLURI Daniel (61) Patent of Addition to Application :NA Number :NA Filing Date (62) Divisional to Application Number :NA Filing Date :NA (57) Abstract : An adjustable length bone screw is provided that has a shaft that can be cut at any of several predetermined positions. The adjustable length bone screws can be provided in a kit containing many bone screws having the same or different initial lengths and these screws can be cut to the desired length for use in the surgical procedure prior to or during the surgical procedure. The adjustable length bone screws have a plurality of threaded shaft sections that are separated by a plurality of unthreaded shaft sections along the length of the shaft. The threaded sections have preferably at least two cutting flutes extending longitudinally along the shaft. The invention provides the adjustable length bone screws a tool for cutting the bone screws to a desired length kits containing the bone screws and optionally the cutting tool and methods for using the screws and/or the cutting tool in preparation for or during a surgical procedure. No. of Pages : 25 No. of Claims : 22 The Patent Office Journal 18/12/2015 65741 (12) PATENT APPLICATION PUBLICATION (21) Application No.6974/DELNP/2015 A (19) INDIA (22) Date of filing of Application :07/08/2015 (43) Publication Date : 18/12/2015 (54) Title of the invention : STAPLE FORMING FEATURES FOR SURGICAL STAPLING INSTRUMENT (51) International classification :A61B17/068,A61B17/072 (71)Name of Applicant : (31) Priority Document No :13/780379 1)ETHICON ENDO SURGERY INC. (32) Priority Date :28/02/2013 Address of Applicant :4545 Creek Road Cincinnati Ohio (33) Name of priority country :U.S.A. 45242 U.S.A. (86) International Application No :PCT/US2014/017304 (72)Name of Inventor : Filing Date :20/02/2014 1)BOUDREAUX Chad P. (87) International Publication No :WO 2014/133858 2)SCHEIB Charles J. (61) Patent of Addition to Application 3)HOFFMAN Douglas B. :NA Number 4)VOLZ Janna B. :NA Filing Date 5)OCONNOR Megan (62) Divisional to Application Number :NA 6)DUNKI JACOBS Adam R. Filing Date :NA 7)KRUTH Robert P. (57) Abstract : An end effector (12) for a surgical instrument comprises a first jaw (16) and a second jaw (18). The first jaw is configured to receive a staple cartridge. The second jaw is movable relative to the first jaw and is configured to provide an anvil (18) for forming staples (350). The anvil has staple forming pockets (310). Each staple forming pocket comprises first (320) and second (340) staple forming surface regions configured to receive respective first and second staple legs. The first and second staple forming surface regions each have a respective length that is greater than half of the length of the staple forming pocket. The staple forming surface regions may include convex surfaces that drive staple legs laterally. The pocket minimizes re entry of staple leg tips into tissue. No. of Pages : 102 No. of Claims : 20 The Patent Office Journal 18/12/2015 65742 (12) PATENT APPLICATION PUBLICATION (21) Application No.6956/DELNP/2015 A (19) INDIA (22) Date of filing of Application :06/08/2015 (43) Publication Date : 18/12/2015 (54) Title of the invention : INFORMATION PROCESSING DEVICE (51) International classification :G06F1/18,G06F3/00,H01R13/641 (71)Name of Applicant : (31) Priority Document No :2013087227 1)SHINANO KENSHI KABUSHIKI KAISHA (32) Priority Date :18/04/2013 Address of Applicant :1078 Kamimaruko Ueda shi Nagano (33) Name of priority country :Japan 3860498 Japan (86) International Application (72)Name of Inventor : :PCT/JP2014/054582 No 1)MIYAOKA Seiji :25/02/2014 Filing Date 2)OGAWA Takahiro (87) International Publication :WO 2014/171185 No (61) Patent of Addition to :NA Application Number :NA Filing Date (62) Divisional to Application :NA Number :NA Filing Date (57) Abstract : The present invention addresses the problem of providing an information processing device with which a plug can be connected to a connector without confusing the front and back of the plug. To solve this problem the case (31) of this information processing device (30) is provided with a connector (50) capable of connecting to a plug (60) on the front surface or back surface of which protrusions (62) are formed. A mounting part (52) which is formed at the same location in the width direction as the location of the connector (50) in the width direction and on which the front surface or the back surface of the plug (60) can be mounted is formed on a surface (31b) of the case which is orthogonal to the surface (35) of the case in which the connector (50) is provided. A recessed part (54) which accommodates the protrusions (62) formed on the front surface or back surface of the plug (60) is formed in the mounting part (52). No. of Pages : 18 No. of Claims : 3 The Patent Office Journal 18/12/2015 65743 (12) PATENT APPLICATION PUBLICATION (21) Application No.6957/DELNP/2015 A (19) INDIA (22) Date of filing of Application :06/08/2015 (43) Publication Date : 18/12/2015 (54) Title of the invention : DISPLAY DEVICE (51) International (71)Name of Applicant : :B60K35/00,B60R16/02,F02D29/02 classification 1)TOYOTA JIDOSHA KABUSHIKI KAISHA (31) Priority Document No :NA Address of Applicant :1 Toyota cho Toyota shi Aichi 4718571 (32) Priority Date :NA Japan (33) Name of priority country :NA (72)Name of Inventor : (86) International Application 1)AMANO Takashi :PCT/JP2013/053140 No 2)KUBO Kaoru :08/02/2013 Filing Date 3)HISANO Taishi (87) International Publication 4)OZAWA Yasushi :WO 2014/122785 No (61) Patent of Addition to :NA Application Number :NA Filing Date (62) Divisional to Application :NA Number :NA Filing Date (57) Abstract : A display device (100) is provided with: a first setting means (101) for setting a first operation amount (711) to be performed by an occupant such that output is increased in the state where the vehicle speed is less than a predetermined threshold; a second setting means (101) for setting a second operation amount (712) to be performed by the occupant such that the operating state of a vehicle can be shifted to a desired state (713) where optimum instantaneous fuel consumption is implemented by decreasing the output in the state where the vehicle speed is the predetermined threshold or more; and a display means (103) for displaying on a display unit (700) the first operation amount and/or the second operation amount and a present operation amount (720) that is an operation amount performed at present by the occupant. No. of Pages : 61 No. of Claims : 11 The Patent Office Journal 18/12/2015 65744 (12) PATENT APPLICATION PUBLICATION (21) Application No.6958/DELNP/2015 A (19) INDIA (22) Date of filing of Application :06/08/2015 (43) Publication Date : 18/12/2015 (54) Title of the invention : INSTANCE HOST CONFIGURATION (51) International classification :G06F15/177 (71)Name of Applicant : (31) Priority Document No :13/747176 1)AMAZON TECHNOLOGIES INC. (32) Priority Date :22/01/2013 Address of Applicant :P.O. Box 8102 Reno Nevada 89507 (33) Name of priority country :U.S.A. U.S.A. (86) International Application No :PCT/US2014/012422 (72)Name of Inventor : Filing Date :22/01/2014 1)KOWALSKI Marcin Piotr (87) International Publication No :WO 2014/116619 2)PATERSON JONES Roland (61) Patent of Addition to Application 3)GREENFIELD James Alfred Gordon :NA Number :NA Filing Date (62) Divisional to Application Number :NA Filing Date :NA (57) Abstract : Methods and apparatus for instance host configuration are disclosed. A system includes a plurality of instance hosts configurable for resource instances of a network accessible service and control servers to manage remote configuration of the instance hosts. In response to an instance configuration request from a client a selected control server transmits to a selected instance host a sequence of one or more commands. The selected instance host instantiates a remote command executor. The remote command executor initiates configuration operations corresponding to the command sequence and terminates. The selected control server provides a response to the instance configuration request based at least in part on results of the operations initiated by the executor. No. of Pages : 71 No. of Claims : 15 The Patent Office Journal 18/12/2015 65745 (12) PATENT APPLICATION PUBLICATION (21) Application No.6959/DELNP/2015 A (19) INDIA (22) Date of filing of Application :06/08/2015 (43) Publication Date : 18/12/2015 (54) Title of the invention : LEVEL SHIFTING DEVICE (51) International (71)Name of Applicant : :H03K19/00,H03K19/017,H03K19/0185 classification 1)ST ERICSSON SA (31) Priority Document Address of Applicant :Chemin du Champ des Filles 39 CH :13152777.2 No 1228 Plan les Ouates Switzerland (32) Priority Date :25/01/2013 (72)Name of Inventor : (33) Name of priority 1)CONFALONIERI Pierangelo :EPO country 2)GUANZIROLI Federico (86) International :PCT/EP2013/075715 Application No :05/12/2013 Filing Date (87) International :WO 2014/114399 Publication No (61) Patent of Addition :NA to Application Number :NA Filing Date (62) Divisional to :NA Application Number :NA Filing Date (57) Abstract : The present disclosure relates to a voltage level shifting device ( 100; 200) for driving a capacitive load (CL). The device comprises an input terminal (Nl) for receiving a first input signal (V! N) switchable between a first logic state corresponding to a first reference voltage (GND) and a second logic state corresponding to a second reference voltage (VDD1) and an output terminal ( 102; 202) for supplying an output signal (VQUT) switchable between a first logic state corresponding to a third reference voltage (VDD2) and a second logic state corresponding to a fourth reference voltage (VDD2 K) obtained by reducing the third reference voltage (VDD2) of a predetermined operative voltage (K).The device comprises a first electronic circuit (103) that is activated following a commutation of the first input signal (V! N) from the first reference voltage (GND) to the second reference voltage (VDD1) for fixing the output terminal ( 102; 202) to the fourth reference voltage (VDD2 K). The device further comprises a second electronic circuit (104) that is activated following a commutation of the first input signal (V!N) from the second reference voltage (VDD1) to the first reference voltage (GND). No. of Pages : 40 No. of Claims : 15 The Patent Office Journal 18/12/2015 65746 (12) PATENT APPLICATION PUBLICATION (21) Application No.5035/DELNP/2015 A (19) INDIA (22) Date of filing of Application :10/06/2015 (43) Publication Date : 18/12/2015 (54) Title of the invention : A METHOD AND APPARATUS FOR SUPPLYING BLAST TO A BLAST FURNACE (51) International classification :C21B5/06,C21B9/10,C21B9/14 (71)Name of Applicant : (31) Priority Document No :1223135.3 1)SIEMENS PLC (32) Priority Date :21/12/2012 Address of Applicant :Faraday House, SirWilliam Siemens (33) Name of priority country :U.K. Square, Frimley, Camberley GUI 6 8QD U.K. (86) International Application No :PCT/EP2013/076109 (72)Name of Inventor : Filing Date :10/12/2013 1)GEACH, Paul Mark (87) International Publication No :WO 2014/095494 (61) Patent of Addition to :NA Application Number :NA Filing Date (62) Divisional to Application :NA Number :NA Filing Date (57) Abstract : Apparatus for supplying blast to a blast furnace (1) comprises a plurality of hot blast stoves (4, 5, 6) , each stove comprising a cold blast inlet, a fuel inlet , an air supply inlet, a hot blast outlet, and a waste gas outlet; and a waste heat recovery unit (30) connected to a fuel supply, the stove fuel inlet and the cold blast inlet. The stove waste gas outlets are connected to the cold blast inlets , whereby stove waste gas from one stove (5) is supplied , via the waste heat recovery unit, as cold blast to another stove (4). No. of Pages : 17 No. of Claims : 12 The Patent Office Journal 18/12/2015 65747 (12) PATENT APPLICATION PUBLICATION (21) Application No.5765/DELNP/2012 A (19) INDIA (22) Date of filing of Application :28/06/2012 (43) Publication Date : 18/12/2015 (54) Title of the invention : FUNGICIDAL HYDROXIMOYL TETRAZOLE DERIVATIVES (51) International (71)Name of Applicant : :C07D401/12,C07D417/12,A01N43/713 classification 1)BAYER CROPSCIENCE AG (31) Priority Document Address of Applicant :Alfred Nobel Strasse 50 40789 :09356069.6 No Monheim Germany (32) Priority Date :28/12/2009 (72)Name of Inventor : (33) Name of priority 1)BEIER Christian :EPO country 2)BENTING Jurgen (86) International 3)BERNIER David :PCT/EP2010/070772 Application No 4)COQUERON Pierre Yves :28/12/2010 Filing Date 5)DESBORDES Philippe (87) International 6)DUBOST Christophe :WO 2011/080255 Publication No 7)GARY Stphanie (61) Patent of Addition to 8)GENIX Pierre :NA Application Number 9)PORTZ Daniela :NA Filing Date 10)WACHENDORFF NEUMANN Ulrike (62) Divisional to :NA Application Number :NA Filing Date (57) Abstract : The present invention relates to hydroximoyl tetrazole derivatives of formula (I) their process of preparation their use as fungicide active agents particularly in the form of fungicide compositions and methods for the control of phytopathogenic fungi notably of plants using these compounds or compositions. wherein A represents a tetrazoyl group Het represents a pyridyl group or a thiazolyl group and X represents various substituents. No. of Pages : 44 No. of Claims : 12 The Patent Office Journal 18/12/2015 65748 (12) PATENT APPLICATION PUBLICATION (21) Application No.5766/DELNP/2012 A (19) INDIA (22) Date of filing of Application :28/06/2012 (43) Publication Date : 18/12/2015 (54) Title of the invention : FUNGICIDE HYDROXIMOYL TETRAZOLE DERIVATIVES (51) International (71)Name of Applicant : :A01N43/713,A01N43/78,A01P3/00 classification 1)BAYER CROPSCIENCE AG (31) Priority Document No :09356070.4 Address of Applicant :Alfred Nobel Strasse 50 40789 (32) Priority Date :28/12/2009 Monheim Germany (33) Name of priority country :EPO (72)Name of Inventor : (86) International 1)BEIER Christian :PCT/EP2010/070773 Application No 2)BENTING Jurgen :28/12/2010 Filing Date 3)BERNIER David (87) International Publication 4)COQUERON Pierre Yves :WO 2011/080256 No 5)DESBORDES Philippe (61) Patent of Addition to 6)DUBOST Christophe :NA Application Number 7)GARY Stphanie :NA Filing Date 8)GENIX Pierre (62) Divisional to 9)PORTZ Daniela :NA Application Number 10)WACHENDORFF NEUMANN Ulrike :NA Filing Date (57) Abstract : The present invention relates to hydroximoyl tetrazole derivatives of Formula (I) their process of preparation their use as fungicide active agents particularly in the form of fungicide compositions and methods for the control of phytopathogenic fungi notably of plants using these compounds or compositions. wherein A represents a tetrazoyl group Het represents a pyridyl group or a thiazolyl group and X represents various substituents. No. of Pages : 44 No. of Claims : 18 The Patent Office Journal 18/12/2015 65749 (12) PATENT APPLICATION PUBLICATION (21) Application No.6978/DELNP/2015 A (19) INDIA (22) Date of filing of Application :07/08/2015 (43) Publication Date : 18/12/2015 (54) Title of the invention : PROCESS OF MANUFACTURING OF SOFT MAGNETIC CERAMIC AND ITS USE (51) International classification :H01F1/24,H01F41/02 (71)Name of Applicant : (31) Priority Document No :P.402606 1)INSTYTUT NISKICH TEMPERATUR I BADAN (32) Priority Date :29/01/2013 STRUKTURALNYCH (33) Name of priority country :Poland Address of Applicant :PAN im. Wlodzimierza (86) International Application No :PCT/PL2014/000006 Trzebiatowskiego Ok³lna 2 PL 50 422 Wroclaw Poland Filing Date :27/01/2014 (72)Name of Inventor : (87) International Publication No :WO 2014/120030 1)OGANISIAN Karen (61) Patent of Addition to Application 2)STREK Wieslaw :NA Number 3)VOGI Andrzej :NA Filing Date 4)GLUCHOWSKI Pawel (62) Divisional to Application Number :NA Filing Date :NA (57) Abstract : A process for the manufacture of magnetic ceramic is provided including the steps of: die compacting a powder composition including a mixture of soft magnetic iron or iron based powder core particles of which are surrounded by an electrically insulating inorganic coating an amount of 1 to 35% by weight of the composition; heating and pressing the compacted body in an atmosphere to a temperature and a pressure below the decomposition temperature/pressure of the magnetic iron or iron based powder. No. of Pages : 8 No. of Claims : 15 The Patent Office Journal 18/12/2015 65750 (12) PATENT APPLICATION PUBLICATION (21) Application No.6979/DELNP/2015 A (19) INDIA (22) Date of filing of Application :07/08/2015 (43) Publication Date : 18/12/2015 (54) Title of the invention : HIGH SOLIDS FABRIC CREPE PROCESS FOR PRODUCING ABSORBENT SHEET WITH INFABRIC DRYING (51) International classification :D21F11/14 (71)Name of Applicant : (31) Priority Document No :60/580,847 1) FORT JAMES CORPORATION (32) Priority Date :18/06/2004 Address of Applicant :133 Peachtree Street, N.E. Atlanta, (33) Name of priority country :U.S.A. Georgia 30303 USA U.S.A. (86) International Application No :PCT/US2005/021437 (72)Name of Inventor : Filing Date :17/06/2005 1)MURRAY, Frank C. (87) International Publication No :WO2006/009833 2)WENDT, Greg (61) Patent of Addition to Application :NA Number :NA Filing Date (62) Divisional to Application Number :6771/DELNP/2006 Filed on :14/11/2006 (57) Abstract : A method of making a fabric-creped absorbent cellulosic sheet is provided which includes dewatering a papermaking furnish and partially drying the web without wet-pressing before applying it to a translating transfer surface moving at a first speed. The process further includes fabric-creping the web from the transfer surface at a consistency of from about 30 to about 60 percent utilizing a creping fabric, the creping step occurring under pressure in a creping nip defined between the transfer surface and the creping fabric wherein the fabric is traveling at a second speed slower than the speed of said transfer surface, the fabric pattern, nip parameters, velocity delta and web consistency being selected such that the web is creped from the surface and redistributed on the creping fabric. After creping, the web is dried, preferably with a plurality of can dryers to a consistency of at least about 90 percent while it is held in the creping fabric. No. of Pages : 64 No. of Claims : 23 The Patent Office Journal 18/12/2015 65751 (12) PATENT APPLICATION PUBLICATION (21) Application No.6965/DELNP/2015 A (19) INDIA (22) Date of filing of Application :07/08/2015 (43) Publication Date : 18/12/2015 (54) Title of the invention : CONTINUITY MAINTAINING BIASING MEMBER (51) International classification :H01R9/05 (71)Name of Applicant : (31) Priority Document No :13/075,406 1)JOHN MEZZALINGUA ASSOCIATES, INC. (32) Priority Date :30/03/2011 Address of Applicant :Legal Department, 6176 East Molloy (33) Name of priority country :U.S.A. Rd, East Syracuse, New York 13057, United States of America (86) International Application No :PCT/US2012/031185 U.S.A. Filing Date :29/03/2012 (72)Name of Inventor : (87) International Publication No :WO2012/135482 1)Noah MONTENA (61) Patent of Addition to Application 2)Trevor EHRET :NA Number 3)Richard HAUBE :NA Filing Date 4)Souheil ZRAIK (62) Divisional to Application Number :8968/DELNP/2013 Filed on :16/10/2013 (57) Abstract : A post having a first end, a second end, and a flange proximate the second end, wherein the post is configured to receive a center conductor surrounded by a dielectric of a coaxial cable, a connector body attached to the post, a coupling element attached to the post, the coupling element having a first end a second end, and a biasing member disposed within a cavity formed between the first end of the coupling element and the connector body to bias the coupling element against the post is provided. Moreover, a connector body having a biasing element, wherein the biasing element biases the coupling element against the post, is further provided. Furthermore, associated methods are also provided. No. of Pages : 34 No. of Claims : 37 The Patent Office Journal 18/12/2015 65752 (12) PATENT APPLICATION PUBLICATION (21) Application No.6966/DELNP/2015 A (19) INDIA (22) Date of filing of Application :07/08/2015 (43) Publication Date : 18/12/2015 (54) Title of the invention : METHOD FOR HEAT TREATING A COATING (51) International (71)Name of Applicant : :C03C17/36,B23K26/30,B23K26/00 classification 1)SAINT GOBAIN GLASS FRANCE (31) Priority Document No :1351840 Address of Applicant :18 avenue dAlsace F 92400 Courbevoie (32) Priority Date :01/03/2013 France (33) Name of priority country :France (72)Name of Inventor : (86) International Application 1)CANOVA Lorenzo :PCT/FR2014/050431 No 2)SCHWEITZER Jean Philippe :27/02/2014 Filing Date 3)BRAJER Xavier (87) International Publication :WO 2014/132000 No (61) Patent of Addition to :NA Application Number :NA Filing Date (62) Divisional to :NA Application Number :NA Filing Date (57) Abstract : The invention concerns a method for heat treating a coating (1) deposited on at least a portion of a first face (F1) of a substrate (2) comprising a first face (F1) and a second face (F2) opposite said first face (F1) which involves treating said coating (1) by means of a laser beam (3) focused on said coating (1) in the form of a laser line (4) extending in a first direction (D1) said heat treatment being such that a movement of relative displacement between said substrate (2) and said laser line (4) is created in a second direction (D2) transverse to said first direction (D1) said method being characterised in that it involves locally heating said second face (F2) to a temperature of at least 30°C in an additional heating area (5) extending opposite said laser line (4) over a length of at least 10cm in said second direction (D2) using at least one additional heating means (6) arranged on the side opposite said laser line (4) relative to said substrate (2). No. of Pages : 35 No. of Claims : 15 The Patent Office Journal 18/12/2015 65753 (12) PATENT APPLICATION PUBLICATION (21) Application No.6967/DELNP/2015 A (19) INDIA (22) Date of filing of Application :07/08/2015 (43) Publication Date : 18/12/2015 (54) Title of the invention : SURGICAL FASTENERS HAVING ARTICULATING JOINTS AND DEFLECTABLE TIPS (51) International classification :A61B17/064,A61B17/122 (71)Name of Applicant : (31) Priority Document No :13/791950 1)ETHICON INC. (32) Priority Date :09/03/2013 Address of Applicant :P.O. Box 151 U.S. Route 22 Somerville (33) Name of priority country :U.S.A. New Jersey 08876 U.S.A. (86) International Application No :PCT/US2014/017245 (72)Name of Inventor : Filing Date :20/02/2014 1)MIKSZA Anthony (87) International Publication No :WO 2014/163814 2)NERING Robert (61) Patent of Addition to Application 3)COHN Simon :NA Number 4)DANIEL Matthew D. :NA Filing Date 5)JARRETT Jeremy D. (62) Divisional to Application Number :NA Filing Date :NA (57) Abstract : A surgical fastener for securing a prosthetic device to tissue includes a first leg having a proximal end a distal end a first insertion tip at the distal end and a first articulating joint that separates said first leg into a proximal segment and a distal segment that is deflectable relative to the proximal segment and a second leg including a proximal end a distal end a second insertion tip at the distal end and a second articulating joint that separates said second leg into a proximal segment and a distal segment that is deflectable relative to the proximal segment. A bridge connects the proximal ends of the first and second legs for forming a closed end of the surgical fastener. After implantation in tissue the insertion tips are deflectable away from vessels and nerves to minimize injury to the vessels and nerves and to minimize patient discomfort and pain. No. of Pages : 128 No. of Claims : 20 The Patent Office Journal 18/12/2015 65754 (12) PATENT APPLICATION PUBLICATION (21) Application No.6968/DELNP/2015 A (19) INDIA (22) Date of filing of Application :07/08/2015 (43) Publication Date : 18/12/2015 (54) Title of the invention : INSTALLATION FEATURES FOR SURGICAL INSTRUMENT END EFFECTOR CARTRIDGE (51) International classification :A61B17/072,A61B17/00 (71)Name of Applicant : (31) Priority Document No :13/780417 1)ETHICON ENDO SURGERY INC. (32) Priority Date :28/02/2013 Address of Applicant :4545 Creek Road Cincinnati Ohio (33) Name of priority country :U.S.A. 45242 U.S.A. (86) International Application No :PCT/US2014/017334 (72)Name of Inventor : Filing Date :20/02/2014 1)HOFFMAN Douglas B. (87) International Publication No :WO 2014/133862 (61) Patent of Addition to Application :NA Number :NA Filing Date (62) Divisional to Application Number :NA Filing Date :NA (57) Abstract : A surgical instrument comprises a body a shaft and an end effector. The end effector has a staple cartridge a lower jaw an anvil and a firing beam. The staple cartridge comprises a cartridge body and a lower cartridge tray. One or both of the cartridge body or the lower cartridge tray comprises at least one notch. The lower jaw is configured to be coupled with the cartridge body and comprises protrusions. The protrusions of the lower jaw align with the notches of the cartridge body and/or lower cartridge tray when the lower jaw and staple cartridge are coupled. The body comprises a handle portion and a series of actuators capable of closing the anvil on the staple cartridge and driving the firing beam to vertically drive a plurality of staples. No. of Pages : 49 No. of Claims : 20 The Patent Office Journal 18/12/2015 65755 (12) PATENT APPLICATION PUBLICATION (21) Application No.5784/DELNP/2012 A (19) INDIA (22) Date of filing of Application :28/06/2012 (43) Publication Date : 18/12/2015 (54) Title of the invention : VULCANIZABLE COPOLYMER SEMICONDUCTIVE SHIELD COMPOSITIONS (51) International classification :H01B3/30,H01B17/56,H01B7/02 (71)Name of Applicant : (31) Priority Document No :12/697807 1)GENERAL CABLE TECHNOLOGIES CORPORATION (32) Priority Date :01/02/2010 Address of Applicant :4 Tesseneer Drive Highland Heights (33) Name of priority country :U.S.A. KY 41076 U.S.A. (86) International Application (72)Name of Inventor : :PCT/US2011/020786 No 1)EASTER Mark :11/01/2011 Filing Date (87) International Publication :WO 2011/094055 No (61) Patent of Addition to :NA Application Number :NA Filing Date (62) Divisional to Application :NA Number :NA Filing Date (57) Abstract : Semi conductive or insulating compositions including an ethylene/octane or butene copolymer and at least one additional polymer such LDPE are described. The compositions may also include carbon black and other additives. The composition may be used as a semi conductive layer in such applications as electrical cables. No. of Pages : 31 No. of Claims : 18 The Patent Office Journal 18/12/2015 65756 (12) PATENT APPLICATION PUBLICATION (21) Application No.5785/DELNP/2012 A (19) INDIA (22) Date of filing of Application :28/06/2012 (43) Publication Date : 18/12/2015 (54) Title of the invention : RESONANCE CIRCUITRY FOR A FIELD EMISSION LIGHTING ARRANGEMENT (51) International (71)Name of Applicant : :H05B41/28,H01J1/304,H01J63/04 classification 1)LIGHTLAB SWEDEN AB (31) Priority Document No :09180155.5 Address of Applicant :–stermalmstorg 1 SE-114 42 Stockholm (32) Priority Date :21/12/2009 Sweden (33) Name of priority country :EPO (72)Name of Inventor : (86) International Application 1)HU Qiu Hong :PCT/EP2010/068419 No :29/11/2010 Filing Date (87) International Publication :WO 2011/076522 No (61) Patent of Addition to :NA Application Number :NA Filing Date (62) Divisional to Application :NA Number :NA Filing Date (57) Abstract : The present invention relates to a field emission lighting arrangement comprising a field emission light source comprising an anode and a cathode and having an inherent predetermined capacitance an inductor having a predetermined inductance and connected to at least one of the anode and the cathode of the field emission light source and a power supply connected to the field emission light source and the inductor and configured to provide a drive signal for powering the field emission light source the drive signal comprising a first frequency component having a first frequency selected to be within a frequency range based on the predetermined capacitance and the predetermined inductance corresponding to the half power width at resonance of the field emission lighting arrangement. Advantages of the invention include lower power consumption as well as an increase in light output of the field emission lighting arrangement. No. of Pages : 14 No. of Claims : 11 The Patent Office Journal 18/12/2015 65757 (12) PATENT APPLICATION PUBLICATION (21) Application No.6969/DELNP/2015 A (19) INDIA (22) Date of filing of Application :07/08/2015 (43) Publication Date : 18/12/2015 (54) Title of the invention : PHOTOVOLTAIC DEVICE WITH PROTECTIVE LAYER OVER A WINDOW LAYER AND METHOD OF MANUFACTURE OF THE SAME (51) International (71)Name of Applicant : :H01L31/073,H01L31/18,H01L31/0216 classification 1)FIRST SOLAR INC. (31) Priority Document Address of Applicant :28101 Cedar Park Boulevard :61/762014 No Perrysburg Ohio 43551 U.S.A. (32) Priority Date :07/02/2013 (72)Name of Inventor : (33) Name of priority 1)TRIVEDI Jigish :U.S.A. country 2)POWELL Rick (86) International 3)DAMJANOVIC Dan :PCT/US2014/014419 Application No 4)GUO Jing :03/02/2014 Filing Date 5)ZHAO Zhibo (87) International 6)LIAO Feng :WO 2014/123806 Publication No 7)KARPENKO Oleh (61) Patent of Addition to 8)JAYARAMAN Sreenivas :NA Application Number 9)LIM Chong :NA Filing Date (62) Divisional to :NA Application Number :NA Filing Date (57) Abstract : A photovoltaic device (100) including a protective layer (114) between a window layer (112) and an absorber layer (116) the protective layer inhibiting dissolving/intermixing of the window layer into the absorber layer during a device activation step and methods of forming such photovoltaic devices. No. of Pages : 28 No. of Claims : 50 The Patent Office Journal 18/12/2015 65758 (12) PATENT APPLICATION PUBLICATION (21) Application No.6970/DELNP/2015 A (19) INDIA (22) Date of filing of Application :07/08/2015 (43) Publication Date : 18/12/2015 (54) Title of the invention : METHOD FOR OPERATING A SURFACE TREATMENT SYSTEM (51) International classification :B05B15/12,B01D46/00 (71)Name of Applicant : (31) Priority Document No :10 2013 002 041.7 1)EISENMANN SE (32) Priority Date :07/02/2013 Address of Applicant :T¼binger Str. 81 71032 Bblingen (33) Name of priority country :Germany Germany (86) International Application No :PCT/EP2014/000083 (72)Name of Inventor : Filing Date :15/01/2014 1)R–CKLE J¼rgen (87) International Publication No :WO 2014/121882 (61) Patent of Addition to Application :NA Number :NA Filing Date (62) Divisional to Application Number :NA Filing Date :NA (57) Abstract : The invention relates to a method for operating a surface treatment system (12) in which overspray which is generated in one or several coating booths (10) is picked up by an air stream and is guided to one or more one way separation units (44) in which the overspray is separated said units being respectively exchanged after reaching an overspray charge limit as charged one way separation units (64) with an empty one way separation unit (44). Said charged one way separation units (64) are used to produce a treatment material (100; 102) which enables a later valuation. No. of Pages : 28 No. of Claims : 10 The Patent Office Journal 18/12/2015 65759 (12) PATENT APPLICATION PUBLICATION (21) Application No.6971/DELNP/2015 A (19) INDIA (22) Date of filing of Application :07/08/2015 (43) Publication Date : 18/12/2015 (54) Title of the invention : LIQUID MENTHOL COMPOSITIONS (51) International (71)Name of Applicant : :A61K47/44,A61K31/045,A61P11/14 classification 1)DDROPS COMPANY (31) Priority Document No :61/759839 Address of Applicant :126 Trowers Roads Woodbridge (32) Priority Date :01/02/2013 Ontario L4L 5Z4 Canada (33) Name of priority (72)Name of Inventor : :U.S.A. country 1)VIETH Simon George (86) International 2)TEMOVSKY Chris James :PCT/CA2014/000090 Application No 3)VIETH Reinhold William :31/01/2014 Filing Date (87) International :WO 2014/117265 Publication No (61) Patent of Addition to :NA Application Number :NA Filing Date (62) Divisional to :NA Application Number :NA Filing Date (57) Abstract : A composition is provided comprising: (i) menthol and (ii) a carrier comprising a digestible edible oil wherein said digestible edible oil is one that provides a composition which is a liquid at 20°C after rising to that temperature from a lower temperature at which the oil was previously semisolid. The preferred edible oil is a medium chain triglyceride oil wherein the level of menthol in the composition is between 1 50 % by total weight so as to provide an menthol application rate of between 5 and 20 mg of menthol and most preferably about 10 mg menthol in a single droplet of the composition. The composition can also include additional added vitamins and essential oils. A liquid method for administering menthol is provided. No. of Pages : 20 No. of Claims : 23 The Patent Office Journal 18/12/2015 65760 (12) PATENT APPLICATION PUBLICATION (21) Application No.6983/DELNP/2015 A (19) INDIA (22) Date of filing of Application :07/08/2015 (43) Publication Date : 18/12/2015 (54) Title of the invention : HYBRID POWER AND OPTICAL FIBER CABLE WITH CONDUCTIVE BUFFER TUBE (51) International classification :H01B11/22,G02B6/44 (71)Name of Applicant : (31) Priority Document No :61/765997 1)ADC TELECOMMUNICATIONS INC. (32) Priority Date :18/02/2013 Address of Applicant :1050 Westlakes Drive Berwyn PA (33) Name of priority country :U.S.A. 19312 U.S.A. (86) International Application No :PCT/US2014/015969 (72)Name of Inventor : Filing Date :12/02/2014 1)HUEGERICH Thomas P. (87) International Publication No :WO 2014/126975 2)CHAPPELL Eric Ryan (61) Patent of Addition to Application 3)KACHMAR Wayne M. :NA Number :NA Filing Date (62) Divisional to Application Number :NA Filing Date :NA (57) Abstract : This disclosure is directed to a cable assembly including a cable with a first end and a second end. The cable includes first and second electrical conductors and first and second optical fibers. The cable assembly includes a first eight pin eight contact modular connector mounted upon the first end and a second eight pin eight contact modular connector mounted upon the second end. The first eight pin eight contact modular connector and the second eight pin eight contact modular connector each include an optical to electrical converter. No. of Pages : 25 No. of Claims : 37 The Patent Office Journal 18/12/2015 65761 (12) PATENT APPLICATION PUBLICATION (21) Application No.6984/DELNP/2015 A (19) INDIA (22) Date of filing of Application :07/08/2015 (43) Publication Date : 18/12/2015 (54) Title of the invention : PROJECTOR AND CONTROL METHOD (51) International classification :G06F3/0354,H04N5/74 (71)Name of Applicant : (31) Priority Document No :2013055372 1)SEIKO EPSON CORPORATION (32) Priority Date :18/03/2013 Address of Applicant :4 1 Nishi shinjuku 2 chome Shinjuku ku (33) Name of priority country :Japan Tokyo 1630811 Japan (86) International Application No :PCT/JP2014/001288 (72)Name of Inventor : Filing Date :07/03/2014 1)SUZUKI Kazumi (87) International Publication No :WO 2014/147988 (61) Patent of Addition to Application :NA Number :NA Filing Date (62) Divisional to Application Number :NA Filing Date :NA (57) Abstract : A projector includes a plurality of transmitters each of which transmits a signal a receiver that receives signals transmitted from another projector and a control unit that achieves synchronization of the signals between the projector and the another projector based on the signals transmitted from the another projector and received by the receiver. The control unit includes a state judgment portion that judges whether or not the synchronization with the another projector is stable and a number determination portion that determines the number of transmitters to be used among the plurality of transmitters based on the judgment result made by the state judgment portion. No. of Pages : 37 No. of Claims : 5 The Patent Office Journal 18/12/2015 65762 (12) PATENT APPLICATION PUBLICATION (21) Application No.6985/DELNP/2015 A (19) INDIA (22) Date of filing of Application :07/08/2015 (43) Publication Date : 18/12/2015 (54) Title of the invention : OXIDATIVELY CURABLE COATING COMPOSITION (51) International classification :C09D167/00 (71)Name of Applicant : (31) Priority Document No :13154852.1 1)CHEMSENTI LIMITED (32) Priority Date :11/02/2013 Address of Applicant :5th Floor 6 St Andrew Street London (33) Name of priority country :EPO EC4A 3AE U.K. (86) International Application No :PCT/GB2014/050270 (72)Name of Inventor : Filing Date :31/01/2014 1)DE BOER Johannes Wietse (87) International Publication No :WO 2014/122432 2)HAGE Ronald (61) Patent of Addition to Application 3)MAAIJEN Karin :NA Number :NA Filing Date (62) Divisional to Application Number :NA Filing Date :NA (57) Abstract : The present invention relates to an oxidatively curable coating formulation comprising an oxidatively curable alkyd based resin and a bis triazacyclononane based chelant which chelant may optionally be complexed with a suitable transition metal ion particularly manganese. The formulations may be paints or other oxidatively curable coating compositions. The invention also provides methods for making such formulations and compositions resultant from the curing of such formulations. No. of Pages : 34 No. of Claims : 15 The Patent Office Journal 18/12/2015 65763 (12) PATENT APPLICATION PUBLICATION (21) Application No.6986/DELNP/2015 A (19) INDIA (22) Date of filing of Application :07/08/2015 (43) Publication Date : 18/12/2015 (54) Title of the invention : OXIDATIVELY CURABLE COATING COMPOSITION (51) International classification :C09D167/00 (71)Name of Applicant : (31) Priority Document No :13154851.3 1)CATEXEL LIMITED (32) Priority Date :11/02/2013 Address of Applicant :TMF Corporate Administration (33) Name of priority country :EPO Services Limited 5th Floor 6 St Andrew Street London EC4A (86) International Application No :PCT/GB2014/050272 3AE U.K. Filing Date :31/01/2014 (72)Name of Inventor : (87) International Publication No :WO 2014/122434 1)HAGE Ronald (61) Patent of Addition to Application 2)DE BOER Johannes Wietse :NA Number 3)MAAIJEN Karin :NA Filing Date (62) Divisional to Application Number :NA Filing Date :NA (57) Abstract : The present invention relates to an oxidatively curable coating formulation comprising an oxidatively curable alkyd based resin and a diazacycloalkane based chelant which chelant may optionally be complexed with a suitable transition metal ion. The formulations may be paints or other oxidatively curable coating compositions. The invention also provides methods for making such formulations and compositions resultant from the curing of such formulations. No. of Pages : 36 No. of Claims : 15 The Patent Office Journal 18/12/2015 65764 (12) PATENT APPLICATION PUBLICATION (21) Application No.6987/DELNP/2015 A (19) INDIA (22) Date of filing of Application :07/08/2015 (43) Publication Date : 18/12/2015 (54) Title of the invention : PAN ELR+ CXC CHEMOKINE ANTIBODIES (51) International classification :C07K16/18,C07K16/24 (71)Name of Applicant : (31) Priority Document No :61/792800 1)ELI LILLY AND COMPANY (32) Priority Date :15/03/2013 Address of Applicant :Lilly Corporate Center Indianapolis (33) Name of priority country :U.S.A. Indiana 46285 U.S.A. (86) International Application No :PCT/US2014/020605 (72)Name of Inventor : Filing Date :05/03/2014 1)BEIDLER Catherine Brautigam (87) International Publication No :WO 2014/149733 2)KIKLY Kristine Kay (61) Patent of Addition to Application 3)STRIFLER Beth Ann :NA Number 4)WITCHER Derrick Ryan :NA Filing Date 5)BOYLES Jeffrey Streetman (62) Divisional to Application Number :NA Filing Date :NA (57) Abstract : Antibodies are provided that specifically bind seven human ELR CXC chemokines. The antibodies of the invention are useful for treating various inflammatory/autoimmune diseases such as inflammatory bowel disease (IBD) plaque psoriasis and palmoplantar pustulosis; and cancer such as renal cancer or ovarian cancer. No. of Pages : 33 No. of Claims : 19 The Patent Office Journal 18/12/2015 65765 (12) PATENT APPLICATION PUBLICATION (21) Application No.6988/DELNP/2015 A (19) INDIA (22) Date of filing of Application :07/08/2015 (43) Publication Date : 18/12/2015 (54) Title of the invention : METHOD FOR CONTROLLING THE PRODUCTION OF A BIOCIDE (51) International classification :C02F1/76 (71)Name of Applicant : (31) Priority Document No :61/761922 1)A.Y. LABORATORIES LTD. (32) Priority Date :07/02/2013 Address of Applicant :8 Beery Street 6468208 Tel Aviv Israel (33) Name of priority country :U.S.A. (72)Name of Inventor : (86) International Application No :PCT/IL2014/050130 1)BARAK Ayala Filing Date :06/02/2014 (87) International Publication No :WO 2014/122652 (61) Patent of Addition to Application :NA Number :NA Filing Date (62) Divisional to Application Number :NA Filing Date :NA (57) Abstract : A method and apparatus for producing a biocide from a hypochlorite oxidant and an ammonium salt are provided. The method includes monitoring a control parameter to optimize the ratio between the hypochlorite oxidant and the ammonium salt. The control parameter may be oxidation reduction potential conductivity induction or oxygen saturation. No. of Pages : 43 No. of Claims : 74 The Patent Office Journal 18/12/2015 65766 (12) PATENT APPLICATION PUBLICATION (21) Application No.5773/DELNP/2012 A (19) INDIA (22) Date of filing of Application :28/06/2012 (43) Publication Date : 18/12/2015 (54) Title of the invention : MOLDING APPARATUS (51) International classification :B21B31/08,B21D5/12 (71)Name of Applicant : (31) Priority Document No :NA 1)NAKATA MANUFACTURING Co. LTD. (32) Priority Date :NA Address of Applicant :7 6 Tagawa 3 chome Yodogawa ku (33) Name of priority country :NA Osaka shi Osaka 5320027 Japan (86) International Application No :PCT/JP2009/071808 (72)Name of Inventor : Filing Date :28/12/2009 1)SATO Takeyuki (87) International Publication No :WO 2011/080839 2)NINOMIYA Manabu (61) Patent of Addition to Application 3)YABUTA Hiroaki :NA Number 4)WATANABE Takeshi :NA Filing Date 5)NAKANO Tomoyasu (62) Divisional to Application Number :NA Filing Date :NA (57) Abstract : Disclosed is a molding apparatus in which to enable the extraction and exchange of a stacked body of roll chocks/yokes from a molding roll stand in an orthogonal direction to the direction of movement of products a more compact size with a simple structure has been achieved and rolls can be easily exchanged without mounting a hydraulic actuator or the like which forms and releases the stacked body on an inner frame or a roll stand. In order to realize this the inner frame is disposed within the molding roll stand in raisable manner. A mechanical mechanism of depressed and protruding fittings is disposed on the facing surfaces of the roll chocks/yokes and the inner frame and the roll chocks/yokes are guided using the lowering motion of the inner frame after the connection with a screw down device is broken thereby enabling the stacked body to be successively formed and extracted from the roll stand. The stacked body is released using the upward motion of the inner frame thereby allowing the roll chocks/yokes to be guided to a prescribed position in the stand and locked. No. of Pages : 39 No. of Claims : 3 The Patent Office Journal 18/12/2015 65767 (12) PATENT APPLICATION PUBLICATION (21) Application No.6994/DELNP/2015 A (19) INDIA (22) Date of filing of Application :07/08/2015 (43) Publication Date : 18/12/2015 (54) Title of the invention : INFRARED RADIATION REFLECTING FILM (51) International classification :B32B9/00,B32B27/00,E04B1/76 (71)Name of Applicant : (31) Priority Document No :2013017024 1)NITTO DENKO CORPORATION (32) Priority Date :31/01/2013 Address of Applicant :1 2 Shimohozumi 1 chome Ibaraki shi (33) Name of priority country :Japan Osaka 5678680 Japan (86) International Application (72)Name of Inventor : :PCT/JP2014/052147 No 1)WATANABE Masahiko :30/01/2014 Filing Date 2)OHMORI Yutaka (87) International Publication :WO 2014/119677 No (61) Patent of Addition to :NA Application Number :NA Filing Date (62) Divisional to Application :NA Number :NA Filing Date (57) Abstract : This infrared radiation reflecting film (100) is provided with in order an infrared radiation reflecting layer (20) and a transparent protective layer (30) on a transparent film substrate (10). The infrared radiation reflecting layer (20) is provided with in order from the transparent film substrate (10) side a first metal oxide layer (21) a metal layer (25) composed mainly of silver and a second metal oxide layer (22) comprising a composite metal oxide containing zinc oxide and tin oxide. The transparent protective layer (30) is in direct contact with the second metal oxide layer (22). The thickness of the transparent protective layer (30) is 30 nm to 150 nm and is preferably an organic layer having a crosslinked structure derived from an ester compound having an acidic group and a polymerizable functional group in the same molecule. The content of the structure derived from the ester compound in the transparent protective layer (30) is preferably 1 wt% to 40 wt%. No. of Pages : 31 No. of Claims : 3 The Patent Office Journal 18/12/2015 65768 (12) PATENT APPLICATION PUBLICATION (21) Application No.6995/DELNP/2015 A (19) INDIA (22) Date of filing of Application :07/08/2015 (43) Publication Date : 18/12/2015 (54) Title of the invention : A TECHNIQUE FOR COOLING A ROOT SIDE OF A PLATFORM OF A TURBOMACHINE PART (51) International classification :F01D5/08,F01D5/18 (71)Name of Applicant : (31) Priority Document No :13162346.4 1)SIEMENS AKTIENGESELLSCHAFT (32) Priority Date :04/04/2013 Address of Applicant :Wittelsbacherplatz 2 80333 M¼nchen (33) Name of priority country :EPO Germany (86) International Application No :PCT/EP2014/055420 (72)Name of Inventor : Filing Date :18/03/2014 1)SZIJARTO Janos (87) International Publication No :WO 2014/161716 2)WANG Lieke (61) Patent of Addition to Application :NA Number :NA Filing Date (62) Divisional to Application Number :NA Filing Date :NA (57) Abstract : A platform cooling device (10) for directing a cooling fluid onto a root side (52) of a platform (50) of a turbomachine part (2) is presented. The platform cooling device (10) includes a first segment (20) to be positioned at a root (60) of the turbomachine part (2) and a second segment (30) at an angle to the first segment (20) to be positioned at the root side (52) of the platform (50) of the turbomachine part (2). The second segment (30) includes at least one impingement channel (32) having an inlet (34) for receiving at least a part of the cooling fluid and an outlet (36) for releasing the received cooling fluid onto the root side (52) of the platform (50). The first segment (20) and the second segment (30) define a path for the cooling fluid via the impingement channel (32). A turbomachine component (1) including the platform cooling device (10) is also presented. No. of Pages : 34 No. of Claims : 15 The Patent Office Journal 18/12/2015 65769 (12) PATENT APPLICATION PUBLICATION (21) Application No.6996/DELNP/2015 A (19) INDIA (22) Date of filing of Application :07/08/2015 (43) Publication Date : 18/12/2015 (54) Title of the invention : NEW USE OF CELL PERMEABLE PEPTIDE INHIBITORS OF THE JNK SIGNAL TRANSDUCTION PATHWAY FOR THE TREATMENT OF VARIOUS DISEASES (51) International (71)Name of Applicant : :A61K38/17,C07K14/47,A61K48/00 classification 1)XIGEN INFLAMMATION LTD. (31) Priority Document No :PCT/EP2013/001881 Address of Applicant :Arch. Makariou III 195 Neocleous (32) Priority Date :26/06/2013 House 3030 Limassol Cyprus (33) Name of priority (72)Name of Inventor : :EPO country 1)COMBETTE Jean Marc (86) International 2)DELOCHE Catherine :PCT/EP2014/001736 Application No :26/06/2014 Filing Date (87) International Publication :WO 2014/206563 No (61) Patent of Addition to :NA Application Number :NA Filing Date (62) Divisional to :NA Application Number :NA Filing Date (57) Abstract : The present invention refers to the use of protein kinase inhibitors and more specifically to the use of inhibitors of the protein kinase c Jun amino terminal kinase JNK inhibitor sequences chimeric peptides or of nucleic acids encoding same as well as pharmaceutical compositions containing same for the treatment of various diseases or disorders strongly related to JNK signaling. No. of Pages : 351 No. of Claims : 31 The Patent Office Journal 18/12/2015 65770 (12) PATENT APPLICATION PUBLICATION (21) Application No.1659/DEL/2012 A (19) INDIA (22) Date of filing of Application :31/05/2012 (43) Publication Date : 18/12/2015 (54) Title of the invention : SELF OVER SPEED CONTROLLER. (51) International classification :F16B (71)Name of Applicant : (31) Priority Document No :NA 1)SARFRAJ ALI (32) Priority Date :NA Address of Applicant :VILLAGE DHAKI, PO(33) Name of priority country :NA MUSTAFABAD, DISTT. BIJNOR, U.P. PIN-246734 Uttar (86) International Application No :NA Pradesh India Filing Date :NA (72)Name of Inventor : (87) International Publication No : NA 1)SARFRAJ ALI (61) Patent of Addition to Application Number :NA Filing Date :NA (62) Divisional to Application Number :NA Filing Date :NA (57) Abstract : -sfe«&<fl -i) <5r icvAA-«Hd #rn R SvrsSl 3Forr%| a &£\&,\ tv3337o£u<£\<iSt ci \8\QI 3 d<£W ftut £& \Q\iJVXrr 2rr H<cft\cL « < c-/ R aW fe £2T 3TVT S> &f\& £\&r zx\ trfeT r onyMchcf | ! dh> 1 i Vll 4_ No. of Pages : 6 No. of Claims : 5 The Patent Office Journal 18/12/2015 65771 (12) PATENT APPLICATION PUBLICATION (21) Application No.5086/DELNP/2015 A (19) INDIA (22) Date of filing of Application :11/06/2015 (43) Publication Date : 18/12/2015 (54) Title of the invention : USING MIXTURES OF E/Z ISOMERS TO OBTAIN QUANTITATIVELY SPECIFIC PRODUCTS BY COMBINED ASYMMETRIC HYDROGENATIONS (51) International (71)Name of Applicant : :C07C45/62,C07C45/82,C07C49/203 classification 1)DSM IP ASSETS B.V. (31) Priority Document No :12197850.6 Address of Applicant :Het Overloon 1, NL- 6411 Te Heerlen (32) Priority Date :18/12/2012 Netherlands (33) Name of priority (72)Name of Inventor : :EPO country 1)BONRATH ,Werner (86) International 2)MEDLOCK ,Jonathan Alan :PCT/EP2013/077245 Application No 3)STEMMLER, Ren Tobias :18/12/2013 Filing Date 4)VERZIJL, Gerardus Karel Maria (87) International 5)VRIES ,DE, Andreas Hendrikus Maria :WO 2014/096106 Publication No 6)NETSCHER ,Thomas (61) Patent of Addition to :NA Application Number :NA Filing Date (62) Divisional to :NA Application Number :NA Filing Date (57) Abstract : The present invention relates to a process of manufacturing compound having stereogenic centres from a mixture of E/Z isomers of unsaturated compounds having prochiral double bonds. The hydrogenation product has a specific desired configuration at the stereogenic centres. The process involves two asymmetric hydrogenation steps. The process is very advantageous in that it forms the desired chiral product from a mixture of stereoisomers of the starting product in an efficient way. No. of Pages : 79 No. of Claims : 15 The Patent Office Journal 18/12/2015 65772 (12) PATENT APPLICATION PUBLICATION (21) Application No.5087/DELNP/2015 A (19) INDIA (22) Date of filing of Application :11/06/2015 (43) Publication Date : 18/12/2015 (54) Title of the invention : BIOABSORBABLE POLYMERIC COMPOSITION FOR A MEDICAL DEVICE (51) International classification :A61L27/26, (71)Name of Applicant : (31) Priority Document No :60/807,932 1)ORBUSNEICH MEDICAL, INC. (32) Priority Date :20/07/2006 Address of Applicant :5363 NW 35th Avenue, Fort (33) Name of priority country :U.S.A. Lauderdale, FL 33309, United States of America U.S.A. (86) International Application No :PCT/US2007/074054 (72)Name of Inventor : Filing Date :20/07/2007 1)THATCHER, G., Lawrence (87) International Publication No : NA 2)COTTONE, Robert, J. (61) Patent of Addition to Application :NA Number :NA Filing Date (62) Divisional to Application Number :410/DELNP/2009 Filed on :19/01/2009 (57) Abstract : A biodegradable and biocompatible nontoxic polymeric composition is provided which includes a base material such as a crystallizable polymer, copolymer, or terpolymer, and a copolymer or terpolymer additive. Medical devices manufactured from the composition are also provided. No. of Pages : 33 No. of Claims : 28 The Patent Office Journal 18/12/2015 65773 (12) PATENT APPLICATION PUBLICATION (21) Application No.5088/DELNP/2015 A (19) INDIA (22) Date of filing of Application :11/06/2015 (43) Publication Date : 18/12/2015 (54) Title of the invention : METHODS AND COMPOSITIONS FOR TREATING NEURODEGENERATIVE DISEASES (51) International (71)Name of Applicant : :A61K31/12,A61K31/122,A61P25/28 classification 1)GOLDEN BIOTECHNOLOGY CORPORATION (31) Priority Document No :61/729295 Address of Applicant :101 Hudson Street, Suite 2100, Jersey (32) Priority Date :21/11/2012 City ,NJ 07301 U.S.A. (33) Name of priority (72)Name of Inventor : :U.S.A. country 1)LIU, Sheng- yung (86) International 2)WEN ,Wu -Che :PCT/US2013/070625 Application No 3)CHEN ,Chih- Ming :18/11/2013 Filing Date (87) International :WO 2014/081675 Publication No (61) Patent of Addition to :NA Application Number :NA Filing Date (62) Divisional to :NA Application Number :NA Filing Date (57) Abstract : The present invention provides methods and compositions for treating neurodegenerative diseases by cyclohexenone compounds. No. of Pages : 49 No. of Claims : 21 The Patent Office Journal 18/12/2015 65774 (12) PATENT APPLICATION PUBLICATION (21) Application No.5089/DELNP/2015 A (19) INDIA (22) Date of filing of Application :11/06/2015 (43) Publication Date : 18/12/2015 (54) Title of the invention : PYRIMIDINE- 2 ,4 -DIAMINE DERIVATIVES FOR TREATMENT OF CANCER (51) International (71)Name of Applicant : :C07D403/04,A61K31/505,A61K31/506 classification 1)THOMAS HELLEDAYS STIFTELSE F–R MEDICINSK (31) Priority Document FORSKNING :12513321 No Address of Applicant :Kungsvgen 17, S -182 79 Stocksund (32) Priority Date :27/11/2012 Sweden (33) Name of priority (72)Name of Inventor : :Sweden country 1)SCOBIE ,Martin (86) International 2)HELLEDAY, Thomas :PCT/SE2013/051387 Application No 3)KOOLMEISTER, Tobias :26/11/2013 Filing Date 4)JACQUES, Sylvain (87) International 5)DESROSES ,Matthieu :WO 2014/084778 Publication No 6)JACQUES -CORDONNIER, Marie -Caroline (61) Patent of Addition to :NA Application Number :NA Filing Date (62) Divisional to :NA Application Number :NA Filing Date (57) Abstract : A compound of formula (I) or a pharmaceutically acceptable salt thereof. The compound is useful in the treatment of cancer or other diseases that may benefit from inhibition of MTH1. No. of Pages : 298 No. of Claims : 54 The Patent Office Journal 18/12/2015 65775 (12) PATENT APPLICATION PUBLICATION (21) Application No.5670/DELNP/2012 A (19) INDIA (22) Date of filing of Application :25/06/2012 (43) Publication Date : 18/12/2015 (54) Title of the invention : SYSTEM FOR CONVERTING THERMAL ENERGY TO MECHANICAL ENERGY IN A VEHICLE (51) International classification :F02G5/02,F01N5/02,F01P9/04 (71)Name of Applicant : (31) Priority Document No :11501699 1)SCANIA CV AB (32) Priority Date :25/02/2011 Address of Applicant :S 151 87 Sdertlje Sweden (33) Name of priority country :Sweden (72)Name of Inventor : (86) International Application No :PCT/SE2012/050164 1)KARDOS Zoltan Filing Date :16/02/2012 2)JAHNS Dieter (87) International Publication No :WO 2012/115572 (61) Patent of Addition to :NA Application Number :NA Filing Date (62) Divisional to Application :NA Number :NA Filing Date (57) Abstract : The present invention relates to a system for converting thermal energy to mechanical energy in a vehicle. The system comprises a line circuit (35) a pump (36) for recirculating a medium in the line circuit at least one evaporator (31 32 38) in which the medium is caused to absorb thermal energy from a heat source (4 28) so that it becomes vaporised a turbine (39) adapted to being driven by the vaporised medium in order to generate mechanical energy and a condenser arrangement (24 42) in which the medium is caused to give off thermal energy so that it condenses. The condenser arrangement comprises a first condenser (24) in which the medium gives off thermal energy to coolant which circulates in said cooling circuit and a second condenser (42) which is situated downstream of the first condenser (24) with respect to the medium s direction of flow in the line circuit (35) and in which the medium gives off thermal energy to air at the temperature of the surroundings. No. of Pages : 19 No. of Claims : 16 The Patent Office Journal 18/12/2015 65776 (12) PATENT APPLICATION PUBLICATION (21) Application No.7003/DELNP/2015 A (19) INDIA (22) Date of filing of Application :10/08/2015 (43) Publication Date : 18/12/2015 (54) Title of the invention : BIODEGRADABLE SYNTHETIC POLYMER MATERIAL (51) International classification :C08K5/00,C08L27/06 (71)Name of Applicant : (31) Priority Document No :MI2013A000004 1)QUEENSBROOK LIMITED (32) Priority Date :10/01/2013 Address of Applicant :7th Floor Hume House Ballsbridge (33) Name of priority country :Italy Dublin 4 Ireland (86) International Application No :PCT/IB2014/058097 (72)Name of Inventor : Filing Date :07/01/2014 1)CATINARI Madrisano (87) International Publication No :WO 2014/108828 (61) Patent of Addition to Application :NA Number :NA Filing Date (62) Divisional to Application Number :NA Filing Date :NA (57) Abstract : A biodegradable synthetic polymer material obtained synthetically and to which sucrose has been added is disclosed. A process for the preparation of a biodegradable synthetic polymer material is also disclosed which provides the steps of: a) causing the starting monomers to polymerise under the usual conditions of macromolecule organic chemistry until reaching the desired molecular weight; b) mixing the polymer obtained and the sugar in the desired proportions; c) proceeding to the usual subsequent processing. No. of Pages : 14 No. of Claims : 11 The Patent Office Journal 18/12/2015 65777 (12) PATENT APPLICATION PUBLICATION (21) Application No.6990/DELNP/2015 A (19) INDIA (22) Date of filing of Application :07/08/2015 (43) Publication Date : 18/12/2015 (54) Title of the invention : TYRE INNERLINER COMPOUND (51) International classification :C08K3/04,B60C1/00,C08K3/34 (71)Name of Applicant : (31) Priority Document No :RM2013A000074 1)BRIDGESTONE CORPORATION (32) Priority Date :11/02/2013 Address of Applicant :1 1 Kyobashi 3 Chome Chuo Ku Tokyo (33) Name of priority country :Italy 104 8340 Japan (86) International Application No :PCT/IB2014/058923 (72)Name of Inventor : Filing Date :11/02/2014 1)FORTE Gianluca (87) International Publication No :WO 2014/122636 (61) Patent of Addition to :NA Application Number :NA Filing Date (62) Divisional to Application :NA Number :NA Filing Date (57) Abstract : A tyre innerliner compound having a polymer base composed at least partly of butyl rubber and/or halobutyl rubber; a filler system; and a curing system. The filler system has 60 to 80 phr of a silicon based lamellar mineral filler; and 8 to 30 phr of a carbon black mixture composed of a first carbon black with a nitrogen absorption measured surface area of 21 to 39 m/g and a second carbon black with a nitrogen absorption measured surface area of 70 to 120 m/g. No. of Pages : 10 No. of Claims : 6 The Patent Office Journal 18/12/2015 65778 (12) PATENT APPLICATION PUBLICATION (21) Application No.6991/DELNP/2015 A (19) INDIA (22) Date of filing of Application :07/08/2015 (43) Publication Date : 18/12/2015 (54) Title of the invention : MOTOR FOR VEHICLE AND RAILWAY VEHICLE (51) International classification :H02K5/20,H02K9/06 (71)Name of Applicant : (31) Priority Document No :2013135502 1)KABUSHIKI KAISHA TOSHIBA (32) Priority Date :27/06/2013 Address of Applicant :1 1 Shibaura 1 chome Minato ku Tokyo (33) Name of priority country :Japan 1058001 Japan (86) International Application No :PCT/JP2014/000271 (72)Name of Inventor : Filing Date :21/01/2014 1)NAGAYAMA Takashi (87) International Publication No :WO 2014/207966 2)ONUMA Aki (61) Patent of Addition to Application :NA Number :NA Filing Date (62) Divisional to Application Number :NA Filing Date :NA (57) Abstract : According to one embodiment a motor for a vehicle includes a casing accommodating a rotor iron core and a stator iron core inside thereof and supporting each of both axial ends of the rotor shaft via a bearing such that the rotor shaft is rotatable an air inlet port formed in a portion of the casing outside the bearing in the radial direction and a fan provided between the rotor iron core and the bearing and rotating with the rotor shaft to introduce outside air through the air inlet port wherein a portion of the casing positioned outside impellers of the fan in the axial direction forms a first housing and a second housing constituting a discharge channel through which the outside air is discharged and the first housing includes a guide wall extending toward the outside in the radial direction and the second housing includes a thinned wall portion located inside the guide wall in the axial direction to constitute the discharge channel between the thin wall portion and the guide wall. No. of Pages : 45 No. of Claims : 12 The Patent Office Journal 18/12/2015 65779 (12) PATENT APPLICATION PUBLICATION (21) Application No.6992/DELNP/2015 A (19) INDIA (22) Date of filing of Application :07/08/2015 (43) Publication Date : 18/12/2015 (54) Title of the invention : SYSTEMS AND METHODS FOR INDENTIFYING DOCUMENTS BASED ON CITATION HISTORY (51) International classification :G06F17/30 (71)Name of Applicant : (31) Priority Document No :13/755874 1)LEXISNEXIS A DIVISION OF REED ELSEVIER INC. (32) Priority Date :31/01/2013 Address of Applicant :9443 Springboro Pike Miamisburg OH (33) Name of priority country :U.S.A. 45342 U.S.A. (86) International Application No :PCT/US2014/013516 (72)Name of Inventor : Filing Date :29/01/2014 1)ZHANG Paul (87) International Publication No :WO 2014/120720 2)SILVER Harry R. (61) Patent of Addition to Application :NA Number :NA Filing Date (62) Divisional to Application Number :NA Filing Date :NA (57) Abstract : Systems methods and computer executable instructions described herein generally relate to increasing user productivity in reviewing query results by surfacing a set of documents ranked by their relative value calculated as a tabulation of how often they are cited for a specific purpose. A database management system can access an index of metadata corresponding to a set of content items in a corpus/corpora of electronically stored content. A sub system is configured to receive a query request entered by a user in said interactive GUI. A computer machine is configured to receive said query as computer machine input; automatically determine at least one concept contained within said query; automatically normalize said at least one concept contained within said query thus creating at least one normalized concept; automatically compare said at least one normalized concept to a set of metadata comprising at least one document centric concept profile associated with said set of content items in said corpora; and automatically surface a set of documents comprising at least one first document matching said document centric concept profile via said GUI wherein said set of documents are ranked according to a reference value assigned to each document for a normalized concept. No. of Pages : 33 No. of Claims : 20 The Patent Office Journal 18/12/2015 65780 (12) PATENT APPLICATION PUBLICATION (21) Application No.6993/DELNP/2015 A (19) INDIA (22) Date of filing of Application :07/08/2015 (43) Publication Date : 18/12/2015 (54) Title of the invention : POLYCYCLIC SUBSTITUTED PYRAZOLE KINASE ACTIVITY INHIBITORS AND USE THEREOF (51) International (71)Name of Applicant : :C07D495/04,C07D487/04,C07D491/048 classification 1)CHINA PHARMACEUTICAL UNIVERSITY (31) Priority Document Address of Applicant :No.639 Longmian Avenue Jiangning :201310005258.6 No Nanjing Jiangsu 211169 China (32) Priority Date :08/01/2013 (72)Name of Inventor : (33) Name of priority 1)LU Tao :China country 2)WANG Yue (86) International 3)CHEN Yadong :PCT/CN2014/070195 Application No 4)LU Yi :07/01/2014 Filing Date 5)WANG Zhanwei (87) International 6)JIN Qiaomei :WO 2014/108053 Publication No 7)YANG Taotao (61) Patent of Addition 8)LIN Guowu :NA to Application Number 9)GUO Qinglong :NA Filing Date 10)ZHAO Li (62) Divisional to :NA Application Number :NA Filing Date (57) Abstract : The present invention relates to the field of medicinal chemistry and in particular relates to 4 (five membered heterocyclic pyrimidine/pyridine substituted) amino 1H 3 pyrazolecarboxamide derivatives the preparation method thereof pharmaceutical compositions containing these compounds and the medicinal use thereof especially as protein kinase inhibitors for anti tumour use. No. of Pages : 73 No. of Claims : 16 The Patent Office Journal 18/12/2015 65781 (12) PATENT APPLICATION PUBLICATION (21) Application No.5055/DELNP/2015 A (19) INDIA (22) Date of filing of Application :11/06/2015 (43) Publication Date : 18/12/2015 (54) Title of the invention : METHODS FOR HIGH THROUGHPUT RECEPTOR:LIGAND IDENTIFICATION (51) International classification :C40B30/06 (71)Name of Applicant : (31) Priority Document No :61/735791 1)ALBERT EINSTEIN COLLEGE OF MEDICINE OF (32) Priority Date :11/12/2012 YESHIVA UNIVERSITY (33) Name of priority country :U.S.A. Address of Applicant :1300 Morris Park Avenue, Bronx, NY (86) International Application No :PCT/US2013/073275 10461 U.S.A. Filing Date :05/12/2013 (72)Name of Inventor : (87) International Publication No :WO 2014/093118 1)ALMO ,Steven ,C. (61) Patent of Addition to Application 2)SEIDEL ,Ronald D. ,III :NA Number 3)HILLERICH ,Brandan, S. :NA Filing Date 4)GARRETT -THOMSON, Sarah, C. (62) Divisional to Application Number :NA 5)LOVE ,James, D. Filing Date :NA (57) Abstract : Methods and systems for high- throughput Identification of receptor: ligand interactions are provided. Throughout this application various publications are referred to in parentheses. Full citations for these references may be found at the end of the specification. The disclosures of these publications, and all patents , patent application publications and books referred to herein, are hereby incorporated by reference in their entirety into the subject application to more fully describe the art to which the subject invention pertains. No. of Pages : 94 No. of Claims : 106 The Patent Office Journal 18/12/2015 65782 (12) PATENT APPLICATION PUBLICATION (21) Application No.5786/DELNP/2012 A (19) INDIA (22) Date of filing of Application :28/06/2012 (43) Publication Date : 18/12/2015 (54) Title of the invention : METHOD FOR AND USE OF DIGITAL HOLOGRAPHIC MICROSCOPY AND IMAGING ON LABELLED CELL SAMPLES (51) International (71)Name of Applicant : :G03H1/04,G01N21/21,G01N21/31 classification 1)PHASE HOLOGRAPHIC IMAGING PHI AB (31) Priority Document No :61/302,867 Address of Applicant :Scheelevgen 22 S 223 63 Lund Sweden (32) Priority Date :09/02/2010 (72)Name of Inventor : (33) Name of priority country :U.S.A. 1)SEBESTA Mikael (86) International Application 2)ALM Kersti :PCT/SE2011/050139 No 3)L…NGBERG Anders :07/02/2011 Filing Date 4)M–LDER Anna (87) International Publication 5)PERSSON Johan :WO 2011/099925 No 6)GISSELSSON Lennart (61) Patent of Addition to :NA Application Number :NA Filing Date (62) Divisional to Application :NA Number :NA Filing Date (57) Abstract : The present invention relates to use of a digital holographic microscopy and imaging setup and a method of digital holographic microscopy and imaging for detecting molecules or structures stained or labelled to at least one cell or conjugated to antibodies which are bound either directly to said at least one cell or indirectly via another or several antibodies in a chain bound to said at least one cell. No. of Pages : 20 No. of Claims : 17 The Patent Office Journal 18/12/2015 65783 (12) PATENT APPLICATION PUBLICATION (21) Application No.5788/DELNP/2012 A (19) INDIA (22) Date of filing of Application :28/06/2012 (43) Publication Date : 18/12/2015 (54) Title of the invention : NOVEL 3´ DEOXY 3´ METHYLIDENE L NUCLEOSIDES (51) International (71)Name of Applicant : :C07H19/06,A61K31/7068,A61K31/7072 classification 1)NOVADEX PHARMACEUTICALS AB (31) Priority Document Address of Applicant :Alfred Nobels All 10 Se-141 52 :09509753 No Huddinge Sweden (32) Priority Date :17/12/2009 (72)Name of Inventor : (33) Name of priority 1)ZHOU Xiao Xiong :Sweden country 2)TORSSELL Staffan (86) International 3)WALLNER Olov :PCT/SE2010/051374 Application No 4)SUN Piaoyang :14/12/2010 Filing Date (87) International :WO 2011/075052 Publication No (61) Patent of Addition :NA to Application Number :NA Filing Date (62) Divisional to :NA Application Number :NA Filing Date (57) Abstract : The present invention includes novel 3´ deoxy 3´ methylidene L nucleosides pharmaceutical composition comprising such compounds as well as the methods to treat or to prevent viral infections and in particular HBV and/or HIV infections. In accordance with the present invention there are provided compounds represented by Formula (I) wherein B is selected from A1 and A2; No. of Pages : 78 No. of Claims : 42 The Patent Office Journal 18/12/2015 65784 (12) PATENT APPLICATION PUBLICATION (21) Application No.5789/DELNP/2012 A (19) INDIA (22) Date of filing of Application :28/06/2012 (43) Publication Date : 18/12/2015 (54) Title of the invention : COMBINATION THERAPY FOR TREATING CANCER AND DIAGNOSTIC ASSAYS FOR USE THEREIN (51) International (71)Name of Applicant : :A61K31/454,A61K31/506,A61K31/5377 classification 1)ABBOTT LABORATORIES (31) Priority Document Address of Applicant :100 Abbott Park Road Abbott Park :12/630957 No Illinois 60064 U.S.A. (32) Priority Date :04/12/2009 (72)Name of Inventor : (33) Name of priority 1)SHAH Omar Jameel :U.S.A. country 2)SHEN Yu (86) International 3)LIN Xiaoya :PCT/US2010/058549 Application No 4)ANDERSON Mark :01/12/2010 Filing Date 5)HUANG Xiaoli (87) International 6)LI Junling :WO 2011/068863 Publication No 7)LI Leiming (61) Patent of Addition :NA to Application Number :NA Filing Date (62) Divisional to :NA Application Number :NA Filing Date (57) Abstract : The present disclosure relates to a combination of therapeutic agents for use in treating a patient suffering from cancer wherein said combination comprises at least one polyploidy inducing agent and at least one Bel 2 family protein inhibitor. In addition the present disclosure also relates to diagnostic assays useful in classification of patients for treatment with one or more therapeutic agents. No. of Pages : 172 No. of Claims : 52 The Patent Office Journal 18/12/2015 65785 (12) PATENT APPLICATION PUBLICATION (21) Application No.7000/DELNP/2015 A (19) INDIA (22) Date of filing of Application :07/08/2015 (43) Publication Date : 18/12/2015 (54) Title of the invention : ASSEMBLY COMPRISING A PUMP ELEMENT AND A FASTENING FLANGE (51) International (71)Name of Applicant : :F04B1/04,F02M59/02,F02M59/10 classification 1)ROBERT BOSCH GMBH (31) Priority Document No :102013202569.6 Address of Applicant :Postfach 30 02 20 70442 Stuttgart (32) Priority Date :18/02/2013 Germany (33) Name of priority country :Germany (72)Name of Inventor : (86) International Application 1)KIEL Waldemar :PCT/EP2013/078046 No 2)LALIC Hrvoje :27/12/2013 Filing Date (87) International Publication :WO 2014/124720 No (61) Patent of Addition to :NA Application Number :NA Filing Date (62) Divisional to Application :NA Number :NA Filing Date (57) Abstract : The invention relates to an assembly (10) comprising a pump element (11) and a fastening flange (12) for installation in a housing. According to the invention the pump element (11) and the fastening flange (12) of the assembly (10) are separate from each other. The flange (12) has a central passage opening (50) which surrounds a head region (21) of the pump element (11) in the assembled state of the assembly (10) and also at least two retaining tabs (37) for fastening means fastened to the housing (22) which retaining tabs are symmetrically opposite each other with respect to the central passage opening (50). The pump element (11) has a spring (34) which acts on a ledge (35) formed on a lower region of the pump element (11) at one end and is designed to be supported on a stop within the opening of the housing (22) at the other end. The pump element (11) is accommodated and anchored in an opening of the housing (22) by means of either a flat or a curved profile of the fastening flange (12). No. of Pages : 14 No. of Claims : 9 The Patent Office Journal 18/12/2015 65786 (12) PATENT APPLICATION PUBLICATION (21) Application No.1620/DEL/2014 A (19) INDIA (22) Date of filing of Application :16/06/2014 (43) Publication Date : 18/12/2015 (54) Title of the invention : SYNCHRONIZING BROADCAST TIMELINE METADATA (51) International classification :H04N5/76 (71)Name of Applicant : (31) Priority Document No :NA 1)Cisco Technology, Inc. (32) Priority Date :NA Address of Applicant :170 West Tasman Drive, San Jose, CA (33) Name of priority country :NA 95134-1706, USA U.S.A. (86) International Application No :NA (72)Name of Inventor : Filing Date :NA 1)Laurent BERTRAND (87) International Publication No : NA 2)Sanjeev MAHEVE (61) Patent of Addition to Application Number :NA 3)Reuven WACHTFOGEL Filing Date :NA (62) Divisional to Application Number :NA Filing Date :NA (57) Abstract : In one embodiment, a first content item having synchronization information, the first content item being a first instance of a reference content item, a candidate content item, which is a second instance of the reference content item, having synchronization information, a synchronizing processor which determines a synchronization point between the first content item and the candidate content item, on the basis of matching the synchronizing formation the first content item and timeline candidate content item, a timeline metadata transmitter, which transmits stored timeline metadata to a device on which the first content iten1 is playing, the transmission of the stored timeline metadata beginning fro11i the synchronization point, wherein the stored timeline metadata includes timeline metadata that has been previously aggregated from earlier broadcasts of instances of the reference content item. Related systems, apparatus, and methods are also described. No. of Pages : 23 No. of Claims : 20 The Patent Office Journal 18/12/2015 65787 (12) PATENT APPLICATION PUBLICATION (21) Application No.2538/DEL/2010 A (19) INDIA (22) Date of filing of Application :25/10/2010 (43) Publication Date : 18/12/2015 (54) Title of the invention : PROCESS FOR SYNTHESIS OF BEADED CROSSLINKED POLYMERS WATER-IN-OIL-INWATER EMULSIONS AND POST FUNCTIONALIZATION (51) International classification (31) Priority Document No (32) Priority Date (33) Name of priority country (86) International Application No Filing Date (87) International Publication No (61) Patent of Addition to Application Number Filing Date (62) Divisional to Application Number Filing Date (71)Name of Applicant : 1)DIRECTOR GENERAL, DEFENCE RESEARCH & DEVELOPMENT ORGANISATION Address of Applicant :MINISTRY OF DEFENCE, GOVT OF INDIA, ROOM NO 348, B - WING, DRDO BHAWAN, RAJAJI MARG, NEW DELHI 110 105 Delhi India (72)Name of Inventor : 1)DWIVEDI MAYANK 2)LOCANINDI HARI SARVOTHAMA RAO 3)SRINIVASULU REDDY KRISHNA MOHAN :C08J9/00, 4)JANAKIRAMAN DHANASEKHARAN C02F1/56 5)BEVARA MADHUSUDANA RAO :NA 6)SRIPERAMBUDUR RAJESH KUMAR :NA 7)SURENDRA PONRATHNAM :NA 8)CHELANATTUKIZHAKKEMADATH RAMAN RAJAN :NA 9)RAJIV KUMAR TAYAL :NA 10)QURESHI MOHAMMED SHADBAR :NA 11)CHAVAN NAYAKU NIVRATI :NA 12)DEOKAR SARIKA BABASAHEB :NA 13)MULANI KHUDBUDIN BABAN :NA 14)GHORPADE RAVINDRA VASANT :NA 15)BHONGALE SUNIL SITARAM 16)NALAWADE ARCHANA CHETAN 17)SONTAKKE KALPANA VISHWANATHRAO 18)BHOSLE SONALI MADHAVRAO 19)MULE SMITA ATMARAM 20)DHOBLE DEEPA ARUN 21)JOHN ARULDOSS 22)SHAIKH WASIF ABDUL LATEEF 23)HARIKRISHNA REGHUNATHAN 24)PUNITHARASU VELLIMALAI 25)MOMIN MOHASIN SHAMSHUDDIN (57) Abstract : The present invention provides a process for the synthesis of ethyl silicate with varying silica concentration, by hydrolysing ethyl silicate in varying water concentration in the presence of sulfonated catalysts having a styrene-divinyl benzene backbone. The present invention further relates to the preparation of beaded crosslinked polymers containing sulfonic acid moieties having an interconnected pore structure and surface area up to 400 m2/g. No. of Pages : 28 No. of Claims : 14 The Patent Office Journal 18/12/2015 65788 (12) PATENT APPLICATION PUBLICATION (21) Application No.5692/DELNP/2012 A (19) INDIA (22) Date of filing of Application :26/06/2012 (43) Publication Date : 18/12/2015 (54) Title of the invention : DAMPENING DEVICE FOR ENDOSCOPIC SURGICAL STAPLER (51) International (71)Name of Applicant : :A61B17/068,A61B17/072,A61B17/28 classification 1)ETHICON ENDO SURGERY INC. (31) Priority Document No :12/650334 Address of Applicant :4545 Creek Road Cincinnati OH 45242 (32) Priority Date :30/12/2009 U.S.A. (33) Name of priority (72)Name of Inventor : :U.S.A. country 1)BOUDREAUX Chad P. (86) International :PCT/US2010/059143 Application No :06/12/2010 Filing Date (87) International :WO 2011/081791 Publication No (61) Patent of Addition to :NA Application Number :NA Filing Date (62) Divisional to :NA Application Number :NA Filing Date (57) Abstract : A surgical instrument including a shaft and an end effector. The end effector may comprise a first jaw and a second jaw. The first jaw may be movable relative to the second jaw between an open configuration and a closed configuration. The surgical instrument may comprise a closure assembly which may be operably engaged with the first jaw. The closure assembly may comprise a closure trigger and a dampening system. The closure trigger may be configured to be actuated from a first position to a second position to close the first jaw. The dampening system may be configured to retard the opening of the closure trigger. The dampening system may comprise an aperture configured to receive the projection at a first end of the aperture and a seal configured to form a fluid seal between said projection and said aperture sidewall. No. of Pages : 129 No. of Claims : 20 The Patent Office Journal 18/12/2015 65789 (12) PATENT APPLICATION PUBLICATION (21) Application No.7018/DELNP/2015 A (19) INDIA (22) Date of filing of Application :10/08/2015 (43) Publication Date : 18/12/2015 (54) Title of the invention : CATALYTIC CONVERTER (51) International classification :B01J23/58,B01D53/94,F01N3/10 (71)Name of Applicant : (31) Priority Document No :2013025698 1)TOYOTA JIDOSHA KABUSHIKI KAISHA (32) Priority Date :13/02/2013 Address of Applicant :1 Toyota cho Toyota shi Aichi 4718571 (33) Name of priority country :Japan Japan (86) International Application (72)Name of Inventor : :PCT/JP2013/084081 No 1)AOKI Yuki :19/12/2013 Filing Date (87) International Publication :WO 2014/125734 No (61) Patent of Addition to :NA Application Number :NA Filing Date (62) Divisional to Application :NA Number :NA Filing Date (57) Abstract : Provided is a catalytic converter which achieves excellent NOx purification performance with a reducing amount of noble metal catalyst. This catalytic converter (10) is configured from a cell structure substrate (1) over which the exhaust gas circulates and a catalyst layer (3) formed on the surface of cell walls (2) of the substrate (1). The catalyst layer (3) is configured from a first catalyst layer (4) arranged upstream in the flow direction of the exhaust gas on the substrate (1) and a second catalyst layer (5) arranged downstream in the flow direction of the exhaust gas on the substrate (1). The first catalyst layer (4) is formed from a carrier and rhodium which is the noble metal catalyst supported on said carrier and the second catalyst layer (5) is formed from a carrier and palladium or platinum which is the noble metal catalyst supported on said carrier. The first catalyst layer (4) is formed within a range with the upstream end of the substrate (1) as the starting point and extending to 80 100% of the total length of the substrate and the second catalyst layer (5) is formed within a range with the downstream end of the substrate (1) as the starting point and extending to 20 50% of the total length of the substrate. No. of Pages : 26 No. of Claims : 2 The Patent Office Journal 18/12/2015 65790 (12) PATENT APPLICATION PUBLICATION (21) Application No.7012/DELNP/2015 A (19) INDIA (22) Date of filing of Application :10/08/2015 (43) Publication Date : 18/12/2015 (54) Title of the invention : SOLID WIRE FOR GAS SHIELDED ARC WELDING GAS SHIELDED ARC WELDING METAL WELDING JOINT WELDING MEMBER WELDING METHOD AND METHOD FOR MANUFACTURING WELDING JOINT (51) International (71)Name of Applicant : :B23K35/30,C22C38/00,C22C38/14 classification 1)NIPPON STEEL & SUMITOMO METAL (31) Priority Document No :2013027411 CORPORATION (32) Priority Date :15/02/2013 Address of Applicant :6 1 Marunouchi 2 chome Chiyoda ku (33) Name of priority country :Japan Tokyo 1008071 Japan (86) International Application (72)Name of Inventor : :PCT/JP2014/053668 No 1)ZENIYA Tasuku :17/02/2014 Filing Date 2)KODAMA Shinji (87) International Publication 3)TSUCHIYA Shoko :WO 2014/126246 No 4)NAITO Yasuaki (61) Patent of Addition to :NA Application Number :NA Filing Date (62) Divisional to Application :NA Number :NA Filing Date (57) Abstract : The present invention comprises a solid wire for gas shielded arc welding which contains by mass% relative to the total mass of the wire including plating C: 0.03 0.15% Si: 0.2 0.5% Mn: 0.3 0.8% P: 0.02% or less S: 0.02% or less Al: 0.1 0.3% Ti: 0.001 0.2% Cu: 0 0.5% Cr: 0 2.5% Nb: 0 1.0% V: 0 1.0%. The remainder thereof comprises Fe and impurities and value X of formula (I) is by mass% within the range of 1.5 3.5%. Furthermore the present invention comprises a welding metal wherein value X of formula (I) is within the range of 1.0 4.0%. Furthermore the present invention comprises a welding joint a welding member a welding method and a method for manufacturing the welding joint which use the solid wire or the welding metal. Formula (I): X=2—[Si]+[Mn]+3— [Ti]+5—[Al] No. of Pages : 53 No. of Claims : 9 The Patent Office Journal 18/12/2015 65791 (12) PATENT APPLICATION PUBLICATION (21) Application No.7013/DELNP/2015 A (19) INDIA (22) Date of filing of Application :10/08/2015 (43) Publication Date : 18/12/2015 (54) Title of the invention : CONTINUOUS CASTING FACILITY (51) International classification :B22D11/128 (71)Name of Applicant : (31) Priority Document No :2013096809 1)NIPPON STEEL & SUMITOMO METAL (32) Priority Date :02/05/2013 CORPORATION (33) Name of priority country :Japan Address of Applicant :6 1 Marunouchi 2 chome Chiyoda ku (86) International Application No :PCT/JP2014/061845 Tokyo 1008071 Japan Filing Date :28/04/2014 (72)Name of Inventor : (87) International Publication No :WO 2014/178369 1)IMAI Shuntaro (61) Patent of Addition to Application 2)MARUKI Yasuo :NA Number 3)MIKI Daisuke :NA Filing Date 4)UCHIYAMA Hiroaki (62) Divisional to Application Number :NA Filing Date :NA (57) Abstract : A continuous casting facility provided with: a cast slab rolling reduction device for performing rolling reduction on a cast slab the cast slab rolling reduction device having a pair of cast slab rolling reduction rolls for clamping and pressing a cast slab; and a cast slab drawing device for drawing the cast slab using a pair of cast slab drawing rolls that clamp the cast slab the cast slab drawing device being disposed on the subsequent stage side of the cast slab rolling reduction device; wherein at least one of the cast slab rolling reduction rolls is provided in the axial center section with a large diameter part protruding radially outward for pressing the width direction center section of the cast slab; the cast slab subjected to rolling reduction by the cast slab rolling reduction device has formed thereon a recess corresponding to the large diameter part; at least one of the cast slab drawing rolls of the cast slab drawing device is driven by a driving mechanism and provided with a recess support part which comes into contact with and supports the recess; and the axial length (L) of the recess support part is within the range of 0.5 — L = L < L in relation to the axial length (L) of the large diameter part of the cast slab rolling reduction roll. No. of Pages : 29 No. of Claims : 2 The Patent Office Journal 18/12/2015 65792 (12) PATENT APPLICATION PUBLICATION (21) Application No.7014/DELNP/2015 A (19) INDIA (22) Date of filing of Application :10/08/2015 (43) Publication Date : 18/12/2015 (54) Title of the invention : ABNORMALITY DIAGNOSIS DEVICE FOR INTERNAL COMBUSTION ENGINE (51) International (71)Name of Applicant : :F02D45/00,F02D19/06,F02D41/22 classification 1)DENSO CORPORATION (31) Priority Document No :2013043373 Address of Applicant :1 1 Showa cho Kariya city Aichi (32) Priority Date :05/03/2013 4488661 Japan (33) Name of priority country :Japan (72)Name of Inventor : (86) International Application 1)FUKUTA Keisuke :PCT/JP2014/000821 No 2)WAKAHARA Keiji :18/02/2014 Filing Date 3)NONOYAMA Kazutaka (87) International Publication 4)MUKAI Yasuo :WO 2014/136387 No 5)WADA Minoru (61) Patent of Addition to 6)TAKEMURA Yuichi :NA Application Number :NA Filing Date (62) Divisional to Application :NA Number :NA Filing Date (57) Abstract : A control unit (80) executes a first determination process for determining whether the combustion state of an engine (10) is normal or abnormal during a period in which the engine (10) is operated on the basis of one fuel said determination being made on the basis of the combustion parameters for that period. After the combustion state has been determined by the first determination process the fuel being used is switched from the one fuel to another fuel and a second determination process is executed for determining whether the combustion state of the engine (10) is normal or abnormal during a period in which the engine (10) is operated on the basis of the other fuel said determination being made on the basis of the combustion parameters for that period. When it is determined by the first determination process and/or the second determination process that the operating state of the engine is abnormal the abnormal part is identified on the basis of the determination result from the first determination process and the determination result from the second determination process. No. of Pages : 32 No. of Claims : 6 The Patent Office Journal 18/12/2015 65793 (12) PATENT APPLICATION PUBLICATION (21) Application No.3581/DEL/2013 A (19) INDIA (22) Date of filing of Application :10/12/2013 (43) Publication Date : 18/12/2015 (54) Title of the invention : A TAG BASED LOCATION AUTHENTICATION TECHNIQUE (51) International classification :H04W (71)Name of Applicant : (31) Priority Document No :NA 1)FILICK2KNOW TECHNOLOGIES (P) LTDQ (32) Priority Date :NA Address of Applicant :#8, LOWER GROUND FLOOR, (33) Name of priority country :NA KAILASH HILLS, NEW DELHI - 110065, INDIA Delhi India (86) International Application No :NA (72)Name of Inventor : Filing Date :NA 1)PEEYUSH JAIN (87) International Publication No : NA 2)APURV GUPTA (61) Patent of Addition to Application Number :NA Filing Date :NA (62) Divisional to Application Number :NA Filing Date :NA (57) Abstract : In a method for authenticating a location of a communication device based on a geographical location of a tag, a tag location information, representing the geographical location of the tag, is received from the tag, from which the geographical location of the tag is determined. Additionally, a device location information obtained from a first source is received. The device location information obtained from the first source represents a geographical location of the communication device obtained from the first source. Subsequently, the geographical location of the communication device obtained from the first source is determined. Finally, the geographical location of the tag and the geographical location of the communication device obtained from the first source are compared to authenticate the location of the communication device. The invention also presents a location authentication system for performing the method of the invention. No. of Pages : 29 No. of Claims : 11 The Patent Office Journal 18/12/2015 65794 (12) PATENT APPLICATION PUBLICATION (21) Application No.7009/DELNP/2015 A (19) INDIA (22) Date of filing of Application :10/08/2015 (43) Publication Date : 18/12/2015 (54) Title of the invention : SAMPLING AND STORAGE REGISTRY DEVICE FOR BREATH GAS ANALYSIS (51) International classification :A61B5/08 (71)Name of Applicant : (31) Priority Document No :61/763896 1)CAPNIA INC. (32) Priority Date :12/02/2013 Address of Applicant :2445 Faber Place Suite 250 Palo Alto (33) Name of priority country :U.S.A. CA 94303 U.S.A. (86) International Application No :PCT/US2014/016105 (72)Name of Inventor : Filing Date :12/02/2014 1)CAUSEVIC Elvir (87) International Publication No :WO 2014/127044 2)WONDKA Anthony D. (61) Patent of Addition to Application 3)BHATNAGAR Anish :NA Number :NA Filing Date (62) Divisional to Application Number :NA Filing Date :NA (57) Abstract : Methods and systems are described to obtain and analyze one or more gas samples from the breath of a person and organizing the samples in a sample registry for subsequent analysis. This technique solves the various problems that are associated with targeting an individual breath for analysis and allows for additional versatility and options in the analysis process. No. of Pages : 53 No. of Claims : 18 The Patent Office Journal 18/12/2015 65795 (12) PATENT APPLICATION PUBLICATION (21) Application No.7010/DELNP/2015 A (19) INDIA (22) Date of filing of Application :10/08/2015 (43) Publication Date : 18/12/2015 (54) Title of the invention : METHOD AND INVERTER FOR POWER DISTRIBUTION OVER MULTIPLE DIRECT CURRENT SOURCES WHICH ARE CONNECTED JOINTLY TO A DIRECT VOLTAGE INPUT OF A DC/AC TRANSFORMER (51) International classification :H02J3/38 (71)Name of Applicant : (31) Priority Document No :10 2013 100 961.1 1)SMA SOLAR TECHNOLOGY AG (32) Priority Date :30/01/2013 Address of Applicant :Sonnenallee 1 34266 Niestetal Germany (33) Name of priority country :Germany (72)Name of Inventor : (86) International Application No :PCT/EP2014/051241 1)UNRU Alexander Filing Date :22/01/2014 2)SCHR–DER Thomas (87) International Publication No :WO 2014/118059 (61) Patent of Addition to Application :NA Number :NA Filing Date (62) Divisional to Application Number :NA Filing Date :NA (57) Abstract : In order to distribute power over multiple direct current sources (25) which are connected in parallel to an input side direct voltage intermediate circuit (5) of a DC/AC transformer (6) at least one of which direct current sources (25) is connected to the direct voltage intermediate circuit (5) via a DC/DC transformer (2) wherein the DC/DC transformer (2) can be actuated to change the power fed into the direct voltage intermediate circuit (5) by the direct current source (25) the power levels of the direct current sources (25) are decreased differently in a decreased operating mode of the DC/AC transformer (6) in which the power of the DC/AC transformer (6) is decreased compared to the sum of the maximum power levels available from all the direct current sources (25) and by actuating at least the one DC/DC transformer (2) via which the at least one direct current source (25) is connected to the direct voltage intermediate circuit (5) variation in the power levels of at least one other direct current source (25) is compensated dynamically. No. of Pages : 25 No. of Claims : 20 The Patent Office Journal 18/12/2015 65796 (12) PATENT APPLICATION PUBLICATION (21) Application No.7011/DELNP/2015 A (19) INDIA (22) Date of filing of Application :10/08/2015 (43) Publication Date : 18/12/2015 (54) Title of the invention : SECURE STREAMING METHOD IN A NUMERICALLY CONTROLLED MANUFACTURING SYSTEM AND A SECURE NUMERICALLY CONTROLLED MANUFACTURING SYSTEM (51) International classification :H04L9/00 (71)Name of Applicant : (31) Priority Document No :13151981.1 1)FABULONIA OU (32) Priority Date :19/01/2013 Address of Applicant :Suur-Sojamae 10a, EE- 114 15 Tallinn (33) Name of priority country :EPO (EE). Estonia (86) International Application No :PCT/EP2014/051065 2)VEDESHIN, Anton Filing Date :20/01/2014 (72)Name of Inventor : (87) International Publication No :WO 2014/111587 1)ISBJ–RNSSUND Kimmo (61) Patent of Addition to Application 2)VEDESHIN Anton :NA Number :NA Filing Date (62) Divisional to Application Number :NA Filing Date :NA (57) Abstract : Secure streaming method in a numerically controlled manufacturing system where the 3D file of the 3D object such as a CAD file or STL file is not sent to the manufacturing machine but is kept in asecured system. Instead only the instructions for controlling the manufacturing machine (e.g. so called G codes) are streamed to the manufacturing machine. Such instructions are secured so that only a specific manufacturing machine can make use of them. To this end the set of instructions may be encoded e.g. hashed on a secure server using a server hash table while the manufacturing machine is provided with a local lookup hash table that is synchronized e.g. loosely synchronized with the server s hash table for converting the hashed instructions back to instructions suitable for operating the manufacturing machine. No. of Pages : 35 No. of Claims : 16 The Patent Office Journal 18/12/2015 65797 (12) PATENT APPLICATION PUBLICATION (21) Application No.7004/DELNP/2015 A (19) INDIA (22) Date of filing of Application :10/08/2015 (43) Publication Date : 18/12/2015 (54) Title of the invention : SOLID FORMS OF TRELAGLIPTIN PREPARATION METHOD AND APPLICATIONS THEREOF (51) International (71)Name of Applicant : :C07D401/04,A61K31/513,A61P3/10 classification 1)SICHUAN HAISCO PHARMACEUTICAL CO. LTD. (31) Priority Document No :201310056368.5 Address of Applicant :No. 136 Beverley Road Across the (32) Priority Date :22/02/2013 Taiwan Strait Technology Industry Development Park Wenjiang (33) Name of priority District Chengdu Sichuan 611130 China :China country (72)Name of Inventor : (86) International 1)FU Li :PCT/CN2014/072370 Application No 2)YUAN Daoyi :21/02/2014 Filing Date 3)LUO Jie (87) International 4)ZHAO Xiong :WO 2014/127735 Publication No 5)XU Tongli (61) Patent of Addition to 6)XIANG Zhixiang :NA Application Number :NA Filing Date (62) Divisional to :NA Application Number :NA Filing Date (57) Abstract : The present invention relates to solid forms of trelagliptin a preparation method therefor and applications thereof and relates specifically to six new solid forms of the dipeptidyl peptidase 4 inhibitor trelagliptin and preparation methods therefor as well as to pharmaceutical compositions comprising said solid forms of trelagliptin and uses of same in the preparation of medicines for the treatment of diseases mediated by dipeptidyl peptidase 4. No. of Pages : 39 No. of Claims : 16 The Patent Office Journal 18/12/2015 65798 (12) PATENT APPLICATION PUBLICATION (21) Application No.7005/DELNP/2015 A (19) INDIA (22) Date of filing of Application :10/08/2015 (43) Publication Date : 18/12/2015 (54) Title of the invention : NON INVASIVE BLOOD ANALYSIS (51) International (71)Name of Applicant : :A61B5/1455,A61B5/00,A61B5/022 classification 1)LEMAN MICRO DEVICES SA (31) Priority Document No :1302548.1 Address of Applicant :Quartier de lInnovation Btiment I CH (32) Priority Date :13/02/2013 1015 Lausanne Switzerland (33) Name of priority country :U.K. (72)Name of Inventor : (86) International 1)ELLIOTT Christopher :PCT/IB2014/000139 Application No 2)JONES Marc Eric :10/02/2014 Filing Date 3)VARSHNEY Arushi (87) International Publication 4)RUEGG Matthieu :WO 2014/125355 No (61) Patent of Addition to :NA Application Number :NA Filing Date (62) Divisional to :NA Application Number :NA Filing Date (57) Abstract : The present invention provides a personal hand held monitor (PHHM) comprising a signal acquisition device for acquiring signals which can be used to derive a measurement of a parameter related to the health of the user wherein the signal acquisition device comprises a blood photosensor having one or more photo emitters for transmitting light to a body part of a user one or more photo detectors for detecting light transmitted through or scattered by the body part and two or more optical cells at least one of which contains an analyte to be detected or which mimics the absorption spectrum of the analyte through which the light that has been or will be transmitted through or scattered by the body part passes before it reaches the photo detector(s) wherein the processor of the PHHM is adapted to process the signals received from the or each photo detector to calculate the difference in intensity of light which has passed through the or each analyte cell and light which has passed through the or each non analyte cell to determine the pulse of the user and to correlate the signals obtained from the photosensor with the pulse of the user wherein the PHHM is adapted to apply pressure to the body part or to have pressure applied to it by the body part so that in use an artery in the body part changes from occluded to patent during each pulse and the processor of the PHHM is adapted to derive a measurement of the change in the luminal area of the artery during each pulse and to correlate the signals received from the blood photosensor with the pulse and the change in the luminal area of the artery to provide a measurement of the concentration of the analyte in the arterial blood. No. of Pages : 16 No. of Claims : 18 The Patent Office Journal 18/12/2015 65799 (12) PATENT APPLICATION PUBLICATION (21) Application No.7006/DELNP/2015 A (19) INDIA (22) Date of filing of Application :10/08/2015 (43) Publication Date : 18/12/2015 (54) Title of the invention : SUBSTITUTED BISPHENYL BUTANOIC PHOSPHONIC ACID DERIVATIVES AS NEP (NEUTRAL ENDOPEPTIDASE) INHIBITORS (51) International classification :C07F9/38,A61K31/66,A61P25/00 (71)Name of Applicant : (31) Priority Document No :61/764679 1)NOVARTIS AG (32) Priority Date :14/02/2013 Address of Applicant :Lichtstrasse 35 CH 4056 Basel (33) Name of priority country :U.S.A. Switzerland (86) International Application (72)Name of Inventor : :PCT/US2014/015980 No 1)BARNES David Weninger :12/02/2014 Filing Date 2)COHEN Scott Louis (87) International Publication 3)RIGEL Dean Franklin :WO 2014/126979 No (61) Patent of Addition to :NA Application Number :NA Filing Date (62) Divisional to Application :NA Number :NA Filing Date (57) Abstract : The present invention provides a compound of formula (I); or a pharmaceutically acceptable salt thereof wherein R R and R are defined herein. The invention also relates to a method for manufacturing the compounds of the invention and its therapeutic uses. The present invention further provides pharmaceutical composition of the compounds of the invention and a combination of pharmacologically active agents and a compound of the invention. No. of Pages : 79 No. of Claims : 19 The Patent Office Journal 18/12/2015 65800 (12) PATENT APPLICATION PUBLICATION (21) Application No.7007/DELNP/2015 A (19) INDIA (22) Date of filing of Application :10/08/2015 (43) Publication Date : 18/12/2015 (54) Title of the invention : VIBRATION ISOLATOR (51) International classification :F16F1/38,B60K5/12,F16F15/08 (71)Name of Applicant : (31) Priority Document No :2013034799 1)BRIDGESTONE CORPORATION (32) Priority Date :25/02/2013 Address of Applicant :1 1 Kyobashi 3 chome Chuo ku Tokyo (33) Name of priority country :Japan 1048340 Japan (86) International Application No :PCT/JP2014/000091 (72)Name of Inventor : Filing Date :10/01/2014 1)SUGIMOTO Yukihiro (87) International Publication No :WO 2014/129099 (61) Patent of Addition to :NA Application Number :NA Filing Date (62) Divisional to Application :NA Number :NA Filing Date (57) Abstract : The present invention has: an inner cylinder (11) coupled to either one of a vibration generator and a vibration receiver; an outer cylinder (12) coupled to the other of the vibration generator and the vibration receiver; an intermediate cylinder (13) fitted on the inner circumferential surface of the outer cylinder (12); a main elastic body (14) for connecting the inner cylinder (11) and the intermediate cylinder (13); and stopper elastic bodies (15 16) that are fixed to the intermediate cylinder (13) and that face the inner cylinder (11) there being interposed therebetween at least hollow sections (17 18) formed in a direction orthogonal to the inner cylinder shaft direction so as to penetrate the main elastic body (14) in the inner cylinder shaft direction so that the stopper elastic bodies (15 16) remain independent of the main elastic body (14). The stopper elastic bodies (15 16) respectively have shaft direction stopper sections (15a 16a) that protrude more in the inner cylinder shaft direction than the intermediate cylinder (13) and the outer cylinder (12). No. of Pages : 16 No. of Claims : 5 The Patent Office Journal 18/12/2015 65801 (12) PATENT APPLICATION PUBLICATION (21) Application No.5796/DELNP/2012 A (19) INDIA (22) Date of filing of Application :28/06/2012 (43) Publication Date : 18/12/2015 (54) Title of the invention : STABILISATION OF OBJECTS (51) International classification :A47B91/16 (71)Name of Applicant : (31) Priority Document No :2009906295 1)NO ROCK CAFE TABLES PTY LTD (32) Priority Date :24/12/2009 Address of Applicant :5 Picquet Close Eagle Bay Western (33) Name of priority country :Australia Australia 6281 Australia (86) International Application No :PCT/AU2010/001745 (72)Name of Inventor : Filing Date :23/12/2010 1)HEYRING Christopher Brian (87) International Publication No :WO 2011/075793 2)BEAMES Jonathan Ramsey (61) Patent of Addition to Application 3)CATONI John Gerard :NA Number 4)HEYRING Toby William :NA Filing Date 5)MONK Richard (62) Divisional to Application Number :NA Filing Date :NA (57) Abstract : A stabilising arrangement to support an object (1) (such as a table) above four ground engaging means (5c 8c) (such as feet) includes an interconnection means (4) interconnecting at least three lever parts (e.g. four table legs (5 8) or beam portions (5a 8a) each connected to the interconnection means by a respective pivot (9) having a respective pivot axis (5h 8h). Each ground engaging means can be attached to or integral with one of the three lever parts where at least one of the ground engaging means is connected to the first lever part and at least one ground engaging means is connected to the third lever part. The first pivot axis and the third pivot axis are at an angle of up to thirty degrees from parallel to each other and within thirty degrees of perpendicular to the second pivot axis. The second lever part has first and second engaging regions the first engaging region located on the opposite side of the second pivot axis to the second engaging region in plan view. The first lever part includes a first engaging region to engage with the second engaging region of the second lever part. The third lever part includes a second engaging region to engage with the first engaging region of the second lever part. Rotation of the first lever part drives a rotation of the second lever part which drives rotation of the third lever part in a substantially opposite direction to the first lever part to give a warp displacement of the four ground engaging means. The stabilising arrangement provides support of the object on uneven ground. A support mechanism having at least four legs for supporting an object and a table that adapts to uneven surfaces are disclosed. No. of Pages : 46 No. of Claims : 24 The Patent Office Journal 18/12/2015 65802 (12) PATENT APPLICATION PUBLICATION (21) Application No.5797/DELNP/2012 A (19) INDIA (22) Date of filing of Application :28/06/2012 (43) Publication Date : 18/12/2015 (54) Title of the invention : LED LIGHTING DEVICE (51) International classification :F21V29/00,F21V15/01 (71)Name of Applicant : (31) Priority Document No :10153302.4 1)DSM IP ASSETS B.V. (32) Priority Date :11/02/2010 Address of Applicant :Het Overloon 1 NL 6411 TE Heerlen (33) Name of priority country :EPO Netherlands (86) International Application No :PCT/EP2011/051850 (72)Name of Inventor : Filing Date :09/02/2011 1)JANSSEN Robert Hendrik Catharina (87) International Publication No :WO 2011/098463 2)DIJK VAN Hans Klaas (61) Patent of Addition to Application :NA Number :NA Filing Date (62) Divisional to Application Number :NA Filing Date :NA (57) Abstract : The invention relates to a LED lighting device LLD) comprising a heat spreader having a front side and a back side; LEDs mounted on a PCB positioned on the front side of the heat spreader; a reflector or lens covering the LEDs; a socket for being received by an electrical supply system; optionally a base part; electronic driver components mounted on the back side of the heat spreader or inside the socket or base part; electrical leads or wiring system connecting the socket the electronic driver components and the heat spreader; and a housing optionally encapsulating the electronic components and the electrical leads or wiring system being in thermally conductive contact with the heat spreader wherein the housing is made of an thermally conductive electrically conductive plastic material (TC/EC material A) covered with a protection layer consisting of an electrically insulating material (EI material B) on the outside of the housing. No. of Pages : 13 No. of Claims : 8 The Patent Office Journal 18/12/2015 65803 (12) PATENT APPLICATION PUBLICATION (21) Application No.7032/DELNP/2015 A (19) INDIA (22) Date of filing of Application :10/08/2015 (43) Publication Date : 18/12/2015 (54) Title of the invention : ACTIVE BYPASS FLOW CONTROL FOR A SEAL IN A GAS TURBINE ENGINE (51) International classification :F01D5/08,F01D11/00,F01D11/04 (71)Name of Applicant : (31) Priority Document No :61/771151 1)SIEMENS ENERGY INC. (32) Priority Date :01/03/2013 Address of Applicant :4400 Alafaya Trail Orlando Florida (33) Name of priority country :U.S.A. 32826 2399 U.S.A. (86) International Application (72)Name of Inventor : :PCT/US2014/019770 No 1)EBERT Todd A. :03/03/2014 Filing Date 2)KIMMEL Keith D. (87) International Publication :WO 2014/134593 No (61) Patent of Addition to :NA Application Number :NA Filing Date (62) Divisional to Application :NA Number :NA Filing Date (57) Abstract : An active bypass flow control system (10) for controlling bypass compressed air based upon leakage flow of compressed air flowing past an outer balance seal (12) between a stator (18) and rotor (20) of a first stage of a gas turbine (21) in a gas turbine engine is disclosed. The active bypass flow control system (10) is an adjustable system in which one or more metering devices (14) may be used to control the flow of bypass compressed air as the flow of compressed air past the outer balance seals (12) changes over time as the outer balance seal (12) between the rim cavity (62) and the cooling cavity (25) wears. In at least one embodiment the metering device (14) may include an annular ring (22) having at least one metering orifice (24) extending therethrough whereby alignment of the metering orifice (24) with the outlet (26) may be adjustable to change a cross sectional area of an opening of aligned portions of the outlet (26) and the metering orifice (24). No. of Pages : 31 No. of Claims : 14 The Patent Office Journal 18/12/2015 65804 (12) PATENT APPLICATION PUBLICATION (21) Application No.1648/DEL/2012 A (19) INDIA (22) Date of filing of Application :30/05/2012 (43) Publication Date : 18/12/2015 (54) Title of the invention : PHARMACEUTICAL COMPOSITIONS OF PEMETREXED (51) International classification :A61K (71)Name of Applicant : (31) Priority Document No :NA 1)FRESENIUS KABI ONCOLOGY LTD. (32) Priority Date :NA Address of Applicant :B - 310, SOM DATT CHAMBERS - 1, (33) Name of priority country :NA BHIKAJI CAMA PLACE, NEW DELHI 110 066, INDIA Delhi (86) International Application No :NA India Filing Date :NA (72)Name of Inventor : (87) International Publication No : NA 1)KHATTAR, DHIRAJ (61) Patent of Addition to Application Number :NA 2)KHANNA, RAJESH Filing Date :NA 3)YADAV, MUKTI (62) Divisional to Application Number :NA 4)BURMAN, KRISHANU Filing Date :NA (57) Abstract : A pharmaceutical composition of Pemetrexed represented by formula I, which is a liquid ready to use solution formulation or a lyophilized pharmaceutical composition for parenteral administration comprising a pharmaceutically acceptable organic amine, an inert gas and optionally containing at least one or more pharmaceutically acceptable excipients. Also provided are processes for preparation of the ready to use solution formulation or lyophilized pharmaceutical composition of the present invention. No. of Pages : 35 No. of Claims : 27 The Patent Office Journal 18/12/2015 65805 (12) PATENT APPLICATION PUBLICATION (21) Application No.1795/DEL/2014 A (19) INDIA (22) Date of filing of Application :02/07/2014 (43) Publication Date : 18/12/2015 (54) Title of the invention : ATOMIZER AND ELECTRONIC CIGARETTE HAVING SAME (51) International classification :A24F7/00 (71)Name of Applicant : (31) Priority Document No :201420314834.5 1)SHENZHEN FIRST UNION TECHNOLOGY CO., LTD. (32) Priority Date :13/06/2014 Address of Applicant :1-3F, Building C, Gaoxin Industry (33) Name of priority country :China Zone, Tangwei Village, Fuyong Town, Baoan District Shenzhen, (86) International Application No :PCT// Guangdong 518000, China; China Filing Date :01/01/1900 (72)Name of Inventor : (87) International Publication No : NA 1)LI, Yonghai (61) Patent of Addition to Application Number :NA 2)XU, Zhongli Filing Date :NA 3)DENG, Yindeng (62) Divisional to Application Number :NA 4)HE, Pushan Filing Date :NA (57) Abstract : ABSTRACT An exemplary atomizer includes a housing, a solution reservoir, and an atomizing part. The housing defines an air inlet, an air outlet, and an air passage communicating the air inlet and the air outlet. The solution reservoir is received in the housing and is configured for reserving tobacco solution. The atomizing part is configured for atomizing the tobacco solution. The atomizing part includes an atomizing cup with an atomizing cavity, and an atomizing unit received in the atomizing cavity. The atomizer further includes a first solution guiding component between the solution reservoir and the atomizing part. The first solution guiding component is configured for conveying the tobacco solution from the solution reservoir to the atomizing cup for atomization. The first solution guiding component includes a porous ceramic body. The tobacco solution is absorbed and stored in the porous ceramic body, and is then conveyed to the atomizing unit for atomization. No. of Pages : 22 No. of Claims : 19 The Patent Office Journal 18/12/2015 65806 (12) PATENT APPLICATION PUBLICATION (21) Application No.2579/DEL/2012 A (19) INDIA (22) Date of filing of Application :21/08/2012 (43) Publication Date : 18/12/2015 (54) Title of the invention : AN APPARATUS AND METHOD FOR PERFORMING THE DRILLING OPERATION ON THE PRINTED CIRCUIT BOARD (51) International classification :H02J (71)Name of Applicant : (31) Priority Document No :NA 1)ANKIT CHATURVEDI (32) Priority Date :NA Address of Applicant :B-402 PARSHAVNATH PRESTIGE (33) Name of priority country :NA SECTOR 93-A, NOIDA, U.P. Uttar Pradesh India (86) International Application No :NA 2)VISHAL CHATURVEDI Filing Date :NA (72)Name of Inventor : (87) International Publication No : NA 1)ANKIT CHATURVEDI (61) Patent of Addition to Application Number :NA 2)VISHAL CHATURVEDI Filing Date :NA (62) Divisional to Application Number :NA Filing Date :NA (57) Abstract : Apparatus and method for performing the drilling operation on the printed circuit board is described. The present invention provides an Automatic Printed Circuit Board Drilling Machine. The machine takes two coordinates as input and subsequently does the drilling. Accuracy and precision are critical for the proper functioning of the machine. Hence, it employs two stepper motors to move the drill to the required position. This can reduce the time required for manual drilling while improving the overall accuracy of the process. No. of Pages : 38 No. of Claims : 10 The Patent Office Journal 18/12/2015 65807 (12) PATENT APPLICATION PUBLICATION (21) Application No.5684/DELNP/2012 A (19) INDIA (22) Date of filing of Application :26/06/2012 (43) Publication Date : 18/12/2015 (54) Title of the invention : INSULATING GARMENT (51) International classification :A41B17/00,A41D31/00 (71)Name of Applicant : (31) Priority Document No :P200931288 1)SUTRAN I MAS D S.L. (32) Priority Date :29/12/2009 Address of Applicant :C/ M¡s nº 153 E 08904 Hospitalet de (33) Name of priority country :Spain Llobregat (Barcelona) Spain (86) International Application No :PCT/ES2010/070779 (72)Name of Inventor : Filing Date :26/11/2010 1)CAHISA GALLARDO David (87) International Publication No :WO 2011/080368 2)DEUMAL RUBIO Oscar (61) Patent of Addition to Application 3)REXACH ALABART Sergi :NA Number :NA Filing Date (62) Divisional to Application Number :NA Filing Date :NA (57) Abstract : The invention relates to an insulating garment formed by: an inner surface made from a fabric comprising textured polyester and multifilament polyamide and having a hydrophilic finish and an outer surface made from cotton and polyester and having a hydrophobic finish. The outer surface has waterproof breathable properties. An air chamber located between the two surfaces facilitates the elimination of perspiration. The inner and outer fabrics are sewn together using thread with a very low diffusion coefficient. The garment can absorb the user s perspiration so that it is not released to the exterior. No. of Pages : 20 No. of Claims : 4 The Patent Office Journal 18/12/2015 65808 (12) PATENT APPLICATION PUBLICATION (21) Application No.7037/DELNP/2015 A (19) INDIA (22) Date of filing of Application :10/08/2015 (43) Publication Date : 18/12/2015 (54) Title of the invention : CLUTCH RELEASE BEARING (51) International classification :F16D23/14 (71)Name of Applicant : (31) Priority Document No :10 2013 208 715.2 1)SCHAEFFLER TECHNOLOGIES AG & CO. KG (32) Priority Date :13/05/2013 Address of Applicant :Industriestrae 1 3 91074 (33) Name of priority country :Germany Herzogenaurach Germany (86) International Application No :PCT/DE2014/200197 (72)Name of Inventor : Filing Date :06/05/2014 1)ALABARSE Bruno Corsi (87) International Publication No :WO 2014/183760 (61) Patent of Addition to Application :NA Number :NA Filing Date (62) Divisional to Application Number :NA Filing Date :NA (57) Abstract : The invention relates to a clutch release bearing (1) the housing (3) of which produced from plastics is operatively connected to a release lever (6). In order to improve the wear resistance of the housing (3) at least the contact surfaces (5.1 5.2) of the housing (3) on which the release lever (6) rests on the housing (3) are provided with a metal reinforcement (7). No. of Pages : 11 No. of Claims : 3 The Patent Office Journal 18/12/2015 65809 (12) PATENT APPLICATION PUBLICATION (21) Application No.5049/DELNP/2015 A (19) INDIA (22) Date of filing of Application :10/06/2015 (43) Publication Date : 18/12/2015 (54) Title of the invention : COMPOSITIONS AND METHODS FOR THE TREATMENT OF BRAIN CANCERS (51) International (71)Name of Applicant : :C12N7/01,A61K35/12,A61K35/76 classification 1)CHILDRENS HOSPITAL OF EASTERN ONTARIO (31) Priority Document No :NA RESEARCH INSTITUTE INC. (32) Priority Date :NA Address of Applicant :401 Smyth Road, Ottawa ,Ontario K1H (33) Name of priority country :NA 8L1 Canada (86) International Application 2)OTTAWA HOSPITAL RESEARCH INSTITUTE :PCT/CA2012/050893 No (72)Name of Inventor : :12/12/2012 Filing Date 1)STOJDL ,David (87) International Publication 2)BELL, John, Cameron :WO 2014/089668 No (61) Patent of Addition to :NA Application Number :NA Filing Date (62) Divisional to Application :NA Number :NA Filing Date (57) Abstract : Described herein is an isolated viral particle having a genome that includes open reading frames that encode: Maraba proteins N ,P ,and L , or variants thereof; as well as Maraba protein M or protein delta 51M , or variants thereof; and a Bahia Grande G protein , a LCMV G protein, or an Ebola G protein. Maraba protein N may have a sequence which includes SEQ ID NO: 1. Maraba protein P may have a sequence which includes SEQ ID NO: 2. Maraba protein L may have a sequence which includes SEQ ID NO: 3. Maraba proteins M and delta 1M may have sequence which include SEQ ID NO: 4 and 5 , respectively. Bahia Grande G protein may have a sequence which includes SEQ ID NO: 6. LCMV G protein may have a sequence which includes SEQ ID NO: 7. Ebola G protein may have a sequence which includes SEQ ID NO: 8. No. of Pages : 87 No. of Claims : 55 The Patent Office Journal 18/12/2015 65810 (12) PATENT APPLICATION PUBLICATION (21) Application No.5668/DELNP/2012 A (19) INDIA (22) Date of filing of Application :25/06/2012 (43) Publication Date : 18/12/2015 (54) Title of the invention : SUBSTITUTED PYRROLE DERIVATIVES AND THEIR USE AS HMG-COA REDUCTASE INHIBITORS (51) International classification :C07D 207/34 (71)Name of Applicant : (31) Priority Document No :PCT/IB2004/001761 1)RANBAXY LABORATORIES LIMITED (32) Priority Date :28/05/2004 Address of Applicant :12TH FLOOR, DEVIKA TOWER, 6, (33) Name of priority country :PCT NEHRU PLACE, NEW DELHI-110019, INDIA Delhi India (86) International Application No :PCT/IB2004/001761 (72)Name of Inventor : Filing Date :28/05/2004 1)HOMAMMAD SALMAN, (87) International Publication No :WO/2004/106299 (61) Patent of Addition to Application :NA Number :NA Filing Date (62) Divisional to Application Number :6150/DELNP/2005 Filed on :30/12/2005 (57) Abstract : The present invention relates to substituted pyrrole derivatives, which can be used as 3-hydroxy-3-methylglutaryl-coenzyme A (HMGCoA) reductase inhibitors. Compounds disclosed herein can function as cholesterol lowering agents and can be used for the treatment of cholesterol-related diseases and related symptoms. Processes for the preparation of disclosed compounds are provided, as well as pharmaceutical compositions containing the disclosed compounds, and methods of treating cholesterol-related diseases and related symptoms. No. of Pages : 56 No. of Claims : 19 The Patent Office Journal 18/12/2015 65811 (12) PATENT APPLICATION PUBLICATION (21) Application No.7021/DELNP/2015 A (19) INDIA (22) Date of filing of Application :10/08/2015 (43) Publication Date : 18/12/2015 (54) Title of the invention : ELECTROSURGICAL SYSTEMS AND METHODS (51) International (71)Name of Applicant : :A61B18/12,A61B18/14,A61M25/01 classification 1)ARTHROCARE CORPORATION (31) Priority Document No :NA Address of Applicant :7000 W. William Cannon Dr. Building (32) Priority Date :NA One Austin TX 78735 U.S.A. (33) Name of priority 2)WOLOSZKO Jean :NA country 3)NA (86) International 4)NA :PCT/US2013/029501 Application No 5)MARION Duane W. :07/03/2013 Filing Date 6)GOODE Johnson E. (87) International 7)MORRISON George :WO 2014/137342 Publication No 8)YUAN David (61) Patent of Addition to (72)Name of Inventor : :NA Application Number 1)WOLOSZKO Jean :NA Filing Date 2)MARION Duane W. (62) Divisional to 3)GOODE Johnson E. :NA Application Number 4)MORRISON George :NA Filing Date 5)YUAN David (57) Abstract : System and methods of an electrosurgical controller having multiple modes of operation that are configured for treatment of a specific targeted tissue type and the electrosurgical effect desired where the treatment and effect are provided by a single controller and an electrosurgical probe. The electrosurgical controller includes an integrated fluid control apparatus or pump where activation of the controller allows for selective energy delivery and corresponding fluid volume flow rates. The electrosurgical probe includes a fluid transport lumen and is in communication with the controller and the pump for operation of the probe in the various user selected modes with accompanying energy delivery and fluid control directed to the desired treatment and surgical effect. No. of Pages : 41 No. of Claims : 40 The Patent Office Journal 18/12/2015 65812 (12) PATENT APPLICATION PUBLICATION (21) Application No.7022/DELNP/2015 A (19) INDIA (22) Date of filing of Application :10/08/2015 (43) Publication Date : 18/12/2015 (54) Title of the invention : WHITE INK (51) International classification :C09D11/00,C09D11/02 (71)Name of Applicant : (31) Priority Document No :61/773372 1)FUJIFILM IMAGING COLORANTS INC. (32) Priority Date :06/03/2013 Address of Applicant :233 Cherry Lane New Castle Delaware (33) Name of priority country :U.S.A. 19720 U.S.A. (86) International Application No :PCT/GB2014/050429 (72)Name of Inventor : Filing Date :14/02/2014 1)ORIAKHI Christopher (87) International Publication No :WO 2014/135843 (61) Patent of Addition to Application :NA Number :NA Filing Date (62) Divisional to Application Number :NA Filing Date :NA (57) Abstract : An ink comprising: (a) from 1 to 20 parts of surface treated titanium dioxide; (b) from 20 to 70 parts of viscosity modifier; (c) from 5 to 30 parts of one or more water miscible polar organic solvent(s); (d) from 0.1 to 3 parts of surfactant; (e) from 0.001 to 5 parts of biocide; (f) from 0 to 20 parts of polymer particles; (g) the balance to 100 parts water; wherein the ink has a viscosity in the range of from 10 to 25 mPa.s when measured at 32°C using a Brookfield spindle SOO at 3 or 12 rpm depending on whether the viscosity is < or > 16 mPa.s. Also ink jet printing processes printed substrates ink containers and ink jet printers. No. of Pages : 17 No. of Claims : 11 The Patent Office Journal 18/12/2015 65813 (12) PATENT APPLICATION PUBLICATION (21) Application No.7023/DELNP/2015 A (19) INDIA (22) Date of filing of Application :10/08/2015 (43) Publication Date : 18/12/2015 (54) Title of the invention : AGROCHEMICAL COMPOSITION IN FORM OF AQUEOUS SUSPENSION (51) International (71)Name of Applicant : :A01N25/04,A01N25/30,A01N47/06 classification 1)MEIJI SEIKA PHARMA CO. LTD. (31) Priority Document No :2013015951 Address of Applicant :4 16 Kyobashi 2 chome Chuo ku Tokyo (32) Priority Date :30/01/2013 1048002 Japan (33) Name of priority 2)NIPPON KAYAKU CO. LTD. :Japan country (72)Name of Inventor : (86) International 1)SATO Atsushi :PCT/JP2014/051986 Application No 2)YABUZAKI Mitsuyuki :29/01/2014 Filing Date 3)UENO Shigeru (87) International 4)MURAMATSU Yoshinori :WO 2014/119620 Publication No 5)OGAWA Kazuteru (61) Patent of Addition to 6)SHIRAKURA Hidetoshi :NA Application Number :NA Filing Date (62) Divisional to :NA Application Number :NA Filing Date (57) Abstract : Provided is an agrochemical composition in the form of an aqueous suspension which contains an agrochemical active ingredient while containing an alkylnaphthalene sulfonate formalin condensate and one or more substances that are selected from the group consisting of alkyl sulfates polyoxyalkylene alkyl ether sulfates alkyl phosphoric acids and salts thereof polyoxyalkylene alkyl ether phosphoric acids and salts thereof and polyoxyalkylene alkyl ether acetic acids and salts thereof. This agrochemical composition in the form of an aqueous suspension inhibits crystal growth of the agrochemical active ingredient and has excellent control effect and storage stability. No. of Pages : 50 No. of Claims : 4 The Patent Office Journal 18/12/2015 65814 (12) PATENT APPLICATION PUBLICATION (21) Application No.7015/DELNP/2015 A (19) INDIA (22) Date of filing of Application :10/08/2015 (43) Publication Date : 18/12/2015 (54) Title of the invention : LIGHT WEIGHT INNER TUBE AND RELATED METHODS (51) International classification :B60C5/02,B60C5/04 (71)Name of Applicant : (31) Priority Document No :61/792294 1)BRIDGESTONE AMERICAS TIRE OPERATIONS LLC (32) Priority Date :15/03/2013 Address of Applicant :535 Marriott Drive Nashville Tennessee (33) Name of priority country :U.S.A. 37214 U.S.A. (86) International Application No :PCT/US2014/023577 (72)Name of Inventor : Filing Date :11/03/2014 1)ABDALLAH David Jr. (87) International Publication No :WO 2014/150550 (61) Patent of Addition to Application :NA Number :NA Filing Date (62) Divisional to Application Number :NA Filing Date :NA (57) Abstract : The present disclosure relates to a light weight tire inner tube comprising a film tube with a wall thickness of 100 to 400 microns pneumatic tires containing the light weight tire inner tube and related methods for manufacturing the light weight tire inner tube. The film tube is comprised of a film material comprising at least one thermoplastic engineering resin and optionally at least one saturated elastomer and the film material of the film tube has an oxygen permeability of 8 15 cm O/mper day at 25° C. No. of Pages : 21 No. of Claims : 16 The Patent Office Journal 18/12/2015 65815 (12) PATENT APPLICATION PUBLICATION (21) Application No.7016/DELNP/2015 A (19) INDIA (22) Date of filing of Application :10/08/2015 (43) Publication Date : 18/12/2015 (54) Title of the invention : GAS TURBINE INCLUDING BELLYBAND SEAL ANTI ROTATION DEVICE (51) International classification :F01D11/00,F01D5/06 (71)Name of Applicant : (31) Priority Document No :13/789802 1)SIEMENS AKTIENGESELLSCHAFT (32) Priority Date :08/03/2013 Address of Applicant :Wittelsbacherplatz 2 80333 M¼nchen (33) Name of priority country :U.S.A. Germany (86) International Application No :PCT/EP2014/052899 (72)Name of Inventor : Filing Date :14/02/2014 1)MULLER Christopher J. (87) International Publication No :WO 2014/135354 2)NA (61) Patent of Addition to Application 3)NA :NA Number :NA Filing Date (62) Divisional to Application Number :NA Filing Date :NA (57) Abstract : A turbine including a plurality of stages each stage including a rotatable disk and blades carried thereby. An annular gap defined between a pair of adjacent rotatable disks. A sealing band is located in opposing sealing band receiving slots formed in the adjacent disks to seal the annular gap the sealing band including band engagement structure. A disk engagement structure is defined in the pair of adjacent rotatable disks. The disk engagement structure extends axially into the pair of adjacent rotatable disks and circumferentially aligns with the band engagement structure. A clip member is positioned in engagement with the sealing band through the band engagement structure and in engagement with the pair of adjacent rotatable disks through the disk engagement structure. The clip member restricts movement of the sealing band in only a circumferential direction of the slots. No. of Pages : 19 No. of Claims : 19 The Patent Office Journal 18/12/2015 65816 (12) PATENT APPLICATION PUBLICATION (21) Application No.7017/DELNP/2015 A (19) INDIA (22) Date of filing of Application :10/08/2015 (43) Publication Date : 18/12/2015 (54) Title of the invention : CATALYTIC CONVERTER (51) International classification :B01J35/04,B01D53/94,B01J23/46 (71)Name of Applicant : (31) Priority Document No :2013025580 1)TOYOTA JIDOSHA KABUSHIKI KAISHA (32) Priority Date :13/02/2013 Address of Applicant :1 Toyota cho Toyota shi Aichi 4718571 (33) Name of priority country :Japan Japan (86) International Application (72)Name of Inventor : :PCT/JP2013/084080 No 1)AOKI Yuki :19/12/2013 Filing Date 2)SUZUKI Hiromasa (87) International Publication 3)MATSUBARA Hiroyuki :WO 2014/125733 No (61) Patent of Addition to :NA Application Number :NA Filing Date (62) Divisional to Application :NA Number :NA Filing Date (57) Abstract : Provided is a catalytic converter comprising a substrate configured from regions of different cell density and having excellent emission gas purification performance in all regions of the substrate. This catalytic converter (10) comprises a catalyst layer formed such that on the surface of cell walls (2) of a cell structure substrate (1) a noble metal catalyst is supported on a carrier and in the longitudinal direction of the substrate (1) over which the gas circulates wherein the substrate (1) is configured from a first region (1A) having a relatively high cell density and a second region (1B) having a relatively low cell density and the ratio of the thickness of the catalyst layer (3A) in the second region (1B) to the thickness of the catalyst layer (3) in the first region (1A) is greater than 0.95 and less than or equal to 1.2. No. of Pages : 19 No. of Claims : 2 The Patent Office Journal 18/12/2015 65817 (12) PATENT APPLICATION PUBLICATION (21) Application No.7167/DELNP/2012 A (19) INDIA (22) Date of filing of Application :17/08/2012 (43) Publication Date : 18/12/2015 (54) Title of the invention : PROCESS&NBSP; TUBE AND DEVICE FOR THE PREPARATION OF WOUND HEALANT COMPOSITION• (51) International classification :C07C (71)Name of Applicant : (31) Priority Document No :1004072.3 1)ANTOINE TURZI (32) Priority Date :11/03/2010 Address of Applicant :5 B Rue de l™Eglise CH-1146 (33) Name of priority country :U.K. Mollens Switzerland (86) International Application No :PCT/IB2011/000684 (72)Name of Inventor : Filing Date :11/03/2011 1)ANTOINE TURZI (87) International Publication No :WO/2011/110948 (61) Patent of Addition to Application :NA Number :NA Filing Date (62) Divisional to Application Number :NA Filing Date :NA (57) Abstract : The present invention is related to the field of tissue regeneration. It concerns more particularly new processes, tubes and devices for thrombin, platelet concentrate and wound healant preparations, alone or in combination with cell extracts, cell compositions and uses thereof. No. of Pages : 113 No. of Claims : 61 The Patent Office Journal 18/12/2015 65818 (12) PATENT APPLICATION PUBLICATION (21) Application No.7168/DELNP/2012 A (19) INDIA (22) Date of filing of Application :17/08/2012 (43) Publication Date : 18/12/2015 (54) Title of the invention : FLOW METER VALIDATION• (51) International classification :G01N (71)Name of Applicant : (31) Priority Document No :12/703,963 1)DANIEL MEASUREMENT AND CONTROL INC. (32) Priority Date :11/02/2010 Address of Applicant :11100 Brittmoore Park Drive Houston (33) Name of priority country :U.S.A. Texas 77041 U.S.A. (86) International Application No :PCT/US2011/024363 (72)Name of Inventor : Filing Date :10/02/2011 1)DANIEL J. HACKETT III (87) International Publication No :WO/2011/100440 2)CHARLES W. DERR (61) Patent of Addition to Application 3)GRAHAM W. FORBES :NA Number 4)KERRY D. GROESCHEL :NA Filing Date 5)HENRY C. STRAUB JR. (62) Divisional to Application Number :NA Filing Date :NA (57) Abstract : Flow meter validation techniques are herein disclosed. An illustrative system includes a flow meter and display logic coupled to the flow meter. The flow meter is configured to provide information indicative of a parameter of fluid flow through the meter. The display logic is configured to provide a display of the information. The display includes an indication of a possible range of values of the parameter. An indication of a baseline portion of the range is also provided. The baseline portion of the range designates preferred values of the parameter. The display further includes an indicator designating the value of the parameter. No. of Pages : 24 No. of Claims : 20 The Patent Office Journal 18/12/2015 65819 (12) PATENT APPLICATION PUBLICATION (21) Application No.7033/DELNP/2015 A (19) INDIA (22) Date of filing of Application :10/08/2015 (43) Publication Date : 18/12/2015 (54) Title of the invention : RADIOLABELLING PROCESS (51) International classification :A61K51/04,C07B59/00 (71)Name of Applicant : (31) Priority Document No :1305687.4 1)GE HEALTHCARE LIMITED (32) Priority Date :28/03/2013 Address of Applicant :Amersham Place Little Chalfont (33) Name of priority country :U.K. Buckinghamshire HP7 9NA U.K. (86) International Application No :PCT/EP2014/056344 (72)Name of Inventor : Filing Date :28/03/2014 1)WICKSTROM Torild (87) International Publication No :WO 2014/154886 (61) Patent of Addition to Application :NA Number :NA Filing Date (62) Divisional to Application Number :NA Filing Date :NA (57) Abstract : The present invention relates to a novel composition comprising 1 amino 3 [F] fluorocyclobutanecarboxylic acid ([F] FACBC) wherein said composition has certain superior properties in comparison with known compositions comprising [F] FACBC. Also provided by the invention is a method to obtain said composition. No. of Pages : 22 No. of Claims : 24 The Patent Office Journal 18/12/2015 65820 (12) PATENT APPLICATION PUBLICATION (21) Application No.7034/DELNP/2015 A (19) INDIA (22) Date of filing of Application :10/08/2015 (43) Publication Date : 18/12/2015 (54) Title of the invention : AUTOMATED SYSTEM FOR THE RECOVERY OF DEAD ANIMALS INSIDE THEIR HOUSING PREMISES (51) International classification :A01K45/00 (71)Name of Applicant : (31) Priority Document No :CR2013A000010 1)DOLARA, Giuseppe (32) Priority Date :14/03/2013 Address of Applicant :Via Dante, 18 I - 26023 Grumello (33) Name of priority country :Italy Cremonese Ed Uniti (CR) ITALY Italy (86) International Application No :PCT/IT2014/000073 (72)Name of Inventor : Filing Date :11/03/2014 1)DOLARA Giuseppe (87) International Publication No :WO 2014/141313 (61) Patent of Addition to Application :NA Number :NA Filing Date (62) Divisional to Application Number :NA Filing Date :NA (57) Abstract : The invention is intended for the agricultural sector of intensive animal farming. In detail the invention concerns an automated system for the recovery of dead animals (1) lying on a surface (2) inside their housing premises (3). Said automated system comprises an automated mobile equipment (4) and guide means (5) for said equipment (4). Said equipment (4) comprises: locomotion motor means (26 27) and automation motor means (23); identification means (6) for identifying said dead animals (1) lying on said surface (2); lifting means (7) for lifting said dead animals (1); container means (8) for containing said dead animals (1); a control unit (9) adapted to supervise the functions of said equipment (4); supply means adapted to supply energy to said equipment (4). Said equipment (4) is adapted to move according to the commands of said control unit (9) processed in cooperation with said guide means (5) so that said equipment (4) covers the entire surface of said premises (3). No. of Pages : 20 No. of Claims : 11 The Patent Office Journal 18/12/2015 65821 (12) PATENT APPLICATION PUBLICATION (21) Application No.7035/DELNP/2015 A (19) INDIA (22) Date of filing of Application :10/08/2015 (43) Publication Date : 18/12/2015 (54) Title of the invention : OPTICAL AMPLIFIER ARRANGEMENT (51) International (71)Name of Applicant : :H04B10/291,H01S5/50,H04Q11/00 classification 1)TELEFONAKTIEBOLAGET L M ERICSSON (PUBL) (31) Priority Document No :NA Address of Applicant :S 164 83 Stockholm Sweden (32) Priority Date :NA (72)Name of Inventor : (33) Name of priority country :NA 1)VON DER WEID Jean Pierre (86) International Application 2)PENELLO TEMPORAO Guilherme :PCT/SE2013/050192 No :05/03/2013 Filing Date (87) International Publication :WO 2014/137254 No (61) Patent of Addition to :NA Application Number :NA Filing Date (62) Divisional to :NA Application Number :NA Filing Date (57) Abstract : The present invention relates to an optical amplifier arrangement and a method of amplifying an optical signal. The optical amplifier arrangement (20) comprises an optical dividing device (21) arranged to divide an optical input pulse into a plurality of non overlapping pulses forming a pulse train an optical amplifier (22) arranged to amplify the pulse train and an optical aligning device (23) arranged to temporally align the plurality of amplified pulses in the amplified pulse train into a single output pulse having the same temporal width as the input pulse. No. of Pages : 27 No. of Claims : 11 The Patent Office Journal 18/12/2015 65822 (12) PATENT APPLICATION PUBLICATION (21) Application No.7036/DELNP/2015 A (19) INDIA (22) Date of filing of Application :10/08/2015 (43) Publication Date : 18/12/2015 (54) Title of the invention : A SOLUBLE FIBROBLAST GROWTH FACTOR RECEPTOR 3 (FGR3) POLYPEPTIDE FOR USE IN THE PREVENTION OR TREATMENT OF SKELETAL GROWTH RETARDATION DISORDERS (51) International classification :C07K14/71 (71)Name of Applicant : (31) Priority Document No :NA 1)INSERM (INSTITUT NATIONAL DE LA SANT‰ ET (32) Priority Date :NA DE LA RECHERCHE M‰DICALE) (33) Name of priority country :NA Address of Applicant :101 rue de Tolbiac F 75013 Paris (86) International Application No :PCT/IB2013/001480 France Filing Date :16/01/2013 2)UNIVERSITE PAUL SABATIER TOULOUSE III (87) International Publication No :WO 2014/111744 (72)Name of Inventor : (61) Patent of Addition to Application 1)GOUZE Elvire :NA Number :NA Filing Date (62) Divisional to Application Number :NA Filing Date :NA (57) Abstract : The present invention relates to the prevention or treatment of skeletal growth retardation disorders in particular skeletal diseases developed by patients that display abnormal increased activation of the fibroblast growth factor receptor 3 (FGFR3) in particular by expression of a constitutively activated mutant of FGFR3. More particularly the present invention relates to a soluble FGFR3 for use in the prevention or treatment of achondroplasia. No. of Pages : 53 No. of Claims : 12 The Patent Office Journal 18/12/2015 65823 (12) PATENT APPLICATION PUBLICATION (21) Application No.7178/DELNP/2012 A (19) INDIA (22) Date of filing of Application :17/08/2012 (43) Publication Date : 18/12/2015 (54) Title of the invention : AMINOTHIAZOLONES AS ESTROGEN RELATED RECEPTOR-ALPHA MODULATORS (51) International classification :C12P (71)Name of Applicant : (31) Priority Document No :61/305,181 1)JANSSEN PHARMACEUTICA NV (32) Priority Date :17/02/2010 Address of Applicant :Turnhoutseweg 30 B-2340 Beerse (33) Name of priority country :U.S.A. Belgium (86) International Application No :PCT/US2011/025004 (72)Name of Inventor : Filing Date :16/02/2011 1)GILLES BIGNAN (87) International Publication No :WO/2011/103134 2)MICHEAL GAUL (61) Patent of Addition to Application 3)GUOZHANG XU :NA Number 4)BAO-PING ZHAO :NA Filing Date (62) Divisional to Application Number :NA Filing Date :NA (57) Abstract : The present invention relates to compounds of Formula (I), methods for preparing these compounds, compositions, intermediates and derivatives thereof and for treating a condition including but not limited to ankylosing spondylitis, artherosclerosis, arthritis (such as rheumatoid arthritis, infectious arthritis, childhood arthritis, psoriatic arthritis, reactive arthritis), bone- related diseases (including those related to bone formation), breast cancer (including those unresponsive to anti-estrogen therapy), cardiovascular disorders, cartilage-related disease (such as cartilage injury/loss, cartilage degeneration, and those related to cartilage formation), chondrodysplasia, chondrosarcoma, chronic back injury, chronic bronchitis, chronic inflammatory airway disease, chronic obstructive pulmonary disease, diabetes, disorders of energy homeostasis, gout, pseudogout, lipid disorders, metabolic syndrome, multiple myeloma, obesity, osteoarthritis, osteogenesis imperfecta, osteolytic bone metastasis, osteomalacia, osteoporosis, Pagets disease, periodontal disease, polymyalgia rheumatica, Reiters syndrome, repetitive stress injury, hyperglycemia, elevated blood glucose level, and insulin resistance. No. of Pages : 137 No. of Claims : 30 The Patent Office Journal 18/12/2015 65824 (12) PATENT APPLICATION PUBLICATION (21) Application No.7024/DELNP/2015 A (19) INDIA (22) Date of filing of Application :10/08/2015 (43) Publication Date : 18/12/2015 (54) Title of the invention : ENHANCED BACKUP RING EDGE FEATURES FOR METAL FACE SEAL IN ROLLER CONE DRILL BITS (51) International classification :E21B10/08,E21B10/22 (71)Name of Applicant : (31) Priority Document No :13/763405 1)BAKER HUGHES INCORPORATED (32) Priority Date :08/02/2013 Address of Applicant :P.O. Box 4740 Houston TX 77210 4740 (33) Name of priority country :U.S.A. U.S.A. (86) International Application No :PCT/US2014/015287 (72)Name of Inventor : Filing Date :07/02/2014 1)LIN Chih (87) International Publication No :WO 2014/124246 2)KOLTERMANN Terry J. (61) Patent of Addition to Application 3)ZAHRADNIK Anton F. :NA Number 4)RICKS Gregory L. :NA Filing Date (62) Divisional to Application Number :NA Filing Date :NA (57) Abstract : A backup ring for a face seal in a roller cone bit is configured to resist wear from drilling fluids present adjacent exposed faces of the backup ring. Portions are removed from an exposed end face in a variety of shapes while the hardness of the material is increased. The removal of material offsets an increase in force that would be transmitted through the backup ring on face seal assembly due to flexing. A spring can optionally be included in the removed material location. Another way is to increase the edge density of all or part of the exposed edges while leaving the interior portions unaffected by using electron beam radiation to increase the crosslink density or by other techniques that allow a unitary structure with a more durable edge region. No. of Pages : 16 No. of Claims : 10 The Patent Office Journal 18/12/2015 65825 (12) PATENT APPLICATION PUBLICATION (21) Application No.7025/DELNP/2015 A (19) INDIA (22) Date of filing of Application :10/08/2015 (43) Publication Date : 18/12/2015 (54) Title of the invention : PROCESS FOR PREPARING 5 FLUORO 1 METHYL 3 DIFLUOROMETHYL 1H PYRAZOLE 4 CARBALDEHYDE (51) International classification :C07D231/16 (71)Name of Applicant : (31) Priority Document No :13151564.5 1)BAYER CROPSCIENCE AG (32) Priority Date :17/01/2013 Address of Applicant :Alfred Nobel Strasse 50 40789 (33) Name of priority country :EPO Monheim Germany (86) International Application No :PCT/EP2014/050767 (72)Name of Inventor : Filing Date :16/01/2014 1)LUI Norbert (87) International Publication No :WO 2014/111449 2)PAZENOK Sergii (61) Patent of Addition to Application :NA Number :NA Filing Date (62) Divisional to Application Number :NA Filing Date :NA (57) Abstract : The present invention relates to a novel process for preparing 5 fluoro 1 methyl 3 difluoromethyl 1H pyrazole 4 carbaldehyde a useful intermediate in the manufacture of fungicides. No. of Pages : 8 No. of Claims : 6 The Patent Office Journal 18/12/2015 65826 (12) PATENT APPLICATION PUBLICATION (21) Application No.7026/DELNP/2015 A (19) INDIA (22) Date of filing of Application :10/08/2015 (43) Publication Date : 18/12/2015 (54) Title of the invention : COPROCESSED SILICA COATED POLYMER COMPOSITION (51) International classification :A61K47/32 (71)Name of Applicant : (31) Priority Document No :61/777604 1)HERCULES INCORPORATED (32) Priority Date :12/03/2013 Address of Applicant :500 Hercules Road Wilmington (33) Name of priority country :U.S.A. Delaware 19808 U.S.A. (86) International Application No :PCT/US2014/024956 (72)Name of Inventor : Filing Date :12/03/2014 1)TEWARI Divya (87) International Publication No :WO 2014/165246 2)TITOVA Yevgeniya A. (61) Patent of Addition to Application 3)BEISSNER Brad :NA Number 4)DURIG Thomas :NA Filing Date (62) Divisional to Application Number :NA Filing Date :NA (57) Abstract : The present invention provides a coprocessed excipient composition and a method of producing the same. The coprocessed excipient comprises vinyl lactam derived polymer and a deagglomerated coprocessing agent. The coprocessing agent is fumed silica colloidal silica or silicon dioxide. The coprocessed excipient is prepared by a continuous process and has a Brookfield cohesion of less than 0.12 kPa a bulk density of at least 0.249 gram/milliliter and a flow property as measured by Johanson flow rate number increase from 1.1 to 5.0 fold. No. of Pages : 21 No. of Claims : 16 The Patent Office Journal 18/12/2015 65827 (12) PATENT APPLICATION PUBLICATION (21) Application No.7027/DELNP/2015 A (19) INDIA (22) Date of filing of Application :10/08/2015 (43) Publication Date : 18/12/2015 (54) Title of the invention : METHOD AND APPARATUS FOR MEASURING A PART (51) International classification :G01B21/04,G01B5/10,G01B5/20 (71)Name of Applicant : (31) Priority Document No :1302012.8 1)RENISHAW PLC (32) Priority Date :05/02/2013 Address of Applicant :New Mills Wotton under Edge (33) Name of priority country :U.K. Gloucestershire GL12 8JR U.K. (86) International Application (72)Name of Inventor : :PCT/GB2014/050285 No 1)OULD John :03/02/2014 Filing Date (87) International Publication :WO 2014/122437 No (61) Patent of Addition to :NA Application Number :NA Filing Date (62) Divisional to Application :NA Number :NA Filing Date (57) Abstract : This invention concerns a method and apparatus for measuring a part 4 with a contact probe 3 mounted on a coordinate positioning machine 1. The method comprises measuring a plurality of points PC on the part 4 when both the part 3 and contact probe 3 are moving continuously between different positions within the coordinate positioning machine 1.The probe 3 moves relative to the part 4 along a scan path 20 such that substantially coincident points that are closely located together along a curve or surface being measured are measured at relatively far apart positions in the machine 1 and at relatively far apart positions along the scan path SC. No. of Pages : 36 No. of Claims : 31 The Patent Office Journal 18/12/2015 65828 (12) PATENT APPLICATION PUBLICATION (21) Application No.7181/DELNP/2012 A (19) INDIA (22) Date of filing of Application :17/08/2012 (43) Publication Date : 18/12/2015 (54) Title of the invention : CHEMICAL PROCESSES GENERATING SOLID (S) CARRIED OUT CONTINUOUSLY WITHIN MICROREACTORS (51) International classification :C07C (71)Name of Applicant : (31) Priority Document No :10305190 1)CORNING INCORPORATED (32) Priority Date :25/02/2010 Address of Applicant :1 Riverfront Plaza Corning New York (33) Name of priority country :EPO 14831 USA U.S.A. (86) International Application No :PCT/US2011/024851 (72)Name of Inventor : Filing Date :15/02/2011 1)STEVEN VAN ZUTPHEN (87) International Publication No :WO/2011/106195 2)FEIXIA ZHANG (61) Patent of Addition to Application :NA Number :NA Filing Date (62) Divisional to Application Number :NA Filing Date :NA (57) Abstract : The present invention relates to a continuous process for conducting a chemical reaction in a liquid reaction medium. Characteristically: - said continuous process is carried out in a microreactor (10), - said chemical reaction produces a solid insoluble in said liquid reaction medium, and - said continuous process comprises the continuous extraction of said solid, as it is produced, with a solvent S2, immiscible with said reaction medium. Such a process is advantageously carried out for conducting the activation of a carboxylic acid in the presence of an organic base. No. of Pages : 24 No. of Claims : 14 The Patent Office Journal 18/12/2015 65829 (12) PATENT APPLICATION PUBLICATION (21) Application No.7182/DELNP/2012 A (19) INDIA (22) Date of filing of Application :17/08/2012 (43) Publication Date : 18/12/2015 (54) Title of the invention : MAGNETICALLY POWERED RECIPROCATING ENGINE AND ELECTROMAGNET CONTROL SYSTEM (51) International classification :G01N (71)Name of Applicant : (31) Priority Document No :12/701,781 1)MAGNETIC MILES LLC (32) Priority Date :08/02/2010 Address of Applicant :5155 Sw Bimini Circle S. Palm City (33) Name of priority country :U.S.A. FL 34990 USA U.S.A. (86) International Application No :PCT/US2011/024018 (72)Name of Inventor : Filing Date :08/02/2011 1)STEPHEN MILES (87) International Publication No :WO/2011/097613 2)MICHAEL CRISTOFORO (61) Patent of Addition to Application :NA Number :NA Filing Date (62) Divisional to Application Number :NA Filing Date :NA (57) Abstract : The instant invention provides a magnetically controlled reciprocating engine having a unique electromagnet control system. The engine is constructed and arranged to operate from a stored power source such as batteries to provide extended run times by controlling the power supplied to the electromagnets in a manner that controls heat generation within the electromagnetic coils, thereby increasing coil life. The control system is also capable of controlling engine speed and/or torque outputs to make the engine versatile for a wide variety of uses. The system is constructed and arranged to be utilized on new or pre-existing engines of various configurations and may be utilized in other industries or devices that benefit from the use of electromagnets. No. of Pages : 36 No. of Claims : 22 The Patent Office Journal 18/12/2015 65830 (12) PATENT APPLICATION PUBLICATION (21) Application No.5007/DELNP/2015 A (19) INDIA (22) Date of filing of Application :09/06/2015 (43) Publication Date : 18/12/2015 (54) Title of the invention : MOLECULAR SIEVE SSZ 85 COMPOSITION OF MATTER AND SYNTHESIS THEREOF (51) International classification :C01B37/06,C01B39/54 (71)Name of Applicant : (31) Priority Document No :61/762589 1)CHEVRON U.S.A. INC. (32) Priority Date :08/02/2013 Address of Applicant :6001 Bollinger Canyon Road, San (33) Name of priority country :U.S.A. Ramon ,California 94583 U.S.A. (86) International Application No :PCT/US2013/072786 (72)Name of Inventor : Filing Date :03/12/2013 1)ZONES ,Stacey Ian (87) International Publication No :WO 2014/123609 (61) Patent of Addition to Application :NA Number :NA Filing Date (62) Divisional to Application Number :NA Filing Date :NA (57) Abstract : This disclosure is directed to a new cobalt aluminophosphate molecular sieve designated SSZ- 85 and a method for preparing SSZ- 85 using a 1, 3- diisopropylimidazolium ionic liquid. No. of Pages : 21 No. of Claims : 11 The Patent Office Journal 18/12/2015 65831 (12) PATENT APPLICATION PUBLICATION (21) Application No.5008/DELNP/2015 A (19) INDIA (22) Date of filing of Application :10/06/2015 (43) Publication Date : 18/12/2015 (54) Title of the invention : METHOD AND SYSTEM FOR REMOVING INK FROM FILMS (51) International classification :B08B1/00,B08B1/02,B08B5/02 (71)Name of Applicant : (31) Priority Document No :13/725817 1)FLORAL PACKAGING IP HOLDINGS, LLC (32) Priority Date :21/12/2012 Address of Applicant :213 S. Temkin Way, Payson, Utah (33) Name of priority country :U.S.A. 84651 U.S.A. (86) International Application No :PCT/IB2013/002769 (72)Name of Inventor : Filing Date :13/12/2013 1)MILLAN Jorge Albeiro (87) International Publication No :WO 2014/096926 (61) Patent of Addition to :NA Application Number :NA Filing Date (62) Divisional to Application :NA Number :NA Filing Date (57) Abstract : A method of removing ink from a film includes unrolling the film from a first roll, exposing the film to a cleaning composition , and scraping the cleaning composition from the film. The film and the cleaning composition pass adjacent a first nonabrasive cloth to spread the cleaning composition over a width of the film , and adjacent at least one additional nonabrasive cloth to remove the ink from the film. The film may be polymeric , metallic ,or a metalized polymer. A system includes a means for unrolling a film , at least one nozzle configured to expose the film to a cleaning composition , and a blade configured to scrape the cleaning composition from the film. The system also includes a first nonabrasive cloth configured to spread the cleaning composition over a width of the film, and at least one additional nonabrasive cloth configured to scrub the ink from the film. No. of Pages : 23 No. of Claims : 25 The Patent Office Journal 18/12/2015 65832 (12) PATENT APPLICATION PUBLICATION (21) Application No.5009/DELNP/2015 A (19) INDIA (22) Date of filing of Application :10/06/2015 (43) Publication Date : 18/12/2015 (54) Title of the invention : OMEGA -3 PENTAENOIC ACID COMPOSITIONS AND METHODS OF USE (51) International classification :C12P7/64,A23D9/00 (71)Name of Applicant : (31) Priority Document No :61/734331 1)MATINAS BIOPHARMA ,INC. (32) Priority Date :06/12/2012 Address of Applicant :1545 Route 206, Suite 302, Bedminster (33) Name of priority country :U.S.A. ,New Jersey 07921 U.S.A. (86) International Application No :PCT/US2013/073701 (72)Name of Inventor : Filing Date :06/12/2013 1)BOBOTAS ,George (87) International Publication No :WO 2014/089501 2)FAWZY, Abdel Aziz (61) Patent of Addition to Application :NA Number :NA Filing Date (62) Divisional to Application Number :NA Filing Date :NA (57) Abstract : Orally administrable composition comprising fatty acids , wherein at least 50% by weight of the fatty acids comprise omega -3- fatty acids, salts or derivatives thereof, wherein the omega -3 fatty acids comprise eicosapentaenoic acid (EPA; C20:5- n3) , docosapentaenoic acid (DPA; C22:5 -n3), and docosahexaenoic acid (DHA; C22:6 -n3) , wherein the ratio of DHA to EPA (DHA:EPA) is less than 1:20 , and wherein the ratio of DHA to DPA (DHA:DPA) is less than 2:1 are provided. These compositions can be used for the treatment or prophylaxis of dyslipidemic , cardiovascular , CNS, inflammatory , and other diseases/conditions or risk factors therefore. No. of Pages : 137 No. of Claims : 45 The Patent Office Journal 18/12/2015 65833 (12) PATENT APPLICATION PUBLICATION (21) Application No.7214/DELNP/2012 A (19) INDIA (22) Date of filing of Application :17/08/2012 (43) Publication Date : 18/12/2015 (54) Title of the invention : BIPOLAR PLATES AND REGENERATIVE FUEL CELL STACKS INCLUDING SAME• (51) International classification :H02J (71)Name of Applicant : (31) Priority Document No :61/297,853 1)RAMOT AT TEL-AVIV UNIVERSITY LTD. (32) Priority Date :25/01/2010 Address of Applicant :P.O. Box 39296 Tel Aviv Israel 61392 (33) Name of priority country :U.S.A. Israel (86) International Application No :PCT/IB2011/000097 (72)Name of Inventor : Filing Date :24/01/2011 1)Emanuel PELED (87) International Publication No :WO/2011/089516 2)Arnon BLUM (61) Patent of Addition to Application 3)Adi AHARON :NA Number 4)Yaron KONRA :NA Filing Date 5)Vladimir ZEL (62) Divisional to Application Number :NA 6)Kobby SAADI Filing Date :NA (57) Abstract : A bipolar plate and regenerative fuel cell stacks including the bipolar plates and membrane electrode assemblies (MEAs) alternately stacked. The bipolar plate comprises a plate main body formed of an electrically conductive material. The plate main body has a first surface and a second surface opposite the first surface. Each surface has reaction flow channels through which fluids pass. The reaction flow channels on the first surface have a plurality of ribs therebetween forming an interdigitate flow field pattern. The reaction flow channels on the second surface have a plurality of ribs therebetween forming an interdigitate flow field pattern or a flow field pattern different from an interdigitate flow field pattern e.g. a serpentine flow field pattern. [Figure 1] No. of Pages : 57 No. of Claims : 36 The Patent Office Journal 18/12/2015 65834 (12) PATENT APPLICATION PUBLICATION (21) Application No.7215/DELNP/2012 A (19) INDIA (22) Date of filing of Application :18/08/2012 (43) Publication Date : 18/12/2015 (54) Title of the invention : DESKTOP RECORDING ARCHITECTURE FOR RECORDING CALL SESSIONS OVER A TELEPHONY NETWORK (51) International classification :H04N (71)Name of Applicant : (31) Priority Document No :NA 1)Calabrio Inc. (32) Priority Date :NA Address of Applicant :605 Highway 169 North Minneapolis (33) Name of priority country :NA Minnesota 55441 U.S.A U.S.A. (86) International Application No :PCT/US2011/026835 (72)Name of Inventor : Filing Date :02/03/2011 1)MARTIN II James Paul (87) International Publication No :WO/2011/109492 2)MACIEJ Mike (61) Patent of Addition to Application :NA Number :NA Filing Date (62) Divisional to Application Number :NA Filing Date :NA (57) Abstract : Systems and methods for recording call sessions over a telephony network using a desktop recording architecture are disclosed. An illustrative system for recording call sessions over a telephony network includes one or more user telephone stations equipped with a telephone and computer desktop and one or more additional record services or record servers. A desktop recording service associated with the computer desktop is configured to operate as either a primary or secondary recording service for recording inbound or outbound calls conducted over the user telephone station. No. of Pages : 38 No. of Claims : 25 The Patent Office Journal 18/12/2015 65835 (12) PATENT APPLICATION PUBLICATION (21) Application No.1592/DEL/2014 A (19) INDIA (22) Date of filing of Application :12/06/2014 (43) Publication Date : 18/12/2015 (54) Title of the invention : CARBON NANOTUBE-METAL NANOCOMPOSITES AS FLEXIBLE, FREE STANDING, BINDER FREE HIGH PERFORMANCE ANODE FOR LI-ION BATTERY (51) International classification (31) Priority Document No (32) Priority Date (33) Name of priority country (86) International Application No Filing Date (87) International Publication No (61) Patent of Addition to Application Number Filing Date (62) Divisional to Application Number Filing Date (71)Name of Applicant : :H01M10/0525, 1)COUNCIL OF SCIENTIFIC & INDUSTRIAL :NA RESEARCH :NA Address of Applicant :ANUSANDHAN BHAWAN, RAFI :NA MARG, NEW DELHI - 110001, INDIA. Delhi India :NA (72)Name of Inventor : :NA 1)MAHESHWARI HEDA PRIYANKA : NA 2)ELIZABETH INDU :NA 3)SINGH BHANU PRATAP :NA 4)GUPTA CHANCHAL :NA 5)MATHUR RAKESH BEHARI :NA 6)SUKUMARAN GOPUKUMAR (57) Abstract : The present invention relates to the carbon nanotubes -metal nano composite by chemical route and the corresponding development of strong and flexible, light weight, self-supporting anode through simple vacuum filtration technique, whrh is favored by the high aspect ratio of the Multiwalled carbon nanotubes. The self-supported anode has an added advantage that it can be used as electrodes without binder and electrical cot due .or (unlike other carbonaceous powder materials) that helps us to elucidate the precise electrochemical properties. The metals used can be Sn, Si, Al etc. The developed high capacity, free-standing mode can be used in rechargeable Li-ion batteries and is demonstrated successfully in powering solrr lantern. No. of Pages : 17 No. of Claims : 4 The Patent Office Journal 18/12/2015 65836 (12) PATENT APPLICATION PUBLICATION (21) Application No.5000/DELNP/2015 A (19) INDIA (22) Date of filing of Application :09/06/2015 (43) Publication Date : 18/12/2015 (54) Title of the invention : ORAL CARE PRODUCTS COMPRISING A TETRABASIC ZINC -AMINO ACID - HALIDE COMPLEX (51) International classification :A61K8/27,A61K8/44,A61Q11/00 (71)Name of Applicant : (31) Priority Document No :NA 1)COLGATE PALMOLIVE COMPANY (32) Priority Date :NA Address of Applicant :300 Park Avenue, New York, New (33) Name of priority country :NA York 10022 U.S.A. (86) International Application (72)Name of Inventor : :PCT/US2012/070521 No 1)LIU, Zhiqiang :19/12/2012 Filing Date 2)PAN ,Long (87) International Publication 3)YANG ,Ying :WO 2014/098825 No 4)XU, Guofeng (61) Patent of Addition to 5)STRANICK ,Michael A. :NA Application Number :NA Filing Date (62) Divisional to Application :NA Number :NA Filing Date (57) Abstract : Described herein are oral care compositions comprising a tetrabasic zinc halide and an amino acid; along with methods of making and using the same. No. of Pages : 36 No. of Claims : 17 The Patent Office Journal 18/12/2015 65837 (12) PATENT APPLICATION PUBLICATION (21) Application No.5001/DELNP/2015 A (19) INDIA (22) Date of filing of Application :09/06/2015 (43) Publication Date : 18/12/2015 (54) Title of the invention : ORAL GEL COMPRISING ZINC - AMINO ACID COMPLEX (51) International classification :A61K8/27,A61K8/44,A61Q11/00 (71)Name of Applicant : (31) Priority Document No :NA 1)COLGATE- PALMOLIVE COMPANY (32) Priority Date :NA Address of Applicant :300 Park Avenue, New York, NY (33) Name of priority country :NA 10022 U.S.A. (86) International Application (72)Name of Inventor : :PCT/US2012/070513 No 1)PAN, Long :19/12/2012 Filing Date 2)YUAN ,Shaotang (87) International Publication 3)PATEL, Vyoma :WO 2014/098824 No 4)PILCH, Shira (61) Patent of Addition to 5)MASTERS ,James G. :NA Application Number 6)LIU ,Zhiqiang :NA Filing Date (62) Divisional to Application :NA Number :NA Filing Date (57) Abstract : Disclosed herein are dentifrices comprising a zinc amino acid halide , which provide a precipitate of zinc oxide upon use with dilution with water and/or saliva. Methods of making and using the dentifrices are also provided. No. of Pages : 40 No. of Claims : 18 The Patent Office Journal 18/12/2015 65838 (12) PATENT APPLICATION PUBLICATION (21) Application No.5002/DELNP/2015 A (19) INDIA (22) Date of filing of Application :09/06/2015 (43) Publication Date : 18/12/2015 (54) Title of the invention : ZINC AMINO ACID HALIDE MOUTHWASHES (51) International classification :A61K8/27,A61K8/44,A61Q11/00 (71)Name of Applicant : (31) Priority Document No :NA 1)COLGATE- PALMOLIVE COMPANY (32) Priority Date :NA Address of Applicant :300 Park Avenue, New York, NY (33) Name of priority country :NA 10022 U.S.A. (86) International Application (72)Name of Inventor : :PCT/US2012/070506 No 1)PAN, Long :19/12/2012 Filing Date 2)YUAN ,Shaotang (87) International Publication 3)PILCH, Shira :WO 2014/098822 No 4)MASTERS, James G. (61) Patent of Addition to 5)LIU, Zhiqiang :NA Application Number :NA Filing Date (62) Divisional to Application :NA Number :NA Filing Date (57) Abstract : Disclosed herein are mouthwashes comprising a complex of a zinc ion source acid. Methods of making and using the compositions are also provided. No. of Pages : 42 No. of Claims : 21 The Patent Office Journal 18/12/2015 65839 (12) PATENT APPLICATION PUBLICATION (21) Application No.7220/DELNP/2012 A (19) INDIA (22) Date of filing of Application :20/08/2012 (43) Publication Date : 18/12/2015 (54) Title of the invention : TRIAZINE DERIVATIVE &NBSP; AND APPLICATION THEREOF• (51) International classification :C07C (71)Name of Applicant : (31) Priority Document No :2010-032467 1)NIPPON KASEI CHEMICAL COMPANY LIMITED (32) Priority Date :17/02/2010 Address of Applicant :34 Aza-Takayama Onahama Iwaki(33) Name of priority country :Japan shi Fukushima-ken 9718101 Japan (86) International Application No :PCT/JP2011/052249 (72)Name of Inventor : Filing Date :03/02/2011 1)MABUKO YAMAURA (87) International Publication No :WO 2011/102231 2)YUKIO ORIKASA (61) Patent of Addition to Application 3)KAZUYA SENZAKI :NA Number 4)TAKASHI KAGAWA :NA Filing Date (62) Divisional to Application Number :NA Filing Date :NA (57) Abstract : The object of the present invention is to provide a novel triazine derivative which is excellent in the heat resistance and rapid in the cross-linking rate, and can be suitably used as a crosslinking agent. The present invention relates to a triazine derivative represented by the general formula (1). [Chemical formula 1] (In the formula (I), Y and X are each independently, represents a diallylamino group, mono-allylamino group, allyloxy group or methallyloxy group; and Z represents an allyloxy group or methallyloxy group) No. of Pages : 38 No. of Claims : 15 The Patent Office Journal 18/12/2015 65840 (12) PATENT APPLICATION PUBLICATION (21) Application No.7221/DELNP/2012 A (19) INDIA (22) Date of filing of Application :20/08/2012 (43) Publication Date : 18/12/2015 (54) Title of the invention : CROSS-LINKING AGENT FOR CROSS-LINKABLE ELASTOMER AND APPLICATION THEREOF• (51) International classification :C07C (71)Name of Applicant : (31) Priority Document No :2010-032466 1)NIPPON KASEI CHEMICAL COMPANY LIMITED (32) Priority Date :17/02/2010 Address of Applicant :34 Aza-Takayama Onahama Iwaki(33) Name of priority country :Japan shi Fukushima-ken 9718101 Japan (86) International Application No :PCT/JP2011/052248 (72)Name of Inventor : Filing Date :03/02/2011 1)MABUKO YAMAURA (87) International Publication No :WO 2011/102230 2)YUKIO ORIKASA (61) Patent of Addition to Application 3)KAZUYA SENZAKI :NA Number 4)TAKASHI KAGAWA :NA Filing Date (62) Divisional to Application Number :NA Filing Date :NA (57) Abstract : The object of the present invention is to provide a cross-linking agent for a cross-linkable elastomer which is rapid in the cross-linking rate in comparison with triallyl isocyanurate (TAIC)m The present invention relates to a cross-linking agent for a cross-linkable elastomer comprising a bisisocyanurate derivative represented by the general formula (I). [Chemical formula 1] (In the formula, X represents the Cl to C12 alkenylene group or Cl to C12 alkylene group, which may contain a carbonyl group, an ether bond or an ester bond in the main chain, and further a substituent in the side chain; at least two of Y1, Y2, Y3 and Y are each independently an allyl group which may be substituted, and the rest is a hydrogen atom or a hydrocarbon group which may be substituted.) No. of Pages : 23 No. of Claims : 12 The Patent Office Journal 18/12/2015 65841 (12) PATENT APPLICATION PUBLICATION (21) Application No.4998/DELNP/2015 A (19) INDIA (22) Date of filing of Application :09/06/2015 (43) Publication Date : 18/12/2015 (54) Title of the invention : ARYL AND HETEROARYL FUSED LACTAMS (51) International (71)Name of Applicant : :C07D401/06,C07D401/14,C07D413/14 classification 1)PFIZER INC. (31) Priority Document Address of Applicant :235 East 42nd Street, New York, NY :61/740596 No 10017 U.S.A. (32) Priority Date :21/12/2012 (72)Name of Inventor : (33) Name of priority 1)EDWARDS ,Martin Paul :U.S.A. country 2)KUMPF ,Robert Arnold (86) International 3)KUNG, Pei -Pei :PCT/IB2013/060682 Application No 4)MCALPINE, Indrawan James :05/12/2013 Filing Date 5)NINKOVIC ,Sacha (87) International 6)RUI ,Eugene Yuanjin :WO 2014/097041 Publication No 7)SUTTON ,Scott Channing (61) Patent of Addition to 8)TATLOCK, John Howard :NA Application Number 9)WYTHES, Martin James :NA Filing Date 10)ZEHNDER ,Luke Raymond (62) Divisional to :NA Application Number :NA Filing Date (57) Abstract : This invention relates to compounds of general Formula (I) in which R1, R2, U, V, L, M, R5, m, X, Y and Z are as defined herein, and the pharmaceutically acceptable salts thereof , to pharmaceutical compositions comprising such compounds and salts , and to methods of using such compounds , salts and compositions for the treatment of abnormal cell growth , including cancer. No. of Pages : 257 No. of Claims : 15 The Patent Office Journal 18/12/2015 65842 (12) PATENT APPLICATION PUBLICATION (21) Application No.4999/DELNP/2015 A (19) INDIA (22) Date of filing of Application :09/06/2015 (43) Publication Date : 18/12/2015 (54) Title of the invention : TWO COMPONENT COMPOSITIONS CONTAINING ZINC AMINO ACID HALIDE COMPLEXES AND CYSTEINE (51) International classification :A61K8/27,A61K8/44,A61Q11/00 (71)Name of Applicant : (31) Priority Document No :PCT/US2012/070489 1)COLGATE PALMOLIVE COMPANY (32) Priority Date :19/12/2012 Address of Applicant :300 Park Avenue, New York, New (33) Name of priority country :U.S.A. York 10022 U.S.A. (86) International Application (72)Name of Inventor : :PCT/US2013/068859 No 1)LIU, Zhiqiang :07/11/2013 Filing Date 2)PAN ,Long (87) International Publication 3)CONVERY ,Joseph :WO 2014/099166 No 4)YUAN ,Shaotang (61) Patent of Addition to 5)TRIVEDI ,Harsh M. :NA Application Number :NA Filing Date (62) Divisional to Application :NA Number :NA Filing Date (57) Abstract : Provided are compositions e.g., oral and personal care products, comprising (i) a zinc (amino acid or trialkyl glycine) halide complex , and (ii) cysteine in free or in orally or cosmetically acceptable salt form , together with methods of making and using the same. No. of Pages : 44 No. of Claims : 23 The Patent Office Journal 18/12/2015 65843 (12) PATENT APPLICATION PUBLICATION (21) Application No.7226/DELNP/2012 A (19) INDIA (22) Date of filing of Application :20/08/2012 (43) Publication Date : 18/12/2015 (54) Title of the invention : SOYBEAN TRANSFORMATION USING HPPD INHIBITORS AS SELECTION AGENTS (51) International classification :C07C (71)Name of Applicant : (31) Priority Document No :10356007.4 1)BAYER CROPSCIENCE AG (32) Priority Date :02/02/2010 Address of Applicant :Alfred-Nobel-Strasse 50 40789 (33) Name of priority country :EPO Monheim Germany Germany (86) International Application No :PCT/EP2011/051340 (72)Name of Inventor : Filing Date :01/02/2011 1)FLAVIE COULOMBIER (87) International Publication No :WO 2011/095460 2)H‰LˆNE ECKERT (61) Patent of Addition to Application 3)YANNICK FAVRE :NA Number 4)BERNARD PELISSIER :NA Filing Date (62) Divisional to Application Number :NA Filing Date :NA (57) Abstract : The invention relates to methods for Agrobacterium-mediated transformation of soybean organogenic tissue using a gene or genes for tolerance to HPPD inhibitors as selection marker. The invention also relates to methods for regenerating transgenic soybean plants from said transformed soybean cells or tissue, and to transgenic soybean plants and seeds obtained by such methods. No. of Pages : 41 No. of Claims : 13 The Patent Office Journal 18/12/2015 65844 (12) PATENT APPLICATION PUBLICATION (21) Application No.7227/DELNP/2012 A (19) INDIA (22) Date of filing of Application :20/08/2012 (43) Publication Date : 18/12/2015 (54) Title of the invention : A METHOD FOR INCREASING PHOTOSYNTHETIC CARBON FIXATION USING GLYCOLATE DEHYDROGENASE MULTI-SUBUNIT FUSION PROTEIN (51) International classification :C07C (71)Name of Applicant : (31) Priority Document No :10152714.1 1)BAYER CROPSCIENCE AG (32) Priority Date :04/02/2010 Address of Applicant :Alfred-Nobel-Strasse 50 40789 (33) Name of priority country :EPO Monheim Germany Germany (86) International Application No :PCT/EP2011/051505 (72)Name of Inventor : Filing Date :03/02/2011 1)FRITZ KREUZALER (87) International Publication No :WO/2011/095528 2)GRETA NOELKE (61) Patent of Addition to Application 3)CHRISTOPH PETERHAENSEL :NA Number 4)STEFAN SCHILLBERG :NA Filing Date (62) Divisional to Application Number :NA Filing Date :NA (57) Abstract : The invention relates to a method for stimulating the growth of the plants and/or improving the biomass production and/or increasing the carbon fixation by the plant comprising introducing into a plant cell, plant tissue or plant one or more nucleic acids, wherein the introduction of the nucleic acid(s) results inside the chloroplast of a de novo expression of one or more polypeptides having the enzymatic activity of a glycolate dehydrogenase made up from translationally fused subunits of bacterial multi-subunit glycolate dehydrogenase enzymes. No. of Pages : 31 No. of Claims : 22 The Patent Office Journal 18/12/2015 65845 (12) PATENT APPLICATION PUBLICATION (21) Application No.7228/DELNP/2012 A (19) INDIA (22) Date of filing of Application :20/08/2012 (43) Publication Date : 18/12/2015 (54) Title of the invention : DIAGNOSTIC METHOD FOR ENDOMETRIAL RECEPTIVITY• (51) International classification :C12N (71)Name of Applicant : (31) Priority Document No :10382011.4 1)EQUIPO IVI INVESTIGACIN S.L. (32) Priority Date :21/01/2010 Address of Applicant :Guadassuar 1 E-46015 Valencia Spain (33) Name of priority country :EPO (72)Name of Inventor : (86) International Application No :PCT/EP2011/050867 1)CARLOS SIMN VALL‰S Filing Date :21/01/2011 2)ANTONIO PELLICER MART•NEZ (87) International Publication No :WO/2011/089240 3)SCAR BERLANGA ATIENZA (61) Patent of Addition to Application :NA Number :NA Filing Date (62) Divisional to Application Number :NA Filing Date :NA (57) Abstract : The invention relates to a non-invasive diagnostic method of endometrial receptivity which includes collecting and comparing lipid biomarker patterns to reference lipidomic biomarkers, particularly prostaglandins PGE2 and/or PGF2α. The method is especially applicable for determining status fertility of a mammalian female, preferably, a woman. No. of Pages : 37 No. of Claims : 15 The Patent Office Journal 18/12/2015 65846 (12) PATENT APPLICATION PUBLICATION (21) Application No.7229/DELNP/2012 A (19) INDIA (22) Date of filing of Application :20/08/2012 (43) Publication Date : 18/12/2015 (54) Title of the invention : METHOD FOR PRODUCING A COLOUR- AND/OR EFFECT-PRODUCING MULTILAYER COATING (51) International classification :C07C (71)Name of Applicant : (31) Priority Document No :10 2010 012 449.4 1)BASF COATINGS GMBH (32) Priority Date :24/03/2010 Address of Applicant :Glasuritstrasse 1 48165 Munster (33) Name of priority country :Germany Germany Germany (86) International Application No :PCT/EP2011/054563 (72)Name of Inventor : Filing Date :24/03/2011 1)BERNHARD STEINMETZ (87) International Publication No :WO 2011/117364 (61) Patent of Addition to Application :NA Number :NA Filing Date (62) Divisional to Application Number :NA Filing Date :NA (57) Abstract : The present invention relates to a method for producing a multicoat color and/or effect paint system, by (1) applying a pigmented aqueous basecoat to a substrate, (2) forming a polymer film from the coating applied in stage (1), (3) applying a clearcoat to the resultant basecoat film, and then (4) curing the basecoat film together with the clearcoat film. The method of the invention comprises using in stage (1) a pigmented aqueous basecoat which comprises at least one vinyl ether of the general formula R®OCH= CH2 where R is an unsubstituted or substituted organic radical selected from the group consisting of alkyl, cycloalkyl, aryl, and alkaryl radicals having 4 to 18 carbon atoms, and where the vinyl ether content of the basecoat is 0.1 % to 5% by weight, based on the total weight of the basecoat. No. of Pages : 17 No. of Claims : 7 The Patent Office Journal 18/12/2015 65847 (12) PATENT APPLICATION PUBLICATION (21) Application No.6942/DELNP/2015 A (19) INDIA (22) Date of filing of Application :06/08/2015 (43) Publication Date : 18/12/2015 (54) Title of the invention : CODE FOR PATIENT CARE DEVICE CONFIGURATION (51) International classification :G06F19/00 (71)Name of Applicant : (31) Priority Document No :61/762725 1)BAXTER CORPORATION ENGLEWOOD (32) Priority Date :08/02/2013 Address of Applicant :9540 S. Maroon Circle Englewood (33) Name of priority country :U.S.A. Colorado 80112 U.S.A. (86) International Application No :PCT/US2013/032515 (72)Name of Inventor : Filing Date :15/03/2013 1)SCHNEIDER Dennis I. (87) International Publication No :WO 2014/123555 (61) Patent of Addition to Application :NA Number :NA Filing Date (62) Divisional to Application Number :NA Filing Date :NA (57) Abstract : Configuration output for use in configuring a patient care device for administration of a therapy to a patient. The configuration output may include at least one code. The code may be used in the verification and/or indication of at least one configuration data component used in the configuration of the patient care device to be used to administer a therapy to a patient. Additionally a check code for validation of the entry of the code and/or check code may be provided. No. of Pages : 52 No. of Claims : 54 The Patent Office Journal 18/12/2015 65848 (12) PATENT APPLICATION PUBLICATION (21) Application No.6943/DELNP/2015 A (19) INDIA (22) Date of filing of Application :06/08/2015 (43) Publication Date : 18/12/2015 (54) Title of the invention : TELECHELIC N ALKYLATED POLYAMIDE POLYMERS AND COPOLYMERS (51) International (71)Name of Applicant : :C08G69/00,C08G69/26,C08G69/36 classification 1)LUBRIZOL ADVANCED MATERIALS INC. (31) Priority Document No :61/764211 Address of Applicant :9911 Brecksville Road Cleveland Ohio (32) Priority Date :13/02/2013 44141 3247 U.S.A. (33) Name of priority country :U.S.A. (72)Name of Inventor : (86) International 1)ERDODI Gabor :PCT/US2014/014422 Application No 2)POURAHMADY Naser :03/02/2014 Filing Date 3)LAI John Ta Yuan (87) International Publication :WO 2014/126739 No (61) Patent of Addition to :NA Application Number :NA Filing Date (62) Divisional to :NA Application Number :NA Filing Date (57) Abstract : Low glass transition temperature polyamide oligomers or telechelic polyamides are formed from monomers forming tertiary amide linkages. These polyamides can be used with co reactants to form high molecular weight or crosslinked polymers with desirable polyamide properties. No. of Pages : 31 No. of Claims : 21 The Patent Office Journal 18/12/2015 65849 (12) PATENT APPLICATION PUBLICATION (21) Application No.6944/DELNP/2015 A (19) INDIA (22) Date of filing of Application :06/08/2015 (43) Publication Date : 18/12/2015 (54) Title of the invention : LOZENGE FOR TREATING A SORE THROAT HOARSENESS AND ASSOCIATED DRY COUGH AND FOR TREATING INFLAMMATORY DISEASES OF THE ORAL CAVITY AND OF THE PHARYNX (51) International classification :A61K36/09 (71)Name of Applicant : (31) Priority Document No :13161902.5 1)BOEHRINGER INGELHEIM INTERNATIONAL (32) Priority Date :02/04/2013 GMBH (33) Name of priority country :EPO Address of Applicant :Binger Str. 173 55216 Ingelheim am (86) International Application No :PCT/EP2014/056437 Rhein Germany Filing Date :31/03/2014 (72)Name of Inventor : (87) International Publication No :WO 2014/161811 1)BONI Julia (61) Patent of Addition to Application 2)PLOHMANN Bernd :NA Number 3)SAUERLAND Sandra :NA Filing Date (62) Divisional to Application Number :NA Filing Date :NA (57) Abstract : The invention relates to a pharmaceutical dosage form containing a combination of (a) at least one astringent active ingredient and (b) at least one mucolytic drug and to the use of said pharmaceutical dosage form to prevent or treat inflammatory diseases of the oral cavity and of the pharynx and to treat painful irritations of the mucosae in the mouth region and pharynx region and dry cough associated therewith. No. of Pages : 19 No. of Claims : 20 The Patent Office Journal 18/12/2015 65850 (12) PATENT APPLICATION PUBLICATION (21) Application No.7235/DELNP/2012 A (19) INDIA (22) Date of filing of Application :20/08/2012 (43) Publication Date : 18/12/2015 (54) Title of the invention : CONTINUOUS PATTERNED LAYER DEPOSITION (51) International classification :C07C (71)Name of Applicant : (31) Priority Document No :10154037.5 1)NEDERLANDSE ORGANISATIE VOOR TOEGEPAST(32) Priority Date :18/01/2010 NATUURWETENSCHAPPELIJK ONDERZOEK TNO (33) Name of priority country :EPO Address of Applicant :Schoemakerstraat 97 NL-2628 VK (86) International Application No :PCT/NL2011/050112 Delft Netherlands Filing Date :17/02/2011 (72)Name of Inventor : (87) International Publication No :WO/2011/102718 1)DE GRAAF Ari«l (61) Patent of Addition to Application 2)VAN ZWET Erwin John :NA Number 3)POODT Paulus Willibrordus George :NA Filing Date 4)VERMEER Adrianus Johannes Petrus Maria (62) Divisional to Application Number :NA Filing Date :NA (57) Abstract : A method of manufacturing a substrate with a patterned layer of deposited material, the patterned layer being deposited from a processing head, the method comprising - applying bearing gas from the processing head to keep the processing head hovering over the substrate on a gas bearing; - moving the substrate and the hovering processing head relative to each other; - applying a primer material for selective deposition of a deposition material to the substrate, the primer material being applied from a first area of a surface of the processing head that faces the substrate, and spatially patterning the primer on the substrate after or during application; applying the deposition material to the substrate from a second area of the surface of the processing head that faces the substrate, the second area lying downstream of the first area in a direction of the movement of the substrate relative to the processing head. No. of Pages : 21 No. of Claims : 13 The Patent Office Journal 18/12/2015 65851 (12) PATENT APPLICATION PUBLICATION (21) Application No.7236/DELNP/2012 A (19) INDIA (22) Date of filing of Application :20/08/2012 (43) Publication Date : 18/12/2015 (54) Title of the invention : WINDSHIELD TREATMENT AND WIPER BLADE COMBINATION (51) International classification :B62D (71)Name of Applicant : (31) Priority Document No :61/306,668 1)ITW CCIP HOLDINGS LLC (32) Priority Date :22/02/2010 Address of Applicant :1201 North Market Street P.O. Box (33) Name of priority country :U.S.A. 1347 Wilmington Delaware 19801 U.S.A. (86) International Application No :PCT/US2011/022055 (72)Name of Inventor : Filing Date :21/01/2011 1)FANG Jiafu (87) International Publication No :WO/2011/102939 2)MINEVSKI Liliana (61) Patent of Addition to Application 3)TEAL Kenneth Henry :NA Number :NA Filing Date (62) Divisional to Application Number :NA Filing Date :NA (57) Abstract : A system for creating a water repellant coating on a windshield comprises a water repellant surface treatment comprising a siliconecontaining compound and a water repellant wiper blade comprising a natural or synthetic or semi-synthetic rubber squeegee body and a water repellant coating comprising a hydrophobic polymeric film former and a hydrophobicity-enabling agent such as polyalkylsiloxane (modified or non-modified) silicone fluids. The polymeric film can be made from a compound selected from the group consisting of polyol resins urethane resins fluorine resins epoxy resins and silicone resins and may further include a friction reducing agent selected from the group consisting of graphite PTFE and molybdenum disulfide powders. No. of Pages : 22 No. of Claims : 10 The Patent Office Journal 18/12/2015 65852 (12) PATENT APPLICATION PUBLICATION (21) Application No.6951/DELNP/2015 A (19) INDIA (22) Date of filing of Application :06/08/2015 (43) Publication Date : 18/12/2015 (54) Title of the invention : THIRD PARTY APPLICATION COMMUNICATION API (51) International classification :G06F15/00 (71)Name of Applicant : (31) Priority Document No :61/762902 1)WIXPRESS LTD. (32) Priority Date :10/02/2013 Address of Applicant :40 Namal Tel Aviv Street 6350671 Tel (33) Name of priority country :U.S.A. Aviv Israel (86) International Application No :PCT/IB2014/058882 (72)Name of Inventor : Filing Date :10/02/2014 1)ABRAHAMI Yoav (87) International Publication No :WO 2014/122628 (61) Patent of Addition to Application :NA Number :NA Filing Date (62) Divisional to Application Number :NA Filing Date :NA (57) Abstract : A device for a website building system. The device includes a page composer to create a page containing website instances of at least one third party application and a configurer to define a 2 way communication backchannel between the page and the at least one third party application or between the at least one third party application and at least one other third party application. The device also includes a coordinator to coordinate communication according to the communication backchannel when the page is viewed or accessed. No. of Pages : 74 No. of Claims : 37 The Patent Office Journal 18/12/2015 65853 (12) PATENT APPLICATION PUBLICATION (21) Application No.6952/DELNP/2015 A (19) INDIA (22) Date of filing of Application :06/08/2015 (43) Publication Date : 18/12/2015 (54) Title of the invention : METHOD PROCESSING MODULES AND SYSTEM FOR EXECUTING AN EXECUTABLE CODE (51) International classification :G06F9/50,G06F9/45 (71)Name of Applicant : (31) Priority Document No :13000810.5 1)HYBRIDSERVER TEC GMBH (32) Priority Date :18/02/2013 Address of Applicant :Suedportal 1 22848 Norderstedt (33) Name of priority country :EPO Germany (86) International Application No :PCT/EP2014/053040 (72)Name of Inventor : Filing Date :17/02/2014 1)ASLAN Halis (87) International Publication No :WO 2014/125109 2)ZIELINSKI Tobias (61) Patent of Addition to Application 3)DUERKOP Hendrik :NA Number 4)SAREMI Farbod :NA Filing Date (62) Divisional to Application Number :NA Filing Date :NA (57) Abstract : The present invention provides execution of an executable code by a set of processing modules wherein the executable code is executed by at least one first processing module of the set of processing modules wherein said executable code comprises a set of parallel executable parts wherein each parallel executable part of the executable code comprises at least two parallel executable steps and wherein said executing comprises: detecting by the at least one first processing module a parallel executable part of the set of parallel executable parts of the executable code to be executed; selecting by the at least one first processing module at least two second processing modules of the set of processing modules; and commanding by the at least one first processing module the selected at least two second processing modules to perform the at least two parallel executable steps of the detected parallel executable part of the executable code. No. of Pages : 62 No. of Claims : 20 The Patent Office Journal 18/12/2015 65854 (12) PATENT APPLICATION PUBLICATION (21) Application No.6953/DELNP/2015 A (19) INDIA (22) Date of filing of Application :06/08/2015 (43) Publication Date : 18/12/2015 (54) Title of the invention : SAMPLE PREPARATION ON A SOLID SUPPORT (51) International classification :C12Q1/68 (71)Name of Applicant : (31) Priority Document No :61/750682 1)ILLUMINA CAMBRIDGE LIMITED (32) Priority Date :09/01/2013 Address of Applicant :Little Chesterford Nr Saffron Walden (33) Name of priority country :U.S.A. Essex CB10 1XL U.K. (86) International Application No :PCT/IB2014/000610 (72)Name of Inventor : Filing Date :08/01/2014 1)GORMLEY Niall Anthony (87) International Publication No :WO 2014/108810 2)SMITH Geoffrey Paul (61) Patent of Addition to Application :NA Number :NA Filing Date (62) Divisional to Application Number :NA Filing Date :NA (57) Abstract : Presented are methods and compositions for using immobilized transposase and a transposon end for generating an immobilized library of 5 tagged double stranded target DNA on a surface. The methods are useful for generating 5 and 3 tagged DNA fragments for use in a variety of processes including massively parallel DNA sequencing. No. of Pages : 75 No. of Claims : 103 The Patent Office Journal 18/12/2015 65855 (12) PATENT APPLICATION PUBLICATION (21) Application No.7245/DELNP/2012 A (19) INDIA (22) Date of filing of Application :20/08/2012 (43) Publication Date : 18/12/2015 (54) Title of the invention : SIGNAL TRANSMISSION DEVICE FOR TIRE PRESSURE GAUGE WITH A GAS NIPPLE (51) International classification :B62D (71)Name of Applicant : (31) Priority Document No :201010213119.9 1)STEELMATE CO. LTD (32) Priority Date :24/06/2010 Address of Applicant :Steelmate Industry Park Heping (33) Name of priority country :China Avenue Dongfu Road Dongfeng Town Zhongshan City (86) International Application No :PCT/CN2010/075170 Guangdong province P.R. China 528425 China Filing Date :15/07/2010 (72)Name of Inventor : (87) International Publication No :WO 2011/160316 1)LI Zhitao (61) Patent of Addition to Application :NA Number :NA Filing Date (62) Divisional to Application Number :NA Filing Date :NA (57) Abstract : A signal transmitting device of a tire pressure meter with a tire valve is disclosed. The tire pressure meter (1) comprises a circuit board (12) furnished with a signal transmitting circuit (121) and a housing (11) encapsulating said circuit board. Said transmitting device comprises: a tire pressure monitoring circuit (123), which is used to monitor the pressure in the tire and convert it into the electric signal; a transmitting circuit fixed on the circuit board, which is used to convert said electric signal into the signal to be transmitted; a cylindrical coil (128), of which one end is electrically connected to said transmitting circuit to receive said signal to be transmitted and transmit said signal to be transmitted to the external space by itself, and as an impedance matching element the other end is electrically connected to the tire valve to transfer said signal to the tire valve; the tire valve, which is universally connected to the housing of the tire pressure meter and transmits the signal to be transmitted to the space. The tire valve in said signal transmitting device is a main antenna, and the cylindrical coil can not only play the role of matching impedance but also transmit the signal as an accessory antenna. No. of Pages : 23 No. of Claims : 7 The Patent Office Journal 18/12/2015 65856 (12) PATENT APPLICATION PUBLICATION (21) Application No.7230/DELNP/2012 A (19) INDIA (22) Date of filing of Application :20/08/2012 (43) Publication Date : 18/12/2015 (54) Title of the invention : FLUID TRANSFER ASSEMBLY WITH VENTING ARRANGEMENT (51) International classification :B62D (71)Name of Applicant : (31) Priority Document No :204141 1)MEDIMOP MEDICAL PROJECTS LTD (32) Priority Date :24/02/2010 Address of Applicant :17 Hatidhar Street P.O. Box 2499 (33) Name of priority country :Israel 43665 Ra™anana Israel Israel (86) International Application No :PCT/IL2011/000186 (72)Name of Inventor : Filing Date :23/02/2011 1)NIMROD LEV (87) International Publication No :WO/2011/104711 2)NIV BEN SHALOM (61) Patent of Addition to Application 3)AMIR LEV :NA Number :NA Filing Date (62) Divisional to Application Number :NA Filing Date :NA (57) Abstract : A fluid transfer assembly including a vented female vial adapter and male vial adapter for use with a pair of vials including a vial with contents under negative pressure for liquid drug reconstitution and administration purposes. The vented female vial adapter includes a venting arrangement and the male vial adapter includes a sealing arrangement for selectively sealing the venting arrangement. The fluid transfer assembly is designed such that only filtered air is drawn into the vial under negative pressure subsequent to reconstitution of liquid drug contents to ensure sterile conditions. No. of Pages : 29 No. of Claims : 10 The Patent Office Journal 18/12/2015 65857 (12) PATENT APPLICATION PUBLICATION (21) Application No.7231/DELNP/2012 A (19) INDIA (22) Date of filing of Application :20/08/2012 (43) Publication Date : 18/12/2015 (54) Title of the invention : A DATA PROCESSING APPARATUS AND METHOD FOR SWITCHING A WORKLOAD BETWEEN FIRST AND SECOND PROCESSING CIRCUITRY (51) International classification :H04N (71)Name of Applicant : (31) Priority Document No :12/659,234 1)ARM LIMITED (32) Priority Date :01/03/2010 Address of Applicant :110 Fulbourn Road Cherry Hinton (33) Name of priority country :U.S.A. Cambridge CB1 9NJ United Kingdom U.K. (86) International Application No :PCT/GB2011/050317 (72)Name of Inventor : Filing Date :17/02/2011 1)PETER RICHARD GREENHALGH (87) International Publication No :WO/2011/107776 2)RICHARD ROY GRISENTHWAITE (61) Patent of Addition to Application :NA Number :NA Filing Date (62) Divisional to Application Number :NA Filing Date :NA (57) Abstract : A data processing apparatus and method are provided for switching performance of a workload between two processing circuits. The data processing apparatus has first processing circuitry which is architecturally compatible with second processing circuitry, but with the first processing circuitry being micro-architecturally different from the second processing circuitry. At any point in time, a workload consisting of at least one application and at least one operating system for running that application is performed by one of the first processing circuitry and the second processing circuitry. A switch controller is responsive to a transfer stimulus to perform a handover operation to transfer performance of the workload from source processing circuitry to destination processing circuitry, with the source processing circuitry being one of the first and second processing circuitry and the destination processing circuitry being the other of the first and second processing circuitry. During the handover operation, the switch controller causes the source processing circuitry to makes it current architectural state available to the destination processing circuitry, the current architectural state being that state not available from shared memory at a time the handover operation is initiated, and that is necessary for the destination processing circuitry to successfully take over performance of the workload from the source processing circuitry. In addition, the switch controller masks predetermined processor specific configuration information from the at least one operating system such that the transfer of the workload is transparent to that operating system. Such an approach has been found to yield significant energy consumption benefits whilst avoiding complexities associated with providing operating systems with the capability for switching applications between processing circuits. No. of Pages : 57 No. of Claims : 20 The Patent Office Journal 18/12/2015 65858 (12) PATENT APPLICATION PUBLICATION (21) Application No.7232/DELNP/2012 A (19) INDIA (22) Date of filing of Application :20/08/2012 (43) Publication Date : 18/12/2015 (54) Title of the invention : FIRE-RESISTANT GLAZING (51) International classification :A61M (71)Name of Applicant : (31) Priority Document No :BE 2010/0196 1)AGC GLASS EUROPE (32) Priority Date :29/03/2010 Address of Applicant :Chaussee de La Hulpe 166 B-1170 (33) Name of priority country :Belgium Bruxelles (Watermael-Boitsfort) Belgium (86) International Application No :PCT/EP2011/054706 (72)Name of Inventor : Filing Date :28/03/2011 1)PIERRE GOELFF (87) International Publication No :WO/2011/120909 (61) Patent of Addition to Application :NA Number :NA Filing Date (62) Divisional to Application Number :NA Filing Date :NA (57) Abstract : The invention relates to an anti-fire glazing having a set of at least two panes of glass, between which there are located at least two layers of intumescent material based on hydrated alkali metal silicate, the compositions of these two layers differing from one another, one having a molar SiO2/Na2O ratio greater than 3.5 and the other having a molar ratio less than 3.2. No. of Pages : 20 No. of Claims : 19 The Patent Office Journal 18/12/2015 65859 (12) PATENT APPLICATION PUBLICATION (21) Application No.7233/DELNP/2012 A (19) INDIA (22) Date of filing of Application :20/08/2012 (43) Publication Date : 18/12/2015 (54) Title of the invention : CONTROL DEVICE AND ELECTRONIC DEVICE COMPRISING SAME• (51) International classification :H04N (71)Name of Applicant : (31) Priority Document No :1000210 1)NEXYS (32) Priority Date :20/01/2010 Address of Applicant :111 Avenue Victor Hugo F-75116 (33) Name of priority country :France Paris France (86) International Application No :PCT/FR2011/050109 (72)Name of Inventor : Filing Date :20/01/2011 1)S‰BASTIEN PHILIPPE (87) International Publication No :WO 2011/089363 (61) Patent of Addition to Application :NA Number :NA Filing Date (62) Divisional to Application Number :NA Filing Date :NA (57) Abstract : The control device comprises at least one emitter-receiver pair (210, 216 to 219), made up of a radiation emitter and a receiver for the radiation emitted by said emitter and reflected by a moving body located at a distance from the pair, within the emission field of said emitter and designed to provide an electrical signal that represents the radiation received from the emitter, characterized in that it comprises, in addition: - a display means (211 to 214) designed, for at least one pair, to display at least one symbol that identifies an action, opposite an intersection of said emitters emission cone, said emitter and said receiver being thus outside the display area of each symbol and - a means of control designed to provide action instruction signals depending on the electrical signal provided by at least one said receiver; each emitter-receiver pair is thus associated with at least one symbol and at least one action instruction when the moving body is in front of the symbol that identifies said action. (Figure 2B) No. of Pages : 25 No. of Claims : 13 The Patent Office Journal 18/12/2015 65860 (12) PATENT APPLICATION PUBLICATION (21) Application No.5722/DELNP/2012 A (19) INDIA (22) Date of filing of Application :26/06/2012 (43) Publication Date : 18/12/2015 (54) Title of the invention : BLOOD TRANSCRIPTIONAL SIGNATURE OF ACTIVE VERSUS LATENT MYCOBACTERIUM TUBERCULOSIS INFECTION (51) International (71)Name of Applicant : :C12Q1/68,C12N15/31,G01N33/15 classification 1)BAYLOR RESEARCH INSTITUTE (31) Priority Document No :12/628148 Address of Applicant :3310 Live Oak Street Suite 501 Dallas (32) Priority Date :30/11/2009 TX 75204 U.S.A. (33) Name of priority country :U.S.A. 2)MEDICAL RESEARCH COUNCIL (86) International Application 3)IMPERIAL COLLEGE HEALTHCARE NHS TRUST :PCT/US2010/046042 No (72)Name of Inventor : :19/08/2010 Filing Date 1)BANCHEREAU Jacques F. (87) International Publication 2)CHAUSSABEL Damien :WO 2011/066008 No 3)OGARRA Anne (61) Patent of Addition to 4)BERRY Matthew :NA Application Number 5)KON Onn Min :NA Filing Date (62) Divisional to Application :NA Number :NA Filing Date (57) Abstract : Mycobacterium tuberculosisMycobacterium tuberculosisMycobacterium tuberculosisMycobacterium tuberculosisMycobacterium tuberculosisThe present invention includes methods systems and kits for distinguishing between active and latent infection in a patient suspected of being infected with the method including the steps of obtaining a patient gene expression dataset from a patient suspected of being infected with ; sorting the patient gene expression dataset into one or more gene modules associated with infection; and comparing the patient gene expression dataset for each of the one or more gene modules to a gene expression dataset from a non patient; wherein an increase or decrease in the totality of gene expression in the patient gene expression dataset for the one or more gene modules is indicative of active infection. No. of Pages : 121 No. of Claims : 25 The Patent Office Journal 18/12/2015 65861 (12) PATENT APPLICATION PUBLICATION (21) Application No.7240/DELNP/2012 A (19) INDIA (22) Date of filing of Application :21/08/2012 (43) Publication Date : 18/12/2015 (54) Title of the invention : SYNTHETIC INTERMEDIATE OF OXAZOLE COMPOUND AND METHOD FOR PRODUCING THE SAME• (51) International classification :C07C (71)Name of Applicant : (31) Priority Document No :2010-019289 1)OTSUKA PHARMACEUTICAL CO., LTD. (32) Priority Date :29/01/2010 Address of Applicant :9 Kanda-Tsukasamachi 2-chome (33) Name of priority country :Japan Chiyoda-ku Tokyo 1018535 Japan (86) International Application No :PCT/JP2011/052307 (72)Name of Inventor : Filing Date :28/01/2011 1)AKIHIRO YAMAMOTO (87) International Publication No :WO/2011/093529 2)KOICHI SHINHAMA (61) Patent of Addition to Application 3)NOBUHISA FUJITA :NA Number 4)SHINJI AKI :NA Filing Date 5)SHIN OGASAWARA (62) Divisional to Application Number :NA 6)NAOTO UTSUMI Filing Date :NA (57) Abstract : An object of the present invention is to provide a method for producing an oxazole compound in a high yield. The object can be achieved by a compound represented by Formula (11): wherein R1 is a hydrogen atom or lower-alkyl group; R2 is a 1-piperidyl group substituted at the 4-position with a substituent selected from (A1a) a phenoxy group substituted on the phenyl moiety with one or more halogen-substituted lower-alkoxy groups, (A1b) a phenoxy-substituted lower-alkyl group substituted on the phenyl moiety with one or more halogen-substituted lower-alkyl groups, (A1c) a phenyl-substituted lower-alkoxy lower-alkyl group substituted on the phenyl moiety with halogen, (A1d) a phenyl-substituted lower-alkyl group substituted on the phenyl moiety with one or more halogen-substituted lower-alkoxy groups, (A1e) an amino group substituted with a phenyl group substituted with one or more halogen-substituted lower-alkoxy groups, and a lower-alkyl group, and (A1f) a phenyl-substituted lower-alkoxy group substituted on the phenyl moiety with one or more halogen-substituted lower-alkoxy groups; n is an integer from 1 to 6; and X3 is an organic sulfonyloxy group. No. of Pages : 65 No. of Claims : 7 The Patent Office Journal 18/12/2015 65862 (12) PATENT APPLICATION PUBLICATION (21) Application No.7241/DELNP/2012 A (19) INDIA (22) Date of filing of Application :21/08/2012 (43) Publication Date : 18/12/2015 (54) Title of the invention : TRIAZOLONES AS FATTY ACID SYNTHASE INHIBITORS• (51) International classification :C07C (71)Name of Applicant : (31) Priority Document No :2010-021518 1)DEXERIALS CORPORATION (32) Priority Date :02/02/2010 Address of Applicant :Gate City Osaki East Tower 8F 1-11-2 (33) Name of priority country :Japan Osaki Shinagawa-ku Tokyo 1410032 Japan (86) International Application No :PCT/JP2011/052102 (72)Name of Inventor : Filing Date :02/02/2011 1)TATSUO KUMURA (87) International Publication No :WO 2011/096416 (61) Patent of Addition to Application :NA Number :NA Filing Date (62) Divisional to Application Number :NA Filing Date :NA (57) Abstract : The present invention provides an antenna device that can freely arrange a coupling electrode without being limited by an arrangement position of a transmitting/receiving circuit maintaining preferable connectivity while realizing a high production efficiency . The antenna device includes : a printed circuit board having one surface on which a ground (2) is formed through a base material (4) and the other surface on which a signal line (3) through which a signal is transmitted is formed; a coupling electrode (8) that is made of an approximately planar conductor and electromagnetically coupled to an electrode of another antenna device formed at a facing position to make it possible to perform communication ; and an electrode column (7) that electrically connects the signal line (3 ) formed on the printed circuit board and the coupling electrode (8) at an interval of a predetermined distance in a direction of thickness of the printed circuit board. A connecting terminal portion (9) that can be electrically connected to a transmitting/receiving device performing a signal transmitting/receiving process is formed on one end of the signal line (3), and a terminal fonning portion (la) where at least the connecting terminal portion (9) is formed on the printed circuit board has flexibility. No. of Pages : 38 No. of Claims : 7 The Patent Office Journal 18/12/2015 65863 (12) PATENT APPLICATION PUBLICATION (21) Application No.6948/DELNP/2015 A (19) INDIA (22) Date of filing of Application :06/08/2015 (43) Publication Date : 18/12/2015 (54) Title of the invention : LIQUID REDISTRIBUTOR (51) International classification :B01D3/00 (71)Name of Applicant : (31) Priority Document No :10 2013 107 357.3 1)LAIR LIQUIDE SOCI‰T‰ ANONYME POUR (32) Priority Date :11/07/2013 LETUDE ET LEXPLOITATION DES PROC‰D‰S (33) Name of priority country :Germany GEORGES CLAUDE (86) International Application No :PCT/EP2014/064465 Address of Applicant :75 quai dOrsay F 75007 Paris France Filing Date :07/07/2014 (72)Name of Inventor : (87) International Publication No :WO 2015/004064 1)ECK Thomas (61) Patent of Addition to Application 2)KIRSTEN Klaus :NA Number :NA Filing Date (62) Divisional to Application Number :NA Filing Date :NA (57) Abstract : A liquid redistributor arranged in a packing column between two packings wherein in the column a liquid phase is guided from top to bottom and against the same a gas phase from bottom to top comprising a liquid distributor tray and a droplet damping tray which attenuates the fluidization of the liquid layer on the liquid distributor tray as caused by the droplets falling down. No. of Pages : 15 No. of Claims : 10 The Patent Office Journal 18/12/2015 65864 (12) PATENT APPLICATION PUBLICATION (21) Application No.6949/DELNP/2015 A (19) INDIA (22) Date of filing of Application :06/08/2015 (43) Publication Date : 18/12/2015 (54) Title of the invention : V RIBBED BELT WITH SPACED RIB FLANK REINFORCEMENT (51) International classification :F16G5/22 (71)Name of Applicant : (31) Priority Document No :13/827602 1)DAYCO IP HOLDINGS LLC (32) Priority Date :14/03/2013 Address of Applicant :2025 W. Sunshine Street Suite L145 (33) Name of priority country :U.S.A. Springfield MO 65807 U.S.A. (86) International Application No :PCT/US2014/017957 (72)Name of Inventor : Filing Date :24/02/2014 1)WITT Richard J. (87) International Publication No :WO 2014/158541 (61) Patent of Addition to Application :NA Number :NA Filing Date (62) Divisional to Application Number :NA Filing Date :NA (57) Abstract : V ribbed belts with spaced rib flank reinforcement and methods of making the same are disclosed. The V ribbed belt comprises a compression section having at least one laterally spaced longitudinally extending V rib having first and second longitudinally extending flanks. The V rib includes an elastomeric material having a dry coefficient of friction encapsulating a plurality of reinforcing bodies having a dry coefficient of friction that is less than that of the elastomeric material. The plurality of reinforcing bodies are arranged generally laterally within the V rib such that at least a portion of the reinforcing bodies forms part of one or more of the first and second longitudinally extending flanks. No. of Pages : 26 No. of Claims : 20 The Patent Office Journal 18/12/2015 65865 (12) PATENT APPLICATION PUBLICATION (21) Application No.7254/DELNP/2012 A (19) INDIA (22) Date of filing of Application :21/08/2012 (43) Publication Date : 18/12/2015 (54) Title of the invention : METHODS FOR DETERMINING MOLECULAR PHARMACOLOGY USING LABEL-FREE INTEGRATIVE PHARMACOLOGY (51) International classification :C07C (71)Name of Applicant : (31) Priority Document No :61/315,625 1)CORNING INCORPORATED (32) Priority Date :19/03/2010 Address of Applicant :1 Riverfront Plaza Corning New York (33) Name of priority country :U.S.A. 14831 USA U.S.A. (86) International Application No :PCT/US2011/028956 (72)Name of Inventor : Filing Date :18/03/2011 1)YE FANG (87) International Publication No :WO/2011/116263 (61) Patent of Addition to Application :NA Number :NA Filing Date (62) Divisional to Application Number :NA Filing Date :NA (57) Abstract : Disclosed are methods and machines to perform cluster analysis on label free biosensor data. No. of Pages : 86 No. of Claims : 55 The Patent Office Journal 18/12/2015 65866 (12) PATENT APPLICATION PUBLICATION (21) Application No.7255/DELNP/2012 A (19) INDIA (22) Date of filing of Application :21/08/2012 (43) Publication Date : 18/12/2015 (54) Title of the invention : DEVICE FOR SEPARATING A MEMBRANE FROM A SUPPORT (51) International classification :C07C (71)Name of Applicant : (31) Priority Document No :1051422 1)EMD MILLIPORE CORPORATION (32) Priority Date :26/02/2010 Address of Applicant :290 Concord Road Billerica MA (33) Name of priority country :France 01821 U.S.A. (86) International Application No :PCT/IB2011/050457 (72)Name of Inventor : Filing Date :02/02/2011 1)FR‰D‰RIC MARC (87) International Publication No :WO/2011/104646 2)LUC FELDEN (61) Patent of Addition to Application 3)GA‹L WAICHE :NA Number 4)JEAN-JACQUES RICHERT :NA Filing Date (62) Divisional to Application Number :NA Filing Date :NA (57) Abstract : A device (1,100) for separating a membrane (81, 91 ) to analyze from a support (83,93), the membrane being mounted in a frame (82, 92), itself mounted on a support, having a body (10) comprising a longitudinal recess (11, 110, 120) for translational reception of the assembly constituted by the frame mounted on the support, the recess having a first end (12) and a second end (13) and longitudinal sides (14A, 14B, 111, 121) facing each other between said two ends, the device having bearing means (30, 112, 122) for a first member of the frame/support group between the first and the second end of the recess, which are adapted to serve as a bearing for the first member of the frame/support group once the assembly is disposed in the recess, each of the sides having a ramp (15A, 15B, 112, 122) adapted to engage a gripping member (84, 73) of the second member of the frame/support group when the assembly is translationally moved from the first to the second end, said ramps being adapted to separate the support from the frame during said translational movement by bearing on said gripping member of the second member of the frame/support group, the first member of the frame/support group then bearing on the bearing means, such that the frame and the support are separated once the translational movement has arrived at the second end. No. of Pages : 19 No. of Claims : 10 The Patent Office Journal 18/12/2015 65867 (12) PATENT APPLICATION PUBLICATION (21) Application No.7256/DELNP/2012 A (19) INDIA (22) Date of filing of Application :21/08/2012 (43) Publication Date : 18/12/2015 (54) Title of the invention : OCEAN THERMAL ENERGY CONVERSION POWER PLANT• (51) International classification :H02J (71)Name of Applicant : (31) Priority Document No :61/297,242 1)THE ABELL FOUNDATION INC. (32) Priority Date :21/01/2010 Address of Applicant :111 S. Calvert Street Suite 2300 (33) Name of priority country :U.S.A. Baltimore Maryland 21202-6174 USA U.S.A. (86) International Application No :PCT/US2011/022115 (72)Name of Inventor : Filing Date :21/01/2011 1)BARRY R. COLE (87) International Publication No :WO/2011/091295 2)JONATHAN M. ROSS (61) Patent of Addition to Application 3)ANDREW REKRET :NA Number 4)HENRY SIBENALLER :NA Filing Date 5)WILLIAM SCHULZ (62) Divisional to Application Number :NA 6)RUSS KRULL Filing Date :NA 7)LAURENCE JAY SHAPIRO (57) Abstract : An offshore power generation structure comprising a submerged portion having a first deck portion comprising an integral multi-stage evaporator system, a second deck portion comprising an integral multi-stage condensing system, a third deck portion housing power generation equipment, cold water pipe; and a cold water pipe connection. No. of Pages : 85 No. of Claims : 15 The Patent Office Journal 18/12/2015 65868 (12) PATENT APPLICATION PUBLICATION (21) Application No.7246/DELNP/2012 A (19) INDIA (22) Date of filing of Application :20/08/2012 (43) Publication Date : 18/12/2015 (54) Title of the invention : ANTI-IMPACT DEVICE FOR TIRE PRESSURE GAUGE WITH A GAS NIPPLE (51) International classification :B62D (71)Name of Applicant : (31) Priority Document No :201020237033.5 1)STEELMATE CO. LTD (32) Priority Date :24/06/2010 Address of Applicant :Steelmate Industry Park Heping (33) Name of priority country :China Avenue Dongfu Road Dongfeng Town Zhongshan City (86) International Application No :PCT/CN2010/075168 Guangdong province P.R. China 528425 China Filing Date :15/07/2010 (72)Name of Inventor : (87) International Publication No :WO 2011/160315 1)LI Zhitao (61) Patent of Addition to Application :NA Number :NA Filing Date (62) Divisional to Application Number :NA Filing Date :NA (57) Abstract : An impact-protection and damage-reduction structure with a tire pressure gauge for an air valve is disclosed. The tire pressure gauge (1) includes a shell (11) and a hollow pipe body (4) of the air valve. An inward concave spherical surface (74) is formed on the shell (11). An air inlet (41) and an air outlet (40) which penetrates through the side are formed on the pipe body (4). A universal head (3) is provided on the outside of the air outlet (40) along the axial direction of the air valve (2), and a universal connection is realized between the universal head (3) and the inner concave spherical surface (74). A weak link (43), the thickness of which is smaller than that of other pipe body parts, is provided on the air inlet tail end of the air valve pipe body (4) and passes through the air outlet (40). Since the mechanical strength of the weak link (43) is weakened relative to other parts of the air valve, the unique weakness lies in the weak link (43) when the tire pressure gauge installed on a hub is impacted by an external force. The weak link is easier to break under the impact of the external force. Accordingly, although the tire pressure gauge can be separated from the air valve (2), a broken structure is the pipe body of the air valve (2) instead of the tire pressure gauge, thus just replacing the air valve and retaining the tire pressure gauge. Since the cost of the air valve is far lower than that of the tire pressure gauge, the impact-protection and damagereduction structure can save high maintenance cost for users. No. of Pages : 22 No. of Claims : 8 The Patent Office Journal 18/12/2015 65869 (12) PATENT APPLICATION PUBLICATION (21) Application No.7247/DELNP/2012 A (19) INDIA (22) Date of filing of Application :20/08/2012 (43) Publication Date : 18/12/2015 (54) Title of the invention : REVERSING RADAR SENSOR ASSEMBLY (51) International classification :G01N (71)Name of Applicant : (31) Priority Document No :201110031158.1 1)STEELMATE CO. LTD (32) Priority Date :28/01/2011 Address of Applicant :Steelmate Industry Park Heping (33) Name of priority country :China Avenue Dongfu Road Dongfeng Town Zhongshan City (86) International Application No :PCT/CN2011/074334 Guangdong province P.R. China 528425 China Filing Date :19/05/2011 (72)Name of Inventor : (87) International Publication No :WO 2011/100472 1)LI Zhitao (61) Patent of Addition to Application :NA Number :NA Filing Date (62) Divisional to Application Number :NA Filing Date :NA (57) Abstract : A reversing radar sensor component is provided, which includes: a sensor(3), a damping rubber ring(4) sheathed on the periphery of the sensor(3), a bottom cover(6) whose front end is used to contain the sensor(3) and the damping rubber ring(4), and a top cover(l) used to match with the bottom cover(6) and provided with opening for exposing the front end of the sensor(3). Cylindrical walls(12) are both formed on the top cover(l) and the bottom cover(6), and several gap grooves(18) are formed in the cylindrical walls(12) surrounding the top cover(l). Buffering rubber rings(5) are set between the cylindrical walls(12) of the bottom cover(6) and those of the top cover(l). An expanding pole(52) is formed in the buffering rubber ring(5) corresponding to every gap groove(18). A double deck buffering and damping structure is formed by the buffering rubber rings(5) configured in the reversing radar sensor component, the annular rubber sleeves(2) and the damping rubber rings(4) together, and more buffering effect can be realized by the expanding poles(52) in the buffering rubber rings(5), thus the whole component is more steady after the whole component is installed on the vehicle protecting stick, and the sensor(3) itself can be protected better, avoiding the false alarm because of the vehicle shock, and the life of the product being extended. No. of Pages : 19 No. of Claims : 10 The Patent Office Journal 18/12/2015 65870 (12) PATENT APPLICATION PUBLICATION (21) Application No.7248/DELNP/2012 A (19) INDIA (22) Date of filing of Application :21/08/2012 (43) Publication Date : 18/12/2015 (54) Title of the invention : INTRODUCER SHEATH ASSEMBLY (51) International classification :A47J (71)Name of Applicant : (31) Priority Document No :2010-074563 1)TERUMO KABUSHIKI KAISHA (32) Priority Date :29/03/2010 Address of Applicant :44-1 Hatagaya 2-chome Shibuya-ku (33) Name of priority country :Japan Tokyo 151-0072 Japan Japan (86) International Application No :PCT/JP2011/057427 (72)Name of Inventor : Filing Date :25/03/2011 1)RYO OKAMURA (87) International Publication No :WO 2011/122488 (61) Patent of Addition to Application :NA Number :NA Filing Date (62) Divisional to Application Number :NA Filing Date :NA (57) Abstract : The introducer sheath assembly 21 has an introducer sheath 25 including a sheath tube 23 to be inserted into the incision made on the patients limb and a sheath hub 24 attached to the proximal end of the sheath tube. Moreover, the introducer sheath assembly has a belt 40, which is connected to the sheath hub and wound around the limb, and a fastening member 50 to fasten the belt wound around the limb. No. of Pages : 46 No. of Claims : 6 The Patent Office Journal 18/12/2015 65871 (12) PATENT APPLICATION PUBLICATION (21) Application No.6975/DELNP/2015 A (19) INDIA (22) Date of filing of Application :07/08/2015 (43) Publication Date : 18/12/2015 (54) Title of the invention : DISTAL TIP FEATURES FOR END EFFECTOR OF SURGICAL INSTRUMENT (51) International (71)Name of Applicant : :A61B17/072,A61B17/068,A61B17/00 classification 1)ETHICON ENDO SURGERY INC. (31) Priority Document No :13/780171 Address of Applicant :4545 Creek Road Cincinnati Ohio (32) Priority Date :28/02/2013 45242 U.S.A. (33) Name of priority (72)Name of Inventor : :U.S.A. country 1)SIMMS Robert J. (86) International 2)HOFFMAN Douglas B. :PCT/US2014/017298 Application No 3)GETTINGER Rebecca J. :20/02/2014 Filing Date 4)BEDARD Timothy S. (87) International 5)GARNER Dean L. :WO 2014/133856 Publication No 6)ARMSTRONG Glen A. (61) Patent of Addition to 7)VOLZ Janna B. :NA Application Number :NA Filing Date (62) Divisional to :NA Application Number :NA Filing Date (57) Abstract : An apparatus comprises a body a shaft and an end effector that is operable to compress staple and cut tissue. The end effector comprises and anvil and a cartridge. A longitudinal axis intersects the distal tip of the anvil when the anvil is in a closed position. The cartridge defines a sight line extending along a distal surface of the cartridge from a first side of the cartridge toward the anvil. The first side of the cartridge is opposite to the anvil. The distal surface of the cartridge is neither parallel to nor perpendicular to the longitudinal axis. The sight line intersects the longitudinal axis near the distal tip when the anvil is in the closed position. A segment of the sight line and a segment the longitudinal axis define an angle . The angle is larger than 90º. No. of Pages : 53 No. of Claims : 20 The Patent Office Journal 18/12/2015 65872 (12) PATENT APPLICATION PUBLICATION (21) Application No.6976/DELNP/2015 A (19) INDIA (22) Date of filing of Application :07/08/2015 (43) Publication Date : 18/12/2015 (54) Title of the invention : JAW CLOSURE FEATURE FOR END EFFECTOR OF SURGICAL INSTRUMENT (51) International classification :A61B17/072 (71)Name of Applicant : (31) Priority Document No :13/780120 1)ETHICON ENDO SURGERY INC. (32) Priority Date :28/02/2013 Address of Applicant :4545 Creek Road Cincinnati Ohio (33) Name of priority country :U.S.A. 45242 U.S.A. (86) International Application No :PCT/US2014/016208 (72)Name of Inventor : Filing Date :13/02/2014 1)ZERKLE Jason E. (87) International Publication No :WO 2014/133774 2)SIMMS Robert J. (61) Patent of Addition to Application 3)HOFFMAN Douglas B. :NA Number 4)DUNKI JACOBS Adam R. :NA Filing Date (62) Divisional to Application Number :NA Filing Date :NA (57) Abstract : An end effector (212) for use with a surgical instrument includes a first jaw (216) a second jaw (218) and a closure ring (233). The second jaw is pivotable relative to the first jaw. The second jaw has a proximal end with a first ramped surface (224) and a second ramped surface (226) distal of the first ramped surface. The closure ring is coupled with the second jaw to engage the first and second ramped surfaces of the second jaw. The closure ring translates from a proximal position to a distal position to engage the first ramped surface of the second jaw and then the second ramped surface of the second jaw. The camming engagement of the closure ring with the first and second ramped surfaces of the second jaw pivots the second jaw toward the first jaw. The closure ring may also provide camming engagement to pivot the second jaw away from the first jaw. No. of Pages : 57 No. of Claims : 20 The Patent Office Journal 18/12/2015 65873 (12) PATENT APPLICATION PUBLICATION (21) Application No.6977/DELNP/2015 A (19) INDIA (22) Date of filing of Application :07/08/2015 (43) Publication Date : 18/12/2015 (54) Title of the invention : BUILDING CONTROL SYSTEM WITH DISTRIBUTED CONTROL (51) International classification (31) Priority Document No (32) Priority Date (33) Name of priority country (86) International Application No Filing Date (87) International Publication No (61) Patent of Addition to Application Number Filing Date (62) Divisional to Application Number Filing Date (71)Name of Applicant : 1)HONEYWELL INTERNATIONAL INC. Address of Applicant :101 Columbia Road Morristown New Jersey 07962 U.S.A. (72)Name of Inventor : :G05B15/02 1)TRIVEDI Ishit :NA 2)ANAND Anurag :NA 3)SHIVASHANKAR Ganesh :NA 4)MALVE Sharath Babu :PCT/US2013/025168 5)THANIKACHALAM Guhapriyan :07/02/2013 6)GUDI Balakrishna G. :WO 2014/123531 7)RAJAN Karthick Dasu :NA 8)SUBRAMANIAM Raman :NA 9)GUNARI Channabasappa 10)JAIN Mohit :NA 11)BHATTACHARYA Rana :NA 12)SUNDARAVADIVELU Balaji 13)MAHASENAN Arun Vijayakumari 14)VALLIGANNU Appar 15)KRISHNASWAMY Janaki 16)RATH Manaswini (57) Abstract : A building control system that includes a central coordinator and one or more discrete air conditioner controllers configured to communicate with one or more discrete air conditioner units. The discrete air conditioner controller may include a wireless I/O block for receiving signals in a first signal format from the central coordinator and for transmitting signals to the one or more discrete air conditioner units in a second signal format. In some instances the discrete air conditioner controller may be configured to wirelessly transmit a signal to at least one discrete air conditioner unit in response to receiving a signal from the central coordinator. This configuration may provide a measure of distributed control of the building control system in a cost effective and efficient manner. No. of Pages : 73 No. of Claims : 20 The Patent Office Journal 18/12/2015 65874 (12) PATENT APPLICATION PUBLICATION (21) Application No.7260/DELNP/2012 A (19) INDIA (22) Date of filing of Application :21/08/2012 (43) Publication Date : 18/12/2015 (54) Title of the invention : HAIR REMOVAL DEVICE (51) International classification :A47J (71)Name of Applicant : (31) Priority Document No :61/340,299 1)The Gillette Company (32) Priority Date :15/03/2010 Address of Applicant :World Shaving Headquarters IP/Legal (33) Name of priority country :U.S.A. Patent Department - 3E One Gillette Park Boston MA 02127 (86) International Application No :PCT/US2011/028488 U.S.A U.S.A. Filing Date :15/03/2011 (72)Name of Inventor : (87) International Publication No :WO/2011/115971 1)ROYLE Terence Gordon (61) Patent of Addition to Application 2)BURROWES Lee :NA Number 3)CLARKE Sean Peter :NA Filing Date 4)HAWES Christopher Martin (62) Divisional to Application Number :NA Filing Date :NA (57) Abstract : The invention features a hair removal device (100) such as a razor for dispensing a fluid during use. The hair removal device includes a fluid dispensing member (500) which comprises an elongated elastomeric contact member (510) for dispensing the fluid onto the skin in a wide and flat layer of fluid. No. of Pages : 28 No. of Claims : 15 The Patent Office Journal 18/12/2015 65875 (12) PATENT APPLICATION PUBLICATION (21) Application No.7261/DELNP/2012 A (19) INDIA (22) Date of filing of Application :21/08/2012 (43) Publication Date : 18/12/2015 (54) Title of the invention : INSTALLATION AND PROCESS FOR RECYCLING WIPING SOLUTION OF ONE OR MORE INTAGLIO PRINTING PRESSES (51) International classification (31) Priority Document No (32) Priority Date (33) Name of priority country :B60J (71)Name of Applicant : :10155645.4 1)KBA-NotaSys SA :05/03/2010 Address of Applicant :PO Box 347 55 Avenue du Grey CH:EUROPEAN 1000 Lausanne 22 (CH) Switzerland UNION (72)Name of Inventor : :PCT/IB2011/050891 1)MARTINI Giacomo :02/03/2011 2)NERY Vronique :WO/2011/107950 (86) International Application No Filing Date (87) International Publication No (61) Patent of Addition to Application :NA Number :NA Filing Date (62) Divisional to Application Number :NA Filing Date :NA (57) Abstract : There is described an installation for recycling wiping solution of one or more intaglio printing presses comprising a flocculation tank for inducing flocculation of ink constituents contained in waste solution coming from the one or more intaglio printing presses a processing tank for pre-treating the waste solution for subsequent filtering and a filtering unit preferably a filter press unit for filtering the waste solution coming from the processing tank and producing recycled solution at an output of the filtering unit which recycled solution is recycled to produce fresh wiping solution for use by the one or more intaglio printing presses. According to one embodiment the installation further comprises a centrifugation unit for separating the waste solution coming from the flocculation tank by centrifugation into precipitate and centrifuged supernatant which centrifuged supernatant is fed to the processing tank . No. of Pages : 30 No. of Claims : 26 The Patent Office Journal 18/12/2015 65876 (12) PATENT APPLICATION PUBLICATION (21) Application No.7265/DELNP/2012 A (19) INDIA (22) Date of filing of Application :21/08/2012 (43) Publication Date : 18/12/2015 (54) Title of the invention : PDE10 INHIBITORS AND RELATED COMPOSITIONS AND METHODS• (51) International classification :A61K (71)Name of Applicant : (31) Priority Document No :61/313,544 1)OMEROS CORPORATION (32) Priority Date :12/03/2010 Address of Applicant :Suite 2600 1420 Fifth Avenue Seattle (33) Name of priority country :U.S.A. Washington 98101 U.S.A. U.S.A. (86) International Application No :PCT/US2011/027927 (72)Name of Inventor : Filing Date :10/03/2011 1)CUTSHALL Neil S (87) International Publication No :WO 2011/112828 2)GAGE Jennifer Lynn (61) Patent of Addition to Application 3)WHEELER Thomas Neil :NA Number 4)LITTLE Thomas L. :NA Filing Date (62) Divisional to Application Number :NA Filing Date :NA (57) Abstract : Compounds that inhibit PDE10 are disclosed that have utility in the treatment of a variety of conditions including (but not limited to) psychotic anxiety movement disorders and/or neurological disorders such as Parkinsons disease Huntingtons disease Alzheimers disease encephalitis phobias epilepsy aphasia Bells palsy cerebral palsy sleep disorders pain Tourettes syndrome schizophrenia delusional disorders drug-induced psychosis and panic and obsessive- compulsive disorders. Pharmaceutically acceptable salts stereoisomers solvates and prodrugs of the compounds are also provided. Also disclosed are compositions containing a compound in combination with a pharmaceutically acceptable carrier as well as methods relating to the use thereof for inhibiting PDE10 in a warmblooded animal in need of the same. No. of Pages : 129 No. of Claims : 39 The Patent Office Journal 18/12/2015 65877 (12) PATENT APPLICATION PUBLICATION (21) Application No.7266/DELNP/2012 A (19) INDIA (22) Date of filing of Application :21/08/2012 (43) Publication Date : 18/12/2015 (54) Title of the invention : PORTABLE APPARATUS FOR LOCAL COMBINED ELECTROMAGNETIC IRRADIATION• (51) International classification :G01N (71)Name of Applicant : (31) Priority Document No :NA 1)PLETNEV SERGEY VLADIMIROVICH (32) Priority Date :NA Address of Applicant :4-105 Cherviakova Str. Minsk 220000 (33) Name of priority country :NA Belarus Belarus (86) International Application No :PCT/IB2010/050235 (72)Name of Inventor : Filing Date :19/01/2010 1)PLETNEV Sergey Vladimirovich (87) International Publication No :WO 2011/089472 2)PLETNEV Andrey Sergeevich (61) Patent of Addition to Application 3)BARSUKOV Anatoly Alekseevich :NA Number 4)RADECKY Anatoly Ivanovich :NA Filing Date (62) Divisional to Application Number :NA Filing Date :NA (57) Abstract : The present invention relates to the electromagnetic field physiotherapy and may be used for treating and preventing various diseases and disorders. A portable apparatus for local integrated electromagnetic irradiation comprises a device for generating a light field with a combinable wavelength, an array of individual light sources with different wavelengths, a controllable magnetic field source including at least one coil and a core made of a ferromagnetic material and a device for controlling and combining the light and magnetic fields. The apparatus is mainly characterized in that the core of the magnetic field source is made magnetically closed from a rear side and is provided with a clearance in the region spatially combined with the light field, with the magnetic field controlling device being capable of generating a low-frequency pulsed magnetic field in the combined spatial region with an adjustable frequency in the range of 1-200 Hz and an amplitude in the range of 10-30 mT and having controlling inputs coupled to the controlling and combining device. No. of Pages : 12 No. of Claims : 4 The Patent Office Journal 18/12/2015 65878 (12) PATENT APPLICATION PUBLICATION (21) Application No.7267/DELNP/2012 A (19) INDIA (22) Date of filing of Application :21/08/2012 (43) Publication Date : 18/12/2015 (54) Title of the invention : UV ASSOCIATED MTDNA FUSION TRANSCRIPTS AND METHODS AND USES THEREOF (51) International (71)Name of Applicant : :C12N15/62,C07H21/00,C07K19/00 classification 1)MITOMICS INC. (31) Priority Document No :61/309216 Address of Applicant :Suite 1000 290 Munro Street Thunder (32) Priority Date :01/03/2010 Bay Ontario P7A 7T1 Canada (33) Name of priority country :U.S.A. (72)Name of Inventor : (86) International 1)HARBOTTLE Andrew :PCT/CA2011/050120 Application No 2)DAKUBO Gabriel :01/03/2011 Filing Date 3)PARR Ryan L. (87) International Publication 4)CREED Jennifer :WO 2011/106892 No 5)REGULY Brian (61) Patent of Addition to 6)ROBINSON Kerry :NA Application Number :NA Filing Date (62) Divisional to :NA Application Number :NA Filing Date (57) Abstract : The present invention provides novel mitochondrial fusion transcripts and related deletion molecules that are associated with UV exposure. Methods for and detection of mtDNA molecules and associated fusion transcripts is also provided as is their use in the screening and testing of skin care products. No. of Pages : 110 No. of Claims : 44 The Patent Office Journal 18/12/2015 65879 (12) PATENT APPLICATION PUBLICATION (21) Application No.7268/DELNP/2012 A (19) INDIA (22) Date of filing of Application :21/08/2012 (43) Publication Date : 18/12/2015 (54) Title of the invention : HYDRAULIC CONTROL ARRANGEMENT (51) International classification :F15B11/16 (71)Name of Applicant : (31) Priority Document No :10 2010 009 705.5 1)ROBERT BOSCH GMBH (32) Priority Date :01/03/2010 Address of Applicant :Postfach 30 02 20 70442 Stuttgart (33) Name of priority country :Germany Germany (86) International Application No :PCT/EP2010/007883 (72)Name of Inventor : Filing Date :22/12/2010 1)KAUSS Wolfgang (87) International Publication No :WO 2011/107134 (61) Patent of Addition to Application :NA Number :NA Filing Date (62) Divisional to Application Number :NA Filing Date :NA (57) Abstract : The invention discloses a hydraulic control arrangement for the supply of pressure medium to two consumer groups by means of a common variable displacement pump. According to the invention the pressure level of a control block assigned to one of the consumer groups is set to a different pressure level than that of a further control block assigned to the other consumer group. No. of Pages : 23 No. of Claims : 11 The Patent Office Journal 18/12/2015 65880 (12) PATENT APPLICATION PUBLICATION (21) Application No.7269/DELNP/2012 A (19) INDIA (22) Date of filing of Application :21/08/2012 (43) Publication Date : 18/12/2015 (54) Title of the invention : METHOD FOR TESTING AN INTEGRATED CIRCUIT (51) International classification :G01R31/3185,G01R31/317 (71)Name of Applicant : (31) Priority Document No :102010002460.0 1)ROBERT BOSCH GMBH (32) Priority Date :01/03/2010 Address of Applicant :Postfach 30 02 20 70442 Stuttgart (33) Name of priority country :Germany Germany (86) International Application No :PCT/EP2011/051706 (72)Name of Inventor : Filing Date :07/02/2011 1)POINSTINGL Peter (87) International Publication No :WO 2011/107316 2)RANDOLL Helmut (61) Patent of Addition to Application 3)KNAUPP Christoph :NA Number 4)BRAUN Thomas :NA Filing Date 5)WIEJA Thomas (62) Divisional to Application 6)WIRTH Steffen :NA Number 7)DOEHREN Stefan :NA Filing Date 8)KRAEMER Ralf (57) Abstract : A method for testing an integrated circuit (100) and an integrated circuit (100) are presented. The integrated circuit (100) has an internal test structure which can be accessed via an internal test access port (106) and a control bus (110) which is routed to the outside via control connections (108) wherein it is possible to change over between a running mode and a test mode with the result that in the test mode the test access port (106) is accessed via the control connections (108) and the control bus (110) and the integrated circuit (100) is thus tested. No. of Pages : 13 No. of Claims : 9 The Patent Office Journal 18/12/2015 65881 (12) PATENT APPLICATION PUBLICATION (21) Application No.6980/DELNP/2015 A (19) INDIA (22) Date of filing of Application :07/08/2015 (43) Publication Date : 18/12/2015 (54) Title of the invention : HIGH SOLIDS FABRIC CREPE PROCESS FOR PRODUCING ABSORBENT SHEET WITH INFABRIC DRYING (51) International classification :D21F11/14 (71)Name of Applicant : (31) Priority Document No :60/580,847 1)FORT JAMES CORPORATION (32) Priority Date :18/06/2004 Address of Applicant :133 Peachtree Street, N.E. Atlanta, (33) Name of priority country :U.S.A. Georgia 30303 USA U.S.A. (86) International Application No :PCT/US2005/021437 (72)Name of Inventor : Filing Date :17/06/2005 1)MURRAY, Frank C. (87) International Publication No :WO2006/009833 2)WENDT, Greg (61) Patent of Addition to Application :NA Number :NA Filing Date (62) Divisional to Application Number :6771/DELNP/2006 Filed on :14/11/2006 (57) Abstract : A method of making a fabric-creped absorbent cellulosic sheet is provided which includes dewatering a papermaking furnish and partially drying the web without wet-pressing before applying it to a translating transfer surface moving at a first speed. The process further includes fabric-creping the web from the transfer surface at a consistency of from about 30 to about 60 percent utilizing a creping fabric, the creping step occurring under pressure in a creping nip defined between the transfer surface and the creping fabric wherein the fabric is traveling at a second speed slower than the speed of said transfer surface, the fabric pattern, nip parameters, velocity delta and web consistency being selected such that the web is creped from the surface and redistributed on the creping fabric. After creping, the web is dried, preferably with a plurality of can dryers to a consistency of at least about 90 percent while it is held in the creping fabric. No. of Pages : 65 No. of Claims : 26 The Patent Office Journal 18/12/2015 65882 (12) PATENT APPLICATION PUBLICATION (21) Application No.6981/DELNP/2015 A (19) INDIA (22) Date of filing of Application :07/08/2015 (43) Publication Date : 18/12/2015 (54) Title of the invention : ROTOMOULDED ARTICLES (51) International (71)Name of Applicant : :B29C41/00,B29C41/04,B29C41/22 classification 1)TOTAL RESEARCH & TECHNOLOGY FELUY (31) Priority Document No :13157828.8 Address of Applicant :Zone Industrielle C B 7181 Seneffe (32) Priority Date :05/03/2013 Belgium (33) Name of priority country :EPO (72)Name of Inventor : (86) International Application 1)MAZIERS Eric :PCT/EP2014/054180 No :04/03/2014 Filing Date (87) International Publication :WO 2014/135541 No (61) Patent of Addition to :NA Application Number :NA Filing Date (62) Divisional to Application :NA Number :NA Filing Date (57) Abstract : The present invention relates to a rotomoulded article comprising one or more layers wherein a layer A comprises: from 50 to 99.4 wt% of a polyolefin; from 0.5 to 50 wt% of a polyester; wherein said polyester is an aliphatic polyester selected from poly(lactic acid) polyhydroxyalkanoate polycaprolactone copolyesters and polyesteramides; from 0.1 to 20 wt% of a co or ter polymer; comprising: (a) 50 to 99.9 wt% of an ethylene or a styrene monomer (b) 0.1 to 50 wt% of an unsaturated anhydride epoxide or carboxylic acid containing monomer (c) 0 to 50 wt% (meth)acrylic ester monomer; and from 0.1 to 20 wt% of an ionomer. No. of Pages : 61 No. of Claims : 13 The Patent Office Journal 18/12/2015 65883 (12) PATENT APPLICATION PUBLICATION (21) Application No.7270/DELNP/2012 A (19) INDIA (22) Date of filing of Application :21/08/2012 (43) Publication Date : 18/12/2015 (54) Title of the invention : METHOD FOR EVALUATING AN ANALOG SIGNAL (51) International classification :H03M1/48 (71)Name of Applicant : (31) Priority Document No :10 2010 002 695.6 1)ROBERT BOSCH GMBH (32) Priority Date :09/03/2010 Address of Applicant :Postfach 30 02 20 70442 Stuttgart (33) Name of priority country :Germany Germany (86) International Application No :PCT/EP2011/052996 (72)Name of Inventor : Filing Date :01/03/2011 1)AUE Axel (87) International Publication No :WO 2011/110446 2)THOSS Dieter (61) Patent of Addition to Application 3)GRUENEWALD Martin :NA Number :NA Filing Date (62) Divisional to Application Number :NA Filing Date :NA (57) Abstract : The invention relates to a method for evaluating an analog signal (150) which carries information on a rotary movement. In the method the analog signal (150) is inputted to an AD converter (126) for evaluation and zero crossings of the analog signal (150) are determined. No. of Pages : 11 No. of Claims : 10 The Patent Office Journal 18/12/2015 65884 (12) PATENT APPLICATION PUBLICATION (21) Application No.7271/DELNP/2012 A (19) INDIA (22) Date of filing of Application :21/08/2012 (43) Publication Date : 18/12/2015 (54) Title of the invention : HEAT CURABLE COMPOSITIONS FOR TINTABLE ABRASION RESISTANT TRANSPARENT HARD COATINGS (51) International classification :C09D183/04,C09D201/10 (71)Name of Applicant : (31) Priority Document No :10305301.3 1)ESSILOR INTERNATIONAL (COMPAGNIE (32) Priority Date :25/03/2010 GENERALE DOPTIQUE) (33) Name of priority country :EPO Address of Applicant :147 rue de Paris F 94220 Charenton le (86) International Application No :PCT/EP2011/054451 Pont France Filing Date :23/03/2011 (72)Name of Inventor : (87) International Publication No :WO 2011/117300 1)SONG Lixin (61) Patent of Addition to Application 2)TEO Puat Wen :NA Number :NA Filing Date (62) Divisional to Application Number :NA Filing Date :NA (57) Abstract : The present invention is relative to a heat-curable coating composition forming transparent tintable abrasion-resistant coatings, said compositions comprising, in an aqueous or hydro-organic solvent: (A) a hydrolysate of an epoxy-functional silane compound containing at least two alkoxy groups, (B) colloidal silica having an average particle diameter of 1 to 100 urn, (C) an aluminium chelate compound of formula Al(0-Cialkyl)žY3-ž wherein n is 0, 1 or 2 and Y is a ligand selected from the group consisting of MC(=0)-CH2-C(=0)-M and M-C(=0)-CH2-C(=0)0-M, wheren each M is independently a Ci_4alkyl group, and (D) a hydrolysate of a silylated poly(tetrahydrofurane) of formula (la) or (lb) said heat-curable composition not containing any multifunctional cross-linking agents selected from the group consisting of multifunctional carboxylic acids and multifunctional anhydrides. No. of Pages : 15 No. of Claims : 15 The Patent Office Journal 18/12/2015 65885 (12) PATENT APPLICATION PUBLICATION (21) Application No.7272/DELNP/2012 A (19) INDIA (22) Date of filing of Application :21/08/2012 (43) Publication Date : 18/12/2015 (54) Title of the invention : METHOD OF CATEGORIZING MESSAGES RECEIVED BY A USER OF A COMPANY SOCIAL NETWORK (51) International classification :G06Q10/00 (71)Name of Applicant : (31) Priority Document No :10/01087 1)ALCATEL LUCENT (32) Priority Date :18/03/2010 Address of Applicant :3 avenue Octave Grard F 75007 Paris (33) Name of priority country :France France (86) International Application No :PCT/FR2011/050451 (72)Name of Inventor : Filing Date :04/03/2011 1)ELLEOUET Jerome (87) International Publication No :WO 2011/114039 2)TALARMAIN Ccile (61) Patent of Addition to Application :NA Number :NA Filing Date (62) Divisional to Application Number :NA Filing Date :NA (57) Abstract : The invention relates to a method of categorizing messages received by a user of a company social network said method making provision to: extract from a message received an identifier of the sender of said message; verify the existence in the company social network of relationships between said identified sender and said user; apply a categorization rule to said message as a function of said relationship; transmit the categorized message to said user. No. of Pages : 16 No. of Claims : 10 The Patent Office Journal 18/12/2015 65886 (12) PATENT APPLICATION PUBLICATION (21) Application No.6960/DELNP/2015 A (19) INDIA (22) Date of filing of Application :06/08/2015 (43) Publication Date : 18/12/2015 (54) Title of the invention : USE OF PHENOXYPROPYLAMINE COMPOUNDS TO TREAT DEPRESSION (51) International (71)Name of Applicant : :A61K31/41,A61K31/496,A61K31/4245 classification 1)MINERVA NEUROSCIENCES INC. (31) Priority Document Address of Applicant :First Street Suite 1800 Cambridge MA :61/756208 No 02142 U.S.A. (32) Priority Date :24/01/2013 (72)Name of Inventor : (33) Name of priority 1)PELLEGRINI Lorenzo :U.S.A. country 2)KARABELAS Argeris (86) International 3)LUTHRINGER Remy :PCT/US2014/013026 Application No :24/01/2014 Filing Date (87) International :WO 2014/117003 Publication No (61) Patent of Addition :NA to Application Number :NA Filing Date (62) Divisional to :NA Application Number :NA Filing Date (57) Abstract : Disclosed herein are compositions and methods for treating depression using compositions comprising a compound of formula I. Disclosed herein are compositions and methods for treating depression using compositions comprising phenoxypropylamine compounds and derivatives having selective affinity for and antagonistic activity against the 5 HT1A receptor as well as 5 HT reuptake inhibitory activity. In addition compositions and methods for treating depression using compositions comprising a compound of formula II are disclosed. Methods of treating or diminishing at least one symptom of depression in a human subject with a composition comprising a compound of the formula (I) or formula (II) or a pharmaceutically acceptable salt hydrate or solvate thereof are also disclosed. No. of Pages : 136 No. of Claims : 21 The Patent Office Journal 18/12/2015 65887 (12) PATENT APPLICATION PUBLICATION (21) Application No.6961/DELNP/2015 A (19) INDIA (22) Date of filing of Application :07/08/2015 (43) Publication Date : 18/12/2015 (54) Title of the invention : OXYGEN ABSORBER COMPOSITION AND MOLDED BODY AND PACKAGE EACH USING SAME (51) International (71)Name of Applicant : :B01J20/22,A23L3/3436,B01D53/14 classification 1)MITSUBISHI GAS CHEMICAL COMPANY INC. (31) Priority Document No :2013044756 Address of Applicant :5 2 Marunouchi 2 chome Chiyoda ku (32) Priority Date :06/03/2013 Tokyo 1008324 Japan (33) Name of priority (72)Name of Inventor : :Japan country 1)IKEDA Shinichi (86) International 2)OKADA Satoshi :PCT/JP2014/055876 Application No 3)IWAMOTO Shinpei :06/03/2014 Filing Date 4)ITO Fumihiro (87) International Publication :WO 2014/136917 No (61) Patent of Addition to :NA Application Number :NA Filing Date (62) Divisional to :NA Application Number :NA Filing Date (57) Abstract : Provided is an oxygen absorber composition which contains: a compound (A) that has two or more imide bonds and two or more tetralin rings at least one of which has a hydrogen bond at the benzyl position; and a transition metal catalyst. No. of Pages : 70 No. of Claims : 10 The Patent Office Journal 18/12/2015 65888 (12) PATENT APPLICATION PUBLICATION (21) Application No.6962/DELNP/2015 A (19) INDIA (22) Date of filing of Application :07/08/2015 (43) Publication Date : 18/12/2015 (54) Title of the invention : OXYGEN ABSORBING MULTILAYER BODY OXYGEN ABSORBING CONTAINER OXYGEN ABSORBING AIRTIGHT CONTAINER OXYGEN ABSORBING PUSH THROUGH PACK AND STORAGE METHOD USING SAME (51) International classification :B32B27/18,A61J1/05,A61J1/10 (71)Name of Applicant : (31) Priority Document No :2013044752 1)MITSUBISHI GAS CHEMICAL COMPANY INC. (32) Priority Date :06/03/2013 Address of Applicant :5 2 Marunouchi 2 chome Chiyoda ku (33) Name of priority country :Japan Tokyo 1008324 Japan (86) International Application No :PCT/JP2014/055871 (72)Name of Inventor : Filing Date :06/03/2014 1)OKADA Satoshi (87) International Publication No :WO 2014/136914 2)IWAMOTO Shinpei (61) Patent of Addition to 3)IKEDA Shinichi :NA Application Number 4)ITO Fumihiro :NA Filing Date 5)KASHIBA Takashi (62) Divisional to Application 6)OGAWA Shun :NA Number 7)ARAKAWA Shota :NA Filing Date 8)USUDA Kenichiro (57) Abstract : The provision of an oxygen absorbing multilayer body that has the following: an oxygen absorption layer that contains an oxygen absorbing composition; and a thermoplastic resin layer that contains a thermoplastic resin (b). The oxygen absorbing composition contains at least one tetralin containing compound that can be represented by general formula (1) a transition metal catalyst and a thermoplastic resin (a). No. of Pages : 279 No. of Claims : 16 The Patent Office Journal 18/12/2015 65889 (12) PATENT APPLICATION PUBLICATION (21) Application No.7274/DELNP/2012 A (19) INDIA (22) Date of filing of Application :21/08/2012 (43) Publication Date : 18/12/2015 (54) Title of the invention : COMMUNICATING INFORMATION IN A SOCIAL NETWORK SYSTEM ABOUT ACTIVITIES FROM ANOTHER DOMAIN (51) International classification :G06Q50/00,G06Q30/00 (71)Name of Applicant : (31) Priority Document No :61/302494 1)FACEBOOK INC. (32) Priority Date :08/02/2010 Address of Applicant :1601 WILLOW ROAD, MENLO (33) Name of priority country :U.S.A. PARK, CALIFORNIA 94025, UNITED STATES OF AMERICA (86) International Application No :PCT/US2011/024047 U.S.A. Filing Date :08/02/2011 (72)Name of Inventor : (87) International Publication No :WO 2011/097624 1)SCHOEN Kent Matthew (61) Patent of Addition to Application 2)DINGLE Gregory Luc :NA Number 3)KENDALL Timothy :NA Filing Date (62) Divisional to Application Number :NA Filing Date :NA (57) Abstract : In one embodiment a method is described for tracking information about the activities of users of a social networking system while on another domain. The method includes maintaining a profile for each of one or more users of the social networking system each profile identifying a connection to one or more other users of the social networking system and including information about the user. The method additionally includes receiving one or more communications from a third party website having a different domain than the social network system each message communicating an action taken by a user of the social networking system on the third party website. The method additionally includes logging the actions taken on the third party website in the social networking system each logged action including information about the action. The method further includes correlating the logged actions with one or more advertisements presented to the one or more users on the third party website as well as correlating the logged actions with a user of the social networking system. No. of Pages : 67 No. of Claims : 20 The Patent Office Journal 18/12/2015 65890 (12) PATENT APPLICATION PUBLICATION (21) Application No.7275/DELNP/2012 A (19) INDIA (22) Date of filing of Application :21/08/2012 (43) Publication Date : 18/12/2015 (54) Title of the invention : METHOD OF MAKING A COATED ARTICLE COATING INCLUDING AN ALLOYED CARBON NANOTUBE THIN FILM (51) International classification :C09D1/00,C09D5/24,C09D7/12 (71)Name of Applicant : (31) Priority Document No :12/659354 1)GUARDIAN INDUSTRIES CORP. (32) Priority Date :04/03/2010 Address of Applicant :2300 Harmon Road Auburn Hills MI (33) Name of priority country :U.S.A. 48326 1714 U.S.A. (86) International Application No :PCT/US2011/021245 (72)Name of Inventor : Filing Date :14/01/2011 1)VEERASAMY Vijayen S. (87) International Publication No :WO 2011/109121 (61) Patent of Addition to :NA Application Number :NA Filing Date (62) Divisional to Application :NA Number :NA Filing Date (57) Abstract : Certain example embodiments of this invention relate to large area transparent conductive coatings (TCCs) including carbon nanotubes (CNTs) and nanowire composites and methods of making the same. The σdc/σopi ratio of such thim films may be improved via stable chemical doping and/or alloying of CNT based films. The doping and/or alloying may be implemented in a large area coating system e.g. on glass and/or other substrates in certain example embodiments a CNT film may be deposited and then doped via chemical functionalization and/or alloyed with silver and/or palladium. Both p type and n type dopants may be used in different embodiments of this invention. In certain example embodiments silver and/or other nanowires may be provided e.g. to further decrease sheet resistance. Certain example embodiments may provide coatings that approach meet or exceed 90% visible transmission and 90 ohms/square target metrics. No. of Pages : 49 No. of Claims : 23 The Patent Office Journal 18/12/2015 65891 (12) PATENT APPLICATION PUBLICATION (21) Application No.7001/DELNP/2015 A (19) INDIA (22) Date of filing of Application :09/08/2015 (43) Publication Date : 18/12/2015 (54) Title of the invention : DRIVE ARRANGEMENT FOR A SUPERCHARGER (51) International (71)Name of Applicant : :F16H15/38,F02B39/04,F16H61/664 classification 1)TOROTRAK (DEVELOPMENT) LTD (31) Priority Document No :1300453.6 Address of Applicant :1 Aston Way Leyland Lancashire PR26 (32) Priority Date :10/01/2013 7UX U.K. (33) Name of priority (72)Name of Inventor : :U.K. country 1)SHAWE James (86) International 2)FULLER John William Edward :PCT/EP2014/000247 Application No 3)DUTSON Brian :10/01/2014 Filing Date 4)DE FREITAS Andrew (87) International Publication :WO 2014/108345 No (61) Patent of Addition to :NA Application Number :NA Filing Date (62) Divisional to :NA Application Number :NA Filing Date (57) Abstract : A supercharging arrangement for an internal combustion engine is disclosed. The supercharging arrangement comprises a supercharger having a rotational drive input and a transmission having a rotational drive input to receive drive from an internal combustion engine and a rotational drive output connected to the input of the supercharger. The transmission includes a variator operatively connected between the input and the output of the transmission which variator has an output that is driven at an operating ratio from an input. There is a control system that operates to cause an engine to deliver an amount of torque that is indicated by the state of an input to the control system. The control system is further operative to set the operating ratio of the variator. No. of Pages : 42 No. of Claims : 34 The Patent Office Journal 18/12/2015 65892 (12) PATENT APPLICATION PUBLICATION (21) Application No.7002/DELNP/2015 A (19) INDIA (22) Date of filing of Application :10/08/2015 (43) Publication Date : 18/12/2015 (54) Title of the invention : COMPACT ANTENNA MOUNT (51) International classification :H01Q1/12 (71)Name of Applicant : (31) Priority Document No :13/900769 1)ANDREW LLC (32) Priority Date :23/05/2013 Address of Applicant :1100 Commscope Place SE Hickory (33) Name of priority country :U.S.A. North Carolina 28602 U.S.A. (86) International Application No :PCT/US2014/020475 (72)Name of Inventor : Filing Date :05/03/2014 1)LEWRY Matthew (87) International Publication No :WO 2014/189592 2)WRIGHT Alastair (61) Patent of Addition to Application :NA Number :NA Filing Date (62) Divisional to Application Number :NA Filing Date :NA (57) Abstract : An antenna mount is provided with a bracket with an azimuth slot an azimuth pivot hole and a boss hole. An azimuth adjuster with an extension portion passes through a boss seated in the boss hole. An offset portion of the azimuth adjuster has an azimuth fastener aperture spaced apart from a longitudinal axis of the extension portion. An azimuth fastener passes through the base the azimuth slot and the azimuth fastener aperture. An azimuth pivot fastener passes through the base and the azimuth pivot hole. The azimuth slot is provided as an arc segment with a center point at the azimuth pivot hole. Adjustment of a longitudinal position along the extension portion of an interconnection between the boss and the extension portion drives the azimuth fastener within the azimuth slot to pivot the base about the azimuth pivot hole with respect to the bracket. No. of Pages : 33 No. of Claims : 18 The Patent Office Journal 18/12/2015 65893 (12) PATENT APPLICATION PUBLICATION (21) Application No.7303/DELNP/2012 A (19) INDIA (22) Date of filing of Application :22/08/2012 (43) Publication Date : 18/12/2015 (54) Title of the invention : METHOD FOR PRODUCING PYRIPYROPENE DERIVATIVE BY ENZYMATIC PROCESS• (51) International classification :C12P (71)Name of Applicant : (31) Priority Document No :2010-014727 1)MEIJI SEIKA PHARMA CO. LTD. (32) Priority Date :26/01/2010 Address of Applicant :4-16 Kyobashi 2-Chome Chuo-Ku (33) Name of priority country :Japan Tokyo 1048002 Japan (86) International Application No :PCT/JP2011/050853 (72)Name of Inventor : Filing Date :19/01/2011 1)KENTARO YAMAMOTO (87) International Publication No :WO 2011/093187 2)MARIKO TSUCHIDA (61) Patent of Addition to Application 3)KAZUHIKO OYAMA :NA Number 4)KIMIHIKO GOTO :NA Filing Date 5)MASAAKI MITOMI (62) Divisional to Application Number :NA Filing Date :NA (57) Abstract : There is provided a method for producing a pyripyropene derivative represented by the following formula A by an enzyme method. The production method of the present invention allows for production of a pyripyropene derivative under simpler conditions and in shorter steps. [wherein R represents a linear, branched or cyclic C2.6 alkylcarbonyl group (when the alkyl moiety of this group is branched or cyclic, C3.6 alkyl carbonyl group)]. No. of Pages : 61 No. of Claims : 14 The Patent Office Journal 18/12/2015 65894 (12) PATENT APPLICATION PUBLICATION (21) Application No.7304/DELNP/2012 A (19) INDIA (22) Date of filing of Application :22/08/2012 (43) Publication Date : 18/12/2015 (54) Title of the invention : SYSTEMS AND METHODS FOR USING NEGATIVE PRESSURE WOUND THERAPY TO MANAGE OPEN ABDOMINAL WOUNDS• (51) International classification :A61B (71)Name of Applicant : (31) Priority Document No :61/308,766 1)SMITH & NEPHEW INC. (32) Priority Date :26/02/2010 Address of Applicant :1450 Brooks Road Memphis TN (33) Name of priority country :U.S.A. 38116 U.S.A. (86) International Application No :PCT/US2011/026347 (72)Name of Inventor : Filing Date :25/02/2011 1)JAMES D. LATTIMORE (87) International Publication No :WO/2011/106722 2)MICHAEL B. MOSHOLDER (61) Patent of Addition to Application :NA Number :NA Filing Date (62) Divisional to Application Number :NA Filing Date :NA (57) Abstract : Embodiments disclosed herein are directed to the treatment of wounds using negative pressure. Some embodiments disclosed herein provide for a foam pad, which may be suitable for use in abdominal wound sites, and which may be sized in a dimensionallyindependent manner. Additional embodiments provide for a wound contact layer, as well as a system for the treatment of abdominal wounds. No. of Pages : 52 No. of Claims : 17 The Patent Office Journal 18/12/2015 65895 (12) PATENT APPLICATION PUBLICATION (21) Application No.7306/DELNP/2012 A (19) INDIA (22) Date of filing of Application :22/08/2012 (43) Publication Date : 18/12/2015 (54) Title of the invention : MULTILAYER BLOW-MOLDED CONTAINER&NBSP; AND PROCESS FOR PRODUCTION THEREOF• (51) International classification :B60J (71)Name of Applicant : (31) Priority Document No :2010-012354 1)PRIME POLYMER CO. LTD. (32) Priority Date :22/01/2010 Address of Applicant :5-2 Higashi-Shimbashi 1-chome (33) Name of priority country :Japan Minato-ku Tokyo 1057117 Japan (86) International Application No :PCT/JP2011/050939 (72)Name of Inventor : Filing Date :20/01/2011 1)HIROYUKI UEKITA (87) International Publication No : NA (61) Patent of Addition to Application :NA Number :NA Filing Date (62) Divisional to Application Number :NA Filing Date :NA (57) Abstract : The present invention provides a multilayer blow-molded container having high gloss, excellent surface appearance and excellent impact resistance. The multilayer blow-molded container has an outermost layer obtainable by using a resin comprising an olefin polymer composition (E) which comprises a propylene resin (A), an ethylene/a-olefin copolymer (B) and a nucleating agent (D), wherein (A-1) the propylene resin (A) is a copolymer of propylene and an a-olefin, and (A-2) has a crystal melting point of 140 to 155° C, (B-1) the ethylene/a-olefin copolymer (B) is a copolymer of ethylene and at least one a-olefin of 4 to 20 carbon atoms, and (B2) has a crystal melting point of not lower than 85° C and lower than 110° C, and (E-1) the olefin polymer composition (E) has MFR of 5 to 10 g/10 mine No. of Pages : 144 No. of Claims : 13 The Patent Office Journal 18/12/2015 65896 (12) PATENT APPLICATION PUBLICATION (21) Application No.5095/DELNP/2015 A (19) INDIA (22) Date of filing of Application :11/06/2015 (43) Publication Date : 18/12/2015 (54) Title of the invention : COMMON EVENT- BASED MULTIDEVICE MEDIA PLAYBACK (51) International classification :H04N5/04,H04H20/18 (71)Name of Applicant : (31) Priority Document No :61/727624 1)BLACKFIRE RESEARCH CORPORATION (32) Priority Date :16/11/2012 Address of Applicant :182 Lyon Street, San Francisco ,CA (33) Name of priority country :U.S.A. 94115 U.S.A. (86) International Application No :PCT/US2013/070634 (72)Name of Inventor : Filing Date :18/11/2013 1)RAVI ,Rajapakse (87) International Publication No :WO 2014/078818 (61) Patent of Addition to Application :NA Number :NA Filing Date (62) Divisional to Application Number :NA Filing Date :NA (57) Abstract : A system for event- based synchronized multimedia playback , comprising a media source device and a plurality of destination devices , each destination device comprising a local clock, and a synchronization module on one of the devices. The synchronization module transmits common events , e,, , each with a unique event number , to each of the plurality of destination devices. Each destination device records time DX,, when evente,, is received and transmits an acknowledgement message back to the synchronization module comprising time D3/4 and event number n. The synchronization module determines phase and frequency differences between clocks of respective destination devices; computes a frequency adjustment to compensate for phase and rate differences; and directs each respective destination device to adjust its clock phase and frequency accordingly. Each destination device adjusts its local clock as directed or may perform a sample rate conversion on sample data in order to enable synchronized media playback. No. of Pages : 47 No. of Claims : 12 The Patent Office Journal 18/12/2015 65897 (12) PATENT APPLICATION PUBLICATION (21) Application No.7171/DELNP/2012 A (19) INDIA (22) Date of filing of Application :17/08/2012 (43) Publication Date : 18/12/2015 (54) Title of the invention : TRICYCLIC PYRIDINE DERIVATIVES&NBSP; MEDICAMENTS CONTAINING SUCH COMPOUNDS&NBSP; THEIR USE AND PROCESS FOR THEIR PREPARATION• (51) International classification (31) Priority Document No (32) Priority Date (33) Name of priority country (86) International Application No Filing Date (87) International Publication No (61) Patent of Addition to Application Number Filing Date (62) Divisional to Application Number Filing Date (71)Name of Applicant : :C07C 1)Other than natural person BOEHRINGER INGELHEIM :10154086.2 INTERNATIONAL GMBH :19/02/2010 Address of Applicant :Binger Strasse 173 55216 Ingelheim :EPO Am Rhein Germany :PCT/EP2011/052376 (72)Name of Inventor : :17/02/2011 1)HOLGER WAGNER :WO/2011/101424 2)DANIELA BERTA 3)KLAUS FUCHS :NA 4)RICCARDO GIOVANNINI :NA 5)DIETER WOLFGANG HAMPRECHT :NA 6)INGO KONETZKI :NA 7)RUEDIGER STREICHER 8)THOMAS TRIESELMANN (57) Abstract : The present invention relates to compounds defined by formula (I) wherein the variables R1-R8 are defined as in the description, possessing valuable pharmacological activity. Particularly, the compounds are inhibitors of cholesterol ester transfer protein (CETP) and thus are suitable for treatment and prevention of diseases which can be influenced by inhibition of this enzyme. No. of Pages : 440 No. of Claims : 21 The Patent Office Journal 18/12/2015 65898 (12) PATENT APPLICATION PUBLICATION (21) Application No.7174/DELNP/2012 A (19) INDIA (22) Date of filing of Application :17/08/2012 (43) Publication Date : 18/12/2015 (54) Title of the invention : SYNERGISTIC HERBICIDE/INSECTICIDE COMPOSITION CONTAINING CERTAIN PYRIDINE CARBOXYLIC ACIDS AND CERTAIN INSECTICIDES• (51) International classification :A01N (71)Name of Applicant : (31) Priority Document No :61/306,060 1)DOW AGROSCIENCES LLC (32) Priority Date :19/02/2010 Address of Applicant :9330 Zionsville Road Indianapolis IN (33) Name of priority country :U.S.A. 46268 U.S.A. (86) International Application No :PCT/US2011/025140 (72)Name of Inventor : Filing Date :17/02/2011 1)NORBERT SATCHIVI (87) International Publication No :WO 2011/103225 2)PAUL SCHMITZER (61) Patent of Addition to Application :NA Number :NA Filing Date (62) Divisional to Application Number :NA Filing Date :NA (57) Abstract : An herbicide/insecticide composition containing (a) a pyridine carboxylic acid component and (b) an insecticide component provides synergistic control of selected weeds. No. of Pages : 30 No. of Claims : 8 The Patent Office Journal 18/12/2015 65899 (12) PATENT APPLICATION PUBLICATION (21) Application No.7175/DELNP/2012 A (19) INDIA (22) Date of filing of Application :17/08/2012 (43) Publication Date : 18/12/2015 (54) Title of the invention : SYNERGISTIC HERBICIDE/FUNGICIDE COMPOSITION CONTAINING A PYRIDINE CARBOXYLIC ACID AND A FUNGICIDE• (51) International classification :A01N (71)Name of Applicant : (31) Priority Document No :61/306,066 1)DOW AGROSCIENCES LLC (32) Priority Date :19/02/2010 Address of Applicant :9330 Zionsville Road Indianapolis IN (33) Name of priority country :U.S.A. 46268 U.S.A. (86) International Application No :PCT/US2011/025160 (72)Name of Inventor : Filing Date :17/02/2011 1)NORBERT SATCHIVI (87) International Publication No :WO/2011/103240 2)PAUL SCHMITZER (61) Patent of Addition to Application :NA Number :NA Filing Date (62) Divisional to Application Number :NA Filing Date :NA (57) Abstract : An herbicide/fungicide composition containing (a) a pyridine carboxylic acid component and (b) a fungicide component provides synergistic control of selected weeds. No. of Pages : 45 No. of Claims : 8 The Patent Office Journal 18/12/2015 65900 (12) PATENT APPLICATION PUBLICATION (21) Application No.7176/DELNP/2012 A (19) INDIA (22) Date of filing of Application :17/08/2012 (43) Publication Date : 18/12/2015 (54) Title of the invention : ENGINEERED LANDING PADS FOR GENE TARGETING IN PLANTS (51) International classification :C12N (71)Name of Applicant : (31) Priority Document No :61/297,641 1)DOW AGROSCIENCES LLC (32) Priority Date :22/01/2010 Address of Applicant :9330 Zionsville Road Indianapolis (33) Name of priority country :U.S.A. Indiana 46268 United States of America U.S.A. (86) International Application No :PCT/US2011/022145 (72)Name of Inventor : Filing Date :21/01/2011 1)WILLIAM MICHAEL AINLEY (87) International Publication No :WO/2011/091317 2)RYAN C. BLUE (61) Patent of Addition to Application 3)MICHAEL G. MURRAY :NA Number 4)DAVID RICHARD CORBIN :NA Filing Date 5)REBECCA RUTH MILES (62) Divisional to Application Number :NA 6)STEVEN R. WEBB Filing Date :NA (57) Abstract : A method for producing a transgenic plant includes providing a nucleic acid molecule comprising at least two regions of nucleic acid sequence that lack sequence homology with genomic DNA of the plant cell, and at least two zinc finger nuclease recognition sites, wherein the at least two regions of nucleic acid sequence that lack sequence homology with genomic DNA of the plant cell flank the at least two zinc finger nuclease recognition sites. A plant cell or tissue having the nucleic acid molecule stably integrated into the genome of the plant cell is transformed. A plant is regenerated from the plant cell. Transgenic plants are produced by the method. Seeds are produced by the transgenic plants. No. of Pages : 91 No. of Claims : 21 The Patent Office Journal 18/12/2015 65901 (12) PATENT APPLICATION PUBLICATION (21) Application No.7322/DELNP/2012 A (19) INDIA (22) Date of filing of Application :22/08/2012 (43) Publication Date : 18/12/2015 (54) Title of the invention : ELECTRICITY GENERATION METHOD USING A GAS/AIR SEPARATION UNIT AND A COMBUSTION UNIT (51) International classification :F01K13/02,F23L7/00,F23J15/00 (71)Name of Applicant : (31) Priority Document No :10 51755 1)LAIR LIQUIDE SOCI‰T‰ ANONYME POUR (32) Priority Date :11/03/2010 LETUDE ET LEXPLOITATION DES PROC‰D‰S (33) Name of priority country :France GEORGES CLAUDE (86) International Application Address of Applicant :75 Quai dOrsay F 75007 Paris France :PCT/FR2011/050495 No (72)Name of Inventor : :11/03/2011 Filing Date 1)ALLARD Nicolas (87) International Publication 2)GUILLARD Alain :WO 2011/110792 No (61) Patent of Addition to :NA Application Number :NA Filing Date (62) Divisional to Application :NA Number :NA Filing Date (57) Abstract : For a plant comprising a gas/air separation unit (2) supplying a boiler (7) and a boiler fed unit for compression and/or purification of C0 (16, 20) the quantity of fumes sent to the compression and/or purification unit is modified according to the sale price of the electricity generated and/or the cost of venting the fumes. No. of Pages : 19 No. of Claims : 14 The Patent Office Journal 18/12/2015 65902 (12) PATENT APPLICATION PUBLICATION (21) Application No.7019/DELNP/2015 A (19) INDIA (22) Date of filing of Application :10/08/2015 (43) Publication Date : 18/12/2015 (54) Title of the invention : A METHOD AND APPARATUS FOR USE IN MACHINE VISION (51) International classification :G01B11/25,G01B11/24 (71)Name of Applicant : (31) Priority Document No :1302018.5 1)RENISHAW PLC (32) Priority Date :05/02/2013 Address of Applicant :New Mills Wotton under Edge (33) Name of priority country :U.K. Gloucestershire GL12 8JR U.K. (86) International Application No :PCT/GB2014/050286 (72)Name of Inventor : Filing Date :03/02/2014 1)McLEAN Calum Conner (87) International Publication No :WO 2014/122438 2)FEATHERSTONE Timothy Charles (61) Patent of Addition to Application 3)DEWAR Richard George :NA Number :NA Filing Date (62) Divisional to Application Number :NA Filing Date :NA (57) Abstract : This invention concerns a method of inspecting an object 6 comprising locating an object 6 on a machine vision apparatus1 attaching a light panel 10 to the object 6 to backlight a region of the object 6 obtaining an image of the region when backlit by the light panel 10 and identifying a geometric property of the object 6 from the image. No. of Pages : 26 No. of Claims : 37 The Patent Office Journal 18/12/2015 65903 (12) PATENT APPLICATION PUBLICATION (21) Application No.7020/DELNP/2015 A (19) INDIA (22) Date of filing of Application :10/08/2015 (43) Publication Date : 18/12/2015 (54) Title of the invention : VANE CARRIER THERMAL MANAGEMENT ARRANGEMENT AND METHOD FOR CLEARANCE CONTROL (51) International classification :F01D9/06,F01D11/24,F01D25/10 (71)Name of Applicant : (31) Priority Document No :13/795542 1)SIEMENS AKTIENGESELLSCHAFT (32) Priority Date :12/03/2013 Address of Applicant :Wittelsbacherplatz 2 80333 M¼nchen (33) Name of priority country :U.S.A. Germany (86) International Application (72)Name of Inventor : :PCT/US2014/018711 No 1)THAM Kok Mun :26/02/2014 Filing Date 2)LEE Ching Pang (87) International Publication 3)TERPOS Brian H. :WO 2014/158609 No 4)SIMKO Dustan M. (61) Patent of Addition to :NA Application Number :NA Filing Date (62) Divisional to Application :NA Number :NA Filing Date (57) Abstract : A thermal management arrangement (110) in a gas turbine engine (60) including: a conduit arrangement (62) providing fluid communication between a compressor section (156) and: a relatively thermally responsive portion (52) of a turbine vane carrier (10); and a relatively thermally unresponsive portion (48) of a turbine vane carrier. The conduit arrangement includes: a general cooling flow outlet (122) disposed proximate the relatively thermally responsive portion of the turbine vane carrier and configured to discharge a general cooling flow (124); and an impingement flow outlet (118) disposed proximate the relatively thermally unresponsive portion and configured to discharge an impingement flow (120). The thermal management arrangement is configured such that a flow rate of the impingement flow is effective to accelerate a thermal response of the relatively thermally unresponsive portion toward a thermal response of the relatively thermally responsive portion. No. of Pages : 25 No. of Claims : 20 The Patent Office Journal 18/12/2015 65904 (12) PATENT APPLICATION PUBLICATION (21) Application No.7314/DELNP/2012 A (19) INDIA (22) Date of filing of Application :22/08/2012 (43) Publication Date : 18/12/2015 (54) Title of the invention : SYNTHESIS OF METAL OXIDES BY REACTIVE CATHODIC ARC EVAPORATION (51) International classification :C07C (71)Name of Applicant : (31) Priority Document No :10002039.5 1)OERLIKON TRADING AG TRBBACH (32) Priority Date :28/02/2010 Address of Applicant :Hauptstrasse CH-9477 Tr¼bbach (33) Name of priority country :EPO Switzerland Switzerland (86) International Application No :PCT/EP2011/000383 (72)Name of Inventor : Filing Date :10/02/2011 1)JRGEN RAMM (87) International Publication No :WO/2011/103955 2)BENNO WIDRIG (61) Patent of Addition to Application :NA Number :NA Filing Date (62) Divisional to Application Number :NA Filing Date :NA (57) Abstract : This application relates to the reactive cathodic arc evaporation of the composite Al-Cr targets and the nucleation and phase formation of the synthesized Al-Cr-O layers. The oxygen partial pressure and the pulsed operation of the arc current influence the formation of intermetallic phases and solid solutions at the target surface. The nucleation of the ternary oxides at the substrate site appears to be, to some extent, controllable by the intermetallics or solid solutions formed at the target surface. A specific nucleation process at substrate site can therefore be induced by the free choice of target composition in combination with the partial pressure of the oxygen reactive gas. It also allows the control over the oxide island growth at the target surface which occurs occasionally at higher oxygen partial pressure. This is supported by the X-ray diffraction analysis of the layers as well as of the target surface. No. of Pages : 28 No. of Claims : 15 The Patent Office Journal 18/12/2015 65905 (12) PATENT APPLICATION PUBLICATION (21) Application No.7316/DELNP/2012 A (19) INDIA (22) Date of filing of Application :22/08/2012 (43) Publication Date : 18/12/2015 (54) Title of the invention : METHOD AND APPARATUS FOR AUTONOMOUS DOWNHOLE FLUID SELECTION WITH PATHWAY DEPENDENT RESISTANCE SYSTEM (51) International classification :E21B43/12,E21B21/08 (71)Name of Applicant : (31) Priority Document No :12/700685 1)HALLIBURTON ENERGY SERVICES INC. (32) Priority Date :04/02/2010 Address of Applicant :10200 Bellaire Boulevard Houston TX (33) Name of priority country :U.S.A. 77072 U.S.A. (86) International Application No :PCT/US2011/022617 (72)Name of Inventor : Filing Date :26/01/2011 1)DYKSTRA Jason D. (87) International Publication No :WO 2011/097101 2)FRIPP Michael Linley (61) Patent of Addition to Application 3)DEJESUS Orlando :NA Number 4)GANO John C. :NA Filing Date 5)HOLDERMAN Luke (62) Divisional to Application Number :NA Filing Date :NA (57) Abstract : An apparatus is described for controlling flow of fluid in a tubular positioned in a wellbore extending through a subterranean formation. A flow control system is placed in fluid communication with a main tubular. The flow control system has a flow ratio control system and a pathway dependent resistance system. The flow ratio control system has a first and second passageway the production fluid flowing into the passageways with the ratio of fluid flow through the passageways related to the characteristic of the fluid flow. The pathway dependent resistance system includes a vortex chamber with a first and second inlet and an outlet the first inlet of the pathway dependent resistance system in fluid communication with the first passageway of the fluid ratio control system and the second inlet m fluid communication with the second passageway of the fluid ratio control system. The first inlet is positioned to direct fluid into the vortex chamber such that it flows primarily tangentially into the vortex chamber and the second inlet is positioned to direct fluid such that it flows primarily radially into the vortex chamber Undesired fluids such as natural gas or water in an oil well are directed based on their relative characteristic into the vortex primarily tangentially thereby restricting fluid flow when the undesired fluid is present as a component of the production fluid. No. of Pages : 90 No. of Claims : 200 The Patent Office Journal 18/12/2015 65906 (12) PATENT APPLICATION PUBLICATION (21) Application No.1599/DEL/2014 A (19) INDIA (22) Date of filing of Application :12/06/2014 (43) Publication Date : 18/12/2015 (54) Title of the invention : OXYGEN INJECTION IN SPONGE IRON PRODUCTION (51) International classification :C21B13/08 (71)Name of Applicant : (31) Priority Document No :NA 1)PRAXAIR INDIA PRIVATE LIMITED (32) Priority Date :NA Address of Applicant :Praxair House, No. 8, Ulsoor Road, (33) Name of priority country :NA Bengalura - 560 042, India, India (86) International Application No :PCT// (72)Name of Inventor : Filing Date :01/01/1900 1)KUNAL PRASANNA SAHA (87) International Publication No : NA 2)NARRA RAJESH (61) Patent of Addition to Application Number :NA Filing Date :NA (62) Divisional to Application Number :NA Filing Date :NA (57) Abstract : ABSTRACT OF THE DISCLOSURE Sponge iron is produced by direct reduction of iron ore or iron ore pellet in a rotary kiln utilizing a first and a second carbonaceous material stream, and a plurality of oxygen streams derived from an oxygen source supplying commercial grade oxygen. The oxygen stream from the oxygen source is split into a first oxygen stream and a second oxygen stream and the split varied in a cyclic manner, changing from a starting value to a final value and then back to starting value in a stepwise manner while holding the flow rates of the first and second oxygen streams at each split value for a pre-defined cycle step time. No. of Pages : 22 No. of Claims : 10 The Patent Office Journal 18/12/2015 65907 (12) PATENT APPLICATION PUBLICATION (21) Application No.1945/DEL/2012 A (19) INDIA (22) Date of filing of Application :25/06/2012 (43) Publication Date : 18/12/2015 (54) Title of the invention : NOVEL SOLID STATE FORMS OF GUANFACINE AND ITS HYDROCHLORIDE AND PREPARATION THEREOF (51) International classification :C07C (71)Name of Applicant : (31) Priority Document No :NA 1)JUBLIANT LIFE SCIENCES LIMITED (32) Priority Date :NA Address of Applicant :PLOT 1A, SECTOR 16A, NOIDA-201 (33) Name of priority country :NA 301, INDIA Uttar Pradesh India (86) International Application No :NA (72)Name of Inventor : Filing Date :NA 1)SINGH, KHUSHWANT (87) International Publication No : NA 2)VERMA, JAI PRAKASH (61) Patent of Addition to Application Number :NA 3)VIR, DHARAM Filing Date :NA 4)AGARWAL, ASHUTOSH (62) Divisional to Application Number :NA Filing Date :NA (57) Abstract : The present invention provides a novel polymorph of guanfacine base and its hydrochloride salt, process for its preparation and to pharmaceutical composition containing it. No. of Pages : 42 No. of Claims : 42 The Patent Office Journal 18/12/2015 65908 (12) PATENT APPLICATION PUBLICATION (21) Application No.5702/DELNP/2012 A (19) INDIA (22) Date of filing of Application :26/06/2012 (43) Publication Date : 18/12/2015 (54) Title of the invention : ABSORBENT ARTICLE COMPRISING LOTION COMPOSITION COMPRISING OMEGA 6 FATTY ACID (51) International classification :A61F13/15,A61L15/34 (71)Name of Applicant : (31) Priority Document No :61/291069 1)THE PROCTER & GAMBLE COMPANY (32) Priority Date :30/12/2009 Address of Applicant :One Procter & Gamble Plaza Cincinnati (33) Name of priority country :U.S.A. OH 45202 U.S.A. (86) International Application No :PCT/US2010/061495 (72)Name of Inventor : Filing Date :21/12/2010 1)WARREN Raphael (87) International Publication No :WO 2011/082025 (61) Patent of Addition to Application :NA Number :NA Filing Date (62) Divisional to Application Number :NA Filing Date :NA (57) Abstract : An absorbent article comprises a lotion composition comprising omega 6 fatty acid. A method of improving skin barrier function of vulvar skin comprising the step of contacting the vulvar skin with an absorbent article comprising a body facing surface and a garment facing surface wherein omega 6 fatty acid is disposed on the body facing surface of the absorbent article. No. of Pages : 27 No. of Claims : 10 The Patent Office Journal 18/12/2015 65909 (12) PATENT APPLICATION PUBLICATION (21) Application No.5703/DELNP/2012 A (19) INDIA (22) Date of filing of Application :26/06/2012 (43) Publication Date : 18/12/2015 (54) Title of the invention : RAILWAY CAR COUPLER HEAD CONTOUR GAUGE AND METHOD (51) International classification :B61G3/04,B61G7/14 (71)Name of Applicant : (31) Priority Document No :12/694705 1)McCONWAY & TORLEY LLC (32) Priority Date :27/01/2010 Address of Applicant :2525 Stemmons Freeway Dallas Texas (33) Name of priority country :U.S.A. 75207 2401 U.S.A. (86) International Application No :PCT/US2011/021979 (72)Name of Inventor : Filing Date :21/01/2011 1)SAELER Kevin S. (87) International Publication No :WO 2011/094119 (61) Patent of Addition to Application :NA Number :NA Filing Date (62) Divisional to Application Number :NA Filing Date :NA (57) Abstract : A railway car coupler head contour gauge (60) includes a cylindrical portion (70) configured to be rotatably coupled to a coupler head. The railway car coupler head contour gauge also includes a pulling lug gauging portion and a contoured gauging surface (68) that is configured to align with a contour face of a top pulling lug (30) of the coupler head during gauging. The coupler head contour gauge may also include a convex portion (65) configured to align with a buffing shoulder (22) of the coupler head. No. of Pages : 21 No. of Claims : 20 The Patent Office Journal 18/12/2015 65910 (12) PATENT APPLICATION PUBLICATION (21) Application No.7197/DELNP/2012 A (19) INDIA (22) Date of filing of Application :17/08/2012 (43) Publication Date : 18/12/2015 (54) Title of the invention : APPARATUS AND METHODS FOR BONE ACCESS AND CAVITY PREPARATION (51) International classification :A61B17/62 (71)Name of Applicant : (31) Priority Document No :61/296722 1)CONVENTUS ORTHOPAEDICS INC. (32) Priority Date :20/01/2010 Address of Applicant :10200 73rd Ave N. Eagle Lake Office (33) Name of priority country :U.S.A. Suite #122 Maple Grove MN 55369 U.S.A. (86) International Application No :PCT/US2011/021735 (72)Name of Inventor : Filing Date :19/01/2011 1)TAYLOR Kyle (87) International Publication No :WO 2011/091052 2)HERTEL Stefan J. (61) Patent of Addition to Application 3)PETERSON Alex A. :NA Number 4)BRENZEL Michael P. :NA Filing Date 5)KRUSE Steve D. (62) Divisional to Application Number :NA 6)KRINKE Todd A. Filing Date :NA 7)HINDRICHS Paul (57) Abstract : Apparatus and methods for preparing the interior of a bone for therapy. The therapy may include therapy for a bone fracture. The apparatus and methods may involve orienting a surgical instrument for proper deployment in the interior of the bone. An instrument guide may be positioned and retained against translation along and rotation about one or more of three substantially orthogonal axes. Apparatus placed exterior to the bone may register the guide to a region inside the bone that is designated for preparation or treatment. One or more broaching members may be used to prepare the region for treatment. A broaching member may be expandable inside the bone. A broaching member may be flexible such that it broaches bone having a relatively lower density and it leaves bone having a relatively higher density substantially intact. No. of Pages : 142 No. of Claims : 34 The Patent Office Journal 18/12/2015 65911 (12) PATENT APPLICATION PUBLICATION (21) Application No.7350/DELNP/2012 A (19) INDIA (22) Date of filing of Application :23/08/2012 (43) Publication Date : 18/12/2015 (54) Title of the invention : CARBONACEOUS MATERIAL WITH BROAD AGGREGATE SIZE DISTRIBUTION AND IMPROVED DISPERSIBILITY• (51) International classification :C07C (71)Name of Applicant : (31) Priority Document No :10/845,368 1)COLUMBIAN CHEMICALS COMPANY (32) Priority Date :13/05/2004 Address of Applicant :1800 West Oak Commons Court (33) Name of priority country :U.S.A. Marietta Georgia 30062-2253 U.S.A. (86) International Application No :PCT/US05/016817 (72)Name of Inventor : Filing Date :13/05/2005 1)WEIDONG WANG (87) International Publication No :WO 2005/113688 2)CHARLES RAY HERD (61) Patent of Addition to Application 3)JORGE ARMANDO AYALA :NA Number :NA Filing Date (62) Divisional to Application Number :7060/DELNP/2006 Filed on :24/11/2006 (57) Abstract : A carbon black with a nitrogen surface area (NSA) of 100 to 120m2/g, a ΔD50 via DCP of greater than 0.07, and a homogeneity index (HI) via QTM greater than 2.3. No. of Pages : 31 No. of Claims : 6 The Patent Office Journal 18/12/2015 65912 (12) PATENT APPLICATION PUBLICATION (21) Application No.7179/DELNP/2012 A (19) INDIA (22) Date of filing of Application :17/08/2012 (43) Publication Date : 18/12/2015 (54) Title of the invention : GAS TURBINE AND THERMODYNAMIC POWER GENERATION SYSTEM (51) International classification :H02J (71)Name of Applicant : (31) Priority Document No :12/708,088 1)THERMAL POWER TECHNOLOGY LLC (32) Priority Date :18/02/2010 Address of Applicant :9611 US Hwy 1 North #202 Sebastian (33) Name of priority country :U.S.A. FL 32958 USA U.S.A. (86) International Application No :PCT/US2010/045898 (72)Name of Inventor : Filing Date :18/08/2010 1)ROBERT F WATERSTRIPE (87) International Publication No :WO/2011/102852 2)GARY P HOFFMAN (61) Patent of Addition to Application 3)RICHARD L WILLOUGHBY :NA Number :NA Filing Date (62) Divisional to Application Number :NA Filing Date :NA (57) Abstract : A power generation system that includes a heat source loop, a heat engine loop, and a heat reclaiming loop. The heat can be waste heat from a steam turbine, industrial process or refrigeration or air-conditioning system, solar heat collectors or geothermal sources. The heat source loop may also include a heat storage medium to allow continuous operation even when the source of heat is intermittent. Heat from the heat source loop is introduced into the heat reclaiming loop or turbine loop. In the turbine loop a working fluid is boiled, injected into the turbine, recovered condensed and recycled. The power generation system further includes a heat reclaiming loop having a fluid that extracts heat from the turbine loop. The fluid of the heat reclaiming loop is then raised to a higher temperature and then placed in heat exchange relationship with the working fluid of the turbine loop. The power generating system is capable of using low temperature waste heat is approximately of 150 degrees F or less. The turbine includes one or more blades mounted on a rotating member. The turbine also includes one or more nozzles capable of introducing the gaseous working fluid, at a very shallow angle on to the surface of the blade or blades at a very high velocity. The pressure differential between the upstream and downstream surfaces of the blade as well as the change in direction of the high velocity hot gas flow create a combined force to impart rotation to the rotary member. No. of Pages : 64 No. of Claims : 46 The Patent Office Journal 18/12/2015 65913 (12) PATENT APPLICATION PUBLICATION (21) Application No.7180/DELNP/2012 A (19) INDIA (22) Date of filing of Application :17/08/2012 (43) Publication Date : 18/12/2015 (54) Title of the invention : INTEGRATED PROCESS AND METHODS OF PRODUCING (E)-1-CHLORO-3&NBSP;3&NBSP;3TRIFLUOROPROPENE (51) International classification :C07C (71)Name of Applicant : (31) Priority Document No :61/305,803 1)HONEYWELL INTERNATIONAL INC. (32) Priority Date :18/02/2010 Address of Applicant :Patent Services M/S AB/2B 101 (33) Name of priority country :U.S.A. Columbia Road P. O. Box 2245 Morristown New Jersey 07962(86) International Application No :PCT/US2011/024483 2245 United States of America U.S.A. Filing Date :11/02/2011 (72)Name of Inventor : (87) International Publication No :WO/2011/103035 1)HSUEH S TUNG (61) Patent of Addition to Application 2)ROBERT JOHNSON :NA Number 3)KONSTANTIN POKROVSKI :NA Filing Date 4)DANIEL C MERKEL (62) Divisional to Application Number :NA Filing Date :NA (57) Abstract : The present invention relates to methods, process, and integrated systems for economically producing (E)-1-chloro-3,3,3trifluoropropene via vapor phase and/or liquid processes. No. of Pages : 70 No. of Claims : 10 The Patent Office Journal 18/12/2015 65914 (12) PATENT APPLICATION PUBLICATION (21) Application No.7331/DELNP/2012 A (19) INDIA (22) Date of filing of Application :22/08/2012 (43) Publication Date : 18/12/2015 (54) Title of the invention : GENETIC MARKERS ASSOCIATED WITH DROUGHT TOLERANCE IN MAIZE (51) International classification (31) Priority Document No (32) Priority Date (33) Name of priority country (86) International Application No Filing Date (87) International Publication No (61) Patent of Addition to Application Number Filing Date (62) Divisional to Application Number Filing Date (71)Name of Applicant : 1)SYNGENTA PARTICIPATIONS AG Address of Applicant :SCHWARZWALDALLEE 215 CH4058 BASEL SWITZERLAND Switzerland (72)Name of Inventor : 1)KISHORE VENKATA KRISHNA 2)ALTENDORF PAUL 3)PREST THOMAS JOSEPH :A01H 5/00 4)ZINSELMEIER CHRIS :61/289,718 5)WANG DAOLONG :23/12/2009 6)BRIGGS WILLIAM :U.S.A. 7)GANDHI SONALI :PCT/US2010/062028 8)FOSTER DAVID :23/12/2010 9)CHAULK-GRACE CHRISTINE :WO 2011/079277 10)CLARKE JOSEPH DALLAS 11)SESSIONS ALLEN :NA 12)KUST KARI DENISE :NA 13)REINDERS JON AARON TUCKER :NA 14)GUTIERREZ ROJAS LIBARDO ANDRES :NA 15)LI MEIJUAN 16)WARNER TODD 17)MARTIN NICOLAS 18)MILLER ROBERT LYNN 19)ARBUCKLE JOHN 20)SKALLA DALE WAYNE 21)DUNN MOLLY 22)DACE GAYLE 23)KRAMER VANCE CARY (57) Abstract : The presently disclosed subject matter relates to methods and compositions for identifying, selecting, and/or producing drought tolerant maize plants or germplasm. Maize plants or germplasm that have been identified, selected, and/or produced by any of the methods of the presently disclosed subject matter are also provided. No. of Pages : 330 No. of Claims : 20 The Patent Office Journal 18/12/2015 65915 (12) PATENT APPLICATION PUBLICATION (21) Application No.7334/DELNP/2012 A (19) INDIA (22) Date of filing of Application :22/08/2012 (43) Publication Date : 18/12/2015 (54) Title of the invention : ELECTROSPINNING APPARATUS AND NANOFIBERS PRODUCED THEREFROM (51) International classification :D06N1/00 (71)Name of Applicant : (31) Priority Document No :61/304,666 1)Cornell University (32) Priority Date :15/02/2010 Address of Applicant :395 Pine Tree Road Suite 310 Ithaca (33) Name of priority country :U.S.A. New York 14850 USA. U.S.A. (86) International Application No :PCT/US2011/024894 (72)Name of Inventor : Filing Date :15/02/2011 1)JOO Yong Lak (87) International Publication No :WO 2011/100743 2)CHO Daehwan (61) Patent of Addition to Application 3)ZHMAYEV Eduard :NA Number :NA Filing Date (62) Divisional to Application Number :NA Filing Date :NA (57) Abstract : Provided herein are gas and/or temperature assisted electrospinning apparatus processes components and polymer nanofibers. No. of Pages : 44 No. of Claims : 55 The Patent Office Journal 18/12/2015 65916 (12) PATENT APPLICATION PUBLICATION (21) Application No.7335/DELNP/2012 A (19) INDIA (22) Date of filing of Application :22/08/2012 (43) Publication Date : 18/12/2015 (54) Title of the invention : ELECTRONIC COMPONENT&NBSP; CONDUCTIVE PASTE&NBSP; AND METHOD FOR MANUFACTURING ELECTRONIC COMPONENT (51) International classification :H04N (71)Name of Applicant : (31) Priority Document No :NA 1)Hitachi Ltd. (32) Priority Date :NA Address of Applicant :6-6 Marunouchi 1-chome Chiyoda-ku (33) Name of priority country :NA Tokyo 100-8280 Japan. Japan (86) International Application No :PCT/JP2010/053077 (72)Name of Inventor : Filing Date :26/02/2010 1)AOYAGI Takuya (87) International Publication No :WO 2011/104859 2)NAITO Takashi (61) Patent of Addition to Application 3)YAMAMOTO Hiroki :NA Number 4)KATO Takahiko :NA Filing Date (62) Divisional to Application Number :NA Filing Date :NA (57) Abstract : Disclosed is a conductive paste having a plurality of particles (4) which are dispersed in a phosphoric acid solution and are composed of aluminum (Al) and/or an alloy containing aluminum. An electrode wiring line (2) is formed by applying and baking the conductive paste on a substrate (3). The electrode wiring line (2) has: the particles (4) composed of aluminum and/or the alloy containing aluminum; and an oxide (5) that fixes the particles (4) on the substrate (3). The oxide (5) contains phosphorus (P) and aluminum mixed therein. The particles (4) contains at least one kind of element selected from among a group composed of silver (Ag) copper (Cu) silicon (Si) magnesium (Mg) and calcium (Ca). The electrode wiring line (2) has 84.2-99.7 vol % of particles (4). No. of Pages : 41 No. of Claims : 13 The Patent Office Journal 18/12/2015 65917 (12) PATENT APPLICATION PUBLICATION (21) Application No.7028/DELNP/2015 A (19) INDIA (22) Date of filing of Application :10/08/2015 (43) Publication Date : 18/12/2015 (54) Title of the invention : IMPACT RESISTANT MEDICAL INSTRUMENTS IMPLANTS AND METHODS (51) International classification :A61F2/36 (71)Name of Applicant : (31) Priority Document No :61/764 387 1)SMITH & NEPHEW INC (32) Priority Date :13/02/2013 Address of Applicant :1450 Brooks Road Memphis TN 38116 (33) Name of priority country :U.S.A. U.S.A. (86) International Application No :PCT/US2014/015770 (72)Name of Inventor : Filing Date :11/02/2014 1)PORZEL Alec Paul (87) International Publication No :WO 2014/126908 2)LUX Thomas William (61) Patent of Addition to Application 3)DYER Robert H. :NA Number :NA Filing Date (62) Divisional to Application Number :NA Filing Date :NA (57) Abstract : Embodiments of the invention include surgical instruments implants and methods. Surgical instruments or implants may be manufactured from a mixture of a polymer and a filler material. In some embodiments the polymer is a medical grade polymer and the filler is a reinforcing material that increases the rigidity of the mixture when cured. The polymer may include one or both of a USP Class VI approved base resin and an ISO 10993 1 approved base resin in some embodiments. No. of Pages : 22 No. of Claims : 55 The Patent Office Journal 18/12/2015 65918 (12) PATENT APPLICATION PUBLICATION (21) Application No.7029/DELNP/2015 A (19) INDIA (22) Date of filing of Application :10/08/2015 (43) Publication Date : 18/12/2015 (54) Title of the invention : METHODS OF HANDLING PAPAYA (51) International classification (31) Priority Document No (32) Priority Date (33) Name of priority country (86) International Application No Filing Date (87) International Publication No (61) Patent of Addition to Application Number Filing Date (62) Divisional to Application Number Filing Date (71)Name of Applicant : 1)AGROFRESH INC. Address of Applicant :400 Arcola Road P.O. Box 7000 :A23L3/34,A23B7/14 Collegeville PA 19426 U.S.A. :61/770616 2)EDAGI Fernando K. :28/02/2013 3)BECERRA Daniel Manriquez :U.S.A. 4)MIR Nazir :PCT/US2014/018919 5)MCCASKEY Evan :27/02/2014 6)TERRA Felipe Monteiro :WO 2014/134270 7)MCGEE Robert L. :NA (72)Name of Inventor : :NA 1)EDAGI Fernando K. 2)BECERRA Daniel Manriquez :NA 3)MIR Nazir :NA 4)MCCASKEY Evan 5)TERRA Felipe Monteiro 6)MCGEE Robert L. (57) Abstract : Provided is a method of storing papaya comprising the step of exposing papaya to an atmosphere that contains a cyclopropene compound wherein either (a) the papayas are in a modified atmosphere package during exposure to the cyclopropene compound or (b) the papayas are placed into a modified atmosphere package after exposure to the cyclopropene compound and the papaya remain in the modified atmosphere package for at least two hours. In some embodiments the modified atmosphere package is constructed so that the transmission rate of oxygen for the entire package is from 200 to 40 000 cubic centimeters per day per kilogram of papaya. No. of Pages : 38 No. of Claims : 37 The Patent Office Journal 18/12/2015 65919 (12) PATENT APPLICATION PUBLICATION (21) Application No.703/DEL/2009 A (19) INDIA (22) Date of filing of Application :06/04/2009 (43) Publication Date : 18/12/2015 (54) Title of the invention : A MOBILE MISSILE LAUNCH SYSTEM AND METHOD THEREOF (51) International classification (31) Priority Document No (32) Priority Date (33) Name of priority country (86) International Application No Filing Date (87) International Publication No (61) Patent of Addition to Application Number Filing Date (62) Divisional to Application Number Filing Date (71)Name of Applicant : 1)THE DIRECTOR GENERAL DEFENCE RESEARCH & DEVELOPMENT ORGANIZATION [DRDO] :F41F Address of Applicant :Ministry of Defence Govt. of India :NA Room No. 348 B-wing DRDO Bhawan Rajaji Marg New Delhi :NA Delhi India :NA (72)Name of Inventor : :NA 1)SIDDALINGAPPA GURUPRASAD :NA 2)SHREEDHAR ARAVIND KATTI : NA 3)ALASANI PRASAD GOUD :NA 4)VIKAS NARAYAN WAGHMARE :NA 5)SANJAY KUMAR :NA 6)ATUL GUPTA :NA 7)RAVINDRA SUDHAKAR KHIRE 8)TUSHAR KANT SANTOSH 9)BIMAL GAUTAM 10)PARAS RAM (57) Abstract : The present invention relates to launching system, more particularly relates to mobile launching system for missiles. The mobile missile launch system comprising a vehicle (14) having a chassis structure adapted to carry the launch system; a mounting frame (16) comprising predetermined truss framework mounted onto the chassis structure; plurality of sliding mechanisms mounted at rear end of the mounting frame (16); plurality of canisters (43) mounted onto said beam (22) and plurality of missiles (11) ensconced within the canisters (43); plurality of containers (42) enclosing said canisters (43) and are connected to the saddles (32, 34) for linear movement; plurality of resting units (27) abutting to rear end of the canisters (43) and are adapted to move linearly to transfer reaction forces from said missiles (11) to ground. Figures 20 and 21 No. of Pages : 45 No. of Claims : 19 The Patent Office Journal 18/12/2015 65920 (12) PATENT APPLICATION PUBLICATION (21) Application No.7031/DELNP/2015 A (19) INDIA (22) Date of filing of Application :10/08/2015 (43) Publication Date : 18/12/2015 (54) Title of the invention : DRY MELT COATING PROCESS AND FORMULATION FOR VOLATILE COMPOUNDS (51) International (71)Name of Applicant : :A01N27/00,A01N3/02,A01N25/10 classification 1)AGROFRESH INC. (31) Priority Document No :61/762512 Address of Applicant :400 Arcola Road P.O. Box 7000 (32) Priority Date :08/02/2013 Collegeville PA 19426 U.S.A. (33) Name of priority country :U.S.A. 2)BECKER Christian Guy (86) International Application (72)Name of Inventor : :PCT/US2014/015085 No 1)BECKER Christian Guy :06/02/2014 Filing Date (87) International Publication :WO 2014/124124 No (61) Patent of Addition to :NA Application Number :NA Filing Date (62) Divisional to Application :NA Number :NA Filing Date (57) Abstract : This invention is based on surprising results that dry coat particles using a melt process where the dispersed melted polymer core (for example a linear polyester diol containing dispersed HAIP) can bead up effectively in a surrounding hydrophobic powder. One good coating powder is identified as organoclay. Silica coating also works well when combined with clay coating. With the coating provided this invention enables generation of a stable powder with for example approximately 20% HAIP loading using a simple grinding and sieving process. The formulations provided can release less than 25% 1 MCP over a period of 4 hours under stirring conditions. No. of Pages : 28 No. of Claims : 25 The Patent Office Journal 18/12/2015 65921 (12) PATENT APPLICATION PUBLICATION (21) Application No.7364/DELNP/2012 A (19) INDIA (22) Date of filing of Application :23/08/2012 (43) Publication Date : 18/12/2015 (54) Title of the invention : SOLAR CELL HAVING A SPECIAL BUSBAR SHAPE SOLAR CELL ARRANGEMENT CONTAINING SAID SOLAR CELL AND METHOD FOR PRODUCING THE SOLAR CELL (51) International classification :H01L31/0224,H01L31/05 (71)Name of Applicant : (31) Priority Document No :10 2010 002 521.6 1)Q CELLS SE (32) Priority Date :02/03/2010 Address of Applicant :Sonnenallee 17 21 Intellectual Property (33) Name of priority country :Germany Management 06766 Bitterfeld Wolfen OT Thalheim Germany (86) International Application No :PCT/DE2011/075005 (72)Name of Inventor : Filing Date :18/01/2011 1)PFENNIG Andreas (87) International Publication No :WO 2011/107089 2)FAULWETTER QUANDT Bjrn (61) Patent of Addition to Application 3)HUBERT Andreas :NA Number :NA Filing Date (62) Divisional to Application Number :NA Filing Date :NA (57) Abstract : The invention relates to a solar cell (1), comprising a Substrate (2), a semiconductor layer (3), a first busbar (4) on a first surface (5) of the semiconductor layer (3), and a second busbar (6) on a second surface (7) of the semiconductor layer (3), wherein the first busbar (4) has contact pads (9, 91) along a connecting line (8), said contact pads having a maximum width bimax perpendicular to the connecting line (8), a current collecting area (10) being located between the contact pads on the connecting line (8), the current collecting area contacting the contact pads (9, 91) in a contact area (11), wherein the contact area (11) has two outer points (PI) and (P2) on both sides of the connecting line (8), the distance of which outer points perpendicular to the connecfing line (8) defines a maximum width bsmax of the current collecting area (10), wherein bimax- bsmax, and the width b of the current collecting area (10), starting from one contact pad (9) to an adjacent contact pad (9), first decreases to a minimum width bsmin between two inner points (P3) and (P4) and then increases again to the adjacent contact pad (9) to a maximum width bsmax. No. of Pages : 18 No. of Claims : 13 The Patent Office Journal 18/12/2015 65922 (12) PATENT APPLICATION PUBLICATION (21) Application No.7222/DELNP/2012 A (19) INDIA (22) Date of filing of Application :20/08/2012 (43) Publication Date : 18/12/2015 (54) Title of the invention : CONTINUOUS METHOD FOR MANUFACTURING FACE GEARS• (51) International classification :B62D (71)Name of Applicant : (31) Priority Document No :61/299, 386 1)THE GLEASON WORKS (32) Priority Date :29/01/2010 Address of Applicant :1000 University Avenue P.O. Box (33) Name of priority country :U.S.A. 22970 Rochester NY 14692-2970 U.S.A. (86) International Application No :PCT/US2011/022858 (72)Name of Inventor : Filing Date :28/01/2011 1)HERMANN J. STADTFELD (87) International Publication No :WO/2011/094492 (61) Patent of Addition to Application :NA Number :NA Filing Date (62) Divisional to Application Number :NA Filing Date :NA (57) Abstract : A continuous method of manufacturing a face gear utilizing a tool, representing a plane which can be oriented to a face gear workpiece under an angle equal to the pressure angle of the mating pinion member of the gear set (e.g. the face gear set), and, which can be rotated around a virtual pinion axis to generate a tooth flank on the workpiece. The tool is a face cutter which performs a continuous indexing motion with equal hand of rotation of cutter and workpiece (e.g. face gear) thereby describing a hypocycloid path of motion and an indexing ratio of two cutter rotations during one workpiece gear rotation which will produce straight lines along the face width of the face gear. No. of Pages : 29 No. of Claims : 12 The Patent Office Journal 18/12/2015 65923 (12) PATENT APPLICATION PUBLICATION (21) Application No.7223/DELNP/2012 A (19) INDIA (22) Date of filing of Application :20/08/2012 (43) Publication Date : 18/12/2015 (54) Title of the invention : METHOD FOR PRODUCING TEMPERATURE RESISTANT NONWOVENS (51) International classification :D06N1/00 (71)Name of Applicant : (31) Priority Document No :12/723,317 1)EXXONMOBIL CHEMICAL PATENTS INC. (32) Priority Date :12/03/2010 Address of Applicant :5200 Bayway Drive Baytown TX (33) Name of priority country :U.S.A. 77520-2101 United States of America U.S.A. (86) International Application No :PCT/US2011/024582 (72)Name of Inventor : Filing Date :11/02/2011 1)ALISTAIR DUNCAN WESTWOOD (87) International Publication No :WO/2011/112309 2)MICHAEL GLENN WILLIAMS (61) Patent of Addition to Application 3)GALEN CHARLES RICHESON :NA Number :NA Filing Date (62) Divisional to Application Number :NA Filing Date :NA (57) Abstract : Temperature resistant multilayer composites, methods for making same, and articles made therefrom. The method can include extruding one or more polyolefm polymers having a MFR from less than 90 dg/min through at least one die having a plurality of nozzles to form a plurality of continuous fibers, at least one die operating at a melt pressure from greater than 500 psi (3447 kPa) to form at least one elastic meltblown layer; adhering the at least one elastic meltblown layer to at least one extensible layer to form a multilayer composite; and at least partially crosslinking the elastic meltblown layer or the extensible layer or both. No. of Pages : 49 No. of Claims : 20 The Patent Office Journal 18/12/2015 65924 (12) PATENT APPLICATION PUBLICATION (21) Application No.7224/DELNP/2012 A (19) INDIA (22) Date of filing of Application :20/08/2012 (43) Publication Date : 18/12/2015 (54) Title of the invention : CROSS-LINKING AGENT FOR CROSS-LINKABLE ELASTOMERS AND APPLICATION THEREOF• (51) International classification :C07C (71)Name of Applicant : (31) Priority Document No :2010-025808 1)NIPPON KASEI CHEMICAL COMPANY LIMITED (32) Priority Date :08/02/2010 Address of Applicant :34 Aza-Takayama Onahama Iwaki(33) Name of priority country :Japan shi Fukushima-ken 9718101 Japan (86) International Application No :PCT/JP2011/052247 (72)Name of Inventor : Filing Date :03/02/2011 1)MABUKO YAMAURA (87) International Publication No :WO 2011/096477 2)YUKIO ORIKASA (61) Patent of Addition to Application 3)KAZUYA SENZAKI :NA Number 4)TAKASHI KAGAWA :NA Filing Date (62) Divisional to Application Number :NA Filing Date :NA (57) Abstract : The object of the present invention is to provide a cross-linking agent for a cross-linkable elastomer which is excellent in the heat resistance and rapid in the crosslinking rate in comparison with triallyl isocyanurate (TAIC)m The present invention relates to a crosslinking agent for a cross-linkable elastomer comprising a triazine derivative represented by the general formula (I) or prepolymer thereof. [Chemical Formula 1] (In the formula (I), at least two of X, Y and Z are each independently a diallylamino group, a monoallyl amino group or allyl-methylamino group, and the rest is a hydrogen atom or a hydrocarbon group which may be substituted.) No. of Pages : 27 No. of Claims : 12 The Patent Office Journal 18/12/2015 65925 (12) PATENT APPLICATION PUBLICATION (21) Application No.7385/DELNP/2012 A (19) INDIA (22) Date of filing of Application :24/08/2012 (43) Publication Date : 18/12/2015 (54) Title of the invention : ARRANGEMENT AND METHOD FOR CONTROL OF A PISTON MOVEMENT (51) International classification :B68F (71)Name of Applicant : (31) Priority Document No :1050170-8 1)SCANIA CV AB (32) Priority Date :24/02/2010 Address of Applicant :S-151 87 Sdertlje Sweden (33) Name of priority country :Sweden (72)Name of Inventor : (86) International Application No :PCT/SE2011/050160 1)ORTWIN SCHLTER Filing Date :15/02/2011 (87) International Publication No :WO/2011/105952 (61) Patent of Addition to Application :NA Number :NA Filing Date (62) Divisional to Application Number :NA Filing Date :NA (57) Abstract : An arrangement for moving a piston (12) in a compressed air cylinder (10), which arrangement comprises: a compressed air cylinder (10); a valve device (17); a compressed air device; a control unit (30); and an aperture (20) in the cylinder chamber casing (11), or a valve which allows air to leave a space (V1 ) formed within the compressed air cylinder (10). The arrangement is characterised in that the control unit (30) comprises means for controlling the valve device (17) in such a way that it supplies compressed air to the space (V1 ) in a constant flow, or in pulses of varying length, so that the piston (12) and the stem (13) coupled to it are thereby moved to desired positions in the cylinder chamber (15). The invention relates also to a method for control of a piston movement. No. of Pages : 20 No. of Claims : 16 The Patent Office Journal 18/12/2015 65926 (12) PATENT APPLICATION PUBLICATION (21) Application No.7386/DELNP/2012 A (19) INDIA (22) Date of filing of Application :24/08/2012 (43) Publication Date : 18/12/2015 (54) Title of the invention : CARBON ELECTRODE BATCH MATERIAL AND METHOD OF MAKING A CARBON ELECTRODE MATERIAL (51) International classification :C07C (71)Name of Applicant : (31) Priority Document No :12/712,661 1)CORNING INCORPORATED (32) Priority Date :25/02/2010 Address of Applicant :1 Riverfront Plaza Corning New York (33) Name of priority country :U.S.A. 14831 U.S.A. (86) International Application No :PCT/US2011/024953 (72)Name of Inventor : Filing Date :16/02/2011 1)RENEE KELLY DUNCAN (87) International Publication No :WO/2011/109165 2)JAMES W. ZIMMERMANN (61) Patent of Addition to Application :NA Number :NA Filing Date (62) Divisional to Application Number :NA Filing Date :NA (57) Abstract : The disclosure relates to carbon electrode batch materials and methods of using and products of the same. In particular, the disclosure relates to batch materials for forming carbon electrodes comprising at least one activated carbon, at least one binder, and a carrier substantially comprising water. The disclosure further relates to methods comprising extruding said batch materials. No. of Pages : 17 No. of Claims : 24 The Patent Office Journal 18/12/2015 65927 (12) PATENT APPLICATION PUBLICATION (21) Application No.7237/DELNP/2012 A (19) INDIA (22) Date of filing of Application :21/08/2012 (43) Publication Date : 18/12/2015 (54) Title of the invention : METHOD&NBSP; SYSTEM AND CONTROLLING RADIO NETWORK CONTROLLER (C-RNC) FOR DETERMINING SUPPORT CAPABILITY OF LOCAL CELL• (51) International classification :H04N (71)Name of Applicant : (31) Priority Document No :201010117146.6 1)ZTE CORPORATION (32) Priority Date :02/03/2010 Address of Applicant :ZTE Plaza Keji Road South Hi-Tech (33) Name of priority country :China Industrial Park Nanshan District Shenzhen Guangdong Province (86) International Application No :PCT/CN2010/075396 518057 China Filing Date :22/07/2010 (72)Name of Inventor : (87) International Publication No :WO/2011/106964 1)XIANG CHENG (61) Patent of Addition to Application 2)LIN LIU :NA Number 3)YAZHU KE :NA Filing Date (62) Divisional to Application Number :NA Filing Date :NA (57) Abstract : The present invention discloses a method, a system and a C-RNC for determining the support capability of a local cell, the method comprising the following steps of: a controlling radio network controller (C-RNC) receiving from a node B capability support information about the local cell of the node B, wherein the capability support information comprises uplink multi-carrier capability support information and shared interconnection of type B (IUB) transport bearer capability support information; and the C-RNC determining by default that the local cell supports a separate IUB transport bearer, and determining an uplink multi-carrier support capability and a shared IUB transport bearer support capability of the local cell according to the capability support information. The present invention accelerates the processing of the C®RNC, thereby improving the system performance. No. of Pages : 26 No. of Claims : 10 The Patent Office Journal 18/12/2015 65928 (12) PATENT APPLICATION PUBLICATION (21) Application No.7238/DELNP/2012 A (19) INDIA (22) Date of filing of Application :21/08/2012 (43) Publication Date : 18/12/2015 (54) Title of the invention : METHOD FOR ACTIVATION AND CONJUGATION OF BIOMOLECULES• (51) International classification :C12P (71)Name of Applicant : (31) Priority Document No :61/306,513 1)BAYER HEALTHCARE LLC (32) Priority Date :21/02/2010 Address of Applicant :555 White Plains Road Tarrytown (33) Name of priority country :U.S.A. New York 10591 U.S.A. (86) International Application No :PCT/US2011/025592 (72)Name of Inventor : Filing Date :21/02/2011 1)JENS H. VOGEL (87) International Publication No :WO/2011/103531 2)CHI SHUNG BRIAN TO (61) Patent of Addition to Application 3)CAROLINA LUCIA BIANCO :NA Number :NA Filing Date (62) Divisional to Application Number :NA Filing Date :NA (57) Abstract : The present invention is directed to a method for producing a biomolecule conjugate where the method is integrated into a single unit operation. No. of Pages : 21 No. of Claims : 9 The Patent Office Journal 18/12/2015 65929 (12) PATENT APPLICATION PUBLICATION (21) Application No.7239/DELNP/2012 A (19) INDIA (22) Date of filing of Application :21/08/2012 (43) Publication Date : 18/12/2015 (54) Title of the invention : PLATE ELEMENT&NBSP; AND FRICTION CLUTCH DEVICE AND BRAKE DEVICE PROVIDED WITH PLATE ELEMENT• (51) International classification :B27F (71)Name of Applicant : (31) Priority Document No :2010-040958 1)KABUSHIKI KAISHA F.C.C. (32) Priority Date :25/02/2010 Address of Applicant :7000-36 Nakagawa Hosoe-cho Kita(33) Name of priority country :Japan ku Hamamatsu-shi Shizuoka 4311304 Japan (86) International Application No :PCT/JP2011/052255 (72)Name of Inventor : Filing Date :03/02/2011 1)JUN TOKUMASU (87) International Publication No :WO 2011/105187) 2)YOICHIRO NAKANO (61) Patent of Addition to Application 3)HIROKAZU KOJIMA :NA Number :NA Filing Date (62) Divisional to Application Number :NA Filing Date :NA (57) Abstract : A plate element which can reduce drag torque, a friction clutch device including such a plate element, and a brake device including such a plate element are provided. A friction clutch device 100 includes clutch plates 103 which are retained, through meshing engagement, on the inner peripheral surface 101a of an outer case 101, which is rotatably driven by an engine. Each clutch plate 103 includes a flat, annular pressing element 103a which is pressed against a clutch friction plate 107 for frictional contact therewith. Engagement protrusions 103b are radially formed on the outer peripheral surface of the pressing element 103a. The engagement protrusions 103b are fit into recessed engagement grooves 101b provided on the outer case 101 and are meshed with the outer case 101. Projecting portions 103c which project toward the inner peripheral surface 101a of the outer case 101 are formed between adjacent engagement protrusions 103b on the outer peripheral surface of the pressing element 103a. No. of Pages : 49 No. of Claims : 7 The Patent Office Journal 18/12/2015 65930 (12) PATENT APPLICATION PUBLICATION (21) Application No.7391/DELNP/2012 A (19) INDIA (22) Date of filing of Application :24/08/2012 (43) Publication Date : 18/12/2015 (54) Title of the invention : INPUT OUTPUT DEVICE AND INFORMATION INPUT OUTPUT SYSTEM (51) International classification :G06F3/042,G06F3/033,G06K7/10 (71)Name of Applicant : (31) Priority Document No :2010017459 1)YOSHIDA Kenji (32) Priority Date :28/01/2010 Address of Applicant :9 14 2302 Koishikawa 1 chome Bunkyo (33) Name of priority country :Japan ku Tokyo 1120002 Japan (86) International Application (72)Name of Inventor : :PCT/JP2011/051774 No 1)YOSHIDA Kenji :28/01/2011 Filing Date (87) International Publication :WO 2011/093458 No (61) Patent of Addition to :NA Application Number :NA Filing Date (62) Divisional to Application :NA Number :NA Filing Date (57) Abstract : Disclosed is a highly user friendly input output device which can be used alone to input and output independent information and when connected to an information processing device can be used as an application dependent input device for information processing device applications. The input output device is provided with: a transmission function whereby a connection recognition means recognises whether or not a connection to an information processing device via a connection means is present and transmits code and/or coordinate values which are converted by a processing means to the information processing device via the connection means; and an operation control function whereby operating instructions command whether to output content data from an output means when the connection recognition means does not recognise a connection between the connection means and the information processing device. The provided functions make the disclosed input output device highly user friendly. No. of Pages : 189 No. of Claims : 37 The Patent Office Journal 18/12/2015 65931 (12) PATENT APPLICATION PUBLICATION (21) Application No.7250/DELNP/2012 A (19) INDIA (22) Date of filing of Application :21/08/2012 (43) Publication Date : 18/12/2015 (54) Title of the invention : A TRANSMISSION ARRANGEMENT COMPRISING A POWER MIXING MECHANISM• (51) International classification :B60B (71)Name of Applicant : (31) Priority Document No :61/311,515 1)TRANSMISSION CVTCORP INC (32) Priority Date :08/03/2010 Address of Applicant :2101 rue Nobel Suite N Sainte-Julie (33) Name of priority country :U.S.A. Qubec J3E 1Z8 Canada Canada (86) International Application No :PCT/CA2011/000241 (72)Name of Inventor : Filing Date :07/03/2011 1)SAMUEL BEAUDOIN (87) International Publication No :WO/2011/109891 2)JEAN-ROBERT DESMEULES (61) Patent of Addition to Application :NA Number :NA Filing Date (62) Divisional to Application Number :NA Filing Date :NA (57) Abstract : A transmission arrangement for transmitting power from a power source to an electrical generator. The transmission arrangement comprises a continuously variable transmission (CVT) and an alternative transmission that is more efficient at transmitting power than the CVT. The transmission arrangement further comprises a power mixing mechanism for combining power from the CVT and the alternative transmission into a combined power output to be provided to the electrical generator. The percentage of CVT power within the combined power output decreases as the power supplied by the power source increases. No. of Pages : 34 No. of Claims : 23 The Patent Office Journal 18/12/2015 65932 (12) PATENT APPLICATION PUBLICATION (21) Application No.7251/DELNP/2012 A (19) INDIA (22) Date of filing of Application :21/08/2012 (43) Publication Date : 18/12/2015 (54) Title of the invention : CHROMATOGRAPHY COLUMN ASSEMBLY COMPRISING A FIXTURE FOR A PLASTIC MESH (51) International classification :C07C (71)Name of Applicant : (31) Priority Document No :1000230-1 1)GE HEALTHCARE BIO-SCIENCES AB (32) Priority Date :12/03/2010 Address of Applicant :Patent Department Bjorkgatan 30 S(33) Name of priority country :Sweden 751 84 Uppsala Sweden (86) International Application No :PCT/SE2011/050261 (72)Name of Inventor : Filing Date :10/03/2011 1)DANIEL SALOMONSSON (87) International Publication No :WO/2011/112144 2)PETTER BENNEMO (61) Patent of Addition to Application 3)PER USELIUS :NA Number :NA Filing Date (62) Divisional to Application Number :NA Filing Date :NA (57) Abstract : In a chromatography column, at least one plastic retaining mesh is attached to a distributor plate using a fixture element comprising an elongated edge that penetrates into the plastic mesh to ensure sealing and to prevent radial movement of the plastic mesh. No. of Pages : 17 No. of Claims : 13 The Patent Office Journal 18/12/2015 65933 (12) PATENT APPLICATION PUBLICATION (21) Application No.7252/DELNP/2012 A (19) INDIA (22) Date of filing of Application :21/08/2012 (43) Publication Date : 18/12/2015 (54) Title of the invention : GAS-GUIDING PIPE COMPRISING A NOISE-ATTENUATING COVERING WITH VARIABLE POROSITY (51) International classification :G01N (71)Name of Applicant : (31) Priority Document No :1000590 1)TURBOMECA (32) Priority Date :12/02/2010 Address of Applicant :F-64510 Bordes France France (33) Name of priority country :France (72)Name of Inventor : (86) International Application No :PCT/FR2011/050296 1)ERIC JEAN-LOUIS BOUTY Filing Date :11/02/2011 2)PIERRE-LUC REGAUD (87) International Publication No :WO/2011 /098737 3)ANTOINE YVAN ALEXANDRE VALLON (61) Patent of Addition to Application :NA Number :NA Filing Date (62) Divisional to Application Number :NA Filing Date :NA (57) Abstract : The invention relates to a noise-attenuating covering intended for a pipe (10) for guiding gases along a gas path (V). Said covering comprises a wall (12) defining the gas path (V) and at least one resonance cavity (13), the wall (12) being pierced with holes (18) for fluid communication between the gas path (V) and the resonance cavity (13) in order to attenuate the noise. The invention is characterised in that the holes (18) have substantially identical diameters and in that, since said pipe (10) is arranged to guide the gases in the downstream direction, the number of said openings (18) per wall surface unit (12) decreases continuously along the gas path (V) in the downstream direction, such as to confer on said wall (12) substantially constant acoustic resistance along said gas path (V), for which the noise attenuation is optimised along the gas path (V). No. of Pages : 12 No. of Claims : 6 The Patent Office Journal 18/12/2015 65934 (12) PATENT APPLICATION PUBLICATION (21) Application No.7253/DELNP/2012 A (19) INDIA (22) Date of filing of Application :21/08/2012 (43) Publication Date : 18/12/2015 (54) Title of the invention : METHODS OF INTRACELLULAR CONVERSION OF SINGLE-CHAIN PROTEINS INTO THEIR DI-CHAIN FORM (51) International classification :C12N (71)Name of Applicant : (31) Priority Document No :61/286,963 1)ALLERGAN INC. (32) Priority Date :25/01/2010 Address of Applicant :2525 Dupont Drive T2-7H Irvine CA (33) Name of priority country :U.S.A. 92612 U.S.A. (86) International Application No :PCT/US2011/022272 (72)Name of Inventor : Filing Date :24/01/2011 1)SANJIV GHANSHANI (87) International Publication No :WO/2011/091370 2)LINH Q. LE (61) Patent of Addition to Application 3)YI LIU :NA Number 4)LANCE E. STEWARD :NA Filing Date (62) Divisional to Application Number :NA Filing Date :NA (57) Abstract : The present specification discloses expression constructs comprising single-chain proteins comprising a di-chain loop region comprising an exogenous protease cleavage site and a protease that can cleave the exogenous protease cleavage site located within the di-chain loop, cell compositions comprising such expression construct, and intracellular methods of converting the single-chain protein into its di-chain form. No. of Pages : 163 No. of Claims : 15 The Patent Office Journal 18/12/2015 65935 (12) PATENT APPLICATION PUBLICATION (21) Application No.7395/DELNP/2012 A (19) INDIA (22) Date of filing of Application :24/08/2012 (43) Publication Date : 18/12/2015 (54) Title of the invention : VEHICLE SEAT (51) International classification :B60N2/44,B60N2/06,B60R22/26 (71)Name of Applicant : (31) Priority Document No :2010067555 1)TOYOTA BOSHOKU KABUSHIKI KAISHA (32) Priority Date :24/03/2010 Address of Applicant :1 1 Toyoda cho Kariya shi Aichi (33) Name of priority country :Japan 4488651 Japan (86) International Application 2)AISIN SEIKI KABUSHIKI KAISHA :PCT/JP2011/053809 No (72)Name of Inventor : :22/02/2011 Filing Date 1)HARA Yoshiro (87) International Publication 2)HOSHIHARA Naoaki :WO 2011/118314 No 3)NIIMI Naoki (61) Patent of Addition to 4)CHIBA Akihiro :NA Application Number :NA Filing Date (62) Divisional to Application :NA Number :NA Filing Date (57) Abstract : A vertical surface (22) bent upwards from the top surface (21) of a slide rail (20) is formed on the side edge of the top surface (21) and a curved surface (23A) following the abovementioned bend is formed on the corner (23) therebetween. Holes (23B) penetrating the curved surface (23A) are formed in the abovementioned corner (23) and elongated regions (21B) that extend from the top surface (21) in a flush manner within a range not extending beyond the vertical surface (22) are formed within the holes (23B). Projecting sections (41B) which are inserted into the abovementioned holes (23B) and are supported from below by means of the elongated regions (21B) are formed on a mounting bracket (40) and the mounting bracket (40) is mounted upon the top surface (21) in a state supported from below by means of the top surface (21) with the projecting sections (41B) simultaneously supported from below by means of the elongated regions (21B). No. of Pages : 18 No. of Claims : 3 The Patent Office Journal 18/12/2015 65936 (12) PATENT APPLICATION PUBLICATION (21) Application No.7234/DELNP/2012 A (19) INDIA (22) Date of filing of Application :20/08/2012 (43) Publication Date : 18/12/2015 (54) Title of the invention : AN AIR MOTOR (51) International classification :H02J (71)Name of Applicant : (31) Priority Document No :2010902095 1)JOE SANTA & ASSOCIATES PTY LIMITED (32) Priority Date :14/05/2010 Address of Applicant :6 Burleigh Street Toronto West NSW (33) Name of priority country :Australia 2283 Australia (86) International Application No :PCT/AU2011/000226 (72)Name of Inventor : Filing Date :01/03/2011 1)SANTA David Luiz (87) International Publication No :WO/2011/140579 (61) Patent of Addition to Application :NA Number :NA Filing Date (62) Divisional to Application Number :NA Filing Date :NA (57) Abstract : An air motor (10) that receives compressed air in order to be driven. The air motor (10) includes a valve assembly (11) with a base (12) of a unitary construction. The base (12) has opposite side faces (13) to which there is sealingly attached caps (14) that in cooperation with flexible diaphragms (15) provide working chambers (15 16). No. of Pages : 20 No. of Claims : 11 The Patent Office Journal 18/12/2015 65937 (12) PATENT APPLICATION PUBLICATION (21) Application No.7380/DELNP/2012 A (19) INDIA (22) Date of filing of Application :24/08/2012 (43) Publication Date : 18/12/2015 (54) Title of the invention : OPTICAL FIBER WITH INCREASED MECHANICAL STRENGTH• (51) International classification :G01N (71)Name of Applicant : (31) Priority Document No :61/308,583 1)CORNING INCORPORATED (32) Priority Date :26/02/2010 Address of Applicant :1 Riverfront Plaza Corning New York (33) Name of priority country :U.S.A. 14831 U.S.A. (86) International Application No :PCT/US2011/026154 (72)Name of Inventor : Filing Date :25/02/2011 1)KEVIN W. BENNETT (87) International Publication No :WO/2011/106585 2)ANDREY V. FILIPPOV (61) Patent of Addition to Application 3)PETER J. RONCO :NA Number 4)ROGER A. ROSE :NA Filing Date 5)PUSHKAR TANDON (62) Divisional to Application Number :NA Filing Date :NA (57) Abstract : An optical fiber having increased mechanical strength is provided. The optical fiber includes an over cladding layer that has a compressive stress of at least 100 MPa. No. of Pages : 19 No. of Claims : 20 The Patent Office Journal 18/12/2015 65938 (12) PATENT APPLICATION PUBLICATION (21) Application No.7381/DELNP/2012 A (19) INDIA (22) Date of filing of Application :24/08/2012 (43) Publication Date : 18/12/2015 (54) Title of the invention : PRINTER COMPONENT MOUNTING AND ALIGNMENT SYSTEM (51) International classification :B68F (71)Name of Applicant : (31) Priority Document No :12/712,296 1)EASTMAN KODAK COMPANY (32) Priority Date :25/02/2010 Address of Applicant :343 State Street Rochester NY 14650(33) Name of priority country :U.S.A. 2201 U.S.A. (86) International Application No :PCT/US2011/024306 (72)Name of Inventor : Filing Date :10/02/2011 1)CHRISTOPHER M. MUIR (87) International Publication No :WO/2011/106164 2)WILLIAM F. DASSERO (61) Patent of Addition to Application 3)MARTIN C. JAMES :NA Number 4)ALLAN MACGREGOR WAUGH :NA Filing Date (62) Divisional to Application Number :NA Filing Date :NA (57) Abstract : A printing system includes a frame. A first printer component is mounted to the frame. A second printer component is compliantly mounted to the frame such that the second printer component is free to move in a plane. A first alignment mechanism is kinematically coupled to the first printer component and is kinematically coupled to the second printer component. A second alignment mechanism is kinematically coupled to the first printer component and is kinematically coupled to the second printer component. No. of Pages : 40 No. of Claims : 17 The Patent Office Journal 18/12/2015 65939 (12) PATENT APPLICATION PUBLICATION (21) Application No.7382/DELNP/2012 A (19) INDIA (22) Date of filing of Application :24/08/2012 (43) Publication Date : 18/12/2015 (54) Title of the invention : LIQUID DRUG TRANSFER DEVICE WITH VENTED VIAL ADAPTER (51) International classification :A61B (71)Name of Applicant : (31) Priority Document No :204141 1)MEDIMOP MEDICAL PROJECTS LTD (32) Priority Date :24/02/2010 Address of Applicant :17 Hatidhar Street P.O. Box 2499 (33) Name of priority country :Israel 43665 Ra™anana Israel Israel (86) International Application No :PCT/IL2011/000187 (72)Name of Inventor : Filing Date :23/02/2011 1)NIMROD LEV (87) International Publication No :WO/2011/104712 2)AMIR LEV (61) Patent of Addition to Application 3)NIV BEN SHALOM :NA Number :NA Filing Date (62) Divisional to Application Number :NA Filing Date :NA (57) Abstract : Liquid drug transfer devices including a vented vial adapter having a top wall, a downward depending skirt, and a dual lumen puncturing spike. The top wall includes vent apertures in flow communication with an underlying air filter and protective hoods for covering the vent apertures from splashes. The hood-like hoods are preferably quarter sphere shaped with hood apertures facing radial outwards. No. of Pages : 11 No. of Claims : 3 The Patent Office Journal 18/12/2015 65940 (12) PATENT APPLICATION PUBLICATION (21) Application No.7383/DELNP/2012 A (19) INDIA (22) Date of filing of Application :24/08/2012 (43) Publication Date : 18/12/2015 (54) Title of the invention : BONE PLATE SCREW HOLES CONVERTIBLE TO HOOKS (51) International classification :A61B (71)Name of Applicant : (31) Priority Document No :61/308,071 1)SYNTHES GMBH (32) Priority Date :25/02/2010 Address of Applicant :Eimattstrasse 3 CH-4436 Oberdorf (33) Name of priority country :U.S.A. Switzerland Switzerland (86) International Application No :PCT/US2011/025898 (72)Name of Inventor : Filing Date :23/02/2011 1)ABHISHEK MODI (87) International Publication No :WO/2011/106403 (61) Patent of Addition to Application :NA Number :NA Filing Date (62) Divisional to Application Number :NA Filing Date :NA (57) Abstract : A system for treating a bone, comprises a bone plate extending longitudinally from a first end to a second end and including a plurality of openings extending therethrough and a first hook member including a head sized and shaped to be lockingly received within a first one of the openings, the first hook member further including a spiked portion extending distally from the head to a sharp bone engaging distal end which, when the head is lockingly received within the first opening, projects distally from the bone plate toward a first target portion of bone to be engaged thereby to temporarily maintain the first target of bone in a desired spatial relation to the bone plate. No. of Pages : 14 No. of Claims : 15 The Patent Office Journal 18/12/2015 65941 (12) PATENT APPLICATION PUBLICATION (21) Application No.7384/DELNP/2012 A (19) INDIA (22) Date of filing of Application :24/08/2012 (43) Publication Date : 18/12/2015 (54) Title of the invention : RADIAL FLOW REACTOR WITH MOVABLE SUPPORTS (51) International classification :C07C (71)Name of Applicant : (31) Priority Document No :12/712,735 1)PRAXAIR TECHNOLOGY INC. (32) Priority Date :25/02/2010 Address of Applicant :39 Old Ridgebury Road Danbury (33) Name of priority country :U.S.A. Connecticut 06810 United States of America U.S.A. (86) International Application No :PCT/US2011/023992 (72)Name of Inventor : Filing Date :08/02/2011 1)MARK WILLIAM ACKLEY (87) International Publication No :WO/2011/106146 2)CEM E. CELIK (61) Patent of Addition to Application 3)JEFFERT JOHN NOWOBILSKI :NA Number 4)JAMES STANLEY SCHNEIDER :NA Filing Date (62) Divisional to Application Number :NA Filing Date :NA (57) Abstract : A radial flow reactor vessel is disclosed for use in gas purification, separation or reaction processes and most suitably used in prepurification processes. The reactor has internal baskets for confining a bed of active material. The baskets are rigidly supported at both the top and bottom ends of the reactor and have walls that are axially flexible and radially rigid. The vessel has multiple movable support columns designed to facilitate pre-stressing of the baskets to offset axial compressive loads induced from thermal cycling. No. of Pages : 44 No. of Claims : 23 The Patent Office Journal 18/12/2015 65942 (12) PATENT APPLICATION PUBLICATION (21) Application No.4993/DELNP/2015 A (19) INDIA (22) Date of filing of Application :09/06/2015 (43) Publication Date : 18/12/2015 (54) Title of the invention : A FILM COMPOSITION, FILM MADE FROM THE FILM COMPOSITION AND A MULTI- LAYER FILM INCLUDING THE FILM AND ARTICLES MADE THEREFROM (51) International classification :C08J5/18,C08L23/00 (71)Name of Applicant : (31) Priority Document No :61/728916 1)DOW GLOBAL TECHNOLOGIES LLC (32) Priority Date :21/11/2012 Address of Applicant :2040 Dow Center, Midland ,MI 48674 (33) Name of priority country :U.S.A. U.S.A. (86) International Application No :PCT/US2013/070925 (72)Name of Inventor : Filing Date :20/11/2013 1)MA ,Hongming (87) International Publication No :WO 2014/081777 2)HERNANDEZ, Claudia (61) Patent of Addition to Application 3)SAAVEDRA, Jose :NA Number :NA Filing Date (62) Divisional to Application Number :NA Filing Date :NA (57) Abstract : A film composition comprising from 5 to 75 percent by weight of an ethylene/a -olefm interpolymer composition (LLDPE) , and from 25 to 95 percent by weight of a propylene/a -olefin interpolymer composition , and films made from the film composition, wherein the films exhibited synergistic physical properties , namely holding force and elastic recovery ,are provided. No. of Pages : 26 No. of Claims : 15 The Patent Office Journal 18/12/2015 65943 (12) PATENT APPLICATION PUBLICATION (21) Application No.7216/DELNP/2012 A (19) INDIA (22) Date of filing of Application :18/08/2012 (43) Publication Date : 18/12/2015 (54) Title of the invention : ACTUATOR CONTROL DEVICE AND WORKING MACHINE EQUIPPED WITH SAME (51) International classification :B62D (71)Name of Applicant : (31) Priority Document No :2010-060944 1)Hitachi Construction Machinery Co. Ltd. (32) Priority Date :17/03/2010 Address of Applicant :5-1 Koraku 2-chome Bunkyo-ku (33) Name of priority country :Japan Tokyo 112-8563 Japan. Japan (86) International Application No :PCT/JP2011/050758 (72)Name of Inventor : Filing Date :18/01/2011 1)MORIKI Hidekazu (87) International Publication No :WO 2011/114765 2)KANEKO Satoru (61) Patent of Addition to Application 3)IZUMI Shiho :NA Number 4)IKIMI Takashi :NA Filing Date 5)YAMADA Hiroyuki (62) Divisional to Application Number :NA 6)MASANO Nobuo Filing Date :NA (57) Abstract : Provided is an actuator control device capable of suppressing vibration during a regeneration period. The actuator control device comprises: a target speed calculation means (121) for calculating a target number of rotations of a motor; a load detection means (2) for detecting a load imposed on an actuator; a torque command calculation means (123) for calculating a torque command of the motor on the basis of the load; a current command calculation means (131) for calculating from the torque command a current vector command to be flowed to the motor; a current detection means (5a); a current conversion means (132) for converting current to a current vector; a voltage command calculation means (133) for calculating a voltage vector command according to the deviation between the current vector command and the current vector; and a voltage conversion means (134)..... No. of Pages : 61 No. of Claims : 6 The Patent Office Journal 18/12/2015 65944 (12) PATENT APPLICATION PUBLICATION (21) Application No.7217/DELNP/2012 A (19) INDIA (22) Date of filing of Application :20/08/2012 (43) Publication Date : 18/12/2015 (54) Title of the invention : PYRAZOLE DERIVATIVES AS JAK INHIBITORS (51) International classification :C07C (71)Name of Applicant : (31) Priority Document No :10382039.5 1)ALMIRALL S.A. (32) Priority Date :18/02/2010 Address of Applicant :Ronda del General Mitre 151 E-08022 (33) Name of priority country :EPO Barcelona Spain Spain (86) International Application No :PCT/EP2011/000792 (72)Name of Inventor : Filing Date :18/02/2011 1)JORDI BACH TANA (87) International Publication No :WO/2011/101161 2)LLUIS MIQUEL PAGES SANTACANA (61) Patent of Addition to Application 3)JOAN TALTAVULL MOLL :NA Number 4)PAUL ROBERT EASTWOOD :NA Filing Date 5)JACOB GONZALEZ RODRIGUES (62) Divisional to Application Number :NA 6)VICTOR GIULIO MATASSA Filing Date :NA (57) Abstract : New pyrazole derivatives having the chemical structure of formula (I) are disclosed; as well as process for their preparation, pharmaceutical compositions comprising them and their use in therapy as inhibitors of Janus Kinases (JAK). No. of Pages : 194 No. of Claims : 43 The Patent Office Journal 18/12/2015 65945 (12) PATENT APPLICATION PUBLICATION (21) Application No.7218/DELNP/2012 A (19) INDIA (22) Date of filing of Application :20/08/2012 (43) Publication Date : 18/12/2015 (54) Title of the invention : ELASTIC MELTBLOWN LAMINATE CONSTRUCTIONS AND METHODS FOR MAKING SAME (51) International classification :A47J (71)Name of Applicant : (31) Priority Document No :12/723,317 1)EXXONMOBIL CHEMICAL PATENTS INC. (32) Priority Date :12/03/2010 Address of Applicant :5200 Bayway Drive Baytown TX (33) Name of priority country :U.S.A. 77520-2101 United States of America U.S.A. (86) International Application No :PCT/US2011/024589 (72)Name of Inventor : Filing Date :11/02/2011 1)ALISTAIR DUNCAN WESTWOOD (87) International Publication No :WO/2011/112311 2)GALEN CHARLES RICHESON (61) Patent of Addition to Application :NA Number :NA Filing Date (62) Divisional to Application Number :NA Filing Date :NA (57) Abstract : Multilayer meltblown composites, articles made therefrom, and methods for making same. The meltblown composite can include a first meltblown layer comprising one or more resins having an Ultimate Elongation (UE) of from about 50% to about 250%, as measured according to ASTM D412; and a second meltblown layer comprising a propylene-α-olefm copolymer having an ethylene content of about 5 wt% to about 20 wt%; a MFR (ASTM- 1238D, 2.16 kg, 230°C) of about 10 g/10 min to about 30 g/10 min; and a heat of fusion of 75 J/g or less. No. of Pages : 41 No. of Claims : 20 The Patent Office Journal 18/12/2015 65946 (12) PATENT APPLICATION PUBLICATION (21) Application No.7219/DELNP/2012 A (19) INDIA (22) Date of filing of Application :20/08/2012 (43) Publication Date : 18/12/2015 (54) Title of the invention : APPARATUS AND METHOD FOR DISTRIBUTING FLUID• (51) International classification :B62D (71)Name of Applicant : (31) Priority Document No :NA 1)JACOB KOBELT (32) Priority Date :NA Address of Applicant :1654 Ocean Park Road Surrey British (33) Name of priority country :NA Columbia V4A 3L9 Canada (86) International Application No :PCT/CA2010/000119 (72)Name of Inventor : Filing Date :25/01/2010 1)JACOB KOBELT (87) International Publication No :WO/2011/088544 (61) Patent of Addition to Application :NA Number :NA Filing Date (62) Divisional to Application Number :NA Filing Date :NA (57) Abstract : Methods and apparatuses for distributing fluid are disclosed. Fluid is received in an opening of a body, and at least some of the fluid is distributed to a first conduit in communication with a first outlet of a first discharge element coupled to said body. At least some of the fluid received in the opening is selectively distributed to a second conduit in communication with a second outlet of a second discharge element couplable to at least one of the body and the first discharge element in response to coupling and decoupling of the second discharge element. No. of Pages : 46 No. of Claims : 24 The Patent Office Journal 18/12/2015 65947 (12) PATENT APPLICATION PUBLICATION (21) Application No.917/DEL/2009 A (19) INDIA (22) Date of filing of Application :05/05/2009 (43) Publication Date : 18/12/2015 (54) Title of the invention : A PROCESS FOR THE PREPARATION OF PROPELLANT FORMULATION INCORPORATING FERROCENE POLY GLYCOL OLIGOMER (51) International classification (31) Priority Document No (32) Priority Date (33) Name of priority country (86) International Application No Filing Date (87) International Publication No (61) Patent of Addition to Application Number Filing Date (62) Divisional to Application Number Filed on (71)Name of Applicant : 1)DIRECTOR GENERAL :C08G 18/00 Address of Applicant :DEFENCE RESEARCH & :NA DEVELOPMENT ORGANISATION, MINISTRY OF :NA DEFENCE, GOVT OF INDIA, DTE OF ER & IPR/IPR GROUP, :NA WEST BLOCK 8, WING 1, R.K.PURAM, NEW DELHI-110011, :NA INDIA Delhi India :NA (72)Name of Inventor : :NA 1)GIRISH MUKUND GORE :NA 2)SHRI NANDAN ASTHANA :NA 3)KALPANA RAVINDRA TIPRE :1521/DEL/2003 4)RASIK GHEWARCHAND BHATEWARA :08/12/2003 5)CHANDRAKANT NANASAHEB DIVEKAR 6)MOHANIRAJ ANANT TAPASWI (57) Abstract : A process for the preparation of propellant formulation incorporating ferrocene polyglycol oligomer (FPGO). This invention relates to a process for the preparation of propellant formulation incorporating ferrocene polyglycol oligomer (FPGO) comprising the steps of mixing binder (15+20%) comprising HTPB and dioctyl adipate (DOA), crosslinker pyrogall (0.3=+0.5%) cured with toluene diisocyanate (TDI) NCO:OH-( 1:1.5-1.1) and lecithin (process aid) in a planetary mixer along eith FPGO for 10-20 min at 60 ± 2°C to obtain a uniform slurry, daerating said Slurry obtained in step (a) by applying vacuum of the order of 5-10 torr at 60 ± 2°C under stirring, adding bimodal AP of 250 µ size (50-55%) and 8-10 µ size (30-35%) or monomodal AP of 8-9 µ, (80-90% AP (coarse) and AP (fine) in small installments to the said slurry, mixing for 30-40 min at 60 ± 5°C, lowering the slurry temperature to <less than 40°C followed by mixing under vacuum for 30-40 minutes, adding tolune di-isocyanate to he said slurry obtained in step (b) and mixing at 45 ± 5°C for 10-15 min without vacuum followed by mixing for 10-15 min under vacuum of the order of 5 to 10 torr, Casting the said slurry obtained by step (c) in a mould evacuated to 2-5 torr, releasing the vacuum, transferring the said mould to a water jacketed oven maintained at 55 + 5°C followed y curing for 7-8 days. No. of Pages : 12 No. of Claims : 2 The Patent Office Journal 18/12/2015 65948 (12) PATENT APPLICATION PUBLICATION (21) Application No.6989/DELNP/2015 A (19) INDIA (22) Date of filing of Application :07/08/2015 (43) Publication Date : 18/12/2015 (54) Title of the invention : MODULATORS OF METHYL MODIFYING ENZYMES COMPOSITIONS AND USES THEREOF (51) International (71)Name of Applicant : :C07D401/14,C07D405/14,C07D401/12 classification 1)CONSTELLATION PHARMACEUTICALS INC. (31) Priority Document Address of Applicant :215 First Street Suite 200 Cambridge :PCT/US2013/025639 No MA 02142 U.S.A. (32) Priority Date :11/02/2013 (72)Name of Inventor : (33) Name of priority 1)ALBRECHT Brian K. :U.S.A. country 2)AUDIA James Edmund (86) International 3)COOK Andrew S. :PCT/US2014/015706 Application No 4)DAKIN Les A. :11/02/2014 Filing Date 5)DUPLESSIS Martin (87) International 6)GEHLING Victor S. :WO 2014/124418 Publication No 7)HARMANGE Jean Christophe (61) Patent of Addition to 8)NASVESCHUK Christopher G. :NA Application Number 9)VASWANI Rishi G. :NA Filing Date (62) Divisional to :NA Application Number :NA Filing Date (57) Abstract : Agents having the structural Formula (II) for modulating histone methyl modifying enzymes compositions and uses thereof for instance as anti cancer agents are provided herein. No. of Pages : 120 No. of Claims : 15 The Patent Office Journal 18/12/2015 65949 (12) PATENT APPLICATION PUBLICATION (21) Application No.7285/DELNP/2012 A (19) INDIA (22) Date of filing of Application :21/08/2012 (43) Publication Date : 18/12/2015 (54) Title of the invention : IMPROVED SEMICONDUCTING COMPOSITION (51) International classification :H01B9/02,H05K9/00,H01B11/06 (71)Name of Applicant : (31) Priority Document No :12/718649 1)GENERAL CABLE TECHNOLOGIES CORPORATION (32) Priority Date :05/03/2010 Address of Applicant :4 Tesseneer Drive Highland Heights (33) Name of priority country :U.S.A. Kentucky 41076 U.S.A. (86) International Application (72)Name of Inventor : :PCT/US2011/026267 No 1)EASTER Mark R. :25/02/2011 Filing Date (87) International Publication :WO 2011/109243 No (61) Patent of Addition to :NA Application Number :NA Filing Date (62) Divisional to Application :NA Number :NA Filing Date (57) Abstract : An improved conductor shielding composition for power cables is disclosed. The composition includes a base polymer conductive carbon black polyethylene glycol and a waxy additive. Cable shields prepared from the composition exhibit improved aging performance in accelerated cable life tests (ACLT). No. of Pages : 14 No. of Claims : 20 The Patent Office Journal 18/12/2015 65950 (12) PATENT APPLICATION PUBLICATION (21) Application No.7286/DELNP/2012 A (19) INDIA (22) Date of filing of Application :21/08/2012 (43) Publication Date : 18/12/2015 (54) Title of the invention : METHOD AND APPARATUS FOR VACUUM FORMED DENTAL APPLIANCE (51) International classification :A61C13/34,A61F5/56,A61C9/00 (71)Name of Applicant : (31) Priority Document No :61/318662 1)FRANTZ DESIGN INC. (32) Priority Date :29/03/2010 Address of Applicant :3202 Oakmont Blvd. Austin TX 78703 (33) Name of priority country :U.S.A. U.S.A. (86) International Application (72)Name of Inventor : :PCT/US2011/030367 No 1)FRANTZ Joseph Lee :29/03/2011 Filing Date 2)FRANTZ Donald E. (87) International Publication :WO 2011/126854 No (61) Patent of Addition to :NA Application Number :NA Filing Date (62) Divisional to Application :NA Number :NA Filing Date (57) Abstract : An appliance and methods are described that include embodiments of a mandibular advancement or positioning device which can use elastic bands to pull the jaw forward. The appliance has an upper plastic tray conforming to the patient s upper teeth and including a set of retention hooks coupled to the upper plastic tray via being encased in plastic one on the right and one on the left anterior buccal portion of an upper plastic base. The appliance also has a lower plastic tray conforming to the patient s lower teeth and has a set of bite pads integrated with a second set of plastic retention hooks encased in plastic extending outwardly from the teeth. The appliance includes the upper and lower plastic trays and specially formed elastic bands of a plurality of lengths and strengths replaceably attached to the retention hooks on both sides of the trays to pull the mandible forward for treatment. No. of Pages : 17 No. of Claims : 14 The Patent Office Journal 18/12/2015 65951 (12) PATENT APPLICATION PUBLICATION (21) Application No.7287/DELNP/2012 A (19) INDIA (22) Date of filing of Application :21/08/2012 (43) Publication Date : 18/12/2015 (54) Title of the invention : MULTI FILTER LUBRICANT PURIFICATION SYSTEM (51) International (71)Name of Applicant : :B01D35/02,B01D27/04,F01M11/03 classification 1)JACOBS William A. (31) Priority Document No :12/732126 Address of Applicant :6006 Las Colinas Circle Lake Worth FL (32) Priority Date :25/03/2010 33463 U.S.A. (33) Name of priority 2)VITTORIA Joseph V. :U.S.A. country (72)Name of Inventor : (86) International 1)JACOBS William A. :PCT/US2011/029312 Application No 2)VITTORIA Joseph V. :22/03/2011 Filing Date (87) International Publication :WO 2011/119529 No (61) Patent of Addition to :NA Application Number :NA Filing Date (62) Divisional to :NA Application Number :NA Filing Date (57) Abstract : A lubricant reclamation configuration includes a series of fluid inlets that distribute the fluid to a series of parallel arrangement of individual filter assemblies. A filter control valve assembly is assembled between the distribution manifold and each respective filter assembly individually controlling fluid flow between the distribution manifold and each respective filter assembly. The filter assembly processes the fluid. The processed fluid is collected and retuned to the system via a series of collection channels. The distribution manifold is preferably fabricated of a series of plates. No. of Pages : 33 No. of Claims : 20 The Patent Office Journal 18/12/2015 65952 (12) PATENT APPLICATION PUBLICATION (21) Application No.7288/DELNP/2012 A (19) INDIA (22) Date of filing of Application :21/08/2012 (43) Publication Date : 18/12/2015 (54) Title of the invention : SELF LUBRICATING BUSHING FOR A JOINT WHICH IS INTENDED TO BE MOUNTED ON A SHAFT (51) International classification :F16C33/20,F16C33/74 (71)Name of Applicant : (31) Priority Document No :1052296 1)H.E.F. (32) Priority Date :29/03/2010 Address of Applicant :Rue Beno®t Fourneyron F 42160 (33) Name of priority country :France Andrezieux Boutheon France (86) International Application No :PCT/FR2011/050530 (72)Name of Inventor : Filing Date :16/03/2011 1)MASSE Emmanuel (87) International Publication No :WO 2011/121205 2)VILLEMAGNE Patrick (61) Patent of Addition to Application 3)CHADUIRON Eric :NA Number :NA Filing Date (62) Divisional to Application Number :NA Filing Date :NA (57) Abstract : This bushing is made of a composite material having an elastic modulus of between 500 and 6000 N/mm2, said bushing having at least one lip (la) formed directly at the time of its manufacture to overhang its bore (lb) to act as a sealing or protective barrier once it has been mounted on the shaft (2), thereby creating a clamping effect between the inside diameter of said lip (la) or said lips, and the outside diameter of said shaft (2). No. of Pages : 12 No. of Claims : 10 The Patent Office Journal 18/12/2015 65953 (12) PATENT APPLICATION PUBLICATION (21) Application No.7262/DELNP/2012 A (19) INDIA (22) Date of filing of Application :21/08/2012 (43) Publication Date : 18/12/2015 (54) Title of the invention : FILM (51) International classification :C08J5/18 (71)Name of Applicant : (31) Priority Document No :2010015360 1)TEIJIN LIMITED (32) Priority Date :27/01/2010 Address of Applicant :6 7 Minamihommachi 1 chome Chuo (33) Name of priority country :Japan ku Osaka shi Osaka 5410054 Japan (86) International Application No :PCT/JP2011/051843 (72)Name of Inventor : Filing Date :25/01/2011 1)OYA Taro (87) International Publication No :WO 2011/093478 2)SHOJI Shinichiro (61) Patent of Addition to Application 3)UCHIYAMA Akihiko :NA Number 4)ONO Yuhei :NA Filing Date 5)ENDO Kohei (62) Divisional to Application Number :NA 6)NAKASHIMA Hiroshi Filing Date :NA (57) Abstract : Provided is a film formed from a composition obtained by mixing a polymer compound having acidic groups and a compound containing at least a cyclic structure having one carbodiimide group wherein the first nitrogen and the second nitrogen thereof are bonded by bonding groups. It is possible to obtain a film which has improved hydrolysis resistance and furthermore does not generate free isocyanate compounds. No. of Pages : 444 No. of Claims : 16 The Patent Office Journal 18/12/2015 65954 (12) PATENT APPLICATION PUBLICATION (21) Application No.7263/DELNP/2012 A (19) INDIA (22) Date of filing of Application :21/08/2012 (43) Publication Date : 18/12/2015 (54) Title of the invention : SPIROHETEROCYCLICAL SUBSTITUTED TETRAMIC ACID DERIVATIVES (51) International (71)Name of Applicant : :C07D471/10,C07D211/94,A01N43/90 classification 1)BAYER INTELLECTUAL PROPERTY GMBH (31) Priority Document No :61/303,069 Address of Applicant :Alfred Nobel Strasse 10 40789 (32) Priority Date :10/02/2010 Monheim Germany (33) Name of priority (72)Name of Inventor : :U.S.A. country 1)FISCHER Reiner (86) International 2)VOERSTE Arnd :PCT/EP2011/051800 Application No 3)H„USER HAHN Isolde :08/02/2011 Filing Date 4)LEHR Stefan (87) International 5)GATZWEILER Elmar :WO 2011/098443 Publication No 6)G–RGENS Ulrich (61) Patent of Addition to 7)HEINEMANN Ines :NA Application Number :NA Filing Date (62) Divisional to :NA Application Number :NA Filing Date (57) Abstract : The invention relates to novel Compounds of formula (I), where W, X, Y, Z, A, and G have the meanings indicated above, to a plurality of methods and intermediate products for producing same, and to the use thereof as pesticides and/or herbicides and/or fungicides. The invention further relates to selective herbicidal agents comprising spiroheterocyclic substituted tetramic acid derivatives and a Compound improving compatibility with useful plants. The invention further relates to increasing the effectiveness of pesticides in particular comprising spiroheterocyclic substituted tetramic acid derivatives, by adding ammonium or phosphonium salts and optionally penetration promoters, to the corresponding agents, to a method for producing same, and to the use thereof in pest control as insecticides and/or acaricides and/or fungicides and/or for preventing unwanted plant growth. No. of Pages : 151 No. of Claims : 24 The Patent Office Journal 18/12/2015 65955 (12) PATENT APPLICATION PUBLICATION (21) Application No.7264/DELNP/2012 A (19) INDIA (22) Date of filing of Application :21/08/2012 (43) Publication Date : 18/12/2015 (54) Title of the invention : INTELLIGENT MULTIFUNCTIONAL ACCUMULATOR (51) International (71)Name of Applicant : :H01M10/42,H01M10/48,B60R25/10 classification 1)YANGJIANG MINGYANG ELECTRONIC (31) Priority Document No :NA TECHNOLOGY CO. LTD. (32) Priority Date :NA Address of Applicant :No. 4 South of 325th National Highway (33) Name of priority Nahuo Industrial Park Yangdong Guangdong 529932 China :NA country (72)Name of Inventor : (86) International 1)LU Kuo Ching :PCT/CN2010/000161 Application No :05/02/2010 Filing Date (87) International :WO 2011/094896 Publication No (61) Patent of Addition to :NA Application Number :NA Filing Date (62) Divisional to :NA Application Number :NA Filing Date (57) Abstract : An intelligent multifunctional accumulator is provided which is composed of a multi pin intelligent controller a signal emitter a buzzer a sensor and an accumulator with an enclosure with two layers. All of the aforementioned devices are totally assembled inside the cavity on the back side of the top cover. Two positive terminals are set on the top surface of the accumulator enclosure. The said two positive terminals can separately control the power of the engine and other electric appliances by means of a chip and two relays to attain an anti theft function. The intelligent controller with an electric lock can be automatically locked after it is inserted into a controller box on the back side of the top cover and it can not be taken out without the password signal of a car owner. The sensor inside the accumulator can automatically detect the inner state of the accumulator and the information of the state can be displayed by an LCD or sent out by using voice prompts. No. of Pages : 22 No. of Claims : 7 The Patent Office Journal 18/12/2015 65956 (12) PATENT APPLICATION PUBLICATION (21) Application No.6997/DELNP/2015 A (19) INDIA (22) Date of filing of Application :07/08/2015 (43) Publication Date : 18/12/2015 (54) Title of the invention : PROCESS FOR DETECTION OF DNA MODIFICATIONS AND PROTEIN BINDING BY SINGLE MOLECULE MANIPULATION (51) International classification (31) Priority Document No (32) Priority Date (33) Name of priority country (86) International Application No Filing Date (87) International Publication No (61) Patent of Addition to Application Number Filing Date (62) Divisional to Application Number Filing Date (71)Name of Applicant : :G01N33/557,C12Q1/68 1)CENTRE NATIONAL DE LA RECHERCHE :13305074.0 SCIENTIFIQUE (CNRS) :22/01/2013 Address of Applicant :3 rue Michel Ange F 75016 Paris :EPO France :PCT/EP2014/051272 2)ECOLE NORMALE SUPERIEURE :22/01/2014 3)UNIVERSITE PIERRE ET MARIE CURIE (PARIS 6) :WO 2014/114687 (72)Name of Inventor : :NA 1)BENSIMON David :NA 2)CROQUETTE Vincent 3)GOUET Harold :NA 4)ALLEMAND Jean Fran§ois :NA 5)DING Fang Yuan (57) Abstract : The present invention relates to a method for determining whether a protein binds to a specific DNA sequence. This method is useful in particular for identifying modifications to the DNA sequence (e.g. methylations) via the binding of proteins that specifically recognize those modifications (e.g. antibodies) but also to identify the binding sequence on DNA of a variety of proteins. No. of Pages : 63 No. of Claims : 25 The Patent Office Journal 18/12/2015 65957 (12) PATENT APPLICATION PUBLICATION (21) Application No.6998/DELNP/2015 A (19) INDIA (22) Date of filing of Application :07/08/2015 (43) Publication Date : 18/12/2015 (54) Title of the invention : PHARMACEUTICAL FORMULATION COMPRISING AN INSOLUBLE CORTICOSTEROID AND A SOLUBLE CORTICOSTEROID (51) International classification :A61K47/36,A61K31/573 (71)Name of Applicant : (31) Priority Document No :61/755723 1)SEMNUR PHARMACEUTICALS INC. (32) Priority Date :23/01/2013 Address of Applicant :4970 El Camino Real Suite 205 Los (33) Name of priority country :U.S.A. Altos CA 94022 U.S.A. (86) International Application No :PCT/US2014/012824 (72)Name of Inventor : Filing Date :23/01/2014 1)SHAH Mahendra G. (87) International Publication No :WO 2014/116876 (61) Patent of Addition to Application :NA Number :NA Filing Date (62) Divisional to Application Number :NA Filing Date :NA (57) Abstract : Disclosed are aqueous pharmaceutical compositions which provide sustained release delivery of corticosteroid compounds. The pharmaceutical composition comprises a insoluble corticosteroid; a soluble corticosteroid; and at least one viscosity enhancing agent. Also provided are methods for using the pharmaceutical compositions in an epidural injection intra articular injection intra lesional injection or an intra ocular injection. No. of Pages : 62 No. of Claims : 23 The Patent Office Journal 18/12/2015 65958 (12) PATENT APPLICATION PUBLICATION (21) Application No.7295/DELNP/2012 A (19) INDIA (22) Date of filing of Application :21/08/2012 (43) Publication Date : 18/12/2015 (54) Title of the invention : MOIRE MAGNIFICATION DEVICE (51) International classification :B42D15/00,G02B27/60 (71)Name of Applicant : (31) Priority Document No :1003397.5 1)DE LA RUE INTERNATIONAL LIMITED (32) Priority Date :01/03/2010 Address of Applicant :De La Rue House Jays Close Viables (33) Name of priority country :U.K. Basingstoke Hampshire RG22 4BS U.K. (86) International Application No :PCT/GB2011/050407 (72)Name of Inventor : Filing Date :01/03/2011 1)HOLMES Brian William (87) International Publication No :WO 2011/107791 (61) Patent of Addition to Application :NA Number :NA Filing Date (62) Divisional to Application Number :NA Filing Date :NA (57) Abstract : A moir magnification device comprises a transparent substrate carrying: i) a regular array of micro focusing elements on a first surface the focusing elements defining a focal plane; ii) a corresponding array of microimage element unit cells located in a plane substantially coincident with the focal plane of the focusing elements each unit cell comprising at least two microimage components. The pitches of the micro focusing elements and the array of microimage element unit cells and their relative locations are such that the array of micro focusing elements cooperates with the array of microimage element unit cells to generate magnified versions of the microimage components due to the moir effect wherein first microimage components of the unit cells have a colour density different to the colour density of the other second microimage component and wherein a further coloured layer is provided on or extending over the array of microimage element unit cells such that when the device is viewed at least the second microimage components appear in a colour dependent at least partly on the further coloured layer and which is different from the colour of the first microimage components. No. of Pages : 46 No. of Claims : 24 The Patent Office Journal 18/12/2015 65959 (12) PATENT APPLICATION PUBLICATION (21) Application No.7296/DELNP/2012 A (19) INDIA (22) Date of filing of Application :21/08/2012 (43) Publication Date : 18/12/2015 (54) Title of the invention : ALPHA EMITTING COMPLEXES (51) International (71)Name of Applicant : :A61K51/10,A61K51/04,A61P35/00 classification 1)ALGETA ASA (31) Priority Document No :1002508.8 Address of Applicant :P.O. Box 54 Kjelss N 0411 Oslo (32) Priority Date :12/02/2010 Norway (33) Name of priority country :U.K. (72)Name of Inventor : (86) International 1)RAMDAHL Thomas :PCT/EP2011/052158 Application No :14/02/2011 Filing Date (87) International Publication :WO 2011/098611 No (61) Patent of Addition to :NA Application Number :NA Filing Date (62) Divisional to :NA Application Number :NA Filing Date (57) Abstract : The present invention provides a tissue targeting complex comprising a tissue targeting moiety an octadentate hydroxypyridinone containing ligand and the ion of an alpha emitting thorium radionuclide. The invention additionally provides therapeutic methods employing such complexes methods of their production and use and kits and pharmaceutical compositions comprising such complexes. No. of Pages : 79 No. of Claims : 19 The Patent Office Journal 18/12/2015 65960 (12) PATENT APPLICATION PUBLICATION (21) Application No.7038/DELNP/2015 A (19) INDIA (22) Date of filing of Application :10/08/2015 (43) Publication Date : 18/12/2015 (54) Title of the invention : HANDLE FOR A SHAVER (51) International classification :B26B21/52 (71)Name of Applicant : (31) Priority Document No :61/766928 1)THE GILLETTE COMPANY (32) Priority Date :20/02/2013 Address of Applicant :World Shaving Headquarters IP/Legal (33) Name of priority country :U.S.A. Patent Department 3E One Gillette Park Boston Massachusetts (86) International Application No :PCT/US2014/017306 02127 U.S.A. Filing Date :20/02/2014 (72)Name of Inventor : (87) International Publication No :WO 2014/130624 1)EAGLETON Christopher Raymond (61) Patent of Addition to Application 2)SZCZEPANOWSKI Andrew Anthony :NA Number :NA Filing Date (62) Divisional to Application Number :NA Filing Date :NA (57) Abstract : A hand held device with a handle comprising a gripping portion which includes a substrate which is retained in a retaining member such that the substrate can be changed during use or manufacturing without impacting the rest of the handle. Preferably the substrate comprises an elastomeric material and can even consist essentially of such an elastomeric material. No. of Pages : 26 No. of Claims : 15 The Patent Office Journal 18/12/2015 65961 (12) PATENT APPLICATION PUBLICATION (21) Application No.7039/DELNP/2015 A (19) INDIA (22) Date of filing of Application :10/08/2015 (43) Publication Date : 18/12/2015 (54) Title of the invention : TILING PRODUCTION OF PACKAGING MATERIALS (51) International classification :G06F19/00 (71)Name of Applicant : (31) Priority Document No :61/754462 1)PACKSIZE LLC (32) Priority Date :18/01/2013 Address of Applicant :6440 South Wasatch Boulevard Salt (33) Name of priority country :U.S.A. Lake City UT 84121 U.S.A. (86) International Application No :PCT/US2014/012124 (72)Name of Inventor : Filing Date :17/01/2014 1)HARNESK Andreas (87) International Publication No :WO 2014/113719 2)OSTERHOUT Ryan (61) Patent of Addition to Application 3)KARLSSON Stefan :NA Number :NA Filing Date (62) Divisional to Application Number :NA Filing Date :NA (57) Abstract : Embodiments described herein generally relate to dynamically assigning product groups to production machines using production groups and producing product groups at a specified ratio using production groups. In one scenario a computer system dynamically assigns a production entity to a product group based on properties for that production entity. The production entity is to be produced using a production machine. The computer system then dynamically assigns each product group to a production group where each production group includes production machines that are available to produce production entities for product groups that belong to the assigned production group. The computer system also indicates that a production entity is to be produced using the production machines in the dynamically assigned production group. No. of Pages : 65 No. of Claims : 20 The Patent Office Journal 18/12/2015 65962 (12) PATENT APPLICATION PUBLICATION (21) Application No.7040/DELNP/2015 A (19) INDIA (22) Date of filing of Application :10/08/2015 (43) Publication Date : 18/12/2015 (54) Title of the invention : METHOD AND MEANS FOR OPERATING A FIRST MOTOR VEHICLE ON THE BASIS OF AT LEAST ONE CHARACTERISTIC OF AT LEAST ONE SECOND MOTOR VEHICLE (51) International classification :B60R99/00,G07C5/00 (71)Name of Applicant : (31) Priority Document No :10 2013 202 193.3 1)ROBERT BOSCH GMBH (32) Priority Date :11/02/2013 Address of Applicant :Postfach 30 02 20 70442 Stuttgart (33) Name of priority country :Germany Germany (86) International Application No :PCT/EP2014/050535 (72)Name of Inventor : Filing Date :14/01/2014 1)MOTZ Stefan (87) International Publication No :WO 2014/121981 2)WENZEL Sebastian Paul (61) Patent of Addition to Application :NA Number :NA Filing Date (62) Divisional to Application Number :NA Filing Date :NA (57) Abstract : The invention relates to a method (200) for operating a first motor vehicle (1) wherein at least one characteristic which is relevant to the operation of the first motor vehicle (1) is ascertained and at least one component (11) of the first motor vehicle (1) is controlled on the basis of the at least one characteristic. The at least one characteristic is ascertained in at least one second motor vehicle (2 3). The invention likewise relates to means for implementing such a method. No. of Pages : 16 No. of Claims : 13 The Patent Office Journal 18/12/2015 65963 (12) PATENT APPLICATION PUBLICATION (21) Application No.7339/DELNP/2012 A (19) INDIA (22) Date of filing of Application :23/08/2012 (43) Publication Date : 18/12/2015 (54) Title of the invention : COMPOUNDS AS BRADYKININ B1 ANTAGONISTS• (51) International classification (31) Priority Document No (32) Priority Date (33) Name of priority country (86) International Application No Filing Date (87) International Publication No (61) Patent of Addition to Application Number Filing Date (62) Divisional to Application Number Filing Date (71)Name of Applicant : 1)BOEHRINGER INGELHEIM INTERNATIONAL :A61K GMBH :PCT/EP2010/052232 Address of Applicant :Binger Strasse 173 55216 Ingelheim :23/02/2010 Am Rhein Germany :EPO (72)Name of Inventor : :PCT/EP2011/052512 1)NORBERT HAUEL :21/02/2011 2)ANGELO CECI :WO 2011/104203 3)HENRI DOODS :NA 4)INGO KONETZKI :NA 5)JUERGEN MACK 6)HENNING PRIEPKE :NA 7)ANNETTE SCHULER-METZ :NA 8)RAINER WALTER 9)DIETER WIEDENMAYER (57) Abstract : The present invention relates to the compounds of general formula I wherein n, R1, R2, R3 , R4, R5, R6, R7, R8 , R9 , R10 , R11 and X are defined as described hereinafter, the enantiomers, the diastereomers, the mixtures and the salts thereof, particularly the physiologically acceptable salts thereof with organic or inorganic acids or bases, which have valuable properties, the preparation thereof, the medicaments containing the pharmacologically effective compounds, the preparation thereof and the use thereof. No. of Pages : 67 No. of Claims : 18 The Patent Office Journal 18/12/2015 65964 (12) PATENT APPLICATION PUBLICATION (21) Application No.7340/DELNP/2012 A (19) INDIA (22) Date of filing of Application :23/08/2012 (43) Publication Date : 18/12/2015 (54) Title of the invention : CUSTOMIZED PATIENT-SPECIFIC TIBIAL CUTTING BLOCKS• (51) International classification :A47J (71)Name of Applicant : (31) Priority Document No :61/308,136 1)DEPUY PRODUCTS INC. (32) Priority Date :25/02/2010 Address of Applicant :700 Orthopaedic Drive Warsaw (33) Name of priority country :U.S.A. Indiana 46581 U.S.A. (86) International Application No :PCT/US2011/025887 (72)Name of Inventor : Filing Date :23/02/2011 1)LUKE J ARAM (87) International Publication No :WO/2011/106395 2)WILLIAM BUGBEE (61) Patent of Addition to Application 3)ANDREW ENGH :NA Number 4)JOSEPH MOSKAL :NA Filing Date 5)MARK PAGNANO (62) Divisional to Application Number :NA 6)MICHAEL SWANK Filing Date :NA 7)BRYAN ROSE (57) Abstract : A number of orthopaedic surgical instruments are disclosed. A method, apparatus, and system for fabricating such instruments are also disclosed. No. of Pages : 43 No. of Claims : 19 The Patent Office Journal 18/12/2015 65965 (12) PATENT APPLICATION PUBLICATION (21) Application No.7307/DELNP/2012 A (19) INDIA (22) Date of filing of Application :22/08/2012 (43) Publication Date : 18/12/2015 (54) Title of the invention : DEVICES FOR TREATING MORBID OBESITY USING HYDROGEL• (51) International classification :A61B (71)Name of Applicant : (31) Priority Document No :12/712,466 1)ETHICON ENDO-SURGERY INC. (32) Priority Date :25/02/2010 Address of Applicant :4545 Creek Road Cincinnati OH (33) Name of priority country :U.S.A. 45242 U.S.A. (86) International Application No :PCT/US2011/024213 (72)Name of Inventor : Filing Date :09/02/2011 1)JANNA M. BURRELL (87) International Publication No :WO/2011/106157 2)RANDAL T. BYRUM (61) Patent of Addition to Application 3)ROBERT L. KOCH JR. :NA Number 4)LARRY D. POOL :NA Filing Date 5)CHRISTOPHER W. WIDENHOUSE (62) Divisional to Application Number :NA Filing Date :NA (57) Abstract : An environmentally sensitive hydrogel material swells or collapses in response to a parameter such as pH level associated with consumption of food by a patient. This swelling or collapsing is harnessed to treat morbid obesity or some other condition of the patient. The swelling or collapsing of the hydrogel may be used to tighten a gastric band or gastric valve when the patient starts eating; then loosen the band or valve when the patient is between meals. The swelling or collapsing of the hydrogel may also be used to increase the size of a space occupying device in the patients stomach when the patient starts eating; then decrease the size of the space occupying device when the patient is between meals. The swelling or collapsing of the hydrogel may also be used to selectively restrict the absorption of nutrients within a patients gastrointestinal tract, such as in the duodenum. No. of Pages : 52 No. of Claims : 20 The Patent Office Journal 18/12/2015 65966 (12) PATENT APPLICATION PUBLICATION (21) Application No.7378/DELNP/2012 A (19) INDIA (22) Date of filing of Application :24/08/2012 (43) Publication Date : 18/12/2015 (54) Title of the invention : 4 - [CYCLOALKYLOXY (HETERO) ARYLAMINO] THIENO [2&NBSP; 3 - D] PYRIMIDINES HAVING MNKL/ MNK2 INHIBITING ACTIVITY FOR PHARMACEUTICAL COMPOSITIONS• (51) International classification (31) Priority Document No (32) Priority Date (33) Name of priority country (86) International Application No Filing Date (87) International Publication No (61) Patent of Addition to Application Number Filing Date (62) Divisional to Application Number Filing Date (71)Name of Applicant : 1)BOEHRINGER INGELHEIM INTERNATIONAL GMBH Address of Applicant :Binger Str. 173 55216 Ingelheim Am Rhein Germany Germany :C07C (72)Name of Inventor : :10154922.8 1)THORSTEN LEHMANN-LINTZ :26/02/2010 2)ARMIN HECKEL :EPO 3)JOERG KLEY :PCT/EP2011/052806 4)ELKE LANGKOPF :25/02/2011 5)NORBERT REDEMANN :WO/2011/104334 6)ACHIM SAUER :NA 7)LEO THOMAS :NA 8)DIETER WIEDENMAYER 9)MATTHIAS AUSTEN :NA 10)JOHN DANILEWICZ :NA 11)MARTIN SCHNEIDER 12)KAY SCHREITER 13)PHILIP BLACK 14)WESLEY BLACKABY 15)IAN LINNEY (57) Abstract : The present invention relates to novel thienopyrimidine compounds of general formula (I), pharmaceutical compositions comprising these compounds and their therapeutic use for the prophylaxis and/or treatment of diseases which can be influenced by the inhibition of the kinase activity of Mnk1 and/or Mnk2 (Mnk2a or Mnk2b) and/or variants thereof. No. of Pages : 298 No. of Claims : 21 The Patent Office Journal 18/12/2015 65967 (12) PATENT APPLICATION PUBLICATION (21) Application No.7379/DELNP/2012 A (19) INDIA (22) Date of filing of Application :24/08/2012 (43) Publication Date : 18/12/2015 (54) Title of the invention : RADIAL FLOW REACTOR• (51) International classification :C07C (71)Name of Applicant : (31) Priority Document No :12/712,694 1)PRAXAIR TECHNOLOGY INC. (32) Priority Date :25/02/2010 Address of Applicant :39 Old Ridgebury Road Danbury (33) Name of priority country :U.S.A. Connecticut 06810 U.S.A. (86) International Application No :PCT/US2011/022909 (72)Name of Inventor : Filing Date :28/01/2011 1)MARK WILLIAM ACKLEY (87) International Publication No :WO/2011/106127 2)CEM E. CELIK (61) Patent of Addition to Application 3)JEFFERT JOHN NOWOBILSKI :NA Number 4)JAMES STANLEY SCHNEIDER :NA Filing Date (62) Divisional to Application Number :NA Filing Date :NA (57) Abstract : A radial flow reactor is disclosed for use in gas purification, separation or reaction processes and most suitably used in prepurification processes. The reactor has two concentric internal baskets which are rigidly supported at both the top and bottom ends of the reactor. The reactor has a removable section in the inner basket to accommodate rotating arms to dense load one or more layers of active materials between the concentric baskets. No. of Pages : 33 No. of Claims : 22 The Patent Office Journal 18/12/2015 65968 (12) PATENT APPLICATION PUBLICATION (21) Application No.6999/DELNP/2015 A (19) INDIA (22) Date of filing of Application :07/08/2015 (43) Publication Date : 18/12/2015 (54) Title of the invention : ENHANCED 3D TORUS (51) International classification :G06F15/173,H04L12/933 (71)Name of Applicant : (31) Priority Document No :13/766115 1)ADVANCED MICRO DEVICES INC. (32) Priority Date :13/02/2013 Address of Applicant :One AMD Place Sunnyvale CA 94088 (33) Name of priority country :U.S.A. U.S.A. (86) International Application No :PCT/US2014/016045 (72)Name of Inventor : Filing Date :12/02/2014 1)FRICKER Jean Philippe (87) International Publication No :WO 2014/127012 (61) Patent of Addition to Application :NA Number :NA Filing Date (62) Divisional to Application Number :NA Filing Date :NA (57) Abstract : A system and method for optimizing a flow of data traffic are provided. A plurality of tori are connected in a parallel tori interconnect. Each torus includes a plurality of nodes. The nodes in the torus are interconnected using links. A host in the network is connected to a subset of nodes where nodes in the subset are associated with different tori. The host transmits the packets to the parallel tori interconnect by selecting a node the subset of nodes. The packets are transmitted using links between from the node to the plurality of nodes in the torus but not between the plurality of tori. No. of Pages : 25 No. of Claims : 25 The Patent Office Journal 18/12/2015 65969 (12) PATENT APPLICATION PUBLICATION (21) Application No.7309/DELNP/2012 A (19) INDIA (22) Date of filing of Application :22/08/2012 (43) Publication Date : 18/12/2015 (54) Title of the invention : PROCESS FOR THE CONVERSION OF AROMATIC NITRO COMPOUND INTO AMINES (51) International classification :C07C (71)Name of Applicant : (31) Priority Document No :NA 1)HUNTSMAN INTERNATIONAL LLC (32) Priority Date :NA Address of Applicant :500 Huntsman Way Salt Lake City (33) Name of priority country :NA Utah 84108 USA U.S.A. (86) International Application No :PCT/EP2010/053529 (72)Name of Inventor : Filing Date :18/03/2010 1)CHRISTOPHER JOHN MITCHELL (87) International Publication No :WO/2011/113491 2)DOUGLAS HYNDMAN STEWART (61) Patent of Addition to Application :NA Number :NA Filing Date (62) Divisional to Application Number :NA Filing Date :NA (57) Abstract : A process for hydrogenating an aromatic nitro compound according to the invention comprises: - providing a hydrogen gas stream and a liquid aromatic nitro compound stream; - providing a fixed bed catalytic reactor having an inflow side and an outflow side; - feeding to the inflow side, the hydrogen gas stream and the liquid aromatic nitro compound stream; - converting the hydrogen gas and the aromatic nitro compound into an aromatic amine, thereby providing a reactor effluent comprising the aromatic amine and water; evacuating the reactor effluent from the reactor at the outflow side of the reactor; wherein an inert solvent or water is fed to the inflow side of the reactor at a molar ratio of moles inert solvent or water to moles hydrogen is more than 1. No. of Pages : 22 No. of Claims : 8 The Patent Office Journal 18/12/2015 65970 (12) PATENT APPLICATION PUBLICATION (21) Application No.7310/DELNP/2012 A (19) INDIA (22) Date of filing of Application :22/08/2012 (43) Publication Date : 18/12/2015 (54) Title of the invention : CATALYST STRUCTURES (51) International classification :C07C (71)Name of Applicant : (31) Priority Document No :1002378.6 1)JOHNSON MATTHEY PLC (32) Priority Date :12/02/2010 Address of Applicant :5th Floor 25 Farringdon Street London (33) Name of priority country :U.K. EC4A 4AB United Kingdom U.K. (86) International Application No :PCT/GB2011/050047 (72)Name of Inventor : Filing Date :13/01/2011 1)DUNCAN ROY COUPLAND (87) International Publication No :WO/2011/098779 (61) Patent of Addition to Application :NA Number :NA Filing Date (62) Divisional to Application Number :NA Filing Date :NA (57) Abstract : A catalyst structure suitable for use in an ammonia oxidation process is described comprising a plurality of shaped catalyst units supported on one or more members in a spaced relationship that allows the structure to flex. No. of Pages : 19 No. of Claims : 21 The Patent Office Journal 18/12/2015 65971 (12) PATENT APPLICATION PUBLICATION (21) Application No.7397/DELNP/2012 A (19) INDIA (22) Date of filing of Application :24/08/2012 (43) Publication Date : 18/12/2015 (54) Title of the invention : MICROCHIP AND PARTICULATE ANALYZING DEVICE (51) International classification :H04N (71)Name of Applicant : (31) Priority Document No :2010-043968 1)SONY CORPORATION (32) Priority Date :01/03/2010 Address of Applicant :1-7-1 Konan Minato-ku Tokyo 108(33) Name of priority country :Japan 0075 Japan (86) International Application No :PCT/JP2011/000902 (72)Name of Inventor : Filing Date :18/02/2011 1)TATSUMI ITO (87) International Publication No :WO/2011/108206 2)SHOJI AKIYAMA (61) Patent of Addition to Application 3)MASAYA KAKUTA :NA Number 4)TAKESHI YAMASAKI :NA Filing Date (62) Divisional to Application Number :NA Filing Date :NA (57) Abstract : A microchip is provided which includes a first introduction channel, second introduction channels arranged to sandwich the first introduction channel and merged with the first introduction channel from both sides, and a merge channel connected to the first introduction channel and the second introduction channels, where fluids fed from the first and the second introduction channels are merged and flow, wherein the merge channel has a tapered portion formed so that a channel width in a sandwiching direction along which the first introduction channel is sandwiched by the second introduction channels gradually increases along a fluid feeding direction. No. of Pages : 53 No. of Claims : 34 The Patent Office Journal 18/12/2015 65972 (12) PATENT APPLICATION PUBLICATION (21) Application No.7398/DELNP/2012 A (19) INDIA (22) Date of filing of Application :24/08/2012 (43) Publication Date : 18/12/2015 (54) Title of the invention : TRANSMISSION (51) International classification :B65D (71)Name of Applicant : (31) Priority Document No :2010-038240 1)JTEKT CORPORATION (32) Priority Date :24/02/2010 Address of Applicant :5-8 Minamisemba 3-chome Chuo-ku (33) Name of priority country :Japan Osaka-shi Osaka 5428502 Japan (86) International Application No :PCT/JP2011/053894 (72)Name of Inventor : Filing Date :23/02/2011 1)TAKAFUMI UEMOTO (87) International Publication No : NA (61) Patent of Addition to Application :NA Number :NA Filing Date (62) Divisional to Application Number :NA Filing Date :NA (57) Abstract : An object of the invention is to provide a transmission device which has a simple structure and can be produced at a low cost. A second electromagnetic clutch 45 is shut off at a timing 5 when an electric motor 23 is decelerated and before selecting motion is finished, and thereafter, a shift/select shaft 11 is moved to a terminal end position of the selecting motion with an inertia of a driven part (a second output hub 53) of the second electromagnetic clutch 45. At a timing 6 after a predetermined period has passed from the timing 5, a first electromagnetic clutch 43 for the next shifting motion is connected. The electric motor 23 is driven synchronously with the end of the selecting motion or immediately in response to the end, thereby to start the next shifting motion. In this manner, gear change can be rapidly conducted. No. of Pages : 51 No. of Claims : 5 The Patent Office Journal 18/12/2015 65973 (12) PATENT APPLICATION PUBLICATION (21) Application No.7399/DELNP/2012 A (19) INDIA (22) Date of filing of Application :24/08/2012 (43) Publication Date : 18/12/2015 (54) Title of the invention : AUTOMATIC GAIN STABILIZATION AND TEMPERATURE COMPENSATION FOR ORGANIC AND/OR PLASTIC SCINTILLATION DEVICES (51) International classification :C07C (71)Name of Applicant : (31) Priority Document No :12/703,305 1)VEGA GRIESHABER KG (32) Priority Date :10/02/2010 Address of Applicant :Am Hohenstein 113 77761 Schiltach (33) Name of priority country :U.S.A. Germany Germany (86) International Application No :PCT/US2011/024040 (72)Name of Inventor : Filing Date :08/02/2011 1)BONAVENTURE CAHILL (87) International Publication No :WO/2011/100240 (61) Patent of Addition to Application :NA Number :NA Filing Date (62) Divisional to Application Number :NA Filing Date :NA (57) Abstract : A detector and associated method are provided including a first scintillation material 40 having a light yield temperature dependence and an output at a first energy level, a second scintillation material 42 having a light yield temperature dependence similar to the first material and an output at a second energy level, and detection circuitry 72, 76, 78, 82, 84, 100, 102. The first and second outputs are responsive to radiation emitted from an ionizing radiation source 68. The detection circuitry includes a photo multiplier tube 72 configured to convert photon outputs from the first and second scintillating materials 40, 42 to electrical pulses, a counter circuit configured to count the electrical pulses generated in the photo multiplier tube 72 by the first and second materials, and a gain control circuit 102 configured to monitor the electrical pulses generated in the photomultiplier tube 72 by the second material 42 and adjust a gain of the detector upon detecting a drift in the output of the second material 42. No. of Pages : 22 No. of Claims : 19 The Patent Office Journal 18/12/2015 65974 (12) PATENT APPLICATION PUBLICATION (21) Application No.7008/DELNP/2015 A (19) INDIA (22) Date of filing of Application :10/08/2015 (43) Publication Date : 18/12/2015 (54) Title of the invention : SUBSTITUTED BISPHENYL BUTANOIC ACID DERIVATIVES AS NEP INHIBITORS WITH IMPROVED IN VIVO EFFICACY (51) International (71)Name of Applicant : :C07D271/113,A61K31/4245,A61P9/00 classification 1)NOVARTIS AG (31) Priority Document Address of Applicant :Lichtstrasse 35 CH 4056 Basel :61/764687 No Switzerland (32) Priority Date :14/02/2013 (72)Name of Inventor : (33) Name of priority 1)BARNES David Weninger :U.S.A. country 2)RIGEL Dean Franklin (86) International :PCT/US2014/015965 Application No :12/02/2014 Filing Date (87) International :WO 2014/126972 Publication No (61) Patent of Addition to :NA Application Number :NA Filing Date (62) Divisional to :NA Application Number :NA Filing Date (57) Abstract : The present invention provides a compound of formula (I); or a pharmaceutically acceptable salt thereof wherein X is defined herein. The invention also relates to a method for manufacturing the compounds of the invention and its therapeutic uses. The present invention further provides pharmaceutical composition of the compounds of the invention and a combination of pharmacologically active agents and a compound of the invention. No. of Pages : 67 No. of Claims : 15 The Patent Office Journal 18/12/2015 65975 (12) PATENT APPLICATION PUBLICATION (21) Application No.7280/DELNP/2012 A (19) INDIA (22) Date of filing of Application :21/08/2012 (43) Publication Date : 18/12/2015 (54) Title of the invention : AMINE POLYMERS FOR USE AS BILE ACID SEQUESTRANTS (71)Name of Applicant : 1)RELYPSA INC. Address of Applicant :5301 Patrick Henry Drive Santa Clara (51) International classification :C08G73/02,C08L79/02,A61P3/06 California 95054 U.S.A. (31) Priority Document No :61/307820 (72)Name of Inventor : (32) Priority Date :24/02/2010 1)CONNOR Eric (33) Name of priority country :U.S.A. 2)BIYANI Kalpesh (86) International Application 3)HECKER Scott :PCT/US2011/026106 No 4)LEES Inez :24/02/2011 Filing Date 5)MANSKY Paul (87) International Publication 6)MU YongQi :WO 2011/106548 No 7)SALAYMEH Felah (61) Patent of Addition to 8)ZHANG Hongmin :NA Application Number 9)BERGBREITER David :NA Filing Date 10)QUAKER Grace (62) Divisional to Application 11)COPE Michael James :NA Number 12)GOKA Elizabeth :NA Filing Date 13)LEE Angela 14)MADSEN Deidre 15)SHAO Jun 16)ZHANG Xinnan (57) Abstract : The present invention provides crosslinked amine polymers effective for binding and removing bile salts from the gastrointestinal tract. These bile acid binding polymers or pharmaceutical compositions thereof can be administered to subjects to treat various conditions including hypercholesteremia diabetes pruritus irritable bowel syndrome diarrhea (IBS D) bile acid malabsorption and the like. No. of Pages : 152 No. of Claims : 155 The Patent Office Journal 18/12/2015 65976 (12) PATENT APPLICATION PUBLICATION (21) Application No.7281/DELNP/2012 A (19) INDIA (22) Date of filing of Application :21/08/2012 (43) Publication Date : 18/12/2015 (54) Title of the invention : CATHETER DEVICE WITH HOODING FEATURE (51) International classification :A61M25/06,A61M25/00 (71)Name of Applicant : (31) Priority Document No :12/721266 1)BECTON DICKINSON AND COMPANY (32) Priority Date :10/03/2010 Address of Applicant :1 Becton Drive Mail Code 110 Franklin (33) Name of priority country :U.S.A. Lakes New Jersey 07417 1880 U.S.A. (86) International Application No :PCT/US2011/025102 (72)Name of Inventor : Filing Date :16/02/2011 1)MINER Tom M. (87) International Publication No :WO 2011/112331 (61) Patent of Addition to Application :NA Number :NA Filing Date (62) Divisional to Application Number :NA Filing Date :NA (57) Abstract : An intravenous catheter device having features to aid a user in hooding the beveled portion of an introducer needle during the catheterization process. An intravenous catheter device is modified to include a biasing arm capable of advancing a portion of the catheter device to cause a beveled portion of an introducer needle to be hooded within an interior lumen of the catheter tube. The dimensions of the biasing arm and various other interacting surfaces of the catheter device are configured to achieve effective hooding of the needle tip while avoiding overhooding or underhooding inaccuracies. No. of Pages : 27 No. of Claims : 20 The Patent Office Journal 18/12/2015 65977 (12) PATENT APPLICATION PUBLICATION (21) Application No.7283/DELNP/2012 A (19) INDIA (22) Date of filing of Application :21/08/2012 (43) Publication Date : 18/12/2015 (54) Title of the invention : PAN ANTIVIRAL PEPTIDES FOR PROTEIN KINASE INHIBITION (51) International classification :A61K38/00 (71)Name of Applicant : (31) Priority Document No :12/691902 1)NUOVO BIOLOGICS LLC (32) Priority Date :22/01/2010 Address of Applicant :P.O. Box 160471 Miami FL 33116 (33) Name of priority country :U.S.A. 0471 U.S.A. (86) International Application No :PCT/US2011/022200 (72)Name of Inventor : Filing Date :24/01/2011 1)MILLER Kent D. (87) International Publication No :WO 2011/091344 2)AUSTIN Billy S. (61) Patent of Addition to Application 3)YOURIST Jay E. :NA Number :NA Filing Date (62) Divisional to Application Number :NA Filing Date :NA (57) Abstract : A method of inhibiting protein kinases by administering polypeptides derived from alpha neurotoxin and inhibiting protein kinases. Diseases treated thereby include cancer influenza Tourette s syndrome pain and neurological deficits. No. of Pages : 22 No. of Claims : 26 The Patent Office Journal 18/12/2015 65978 (12) PATENT APPLICATION PUBLICATION (21) Application No.7284/DELNP/2012 A (19) INDIA (22) Date of filing of Application :21/08/2012 (43) Publication Date : 18/12/2015 (54) Title of the invention : METHOD OF INCREASING FILLER CONTENT IN PAPERMAKING (51) International (71)Name of Applicant : :D21H23/24,D21H17/63,D21H17/68 classification 1)NALCO COMPANY (31) Priority Document No :12/727299 Address of Applicant :1601 W. Diehl Road Naperville Illinois (32) Priority Date :19/03/2010 60563 1198 U.S.A. (33) Name of priority (72)Name of Inventor : :U.S.A. country 1)CHENG Weiguo (86) International 2)GRAY Ross T. :PCT/US2011/028917 Application No :18/03/2011 Filing Date (87) International :WO 2011/116253 Publication No (61) Patent of Addition to :NA Application Number :NA Filing Date (62) Divisional to :NA Application Number :NA Filing Date (57) Abstract : The invention provides a method of producing paper with a higher proportion of mineral filler particles than is otherwise be possible without the expected loss in paper strength by preflocculating the filler particles. The method allows for the use of the greater amount of filler particles by coating at least some of the filler particles with a material that prevents the filler materials form adhering to a strength additive. The strength additive holds the paper fibers together tightly and is not wasted on the filler particles. No. of Pages : 17 No. of Claims : 15 The Patent Office Journal 18/12/2015 65979 (12) PATENT APPLICATION PUBLICATION (21) Application No.7169/DELNP/2012 A (19) INDIA (22) Date of filing of Application :17/08/2012 (43) Publication Date : 18/12/2015 (54) Title of the invention : AMINOTHIAZOLONES AS ESTROGEN RELATED RECEPTOR-ALPHA MODULATORS• (51) International classification :C12P (71)Name of Applicant : (31) Priority Document No :61/305,177 1)JANSSEN PHARMACEUTICA NV (32) Priority Date :17/02/2010 Address of Applicant :Turnhoutseweg 30 B-2340 Beerse (33) Name of priority country :U.S.A. Belgium (86) International Application No :PCT/US2011/024999 (72)Name of Inventor : Filing Date :16/02/2011 1)GILLES BIGNAN (87) International Publication No :WO/2011/103130 2)MICHEAL GAUL (61) Patent of Addition to Application 3)GUOZHANG XU :NA Number 4)BAO-PING ZHAO :NA Filing Date (62) Divisional to Application Number :NA Filing Date :NA (57) Abstract : The present invention relates to compounds of Formula (I): methods for preparing these compounds, compositions, intermediates and derivatives thereof and for treating a condition including but not limited to ankylosing spondylitis, artherosclerosis, arthritis (such as rheumatoid arthritis, infectious arthritis, childhood arthritis, psoriatic arthritis, reactive arthritis), bone- related diseases (including those related to bone formation), breast cancer (including those unresponsive to anti-estrogen therapy), cardiovascular disorders, cartilage-related disease (such as cartilage injury/loss, cartilage degeneration, and those related to cartilage formation), chondrodysplasia, chondrosarcoma, chronic back injury, chronic bronchitis, chronic inflammatory airway disease, chronic obstructive pulmonary disease, diabetes, disorders of energy homeostasis, gout, pseudogout, lipid disorders, metabolic syndrome, multiple myeloma, obesity, osteoarthritis, osteogenesis imperfecta, osteolytic bone metastasis, osteomalacia, osteoporosis, Pagets disease, periodontal disease, polymyalgia rheumatica, Reiters syndrome, repetitive stress injury, hyperglycemia, elevated blood glucose level, and insulin resistance. No. of Pages : 170 No. of Claims : 30 The Patent Office Journal 18/12/2015 65980 (12) PATENT APPLICATION PUBLICATION (21) Application No.7347/DELNP/2012 A (19) INDIA (22) Date of filing of Application :23/08/2012 (43) Publication Date : 18/12/2015 (54) Title of the invention : A PREFORM SUITABLE FOR BLOW-MOLDING INTO A FINAL SHAPED CONTAINER (51) International classification :B68F (71)Name of Applicant : (31) Priority Document No :61/308,491 1)HUSKY INJECTION MOLDING SYSTEMS LTD. (32) Priority Date :26/02/2010 Address of Applicant :500 Queen Street South Bolton (33) Name of priority country :U.S.A. Ontario L7E 5S5 Canada (86) International Application No :PCT/CA2011/050028 (72)Name of Inventor : Filing Date :20/01/2011 1)JEAN-CHRISTOPHE WITZ (87) International Publication No :WO/2011/103677 2)LAURENT CHRISTEL SIGLER (61) Patent of Addition to Application 3)RAINER KINTZINGER :NA Number 4)RALF WALTER FISCH :NA Filing Date 5)ADELINE HOUSSAYE (62) Divisional to Application Number :NA Filing Date :NA (57) Abstract : A preform (200, 300, 400, 500, 800a, 800b, 900, 1000) suitable for blow-molding into a final- shaped article is provided. The preform (200, 300, 400, 5000, 800a, 800b) comprises a neck portion (202, 302, 402, 502); a gate portion (206, 306, 406, 506); and a body portion (204, 304, 404, 504) extending between the gate portion (206, 306, 406, 506) and the neck portion (202, 302, 402, 502); the body portion (204, 304, 404, 504) defining: a first portion (210, 310, 410, 510, 810), a second portion (212, 312, 412, 512, 812) and a third portion (214, 314, 414, 514, 814), the second portion being disposed in-between the first portion and the third portion located in sequence along one of: (i) substantially the whole circumference of the body portion and (ii) substantially the whole length of the body portion; one of the first portion, second portion and the third portion having a stretch ratio different that at least one of the other ones of the first portion, the second portion and the third portion. No. of Pages : 36 No. of Claims : 19 The Patent Office Journal 18/12/2015 65981 (12) PATENT APPLICATION PUBLICATION (21) Application No.7349/DELNP/2012 A (19) INDIA (22) Date of filing of Application :23/08/2012 (43) Publication Date : 18/12/2015 (54) Title of the invention : GAS-GUIDING PIPE COMPRISING A NOISE-ATTENUATING COVERING WITH VARIABLE POROSITY (51) International classification :G01N (71)Name of Applicant : (31) Priority Document No :1000590 1)TURBOMECA (32) Priority Date :12/02/2010 Address of Applicant :F-64510 Bordes France France (33) Name of priority country :France (72)Name of Inventor : (86) International Application No :PCT/FR2011/050296 1)ERIC JEAN-LOUIS BOUTY Filing Date :11/02/2011 2)PIERRE-LUC REGAUD (87) International Publication No :WO 2011/098737 3)ANTOINE YVAN ALEXANDRE VALLON (61) Patent of Addition to Application :NA Number :NA Filing Date (62) Divisional to Application Number :NA Filing Date :NA (57) Abstract : The invention relates to a turbomachine (10) having at least one shaft (12, 22) carrying at least one turbine wheel (18, 20). The shaft (12, 22) is oriented substantially vertically in situations of normal utilization of the turbomachine (10), the shaft (12, 22) 10 being held by a single bearing (14, 24). No. of Pages : 12 No. of Claims : 6 The Patent Office Journal 18/12/2015 65982 (12) PATENT APPLICATION PUBLICATION (21) Application No.7184/DELNP/2012 A (19) INDIA (22) Date of filing of Application :17/08/2012 (43) Publication Date : 18/12/2015 (54) Title of the invention : ENERGY AND WEIGHT EFFICIENT BUILDING BLOCK&NBSP; MANUFACTURING AND APPLICATION PROCESS THEREOF (51) International classification :E06B (71)Name of Applicant : (31) Priority Document No :P 1000094 1)WYW BLOCK AG (32) Priority Date :17/02/2010 Address of Applicant :Landstrasse 140 FL-9494 Schaan (33) Name of priority country :Hungary Liechtenstein Liechtenstein (86) International Application No :PCT/CH2011/000028 (72)Name of Inventor : Filing Date :15/02/2011 1)ISTV•N ANTAL (87) International Publication No :WO/2011/100854 (61) Patent of Addition to Application :NA Number :NA Filing Date (62) Divisional to Application Number :NA Filing Date :NA (57) Abstract : The subject matter of the invention is an energy and weight efficient building block that has a prismatic body made form a posthardening material (1). The invention is characterized in that a flexible static insert structure (2) is placed inside the body. Furthermore, the subject matter of the invention is the manufacturing and application process for the production of the building block. Manufacturing is characterized in that a static insert structure (2) is placed into the form body (16), then the form body (16) is filled up with the stirred post-hardening material (1) or at first the stirred post-hardening material (1) is poured into the form body (16), and the static insert structure (2) is placed therein afterwards, then the building block with the static insert structure (2), embedded in the posthardening material (1) is let to dry until set in the form body (16) itself or after being taken out thereof. No. of Pages : 26 No. of Claims : 9 The Patent Office Journal 18/12/2015 65983 (12) PATENT APPLICATION PUBLICATION (21) Application No.7328/DELNP/2012 A (19) INDIA (22) Date of filing of Application :22/08/2012 (43) Publication Date : 18/12/2015 (54) Title of the invention : SILICA REMEDIATION IN WATER (51) International classification :C02F1/28,C02F1/60,C02F101/10 (71)Name of Applicant : (31) Priority Document No :12/712225 1)GENERAL ELECTRIC (32) Priority Date :25/02/2010 Address of Applicant :1 River Road Schenectady NY 12345 (33) Name of priority country :U.S.A. U.S.A. (86) International Application (72)Name of Inventor : :PCT/US2010/059977 No 1)PETKO Danielle Lynn :11/12/2010 Filing Date 2)LEWIS Larry Neil (87) International Publication 3)WHISENHUNT Donald Wayne :WO 2011/106062 No 4)YIN Ming (61) Patent of Addition to 5)PETERS Andrea Jeannine :NA Application Number 6)COLBORN Robert Edgar :NA Filing Date (62) Divisional to Application :NA Number :NA Filing Date (57) Abstract : Water treatment methods for reducing silica concentration in water containing at least 100 ppm dissolved or suspended silica include contacting the water with particles comprising mesoporous alumina having surface area ranging from about 250 m2/g to about 600 m2/g and pore volume ranging from about 0.1 cm3/g to about 1.0 cm3/g; and separating the treated water from the particles. No. of Pages : 22 No. of Claims : 10 The Patent Office Journal 18/12/2015 65984 (12) PATENT APPLICATION PUBLICATION (21) Application No.7300/DELNP/2012 A (19) INDIA (22) Date of filing of Application :21/08/2012 (43) Publication Date : 18/12/2015 (54) Title of the invention : METHOD OF PREPARING AN ORGANOHALOSILANE (51) International classification :C07C (71)Name of Applicant : (31) Priority Document No :61/298,375 1)DOW CORNING CORPORATION (32) Priority Date :26/01/2010 Address of Applicant :2200 West Salzburg Road Midland MI (33) Name of priority country :U.S.A. 48686-0994 United States of America. U.S.A. (86) International Application No :PCT/US2011/022195 (72)Name of Inventor : Filing Date :24/01/2011 1)ANDERSON Kurt E. (87) International Publication No :WO 2011/094140 2)DASH Aswini K. (61) Patent of Addition to Application 3)HALL Charles Alan :NA Number 4)KATSOULIS Dimitris :NA Filing Date 5)LARSEN Robert Thomas (62) Divisional to Application Number :NA 6)MCLAUGHLIN Matthew J. Filing Date :NA 7)WINELAND Jonathan David (57) Abstract : A method of preparing organohalosilanes comprising combining an organohalide having the formula RX (I), wherein R is a hydrocarbyl group having 1 to 10 carbon atoms and X is fluoro, chloro, bromo, or iodo, with a contact mass comprising at least 2% (w/w) of a palladium suicide of the formula PdxSiy (II), wherein x is an integer from 1 to 5 and y is 1 to 8, or a platinum suicide of formula PtzSi (III), wherein z is 1 or 2, in a reactor at a temperature from 250 to 700 °C to form an organohalosilane. No. of Pages : 18 No. of Claims : 12 The Patent Office Journal 18/12/2015 65985 (12) PATENT APPLICATION PUBLICATION (21) Application No.7301/DELNP/2012 A (19) INDIA (22) Date of filing of Application :21/08/2012 (43) Publication Date : 18/12/2015 (54) Title of the invention : POWER GENERATING SYSTEM (51) International classification :H02J (71)Name of Applicant : (31) Priority Document No :2010-016208 1)EBARA CORPORATION (32) Priority Date :28/01/2010 Address of Applicant :11-1 Haneda Asahi-cho Ohta-ku (33) Name of priority country :Japan Tokyo 144-8510 Japan. Japan (86) International Application No :PCT/JP2010/067314 (72)Name of Inventor : Filing Date :28/09/2010 1)OGATA Hiroshi (87) International Publication No :WO 2011/092895 (61) Patent of Addition to Application :NA Number :NA Filing Date (62) Divisional to Application Number :NA Filing Date :NA (57) Abstract : The present invention relates to a power generating system which can recover exhaust heat from a working fluid of a fluid coupling and utilize the recovered exhaust heat to generate power. In the power generating system water is supplied to a boiler (1) by a feed pump (BP) to generate steam a steam turbine (2) is driven by using the generated steam to generate power the steam discharged from the steam turbine (2) is condensed in a condenser (4) and then the condensed water is resupplied to the boiler (1) by the feed pump (BP). The power generating system includes a fluid coupling (10) No. of Pages : 40 No. of Claims : 9 The Patent Office Journal 18/12/2015 65986 (12) PATENT APPLICATION PUBLICATION (21) Application No.7290/DELNP/2012 A (19) INDIA (22) Date of filing of Application :21/08/2012 (43) Publication Date : 18/12/2015 (54) Title of the invention : COMPOUNDS FOR IMMUNOPROTEASOME INHIBITION (51) International (71)Name of Applicant : :A61K31/4045,A61K31/5375,C07D209/20 classification 1)ONYX THERAPEUTICS INC. (31) Priority Address of Applicant :2100 Powell Street Emeryville :61/309366 Document No California 94608 U.S.A. (32) Priority Date :01/03/2010 (72)Name of Inventor : (33) Name of priority 1)SHENK Kevin D. :U.S.A. country 2)PARLATI Francesco (86) International 3)BENNETT Mark K. :PCT/US2011/026629 Application No :01/03/2011 Filing Date (87) International :WO 2011/109355 Publication No (61) Patent of Addition :NA to Application Number :NA Filing Date (62) Divisional to :NA Application Number :NA Filing Date (57) Abstract : One aspect of the invention relates to inhibitors that preferentially inhibit immunoproteasome activity over constitutive proteasome activity. In certain embodiments the invention relates to the treatment of immune related diseases comprising administering a compound of the invention. In certain embodiments the invention relates to the treatment of cancer comprising administering a compound of the invention. No. of Pages : 48 No. of Claims : 32 The Patent Office Journal 18/12/2015 65987 (12) PATENT APPLICATION PUBLICATION (21) Application No.7291/DELNP/2012 A (19) INDIA (22) Date of filing of Application :21/08/2012 (43) Publication Date : 18/12/2015 (54) Title of the invention : EXTRUDED ANIMAL LITTERS HAVING AN INCREASED ABSORPTION RATE (51) International classification :A61K9/14 (71)Name of Applicant : (31) Priority Document No :61/337019 1)NESTEC S.A. (32) Priority Date :29/01/2010 Address of Applicant :Avenue Nestle 55 CH 1800 Vevey (33) Name of priority country :U.S.A. Switzerland (86) International Application No :PCT/US2011/000172 (72)Name of Inventor : Filing Date :27/01/2011 1)DIXON Dan Kenneth (87) International Publication No :WO 2011/094023 2)HUCK Nathan Foster (61) Patent of Addition to Application :NA Number :NA Filing Date (62) Divisional to Application Number :NA Filing Date :NA (57) Abstract : The invention provides animal litters that have an increased absorption rate and methods of making and using such litters. The animal litters comprise one or more animal litter particles that have been produced by fragmenting extruded animal litter particles that have a film on the surface of the particle that adversely affects the absorption rate. The fragmenting exposes the interior of the extruded animal litter particles which does not have this film to the external environment and increases the absorption rate. No. of Pages : 18 No. of Claims : 28 The Patent Office Journal 18/12/2015 65988 (12) PATENT APPLICATION PUBLICATION (21) Application No.7293/DELNP/2012 A (19) INDIA (22) Date of filing of Application :21/08/2012 (43) Publication Date : 18/12/2015 (54) Title of the invention : SECURITY DEVICE (51) International (71)Name of Applicant : :B42D15/00,B42D15/10,G07D7/00 classification 1)DE LA RUE INTERNATIONAL LIMITED (31) Priority Document No :1003136.7 Address of Applicant :De La Rue House Jays Close Viables (32) Priority Date :24/02/2010 Basingstoke Hampshire RG22 4BS U.K. (33) Name of priority country :U.K. (72)Name of Inventor : (86) International Application 1)HOLMES Brian William :PCT/GB2011/050362 No :24/02/2011 Filing Date (87) International Publication :WO 2011/104551 No (61) Patent of Addition to :NA Application Number :NA Filing Date (62) Divisional to Application :NA Number :NA Filing Date (57) Abstract : A security device comprises a transparent coloured element (2) in a first region of the device and in a surface of which a first optically variable effect generating relief structure (21) is formed. A reflection enhancing layer (30) extends over the first optically variable effect generating relief microstructure (21) and follows the contour of the relief the reflection enhancing layer also being provided in a second region of the device laterally offset from the first region. No. of Pages : 28 No. of Claims : 35 The Patent Office Journal 18/12/2015 65989 (12) PATENT APPLICATION PUBLICATION (21) Application No.7294/DELNP/2012 A (19) INDIA (22) Date of filing of Application :21/08/2012 (43) Publication Date : 18/12/2015 (54) Title of the invention : MOIRE MAGNIFICATION DEVICE (51) International classification :B42D15/10,G07D7/00 (71)Name of Applicant : (31) Priority Document No :1003397.5 1)DE LA RUE INTERNATIONAL LIMITED (32) Priority Date :01/03/2010 Address of Applicant :De La Rue House Jays Close Viables (33) Name of priority country :U.K. Basingstoke Hampshire RG22 4BS U.K. (86) International Application No :PCT/GB2011/050404 (72)Name of Inventor : Filing Date :01/03/2011 1)HOLMES Brian William (87) International Publication No :WO 2011/107788 (61) Patent of Addition to Application :NA Number :NA Filing Date (62) Divisional to Application Number :NA Filing Date :NA (57) Abstract : A moir magnification device comprises a transparent substrate (20) carrying: i) a regular array (22) of micro focusing elements on a first surface the focusing elements defining a focal plane; ii) a corresponding first array (10) of microimage elements in a first colour and located in a plane substantially coincident with the focal plane of the focusing elements; and iii) a corresponding second array (11) of microimage elements in a second colour different from the first colour and located in a plane substantially coincident with the focal plane of the focusing elements. The pitches of the micro focusing elements (22) and first and second arrays (10, 11) of microimage elements and their relative locations are such that the array of micro focusing elements cooperates with each of the first and second arrays of microimage elements to generate respective magnified versions of the microimage elements of each array due to the moire effect and such that the magnified version of the first array of microimage elements is viewed against a background defined by the magnified version of the second array of microimage elements the magnified version of the first array of microimage elements exhibiting movement relative to the background when the device is tilted and wherein the pitch mismatch between the arrays is chosen such that the magnified version of the elements of the first array appears above or below the magnified version of the elements of the second array. No. of Pages : 51 No. of Claims : 27 The Patent Office Journal 18/12/2015 65990 (12) PATENT APPLICATION PUBLICATION (21) Application No.7249/DELNP/2012 A (19) INDIA (22) Date of filing of Application :21/08/2012 (43) Publication Date : 18/12/2015 (54) Title of the invention : SUBSTRATE GEOMETRY FOR A FILTRATION MEMBRANE• (51) International classification :C07C (71)Name of Applicant : (31) Priority Document No :1051739 1)TECHNOLOGIES AVANCEES ET MEMBRANES (32) Priority Date :10/03/2010 INDUSTRIELLES (33) Name of priority country :France Address of Applicant :ZA Les Laurons F-26110 Nyons (86) International Application No :PCT/FR2011/050458 France Filing Date :04/03/2011 (72)Name of Inventor : (87) International Publication No :WO 2011/110780 1)PHILIPPE LESCOCHE (61) Patent of Addition to Application :NA Number :NA Filing Date (62) Divisional to Application Number :NA Filing Date :NA (57) Abstract : The present invention concerns a filtering element for the filtration of a fluid medium comprising a rigid porous support of cylindrical shape having a longitudinal central axis (A) and comprising a plurality of channels for the circulation of the fluid medium to be filtered with a view to collecting a filtrate on the periphery of the support, said channels being arranged in the support parallel to its central axis central (A) and defining at least three filtering zones which are distributed concentrically and separated from each other by a continuous porous zone, characterized in that the mean thickness of the porous zone (Zl) the closest to the central axis (A) is smaller than the mean thickness of the porous zone (Zn_1) the closest to the periphery of the support (1) and, in the direction moving away from the central axis (A) of the support towards its periphery, the mean thickness of a porous zone is either identical to the next or smaller. (Figure to be published: Fig. 3) No. of Pages : 26 No. of Claims : 20 The Patent Office Journal 18/12/2015 65991 (12) PATENT APPLICATION PUBLICATION (21) Application No.7242/DELNP/2012 A (19) INDIA (22) Date of filing of Application :21/08/2012 (43) Publication Date : 18/12/2015 (54) Title of the invention : TRIAZOLONES AS FATTY ACID SYNTHASE INHIBITORS• (51) International classification (31) Priority Document No (32) Priority Date (33) Name of priority country (86) International Application No Filing Date (87) International Publication No (61) Patent of Addition to Application Number Filing Date (62) Divisional to Application Number Filing Date (71)Name of Applicant : :C07C 1)GLAXOSMITHKLINE LLC :61/306,709 Address of Applicant :One Franklin Plaza 200 North 16th :22/02/2010 Street Philadelphia PA 19102 U.S.A. :U.S.A. (72)Name of Inventor : :PCT/US2011/025661 1)NICHOLAS D. ADAMS :22/02/2011 2)CHRISTOPHER JOSEPH AQUINO :WO/2011/103546 3)AMITA M. CHAUDHARI :NA 4)JONATHAN M. GHERGUROVICH :NA 5)TERENCE JOHN KIESOW 6)CYNTHIA A. PARRISH :NA 7)ALEXANDER JOSEPH REIF :NA 8)KENNETH WIGGALL (57) Abstract : This invention relates to the use of triazolone derivatives for the modulation, notably the inhibition of the activity or function of fatty acid synthase (FAS). Suitably, the present invention relates to the use of triazolones in the treatment of cancer. No. of Pages : 219 No. of Claims : 15 The Patent Office Journal 18/12/2015 65992 (12) PATENT APPLICATION PUBLICATION (21) Application No.7243/DELNP/2012 A (19) INDIA (22) Date of filing of Application :21/08/2012 (43) Publication Date : 18/12/2015 (54) Title of the invention : METHOD FOR PRODUCING HIGH-STRENGTH COKE• (51) International classification :C07C (71)Name of Applicant : (31) Priority Document No :2010-040650 1)NIPPON STEEL & SUMITOMO METAL (32) Priority Date :25/02/2010 CORPORATION (33) Name of priority country :Japan Address of Applicant :6-1 Marunouchi 2-chome Chiyoda(86) International Application No :PCT/JP2011/054122 ku Tokyo 100-8071 Japan Filing Date :24/02/2011 (72)Name of Inventor : (87) International Publication No :WO 2011/105480 1)SEIJI NOMURA (61) Patent of Addition to Application 2)ATSUSHI DOBASHI :NA Number 3)HIROSHI UEMATSU :NA Filing Date 4)HIDEYUKI HAYASHIZAKI (62) Divisional to Application Number :NA 5)YASUHIRO KATSUMI Filing Date :NA (57) Abstract : In a method of producing high-strength coke, in a case in which a temperature at which the weight loss rate obtained through a first derivative of weight loss with respect to time when the temperature increases up to 900°C at 3 °C/min becomes the maximum is defined as the maximum weight loss temperature , a coal feed including a first caking additive whose maximum weight loss temperature is 400°C or higher and a second caking additive whose maximum weight loss temperature is lower than 400°C in coal for coke making is carbonized. No. of Pages : 45 No. of Claims : 8 The Patent Office Journal 18/12/2015 65993 (12) PATENT APPLICATION PUBLICATION (21) Application No.7244/DELNP/2012 A (19) INDIA (22) Date of filing of Application :21/08/2012 (43) Publication Date : 18/12/2015 (54) Title of the invention : METHOD FOR HEATING COATED GLASS SHEETS IN AN OVEN• (51) International classification :B60B (71)Name of Applicant : (31) Priority Document No :BE2010/0058 1)AGC GLASS EUROPE (32) Priority Date :03/02/2010 Address of Applicant :Chaussee de La Hulpe 166 B-1170 (33) Name of priority country :Belgium Bruxelles (Watermael-Boitsfort) Belgium (86) International Application No :PCT/EP2011/051362 (72)Name of Inventor : Filing Date :01/02/2011 1)DAVID PIERRE (87) International Publication No :WO/2011/095471 2)RONNY PIETERS (61) Patent of Addition to Application 3)JEAN-MARIE SELLIER :NA Number :NA Filing Date (62) Divisional to Application Number :NA Filing Date :NA (57) Abstract : The present invention relates to a method for heating glass sheets having an organic material-based coating in an oven, particularly with a view to the subsequent tempering thereof. More precisely, the invention relates to a method enabling glass sheets having an organic material-based coating to be heat treated by enabling the management of the rapid and violent combustion of said organic material in the oven, using a forced heat convection effect due to a hot gas comprising an oxidizer, injected above the glass sheet at least between t1 and t2, t1 being the time at which the flames from the combustion of the organic matter appear and t2 the time when said flames disappear. No. of Pages : 20 No. of Claims : 10 The Patent Office Journal 18/12/2015 65994 (12) PATENT APPLICATION PUBLICATION (21) Application No.7400/DELNP/2012 A (19) INDIA (22) Date of filing of Application :24/08/2012 (43) Publication Date : 18/12/2015 (54) Title of the invention : HETEROCYCLOALKYL-CONTAINING THIENOPYRIMIDINES FOR PHARMACEUTICAL COMPOSITIONS (51) International classification (31) Priority Document No (32) Priority Date (33) Name of priority country (86) International Application No Filing Date (87) International Publication No (61) Patent of Addition to Application Number Filing Date (62) Divisional to Application Number Filing Date (71)Name of Applicant : 1)BOEHRINGER INGELHEIM INTERNATIONAL GMBH Address of Applicant :Binger Strasse 173 55216 Ingelheim :A61K Am Rhein Germany :10154925.1 (72)Name of Inventor : :26/02/2010 1)THORSTEN LEHMANN-LINTZ :EPO 2)JOERG KLEY :PCT/EP2011/052810 3)NORBERT REDEMANN :25/02/2011 4)ACHIM SAUER :WO/2011/104337 5)LEO THOMAS :NA 6)DIETER WIEDENMAYER :NA 7)MATTHIAS AUSTEN 8)JOHN DANILEWICZ :NA 9)MARTIN SCHNEIDER :NA 10)KAY SCHREITER 11)PHILLIP BLACK 12)WESLEY BLACKABY 13)IAN LINNEY (57) Abstract : The present invention relates to novel pharmaceutical compositions comprising thienopyrimidine compounds. Moreover, the present invention relates to the use of the thienopyrimidine compounds of the invention for the production of pharmaceutical compositions for the prophylaxis and/or treatment of diseases which can be influenced by the inhibition of the kinase activity of Mnk1 and/or Mnk2 (Mnk2a or Mnk2b) and/or variants thereof. No. of Pages : 197 No. of Claims : 25 The Patent Office Journal 18/12/2015 65995 (12) PATENT APPLICATION PUBLICATION (21) Application No.7401/DELNP/2012 A (19) INDIA (22) Date of filing of Application :24/08/2012 (43) Publication Date : 18/12/2015 (54) Title of the invention : THIENOPYRIMIDINES CONTAINING A SUBSTITUTED ALKYL GROUP FOR PHARMACEUTICAL COMPOSITIONS (51) International classification (31) Priority Document No (32) Priority Date (33) Name of priority country (86) International Application No Filing Date (87) International Publication No (61) Patent of Addition to Application Number Filing Date (62) Divisional to Application Number Filing Date (71)Name of Applicant : 1)BOEHRINGER INGELHEIM INTERNATIONAL GMBH Address of Applicant :Binger Strasse 173 55216 Ingelheim Am Rhein Germany :A61K (72)Name of Inventor : :10154930.1 1)ARMIN HECKEL :26/02/2010 2)FRANK HIMMELSBACH :EPO 3)JOERG KLEY :PCT/EP2011/052813 4)THORSTEN LEHMANN-LINTZ :25/02/2011 5)NORBERT REDEMANN :WO/2011/104340 6)ACHIM SAUER :NA 7)LEO THOMAS :NA 8)DIETER WIEDENMAYER 9)PHILLIP BLACK :NA 10)WESLEY BLACKABY :NA 11)IAN LINNEY 12)MATTHIAS AUSTEN 13)JOHN DANILEWICZ 14)MARTIN SCHNEIDER 15)KAY SCHREITER (57) Abstract : The present invention relates to novel thienopyhmidine compounds of general formula pharmaceutical compositions comprising these compounds and their therapeutic use for the prophylaxis and/or treatment of diseases which can be influenced by the inhibition of the kinase activity of Mnk1 and/or Mnk2 (Mnk2a or Mnk2b) and/or variants thereof. No. of Pages : 180 No. of Claims : 33 The Patent Office Journal 18/12/2015 65996 (12) PATENT APPLICATION PUBLICATION (21) Application No.7273/DELNP/2012 A (19) INDIA (22) Date of filing of Application :21/08/2012 (43) Publication Date : 18/12/2015 (54) Title of the invention : CRYSTALLINE FORMS OF SODIUM 4 {[9 CHLORO 7 (2 FLUORO 6 METHOXYPHENYL) 5H PYRIMIDO[5 4 D][2]BENZAZEPIN 2YL]AMINO} 2 METHOXYBENZOATE (51) International (71)Name of Applicant : :A01N43/00,A61K31/55,C07D498/00 classification 1)MILLENNIUM PHARMACEUTICALS INC. (31) Priority Document No :61/306047 Address of Applicant :40 Landsdowne Street Cambridge MA (32) Priority Date :19/02/2010 02139 U.S.A. (33) Name of priority (72)Name of Inventor : :U.S.A. country 1)ARMITAGE Ian (86) International 2)COOPER Martin I. :PCT/US2011/024883 Application No 3)EDDLESTON Mark D. :15/02/2011 Filing Date 4)FAIBER Neil C. (87) International 5)MCCUBBIN Quentin J. :WO 2011/103089 Publication No 6)WATT Stephen W. (61) Patent of Addition to :NA Application Number :NA Filing Date (62) Divisional to :NA Application Number :NA Filing Date (57) Abstract : The present invention is directed to a compound of formula (Z): or a crystalline form thereof or a solvate thereof; to a solid pharmaceutical composition comprising a pharmaceutically effective amount of the compound of formula (I) or a crystalline form thereof or a solvate thereof and at least one pharmaceutically acceptable carrier or diluent and to the use of a compound of formula (J) or a crystalline form thereof or a solvate thereof for treating a patient suffering from or subject to a disease disorder or condition mediated by Aurora kinase and methods related thereto. No. of Pages : 76 No. of Claims : 28 The Patent Office Journal 18/12/2015 65997 (12) PATENT APPLICATION PUBLICATION (21) Application No.5065/DELNP/2015 A (19) INDIA (22) Date of filing of Application :11/06/2015 (43) Publication Date : 18/12/2015 (54) Title of the invention : LASER WELDING HEAD AND PROCESS (51) International classification :B23K26/14 (71)Name of Applicant : (31) Priority Document No :1262368 1)TURBOMECA (32) Priority Date :19/12/2012 Address of Applicant :F- 64510 Bordes France (33) Name of priority country :France (72)Name of Inventor : (86) International Application No :PCT/FR2013/053090 1)CHANTELOUP ,Denis, Luc, Alain Filing Date :16/12/2013 2)DUBOURDIEU ,Jean Marc (87) International Publication No :WO 2014/096653 3)LAMAISON, Olivier (61) Patent of Addition to Application 4)VALLY ,Christian :NA Number :NA Filing Date (62) Divisional to Application Number :NA Filing Date :NA (57) Abstract : The invention relates to the field of laser welding, and in particular to a laser welding head (1) intended to be fixed under a lens for focusing the laser , the laser welding head (1) comprising at least one annular nozzle (5) for the injection of a shielding gas , and a chamber (3) for protecting the focusing lens with a transverse current of air. The annular nozzle (5) is arranged around a clear optical axis (0) passing through the laser welding head (1). The chamber (3) for protecting the focusing lens with a transverse current of air comprises an air inlet (9) and an air exhaust (10) square with the air inlet (9) in a plane substantially perpendicular to the said optical axis (0). This laser welding head (1) is configured to be fixed against said focusing lens with no lateral aperture between the focusing lens and said protecting chamber (3). It ensures a distance (d) of at least 100 mm between an outlet (18) of the annular nozzle (5) and said protecting chamber (3). No. of Pages : 13 No. of Claims : 11 The Patent Office Journal 18/12/2015 65998 (12) PATENT APPLICATION PUBLICATION (21) Application No.7201/DELNP/2012 A (19) INDIA (22) Date of filing of Application :17/08/2012 (43) Publication Date : 18/12/2015 (54) Title of the invention : METHODS FOR PRODUCING AND HARVESTING ETHANOL AND APPARATUS FOR PRODUCING AND HARVESTING THE SAME (51) International classification :C12M1/00,C12P5/02,C12P7/06 (71)Name of Applicant : (31) Priority Document No :201000059 1)SCALE BIOFUEL APS (32) Priority Date :26/01/2010 Address of Applicant :Niels Jernes Vej 10 DK 9220 Aalborg (33) Name of priority country :Denmark Denmark (86) International Application No :PCT/IB2011/050347 (72)Name of Inventor : Filing Date :26/01/2011 1)NILSSON Dan (87) International Publication No :WO 2011/092638 (61) Patent of Addition to :NA Application Number :NA Filing Date (62) Divisional to Application :NA Number :NA Filing Date (57) Abstract : The invention relates to methods for producing and harvesting ethanol from fermentable sugars derived from sugar crops starch containing and lignocellulose containing materials and apparatuses for producing and harvesting the same. No. of Pages : 22 No. of Claims : 22 The Patent Office Journal 18/12/2015 65999 (12) PATENT APPLICATION PUBLICATION (21) Application No.7202/DELNP/2012 A (19) INDIA (22) Date of filing of Application :17/08/2012 (43) Publication Date : 18/12/2015 (54) Title of the invention : ASSIGNMENT OF COMPONENT CARRIERS (51) International classification :H04L5/00 (71)Name of Applicant : (31) Priority Document No :NA 1)NOKIA SIEMENS NETWORKS OY (32) Priority Date :NA Address of Applicant :Karaportti 3 FIN 02610 Espoo Finland (33) Name of priority country :NA (72)Name of Inventor : (86) International Application No :PCT/EP2010/051674 1)PEDERSEN Klaus Ingemann Filing Date :11/02/2010 2)YUANYE Wang (87) International Publication No :WO 2011/098124 (61) Patent of Addition to Application :NA Number :NA Filing Date (62) Divisional to Application Number :NA Filing Date :NA (57) Abstract : Assignment of component carriers Carrier aggregation and assignment of component carriers is disclosed. In a method a capability of a communication device for carrier aggregation of a plurality of component carriers is determined. Loading of at least one of the component carriers is determined. The communication device is assigned to one or more of the component carriers on the basis of determining the capability and determining the loading. No. of Pages : 44 No. of Claims : 33 The Patent Office Journal 18/12/2015 66000 (12) PATENT APPLICATION PUBLICATION (21) Application No.7369/DELNP/2012 A (19) INDIA (22) Date of filing of Application :23/08/2012 (43) Publication Date : 18/12/2015 (54) Title of the invention : DATA MANAGEMENT UTILIZING ACCESS AND CONTENT INFORMATION (51) International classification :G06F7/00,G06F17/00 (71)Name of Applicant : (31) Priority Document No :PCT/IL2010/000069 1)VARONIS SYSTEMS INC. (32) Priority Date :27/01/2010 Address of Applicant :499 7th Avenue 23rd Floor South (33) Name of priority country :Israel Tower New York New York 11018 U.S.A. (86) International Application No :PCT/IL2011/000066 (72)Name of Inventor : Filing Date :20/01/2011 1)FAITELSON Yakov (87) International Publication No :WO 2011/092685 2)KORKUS Ohad (61) Patent of Addition to Application 3)KRETZER KATZIR Ophir :NA Number 4)BASS David :NA Filing Date (62) Divisional to Application Number :NA Filing Date :NA (57) Abstract : A system for operating an enterprise computer network including multiple disparate clients data elements and computer resources the system including monitoring and collection functionality for providing continuously updated metadata relating to at least one of actual access access permissions and content of the data elements and operating functionality utilizing the continuously updated metadata provided by the monitoring and collection functionality for functions other than reporting the at least one of actual access access permissions and content or recommending changes in the access permissions. No. of Pages : 35 No. of Claims : 57 The Patent Office Journal 18/12/2015 66001 (12) PATENT APPLICATION PUBLICATION (21) Application No.7276/DELNP/2012 A (19) INDIA (22) Date of filing of Application :21/08/2012 (43) Publication Date : 18/12/2015 (54) Title of the invention : DEVICE AND METHOD FOR ASSESSING A POTENTIAL TARGET (51) International classification :G01S17/74,G01S13/78 (71)Name of Applicant : (31) Priority Document No :10502409 1)BAE SYSTEMS H„GGLUNDS AKTIEBOLAG (32) Priority Date :17/03/2010 Address of Applicant :S 891 82 –rnskldsvik Sweden (33) Name of priority country :Sweden (72)Name of Inventor : (86) International Application No :PCT/SE2011/050289 1)NORDLANDER Per …ke Filing Date :17/03/2011 (87) International Publication No :WO 2011/115561 (61) Patent of Addition to Application :NA Number :NA Filing Date (62) Divisional to Application Number :NA Filing Date :NA (57) Abstract : The invention relates to a method for assessing from a firing unit (101) a potential target (102) for said firing unit comprising the steps of: visually observing said potential target (102) through direction means; initiating measuring of a range from said firing unit (101) to the potential target (102) by means of delivering an identifiable signal (S1); at said potential target receiving and analysing said signal (S1) said analysis comprising establishing that at least one of the parameters power frequency and durability configuration of said signal (S1). comparing said at least one parameter with parameter indications stored in advance; on correspondence establishing that the firing unit belongs to own troop; and delivering a visual signal (S2) from the potential target (102). The invention also relates to a computer program product comprising a program code (P) for a computer (200; 210) for implementing a method according to the invention. The invention also relates to a system and a firing unit being equipped with the device. No. of Pages : 34 No. of Claims : 19 The Patent Office Journal 18/12/2015 66002 (12) PATENT APPLICATION PUBLICATION (21) Application No.7277/DELNP/2012 A (19) INDIA (22) Date of filing of Application :21/08/2012 (43) Publication Date : 18/12/2015 (54) Title of the invention : UNDERGROUND MINING (51) International classification :E21C41/22 (71)Name of Applicant : (31) Priority Document No :2010900726 1)TECHNOLOGICAL RESOURCES PTY. LIMITED (32) Priority Date :22/02/2010 Address of Applicant :120 Collins Street Melbourne Victoria (33) Name of priority country :Australia 3000 Australia (86) International Application No :PCT/AU2011/000187 (72)Name of Inventor : Filing Date :22/02/2011 1)ODDIE Max Edward (87) International Publication No :WO 2011/100808 2)JONES Colin Ian (61) Patent of Addition to Application 3)LABRECQUE Pierre :NA Number 4)DELABBIO Fredric Christopher :NA Filing Date (62) Divisional to Application Number :NA Filing Date :NA (57) Abstract : A method of block cave mining comprising excavating undercut tunnels (21) at an undercut level; drilling undercut blast holes (25) through the undercut tunnel roofs and setting and detonating explosive charges in those holes to blast rock above the undercut tunnels to initiate the formation of broken rock caverns (26) above the undercut tunnels (21); excavating extraction level tunnels (22) at an extraction level below the undercut level; drilling drawbell blast holes (33) upwardly from the extraction level tunnels at selected drawbell locations toward the broken rock caverns (26) and setting and detonating explosive charges in those holes to blast drawbells (32) through which broken rock falls down into the extraction level tunnels (22); and progressively removing such fallen rock from the drawbell locations through the extraction level tunnels (22); wherein some of the excavation is done mechanically by tunnel boring machinery. No. of Pages : 29 No. of Claims : 20 The Patent Office Journal 18/12/2015 66003 (12) PATENT APPLICATION PUBLICATION (21) Application No.7278/DELNP/2012 A (19) INDIA (22) Date of filing of Application :21/08/2012 (43) Publication Date : 18/12/2015 (54) Title of the invention : POLYIMIDAZOLES FOR USE AS BILE ACID SEQUESTRANTS (51) International (71)Name of Applicant : :A61K31/785,A61K31/787,A61K45/06 classification 1)RELYPSA INC. (31) Priority Document Address of Applicant :5301 Patrick Henry Drive Santa Clara :61/307816 No California 95054 U.S.A. (32) Priority Date :24/02/2010 (72)Name of Inventor : (33) Name of priority 1)LEES Inez :U.S.A. country 2)BIYANI Kalpesh (86) International 3)CONNOR Eric :PCT/US2011/026102 Application No 4)HECKER Scott :24/02/2011 Filing Date 5)ZHANG Hongmin (87) International 6)COPE Michael James :WO 2011/106545 Publication No 7)GOKA Elizabeth (61) Patent of Addition to 8)LEE Angela :NA Application Number 9)MADSEN Deidre :NA Filing Date 10)SHAO Jun (62) Divisional to 11)ZHANG Xinnan :NA Application Number :NA Filing Date (57) Abstract : The present invention provides crosslinked amine polymers effective for binding and removing bile salts from the gastrointestinal tract. These bile acid binding polymers or pharmaceutical compositions thereof can be administered to subjects to treat various conditions including hypercholesteremia diabetes pruritus irritable bowel syndrome diarrhea (IBS D) bile acid malabsorption and the like. No. of Pages : 97 No. of Claims : 149 The Patent Office Journal 18/12/2015 66004 (12) PATENT APPLICATION PUBLICATION (21) Application No.7279/DELNP/2012 A (19) INDIA (22) Date of filing of Application :21/08/2012 (43) Publication Date : 18/12/2015 (54) Title of the invention : CROSSLINKED POLYVRNYLAMINE POLY ALL YLAMINE AND POLYETHYLENEIMINE FOR USE AS BILE ACID SEQUESTRANTS (71)Name of Applicant : 1)RELYPSA INC. Address of Applicant :5301 Patrick Henry Drive Santa Clara (51) International :C08F20/52,C08F22/38,C08L39/02 California 95054 U.S.A. classification (72)Name of Inventor : (31) Priority Document No :61/307814 1)KOPPING Jordon (32) Priority Date :24/02/2010 2)BIYANI Kalpesh (33) Name of priority country :U.S.A. 3)CONNOR Eric (86) International Application :PCT/US2011/026099 4)HECKER Scott No :24/02/2011 5)LEES Inez Filing Date 6)QUAKER Grace (87) International Publication :WO 2011/106542 7)SALAYMEH Faleh No 8)ZHANG Hongmin (61) Patent of Addition to :NA 9)BERGBREITER David Application Number :NA 10)MANSKY Paul Filing Date 11)MU YongQi (62) Divisional to Application :NA 12)COPE Michael James Number :NA 13)GOKA Elizabeth Filing Date 14)LEE Angela 15)MADSEN Deidre 16)SHAO Jun (57) Abstract : The present invention provides a crosslinked amine and amide polymers effective for binding and removing bile salts from the gastrointestinal tract. These bile acid binding polymers or pharmaceutical compositions thereof can be administered to subjects to treat various conditions including hypercholesteremia diabetes pruritis irritable bowel syndrome diarrhea (IBS D) bile acid malabsorption and the like. No. of Pages : 104 No. of Claims : 143 The Patent Office Journal 18/12/2015 66005 (12) PATENT APPLICATION PUBLICATION (21) Application No.7341/DELNP/2012 A (19) INDIA (22) Date of filing of Application :23/08/2012 (43) Publication Date : 18/12/2015 (54) Title of the invention : REPRODUCTION CONTROL DEVICE&NBSP; REPRODUCTION CONTROL METHOD&NBSP; AND REPRODUCTION SUPPORT SYSTEM FOR DPF• (51) International classification :B60J (71)Name of Applicant : (31) Priority Document No :2010-070121 1)MITSUBISHI HEAVY INDUSTRIES LTD. (32) Priority Date :25/03/2010 Address of Applicant :16-5 Konan 2-chome Minato-ku (33) Name of priority country :Japan Tokyo 1088215 Japan (86) International Application No :PCT/JP2011/051512 (72)Name of Inventor : Filing Date :26/01/2011 1)KO TAKAYANAGI (87) International Publication No :WO 2011/118250 2)TOMOTSUGU MASUDA (61) Patent of Addition to Application 3)YASUMICHI AOKI :NA Number :NA Filing Date (62) Divisional to Application Number :NA Filing Date :NA (57) Abstract : A DPF regeneration control device includes: a differential pressure sensor 39 which detects a differential pressure between a front and a rear of a DPF 7; a DPF differential pressure setting unit 51 which sets a DPF differential pressure generated in accordance with a total accumulated amount of soot and ash in advance through an experiment or a calculation, sets a DPF differential pressure generated when an ash accumulation amount corresponds to an accumulation amount at which washing is required, as a washing request threshold, and sets a DPF differential pressure. generated when the ash accumulation amount is larger than the washing request threshold such that a reduction in output is necessary, as an output reduction threshold; a washing request issuing unit 53 which determines whether or not the DPF differential pressure has reached the washing request threshold and outputs a washing request; and an output reduction warning unit 55 which determines whether or not the DPF differential pressure has reached the output reduction threshold and issues an output reduction warning. No. of Pages : 62 No. of Claims : 10 The Patent Office Journal 18/12/2015 66006 (12) PATENT APPLICATION PUBLICATION (21) Application No.7344/DELNP/2012 A (19) INDIA (22) Date of filing of Application :23/08/2012 (43) Publication Date : 18/12/2015 (54) Title of the invention : POLYMERIC PHOTOINITIATORS (51) International classification :C08F (71)Name of Applicant : (31) Priority Document No :PA 2010 70065 1)COLOPLAST A/S (32) Priority Date :23/02/2010 Address of Applicant :Holtedam 1 DK-3050 Humlebaek (33) Name of priority country :Denmark Denmark (86) International Application No :PCT/DK2011/050055 (72)Name of Inventor : Filing Date :23/02/2011 1)CHRISTIAN B. NIELSEN (87) International Publication No :WO/2011/103878 2)NIELS JOERGEN MADSEN (61) Patent of Addition to Application 3)CHRISTINA MAJ JOERGENSEN :NA Number :NA Filing Date (62) Divisional to Application Number :NA Filing Date :NA (57) Abstract : A polyalkylether photoinitiator of the general formula I, R1(A1)r-(R2(A2)m-O)o-(R3(A3)n- O)p-R4(A4)s I wherein R1, R2, R3,R4 and m, n, o, p, r and s are as defined herein and A1, A2, A3 and A4 are identical or different photoinitiator moieties. No. of Pages : 31 No. of Claims : 24 The Patent Office Journal 18/12/2015 66007 (12) PATENT APPLICATION PUBLICATION (21) Application No.7345/DELNP/2012 A (19) INDIA (22) Date of filing of Application :23/08/2012 (43) Publication Date : 18/12/2015 (54) Title of the invention : A DEVICE FOR ATTACHMENT TO A PENIS (51) International classification :A47J (71)Name of Applicant : (31) Priority Document No :PA 2010 00123 1)SECURIN APS (32) Priority Date :13/02/2010 Address of Applicant :Krakasvej 17 DK-3400 Hiller¸d (33) Name of priority country :Denmark Denmark Denmark (86) International Application No :PCT/EP2011/052066 (72)Name of Inventor : Filing Date :11/02/2011 1)BRIAN NIELSEN (87) International Publication No :WO/2011/098581 2)NICOLAI S˜RENSEN (61) Patent of Addition to Application :NA Number :NA Filing Date (62) Divisional to Application Number :NA Filing Date :NA (57) Abstract : An attachment member suitable for attaching a system to a male human beings penis, said system being suitable for collecting urine from a male human being, said attachment member comprising a substantially cylindrical portion which : comprises an elastic film material, has a first opening at a first end thereof and a second opening at the other end thereof, is arranged such that at least the glans penis of a penis could be arranged inside the substantially cylindrical portion with the first opening being further from the base of the penis than the second opening, and is at least partly rolled up to assume a ring like configuration in such a way that the first opening is located inside the rolled up portion and the second opening is located outside the rolled up portion, wherein the inner diameter of the rolled up portion of the substantially cylindrical portion is less than 45mm when the elastic film material of the attachment member is not stretched and not rolled up. In this way, an effective and simple to apply attachment member is provided. No. of Pages : 62 No. of Claims : 19 The Patent Office Journal 18/12/2015 66008 (12) PATENT APPLICATION PUBLICATION (21) Application No.7411/DELNP/2012 A (19) INDIA (22) Date of filing of Application :24/08/2012 (43) Publication Date : 18/12/2015 (54) Title of the invention : SYSTEM AND METHOD FOR CALL ROUTING AND PAGING ACROSS DIFFERENT TYPES OF NETWORKS (51) International classification :H04L 12/66 (71)Name of Applicant : (31) Priority Document No :60/583,708 1)INTERDIGITAL TECHNOLOGY CORPORATION (32) Priority Date :29/06/2004 Address of Applicant :3411 SILVERSIDE ROAD, (33) Name of priority country :U.S.A. CONCORD PLAZA, SUITE 105, HAGLEY BUILDING, (86) International Application No :PCT/US2005/022220 WILMINGTON, DELAWARE 19810, U.S.A. U.S.A. Filing Date :23/06/2005 (72)Name of Inventor : (87) International Publication No :WO 2006/012191 1)MENON, NARAYAN, PARAPPIL (61) Patent of Addition to Application 2)CARLTON, ALAN, GERALD :NA Number :NA Filing Date (62) Divisional to Application Number :194/DELNP/2007 Filed on :08/01/2007 (57) Abstract : A network architecture uses an Application Server Autonomous Access (ASAA) server (12) which allows paging and call routing across different types of wireless and wireline access networks. The ASAA server (12) provides connectivity between an external voice or data network (14) and a wireless transmit/receive unit (WTRU, 13). The external voice or data network (14) may be a public switched telephone network (PSTN) or a public data network (PDN), so that the connectivity between the external network (14) and the WTRU (13) is provided through the access networks using data from the ASAA server (12). No. of Pages : 21 No. of Claims : 20 The Patent Office Journal 18/12/2015 66009 (12) PATENT APPLICATION PUBLICATION (21) Application No.7336/DELNP/2012 A (19) INDIA (22) Date of filing of Application :22/08/2012 (43) Publication Date : 18/12/2015 (54) Title of the invention : 6 -BENZYLPHENYL- 2 - SULFURTERAHYDROPYRAN-3&NBSP; 4&NBSP; 5 -TRIOL DERIVATIVES AS INHIBITORS OF SODIUM -GLUCOSE COTRANS PORTERS 1 AND 2 FOR USE IN DIABETIC PATIENTS (51) International classification :A61K (71)Name of Applicant : (31) Priority Document No :61/309,592 1)LEXICON PHARMACEUTICALS INC. (32) Priority Date :02/03/2010 Address of Applicant :8800 Technology Forest Place The (33) Name of priority country :U.S.A. Woodlands TX 77381 U.S.A. (86) International Application No :PCT/US2011/026591 (72)Name of Inventor : Filing Date :01/03/2011 1)BROWN Philip Manton (87) International Publication No :WO/2011/109333 2)FREIMAN Joel Philip (61) Patent of Addition to Application 3)POWELL David Reed :NA Number :NA Filing Date (62) Divisional to Application Number :NA Filing Date :NA (57) Abstract : Methods of improving the cardiovascular and/or metabolic health of patients, particularly those suffering from type 2 diabetes, are disclosed, as well as compounds and pharmaceutical compositions useful therein. No. of Pages : 43 No. of Claims : 16 The Patent Office Journal 18/12/2015 66010 (12) PATENT APPLICATION PUBLICATION (21) Application No.7337/DELNP/2012 A (19) INDIA (22) Date of filing of Application :22/08/2012 (43) Publication Date : 18/12/2015 (54) Title of the invention : PROCESSES FOR THE PREPARATION OF S1P1 RECEPTOR MODULATORS AND CRYSTALLINE FORMS THEREOF (51) International classification :C07C (71)Name of Applicant : (31) Priority Document No :61/339,362 1)ARENA PHARMACEUTICALS INC. (32) Priority Date :03/03/2010 Address of Applicant :6166 Nancy Ridge Drive San Diego (33) Name of priority country :U.S.A. California 92121 U.S.A. (86) International Application No :PCT/US2011/026806 (72)Name of Inventor : Filing Date :02/03/2011 1)JONES Robert M. (87) International Publication No :WO 2011/109471 2)BUZARD Daniel J. (61) Patent of Addition to Application 3)GHARBAOUI Tawfik :NA Number 4)JOHNSON Benjamin R. :NA Filing Date 5)KASEM Michelle (62) Divisional to Application Number :NA 6)SCHRADER Thomas O. Filing Date :NA 7)STIRN Scott (57) Abstract : The present invention relates to salts processes and process intermediates useful in the preparation of (R)-2-(9-chloro-7-(4isopropoxy-3-(trifluoromethyl)benzyloxy)-2 3-dihydro-1H-pyrrolo[1 2-a]indol-1-yl)acetic acid of Formula (Ia) salts and crystalline forms thereof. The compound (R)-2-(9-chloro-7-(4-isopropoxy-3-(trifluoromethyl)benzyloxy)-2 3-dihydro-1H-pyrrolo[1 2-a]indol-1yl)acetic acid has been identified as an S1P1 receptor modulator that is useful in the treatment of S1P1 receptor-associated disorders for example diseases and disorders mediated by lymphocytes transplant rejection autoimmune diseases and disorders inflammatory diseases and disorders (e.g. acute and chronic inflammatory conditions) cancer and conditions characterized by an underlying defect in vascular integrity or that are associated with angiogenesis such as may be pathologic (e.g. as may occur in inflammation tumor development and atherosclerosis). No. of Pages : 167 No. of Claims : 56 The Patent Office Journal 18/12/2015 66011 (12) PATENT APPLICATION PUBLICATION (21) Application No.7257/DELNP/2012 A (19) INDIA (22) Date of filing of Application :21/08/2012 (43) Publication Date : 18/12/2015 (54) Title of the invention : DRY GLASSY COMPOSITION COMPRISING A BIOACTIVE MATERIALMAKING THE SAME (51) International classification :C12P (71)Name of Applicant : (31) Priority Document No :61/299,315 1)ADVANCED BIONUTRITION CORPORATION (32) Priority Date :28/01/2010 Address of Applicant :7155 Columbia Gateway Drive (33) Name of priority country :U.S.A. Columbia MD 21046-2545 United States of America U.S.A. (86) International Application No :PCT/US2011/022821 (72)Name of Inventor : Filing Date :28/01/2011 1)MOTI HAREL (87) International Publication No :WO/2011/094469 2)JANUARY SCARBROUGH (61) Patent of Addition to Application 3)ROGER DREWS :NA Number :NA Filing Date (62) Divisional to Application Number :NA Filing Date :NA (57) Abstract : The present invention relates to formulations and methods for stabilizing and protecting of biologic materials during harsh storing and use conditions, wherein the formulations relate to embedded bioactive materials and biologics, including live bacteria, in a protective glassy matrix. No. of Pages : 49 No. of Claims : 20 The Patent Office Journal 18/12/2015 66012 (12) PATENT APPLICATION PUBLICATION (21) Application No.7258/DELNP/2012 A (19) INDIA (22) Date of filing of Application :21/08/2012 (43) Publication Date : 18/12/2015 (54) Title of the invention : MEASUREMENT METHOD FOR A SURFACE-MEASURING MEASURING MACHINE (51) International classification (31) Priority Document No (32) Priority Date (33) Name of priority country :G01N (71)Name of Applicant : :10157931.6 1)Leica Geosystems AG :26/03/2010 Address of Applicant :Heinrich-Wild-Strasse CH-9435 :EUROPEAN Heerbrugg (CH) Switzerland UNION (72)Name of Inventor : :PCT/EP2011/054192 1)LIPPUNER Heinz :21/03/2011 2)VOKINGER Urs :WO 2011/117171 3)SIERCKS Knut (86) International Application No Filing Date (87) International Publication No (61) Patent of Addition to Application :NA Number :NA Filing Date (62) Divisional to Application Number :NA Filing Date :NA (57) Abstract : Disclosed is a measurement method for a surface-measuring measuring machine comprising a base, a measurement component for establishing and maintaining a contacting or contact-less, in particular optical, measurement connection to a surface to be measured, wherein the measurement component is connected to the base by way of at least one connecting element (lo), and at least one rotary encoder, which detects the rotation of the at least one connecting element (10) with respect to a holder (11) and each of which has a code carrier (12) and a sensor arrangement (13). In said measurement method, a code projection which is dependent on the the dimensional position sf the code carrier (12) relative to the sensor arrangement (13) is generated on the sensor arrangement (13), and at least part of the code projection is captured. From this, an angular position of the code carrier (12) with reference to the defined axis of rotation (DA) is ascertained and the current measurement position of the measurement component relative to the base is determined, wherein, for the at least one rotary encoder, a position value for at least one further degree of freedom of the code carrier (12) relative to the sensor arrangement (13) is ascertained on the basis of the code projection and is taken into account to determine the current measurement position, and d relative position of the connecting element (16) with respect to the holder (11) War the deformation thereof is: determined from the position due in the form of a change in shape or size. No. of Pages : 50 No. of Claims : 15 The Patent Office Journal 18/12/2015 66013 (12) PATENT APPLICATION PUBLICATION (21) Application No.7259/DELNP/2012 A (19) INDIA (22) Date of filing of Application :21/08/2012 (43) Publication Date : 18/12/2015 (54) Title of the invention : CRIMPING PRESS (51) International classification :B60J (71)Name of Applicant : (31) Priority Document No :CH00530/10 1)Schleuniger Holding AG (32) Priority Date :13/04/2010 Address of Applicant :Bierigutstrasse 9 CH-3608 Thun (CH) (33) Name of priority country :Switzerland Switzerland (86) International Application No :PCT/IB2011/051576 (72)Name of Inventor : Filing Date :12/04/2011 1)AYABAKAN Mustafa (87) International Publication No :WO/2011/128844 2)WORTMANN Thomas (61) Patent of Addition to Application :NA Number :NA Filing Date (62) Divisional to Application Number :NA Filing Date :NA (57) Abstract : A crimping press (1) is disclosed comprising a first crimping tool (11) a second crimping tool (13) which can be moved relative to the first crimping tool (11) and a drive (3..8) for applying a crimping force between the first and second crimping tools (11, 13) during a crimp production process (D). In accordance with the invention the crimping press (1) further comprises biasing means (15, 18) for applying an initial force between the first and second crimping tools (11, 13) which is oriented in the same direction as the crimping force and is already effective before the crimp production process (D). No. of Pages : 23 No. of Claims : 10 The Patent Office Journal 18/12/2015 66014 (12) PATENT APPLICATION PUBLICATION (21) Application No.7326/DELNP/2012 A (19) INDIA (22) Date of filing of Application :22/08/2012 (43) Publication Date : 18/12/2015 (54) Title of the invention : APPARATUS AND METHODS FOR INTEGRATED SAMPLE PREPARATION REACTION AND DETECTION (51) International classification :C12M1/24 (71)Name of Applicant : (31) Priority Document No :61/307281 1)GENTURADX USA INC. (32) Priority Date :23/02/2010 Address of Applicant :24590 Clawiter Road Hayward (33) Name of priority country :U.S.A. California 94545 U.S.A. (86) International Application No :PCT/US2011/025871 (72)Name of Inventor : Filing Date :23/02/2011 1)BIRD Dylan Hilmer (87) International Publication No :WO 2011/106384 2)CHING Jesus (61) Patent of Addition to Application 3)JOHNSON Bruce A. :NA Number 4)MORAVICK Keith E. :NA Filing Date 5)RICHARDSON Bruce (62) Divisional to Application Number :NA Filing Date :NA (57) Abstract : Cartridges for the isolation of a biological sample and downstream biological assays on the sample are provided. In one embodiment a nucleic acid sample is isolated from a biological sample and the nucleic acid sample is amplified for example by the polymerase chain reaction. The cartridges provided herein can also be used for the isolation of non nucleic acid samples for example proteins and to perform downstream reactions on the proteins for example binding assays. Instruments for carrying out the downstream biological assays and for detecting the results of the assays are also provided. No. of Pages : 198 No. of Claims : 28 The Patent Office Journal 18/12/2015 66015 (12) PATENT APPLICATION PUBLICATION (21) Application No.7353/DELNP/2012 A (19) INDIA (22) Date of filing of Application :23/08/2012 (43) Publication Date : 18/12/2015 (54) Title of the invention : NUCLEIC ACID STRUCTURE CONTAINING A PYRIPYROPENE BIOSYNTHESIS GENE CLUSTER AND A MARKER GENE (51) International classification :C12P (71)Name of Applicant : (31) Priority Document No :2010-014700 1)MEIJI SEIKA PHARMA CO. LTD. (32) Priority Date :26/01/2010 Address of Applicant :4-16 Kyobashi 2-chome Chuo-ku (33) Name of priority country :Japan Tokyo 1048002 Japan Japan (86) International Application No :PCT/JP2011/050852 (72)Name of Inventor : Filing Date :19/01/2011 1)SATO AIHARA (87) International Publication No :WO 2011/093186 2)NAOMI SUMIDA (61) Patent of Addition to Application 3)KOICHIRO MURASHIMA :NA Number 4)KOUJI YANAI :NA Filing Date 5)HIROYUKI ANZAI (62) Divisional to Application Number :NA 6)KENTARO YAMAMOTO Filing Date :NA (57) Abstract : There is provided a nucleic acid construct comprising a pyripyropene biosynthetic gene cluster and a marker gene. The nucleic acid construct according to the present invention provides an inexpensive and highly productive method for producing pyripyropene. No. of Pages : 200 No. of Claims : 17 The Patent Office Journal 18/12/2015 66016 (12) PATENT APPLICATION PUBLICATION (21) Application No.7354/DELNP/2012 A (19) INDIA (22) Date of filing of Application :23/08/2012 (43) Publication Date : 18/12/2015 (54) Title of the invention : CONTAINER HANDLER ALIGNMENT SYSTEM AND METHOD (51) International classification :B68F (71)Name of Applicant : (31) Priority Document No :61/474,982 1)TMEIC CORPORATION (32) Priority Date :13/04/2011 Address of Applicant :Suite 200 1325 Electric Road (33) Name of priority country :U.S.A. Roanoke Virginia 24018 United States of America U.S.A. (86) International Application No :PCT/US2012/032684 (72)Name of Inventor : Filing Date :09/04/2012 1)DAVID G. STOCKER (87) International Publication No :WO 2012/141987 (61) Patent of Addition to Application :NA Number :NA Filing Date (62) Divisional to Application Number :NA Filing Date :NA (57) Abstract : A system and method for assisting drivers of Bomb Carts and Shuttle Carriers to position their vehicles appropriately for loading and unloading containers at a gantry crane. The system uses laser scanners mounted at various levels on the gantry crane sill beams to determine the type, position, orientation and skew angle of the vehicles as well as whether the vehicles are in a loaded or unloaded condition. In addition, the system provides indicator devices to direct drivers how to move their vehicles. No. of Pages : 21 No. of Claims : 10 The Patent Office Journal 18/12/2015 66017 (12) PATENT APPLICATION PUBLICATION (21) Application No.7355/DELNP/2012 A (19) INDIA (22) Date of filing of Application :23/08/2012 (43) Publication Date : 18/12/2015 (54) Title of the invention : IMPROVED RESOLUTION METHODS FOR ISOLATING DESIRED ENANTIOMERS OF TAPENTADOL INTERMEDIATES AND USE THEREOF FOR THE PREPARATION OF TAPENTADOL (51) International (71)Name of Applicant : :C07C209/88,C07C211/03,C07C213/10 classification 1)ACTAVIS GROUP PTC EHF (31) Priority Document Address of Applicant :Reykjavikurvegi 76 78 IS 220 :577/CHE/2010 No Hafnarfjorour Ice Land (32) Priority Date :05/03/2010 (72)Name of Inventor : (33) Name of priority 1)KHUNT Mayur Devjibhai :India country 2)BONDGE Sandipan Prabhurao (86) International 3)PRADHAN Nitin Sharadchandra :PCT/IB2011/000526 Application No :01/03/2011 Filing Date (87) International :WO 2011/107876 Publication No (61) Patent of Addition to :NA Application Number :NA Filing Date (62) Divisional to :NA Application Number :NA Filing Date (57) Abstract : Provided herein is an improved and industrially advantageous optical resolution method for resolving (2R,3R)/ (2S,35)-ldimethylamino-3-(3-methoxyphenyl)-2- methylpentan-3-ol, and use thereof for the preparation of tapentadol or a pharmaceutically acceptable salt thereof. Provided further herein is an improved and industrially advantageous optical resolution method for resolving (2R,3R)/(2S,3S)-[3-(3-methoxyphenyl)-2- methylpentylj-dimethylamine, and use thereof for the preparation of tapentadol or a pharmaceutically acceptable salt thereof. Disclosed also herein is an improved, commercially viable and industrially advantageous process for the preparation of tapentadol or a pharmaceutically acceptable salt thereof in high yield and purity No. of Pages : 35 No. of Claims : 20 The Patent Office Journal 18/12/2015 66018 (12) PATENT APPLICATION PUBLICATION (21) Application No.7356/DELNP/2012 A (19) INDIA (22) Date of filing of Application :23/08/2012 (43) Publication Date : 18/12/2015 (54) Title of the invention : RECOMBINANT PROTEINS FOR USE IN VACCINE ANTIBODIES AGAINST SAID PROTEINS AND DIAGNOSTIC AND THERAPEUTIC METHODS INCLUDING THE SAME (51) International (71)Name of Applicant : :C07K14/20,A61K39/02,A61P31/04 classification 1)ROSANDER Anna (31) Priority Document No :61/298960 Address of Applicant :Orrstigen 10 S 756 53 Uppsala Sweden (32) Priority Date :28/01/2010 2)PRINGLE Mrit (33) Name of priority country :U.S.A. (72)Name of Inventor : (86) International Application 1)ROSANDER Anna :PCT/SE2011/050090 No 2)PRINGLE Mrit :28/01/2011 Filing Date (87) International Publication :WO 2011/093783 No (61) Patent of Addition to :NA Application Number :NA Filing Date (62) Divisional to :NA Application Number :NA Filing Date (57) Abstract : The present invention relates to proteins and/or fragments and derivatives thereof and their use as vaccines and in biotechnological methods. The vaccines particularly include immunogenic proteins in spp. isolated from digital dermatitis in cattle. The present invention further relates to antibodies raised against said proteins or fragments thereof and the use of said proteins in diagnostic methods in which antibodies are detected as a sign of digital dermatitis in cattle. No. of Pages : 41 No. of Claims : 19 The Patent Office Journal 18/12/2015 66019 (12) PATENT APPLICATION PUBLICATION (21) Application No.7357/DELNP/2012 A (19) INDIA (22) Date of filing of Application :23/08/2012 (43) Publication Date : 18/12/2015 (54) Title of the invention : METHOD AND SYSTEM FOR OPTIMIZING FILM PRODUCTION AND MINIMIZING FILM SCRAP (51) International classification :A61K9/22,G06F19/00 (71)Name of Applicant : (31) Priority Document No :61/303409 1)MONOSOL RX LLC (32) Priority Date :11/02/2010 Address of Applicant :30 Technology Drive Warren NJ 07059 (33) Name of priority country :U.S.A. U.S.A. (86) International Application No :PCT/US2011/024340 (72)Name of Inventor : Filing Date :10/02/2011 1)BOGUE Beuford A. (87) International Publication No :WO 2011/100423 (61) Patent of Addition to Application :NA Number :NA Filing Date (62) Divisional to Application Number :NA Filing Date :NA (57) Abstract : The present invention relates to a method of optimizing self supporting film production which includes the steps of: determining at least one scrap factor which relates to a total amount of scrap in processing a film product; correlating the at least one scrap factor to at least one processing parameter; and adjusting the at least one processing parameter to reduce the total amount of scrap in processing the film product. No. of Pages : 93 No. of Claims : 21 The Patent Office Journal 18/12/2015 66020 (12) PATENT APPLICATION PUBLICATION (21) Application No.7392/DELNP/2012 A (19) INDIA (22) Date of filing of Application :24/08/2012 (43) Publication Date : 18/12/2015 (54) Title of the invention : MAPPING APPARATUS AND METHOD FOR TRANSMISSION OF DATA IN A MULTI-CARRIER BROADCAST SYSTEM• (51) International classification :H04N (71)Name of Applicant : (31) Priority Document No :10154717.2 1)SONY CORPORATION (32) Priority Date :25/02/2010 Address of Applicant :1-7-1 Konan Minato-ku Tokyo 108(33) Name of priority country :EPO 0075 Japan (86) International Application No :PCT/EP2011/052222 (72)Name of Inventor : Filing Date :15/02/2011 1)LOTHAR STADELMEIER (87) International Publication No :WO/2011/104142 2)NABIL LOGHIN (61) Patent of Addition to Application 3)JOERG ROBERT :NA Number 4)SAMUEL ASANGBENG ATUNGSIRI :NA Filing Date (62) Divisional to Application Number :NA Filing Date :NA (57) Abstract : The present invention relates to an apparatus and a corresponding method for mapping payload data of mapping input data streams (S1, S2,..., Sp) onto a mapping output data stream (Q) having a channel bandwidth for transmission in a multi- carrier broadcast system. To enable the selection of the robustness for the transmission of data, said apparatus comprises a frame forming means (16, 64) for mapping the data blocks of said at least two mapping input data streams (S1, S2,..., Sp) onto frames (F) of said mapping output data stream (Q) covering said channel bandwidth, each frame (F) comprising a payload portion (50), said payload portion (50) comprising a plurality of data symbols (52)and being segmented into data segments (51) each covering a bandwidth portion of said channel bandwidth, wherein the frame forming means (64) is adapted for mapping the data blocks of said at least two mapping input data streams (S1, S2,..., Sp) onto the data symbols (52) of said pay- load portion (50) and comprises a MIMO mode selection means (1614, 1682) for selecting the MIMO mode of the data blocks per data segment (51) and/or per map- ping input data stream (S1, S2,..., Sp). No. of Pages : 110 No. of Claims : 32 The Patent Office Journal 18/12/2015 66021 (12) PATENT APPLICATION PUBLICATION (21) Application No.7393/DELNP/2012 A (19) INDIA (22) Date of filing of Application :24/08/2012 (43) Publication Date : 18/12/2015 (54) Title of the invention : COMPOSITIONS AND METHODS FOR ENHANCING PROTEASOME ACTIVITY• (51) International classification :C07C (71)Name of Applicant : (31) Priority Document No :61/336,959 1)PRESIDENT AND FELLOWS OF HARVARD (32) Priority Date :28/01/2010 COLLEGE (33) Name of priority country :U.S.A. Address of Applicant :17 Quincy Street Cambridge MA (86) International Application No :PCT/US2011/022929 02138 U.S.A. Filing Date :28/01/2011 (72)Name of Inventor : (87) International Publication No :WO/2011/094545 1)DANIEL FINLEY (61) Patent of Addition to Application 2)RANDALL W. KING :NA Number 3)BYUNG-HOON LEE :NA Filing Date 4)MIN JAE LEE (62) Divisional to Application Number :NA 5)TIMOTHY C. GAHMAN Filing Date :NA (57) Abstract : Proteinopathies result from the proteasome not acting efficiently enough to eliminate harmful proteins and prevent the formation of the pathogenic aggregates. As described herein, inhibition of proteasome-associated deubiquitinase Usp 14 results in increased proteasome efficiency. The present invention therefore provides novel compositions and methods for inhibition of Uspl4, enhancement of proteasome activity and treatment of proteinopathies. No. of Pages : 160 No. of Claims : 108 The Patent Office Journal 18/12/2015 66022 (12) PATENT APPLICATION PUBLICATION (21) Application No.170/MUMNP/2015 A (19) INDIA (22) Date of filing of Application :23/01/2015 (43) Publication Date : 18/12/2015 (54) Title of the invention : METHOD AND APPARATUS FOR MULTILAYER VIDEO ENCODING FOR RANDOM ACCESS AND METHOD AND APPARATUS FOR MULTILAYER VIDEO DECODING FOR RANDOM ACCESS (51) International classification :H04N7/32 (71)Name of Applicant : (31) Priority Document No :61/668634 1)SAMSUNG ELECTRONICS CO. LTD. (32) Priority Date :06/07/2012 Address of Applicant :129 Samsung ro Yeongtong gu Suwon (33) Name of priority country :U.S.A. si Gyeonggi do 443 742 Republic of Korea Republic of Korea (86) International Application No :PCT/KR2013/006032 (72)Name of Inventor : Filing Date :08/07/2013 1)CHOI Byeong doo (87) International Publication No :WO 2014/007590 2)KIM Jae hyun (61) Patent of Addition to Application 3)PARK Jeong hoon :NA Number :NA Filing Date (62) Divisional to Application Number :NA Filing Date :NA (57) Abstract : According to one embodiment proposed are a method and apparatus for multilayer video encoding and a method and apparatus for multilayer video decoding capable of achieving a novel multilayer video prediction structure. The present invention proposes a method which involves performing motion compensation and intra decoding for a basic layer stream to restore basic layer pictures restoring from an enhanced layer stream a homogeneous enhanced layer random access point (RAP) picture corresponding to the basic layer RAP picture which is randomly accessible from among the basic layer pictures and performing inter layer decoding using motion compensation and a basic layer picture for enhanced layer pictures including the restored enhanced layer RAP picture to restore the enhanced layer pictures. No. of Pages : 112 No. of Claims : 15 The Patent Office Journal 18/12/2015 66023 (12) PATENT APPLICATION PUBLICATION (21) Application No.179/MUMNP/2015 A (19) INDIA (22) Date of filing of Application :27/01/2015 (43) Publication Date : 18/12/2015 (54) Title of the invention : INTEGRALLY MOLDED MAGNETIC FLOWMETER (51) International classification :G01F1/58 (71)Name of Applicant : (31) Priority Document No :13/627446 1)ROSEMOUNT INC. (32) Priority Date :26/09/2012 Address of Applicant :8200 Market Boulevard Chanhassen (33) Name of priority country :U.S.A. MN 55317 U.S.A. U.S.A. (86) International Application No :PCT/US2013/058911 (72)Name of Inventor : Filing Date :10/09/2013 1)ROGERS Steven Bruce (87) International Publication No :WO 2014/051987 2)SMITH Joseph Alan (61) Patent of Addition to Application :NA Number :NA Filing Date (62) Divisional to Application Number :NA Filing Date :NA (57) Abstract : A magnetic flowmeter (102) for measuring flow rate of a process fluid includes a magnetic coil (222) arranged to apply a magnetic field to the process fluid. A pair of electrodes (224) are electronically coupled to the process fluid and arranged to sense a voltage induced in the process fluid related to the applied magnetic field and the flow rate of the process fluid. A molded flow tube (108) of a non conductive material is arranged to receive a flow of the process fluid. The flow tube (108) is molded around the magnetic coil and the pair of electrodes and is configured to support the magnetic coil and the pair of electrodes (224). Flow meter circuitry (240) is configured to apply a current to the magnetic coil (222) and receive the resultant voltage sensed by the pair of electrodes (224). No. of Pages : 19 No. of Claims : 25 The Patent Office Journal 18/12/2015 66024 (12) PATENT APPLICATION PUBLICATION (21) Application No.189/MUMNP/2015 A (19) INDIA (22) Date of filing of Application :27/01/2015 (43) Publication Date : 18/12/2015 (54) Title of the invention : CAP FOR SUBMERSIBLE PUMP (51) International classification :E21B33/04 (71)Name of Applicant : (31) Priority Document No :2012127091 1)YAZYKOV Andrey Yurievich (32) Priority Date :28/06/2012 Address of Applicant :Chobotovskay 5 ya alley 24 Moscow (33) Name of priority country :Russia 119619 Russia Russia (86) International Application No :PCT/RU2012/000718 (72)Name of Inventor : Filing Date :30/08/2012 1)YAZYKOV Andrey Yurievich (87) International Publication No :WO 2014/003601 (61) Patent of Addition to Application :NA Number :NA Filing Date (62) Divisional to Application Number :NA Filing Date :NA (57) Abstract : The cap for suspension of submersible pump with a pressure pipe and a cable comprises cover 2 with central axial hole 4 and with circular collar 10 implemented with conical inner surface 3 narrowing towards central hole 4 as well as clamping flange 5 with central hole 17 sealing rubber ring 6 of rubber cross section to be installed between conical surface 3 of collar 10 of cover 2 and flat side 18 of flange 5. Bolts 7 with nuts 8 are installed in coaxial holes 9 of cover 2 and 5 for fixation of ring 6 on the outer side of casing pipe 1 of the well. Central hole 17 of clamping flange 5 is made with diameter D1 smaller than mean diameter Dm of rubber ring 6 while smaller diameter D2 of conical surface 3 of collar 10 of cover 2 is made with diameter exceeding mean diameter Dm of rubber ring 6. Cover 2 and flange 5 may be made of metal; in other embodiments cover 2 and flange 5 are made of plastic with stiffening ribs. Cover 2 has collet clamp 11 for pressure pipe installed in its central axial hole 4. Cover 2 is provided with cable entries 12 upper eyebolts 13 as well as with lower eyebolt 14 suspended with clevis 16 for fastening of a rope for suspension of submersible pump (not shown). All eyebolts 13 and 14 are located in the same centerline plane in which the vertical axis of the cover and the flange lies. As a result increased reliability and durability is provided determined by elimination of a possibility for the edge of the flange hole to cut into the rubber ring owing to guaranteed displacement of the edge of the flange hole from the surface of the contact of the flange with the rubber ring. No. of Pages : 11 No. of Claims : 6 The Patent Office Journal 18/12/2015 66025 (12) PATENT APPLICATION PUBLICATION (21) Application No.172/MUMNP/2015 A (19) INDIA (22) Date of filing of Application :23/01/2015 (43) Publication Date : 18/12/2015 (54) Title of the invention : CONTENT SUPPLY DEVICE CONTENT SUPPLY METHOD PROGRAM TERMINAL DEVICE AND CONTENT SUPPLY SYSTEM (51) International (71)Name of Applicant : :H04N21/238,H04N21/235,H04N21/242 classification 1)SONY CORPORATION (31) Priority Document Address of Applicant :1 7 1 Konan Minato ku Tokyo 1080075 :2013119935 No Japan (32) Priority Date :06/06/2013 (72)Name of Inventor : (33) Name of priority 1)YAMAGISHI Yasuaki :Japan country (86) International :PCT/JP2014/063795 Application No :26/05/2014 Filing Date (87) International :WO 2014/196393 Publication No (61) Patent of Addition :NA to Application Number :NA Filing Date (62) Divisional to :NA Application Number :NA Filing Date (57) Abstract : The present disclosure relates to a content supply device a content supply method a program a terminal device and a content supply system which allow for achieving fast zapping between channels in DASH. A content supply device according to the present disclosure is a content supply device for supplying a plurality of pieces of streaming data having the same content but different attributes via the same channel and is provided with: a supply unit which divides each of the plurality of pieces of streaming data into the smallest units by which the reception of the plurality of pieces of streaming data is switched with timing common to other channels and then supplies the whole plurality of pieces of streaming data to a receiver via a network; and a metafile generation unit which generates a metafile used by the receiver to receive the plurality of pieces of streaming data which are supplied as a sequence of the aforementioned smallest units said metafile indicating that the plurality of pieces of streaming data are to be used for zapping. The present disclosure can be applied to systems for delivering content in a steaming manner. No. of Pages : 63 No. of Claims : 13 The Patent Office Journal 18/12/2015 66026 (12) PATENT APPLICATION PUBLICATION (21) Application No.182/MUMNP/2015 A (19) INDIA (22) Date of filing of Application :27/01/2015 (43) Publication Date : 18/12/2015 (54) Title of the invention : FUEL CELLS FOR USE AT ELEVATED TEMPERATURES AND PRESSURES (51) International classification :H01M8/18,C01G41/02,C11D3/39 (71)Name of Applicant : (31) Priority Document No :1211435.1 1)ACAL ENERGY LIMITED (32) Priority Date :27/06/2012 Address of Applicant :The Heath Business & Technical Park (33) Name of priority country :U.K. Runcorn Cheshire WA7 4QX U.K. U.K. (86) International Application (72)Name of Inventor : :PCT/GB2013/051675 No 1)KNUCKEY Kathryn Jane :25/06/2013 Filing Date 2)CREETH Andrew Martin (87) International Publication 3)BAYNES Nicholas de Brissac :WO 2014/001786 No 4)ROCHESTER David (61) Patent of Addition to 5)CLARKSON Brian :NA Application Number :NA Filing Date (62) Divisional to Application :NA Number :NA Filing Date (57) Abstract : This invention provides a redox fuel cell comprising an anode and a cathode separated by an ion selective polymer electrolyte membrane; means for supplying a fuel to the anode region of the cell; means for supplying an oxidant to the cathode region of the cell; means for providing an electrical circuit between the anode and the cathode; a non volatile catholyte solution flowing in fluid communication with the cathode the catholyte solution comprising a polyoxometallate redox couple being at least partially reduced at the cathode in operation of the cell and at least partially re generated by reaction with the oxidant after such reduction at the cathode the catholyte solution further comprising vanadium species that result from the speciation of the polyoxometallate at an elevated temperature and/or pressure. No. of Pages : 40 No. of Claims : 42 The Patent Office Journal 18/12/2015 66027 (12) PATENT APPLICATION PUBLICATION (21) Application No.1917/MUM/2014 A (19) INDIA (22) Date of filing of Application :13/06/2014 (43) Publication Date : 18/12/2015 (54) Title of the invention : ORAL CARE DEVICE (51) International classification :A46B 5/00 (71)Name of Applicant : (31) Priority Document No :NA 1)THAKKAR JATIN VASANT (32) Priority Date :NA Address of Applicant :L-3/4 Eden Hall, Dr. Annie Besant (33) Name of priority country :NA Road, Worli, Mumbai 400018, Maharashtra, India Maharashtra (86) International Application No :PCT// India Filing Date :01/01/1900 (72)Name of Inventor : (87) International Publication No : NA 1)THAKKAR JATIN VASANT (61) Patent of Addition to Application Number :NA Filing Date :NA (62) Divisional to Application Number :NA Filing Date :NA (57) Abstract : An oral care device is disclosed and has a toothbrush has an elongated handle with bristles attached to an end thereof. The elongated handle includes a first portion and a second portion detachably connected with the first portion. Each of the first portion and the second portion has cavity formed there-within. A resilient element is made of a resilient material and has a first edge disposed within cavity of the first portion and a second edge disposed within cavity of the second portion. The resilient element in an in-operative configuration is linearly disposed within the first portion and the second portion thereby defining operative configuration of the toothbrush and the resilient in an operative configuration has at least a portion forming an arc-shaped thereby defining an in-operative configuration of the toothbrush. Fig. 1d No. of Pages : 18 No. of Claims : 8 The Patent Office Journal 18/12/2015 66028 (12) PATENT APPLICATION PUBLICATION (21) Application No.183/MUMNP/2015 A (19) INDIA (22) Date of filing of Application :27/01/2015 (43) Publication Date : 18/12/2015 (54) Title of the invention : DOUBLE STRANDED OLIGONUCLEOTIDE MOLECULES TO P53 AND METHODS OF USE THEREOF (51) International classification :C12N15/113,A61K31/713 (71)Name of Applicant : (31) Priority Document No :61/699884 1)QUARK PHARMACEUTICALS INC. (32) Priority Date :12/09/2012 Address of Applicant :6501 Dumbarton Circle Fremont (33) Name of priority country :U.S.A. California 94555 U.S.A. U.S.A. (86) International Application No :PCT/US2013/059349 (72)Name of Inventor : Filing Date :12/09/2013 1)FEINSTEIN Elena (87) International Publication No :WO 2014/043292 2)AVKIN NACHUM Sharon (61) Patent of Addition to Application 3)KALINSKI Hagar :NA Number 4)METT Igor :NA Filing Date (62) Divisional to Application Number :NA Filing Date :NA (57) Abstract : The present application relates to nucleic acid compounds compositions comprising same and methods of use thereof for treatment of various diseases disorders and conditions. The compounds are preferably chemically synthesized and modified double stranded nucleic acid molecules which down regulate expression of a p53 gene. No. of Pages : 170 No. of Claims : 50 The Patent Office Journal 18/12/2015 66029 (12) PATENT APPLICATION PUBLICATION (21) Application No.1930/MUM/2014 A (19) INDIA (22) Date of filing of Application :13/06/2014 (43) Publication Date : 18/12/2015 (54) Title of the invention : A SYSTEM AND METHOD FOR DYNAMIC MONITORING & ALERTING (51) International classification :G06F15/16 (71)Name of Applicant : (31) Priority Document No :NA 1)Defence Institute of Advanced Technology, (Deemed (32) Priority Date :NA University) (33) Name of priority country :NA Address of Applicant :Girinagar, Pune 411025, Maharashtra, (86) International Application No :PCT// India Maharashtra India Filing Date :01/01/1900 (72)Name of Inventor : (87) International Publication No : NA 1)Arun Mishra (61) Patent of Addition to Application Number :NA 2)N. Viswanathan Filing Date :NA (62) Divisional to Application Number :NA Filing Date :NA (57) Abstract : An automatic system and method for dynamic monitoring and alerting content modifications, the system and the method thereof dynamically monitor web-server files with a daemon process for identifying changes through kernel feature. It utilizes a security mechanism based on at least one trusted hardware called a trusted platform module mounted on mother-board of web-server computer. The method Detects and reacts to Website Defacement attack by dynamic monitoring with usage of trusted platform module. No. of Pages : 30 No. of Claims : 10 The Patent Office Journal 18/12/2015 66030 (12) PATENT APPLICATION PUBLICATION (21) Application No.175/MUMNP/2015 A (19) INDIA (22) Date of filing of Application :23/01/2015 (43) Publication Date : 18/12/2015 (54) Title of the invention : VALVE CONTROL SYSTEMS FOR INTERNAL COMBUSTION ENGINES AND METHODS OF OPERATION THEREOF (51) International classification :F01L1/26,F01L13/00,F02D13/02 (71)Name of Applicant : (31) Priority Document No :1217095.7 1)CAMCON AUTO LIMITED (32) Priority Date :25/09/2012 Address of Applicant :St Johns Innovation Centre Cowley (33) Name of priority country :U.K. Road Cambridge Cambridgeshire CB4 0WS U.K. U.K. (86) International Application (72)Name of Inventor : :PCT/GB2013/052486 No 1)STONE Roger Derrick :23/09/2013 Filing Date 2)TYRRELL Richard James (87) International Publication :WO 2014/049339 No (61) Patent of Addition to :NA Application Number :NA Filing Date (62) Divisional to Application :NA Number :NA Filing Date (57) Abstract : A valve control system is provided for an internal combustion engine the engine having at least one cylinder with at least one set of at least two valves (12 17 14 19). All the valves in the set are either inlet valves or exhaust valves and the system is configured to selectively operate the set of valves in a single valve mode of operation during which only one valve of the set is open at any time. No. of Pages : 17 No. of Claims : 14 The Patent Office Journal 18/12/2015 66031 (12) PATENT APPLICATION PUBLICATION (21) Application No.176/MUMNP/2015 A (19) INDIA (22) Date of filing of Application :24/01/2015 (43) Publication Date : 18/12/2015 (54) Title of the invention : URINE COLLECTING AND ANALYZING APPARATUS (51) International classification :A61B10/00,B01L3/00 (71)Name of Applicant : (31) Priority Document No :2012/07505 1)OLGUN Abdullah (32) Priority Date :27/06/2012 Address of Applicant :Akdeniz niversitesi Teknokent ARGE 1 (33) Name of priority country :Turkey Binasi Kat 2 No. 1Kampus Antalya Turkey Turkey (86) International Application No :PCT/IB2013/055212 (72)Name of Inventor : Filing Date :25/06/2013 1)OLGUN Abdullah (87) International Publication No :WO 2014/002010 (61) Patent of Addition to Application :NA Number :NA Filing Date (62) Divisional to Application Number :NA Filing Date :NA (57) Abstract : According to the present invention every function of a urine collection container urine centrifugal tube and pipette (Pasteur pipette or automatic pipette tip) used traditionally for urine analysis are realized in the most ergonomic manner under a single product and standardization according to scientific criteria of such stages of the microscopic analysis process of urine up till inspection under the microscope. No. of Pages : 19 No. of Claims : 26 The Patent Office Journal 18/12/2015 66032 (12) PATENT APPLICATION PUBLICATION (21) Application No.1954/MUM/2014 A (19) INDIA (22) Date of filing of Application :17/06/2014 (43) Publication Date : 18/12/2015 (54) Title of the invention : A PROCESS FOR THE SYNTHESIS OF COPPER (II) TETRAFLUOROBORATE SCHIFF'S BASE COMPLEX USING 4-BROMO-(2-CARBOXYPHENYL)-PYRIDINE-2-YL ETHYLENE AMINE AND 1,10-PHENANTHROLINE AS LIGAND AND ITS ANTIBREAST CANCER ACTIVITY. (51) International classification :C07F 1/08, C07F 5/00 :NA :NA :NA :NA :NA : NA :NA :NA :NA :NA (71)Name of Applicant : 1)DR. S. V. RATHOD Address of Applicant :CHEMISTRY RESEARCH LABORATORY, BHAVAN'S H. SOMANI COLLEGE, CHOWPATTY, MUMBAI-400007, MAHARASHTRA, INDIA. Maharashtra India (72)Name of Inventor : 1)DR. S. V. RATHOD 2)SMT. SMITA S. GIRI (31) Priority Document No (32) Priority Date (33) Name of priority country (86) International Application No Filing Date (87) International Publication No (61) Patent of Addition to Application Number Filing Date (62) Divisional to Application Number Filing Date (57) Abstract : A process for the Synthesis of copper (II) tetrafluoroborate Schiff s base complex using 4-Bromo-(2-carboxyphenyl)-pyridine-2-y! ethylene amine and 1,10-Phenanthroline as ligands and its antibreast cancer activity No. of Pages : 8 No. of Claims : 3 The Patent Office Journal 18/12/2015 66033 (12) PATENT APPLICATION PUBLICATION (21) Application No.1955/MUM/2014 A (19) INDIA (22) Date of filing of Application :17/06/2014 (43) Publication Date : 18/12/2015 (54) Title of the invention : A PROCESS FOR THE SYNTHSIS OF COPPER (II) TETRAFLUOROBORATE SCHIFF'S BASE COMPLEX OF 4-NITRO-(2-CARBOXYPHENYL)-PYRIDINE-2-YL ETHYLENE AMINE AND OF 1,10-PHENANTHROLINE AS LIGANDS AND ITS ANTIBREAST CANCER ACTIVITY. (51) International classification :C07F 1/08, C07F 5/00 :NA :NA :NA :NA :NA : NA :NA :NA :NA :NA (71)Name of Applicant : 1)DR. S. V. RATHOD Address of Applicant :CHEMISTRY RESEARCH LABORATORY, BHAVAN'S H. SOMANI COLLEGE, CHOWPATTY, MUMBAI-400007, MAHARASHTRA, INDIA. Maharashtra India (72)Name of Inventor : 1)DR. S. V. RATHOD 2)SMT. SMITA S. GIRI (31) Priority Document No (32) Priority Date (33) Name of priority country (86) International Application No Filing Date (87) International Publication No (61) Patent of Addition to Application Number Filing Date (62) Divisional to Application Number Filing Date (57) Abstract : A process for the Synthesis of copper(II) tetrafluoroborate Schiffs base complex using 4-Nitro-(2-carboxyphenyl)-pyridine-2-y] ethylene amine and of 1,10-Phenanthroline as ligands and its antibreast cancer activity. No. of Pages : 8 No. of Claims : 3 The Patent Office Journal 18/12/2015 66034 (12) PATENT APPLICATION PUBLICATION (21) Application No.245/MUM/2015 A (19) INDIA (22) Date of filing of Application :23/01/2015 (43) Publication Date : 18/12/2015 (54) Title of the invention : IGNITION SWITCH (51) International classification (31) Priority Document No :B60R25/04, F02N11/00 :2014017786 :31/01/2014 :Japan :PCT// :01/01/1900 : NA :NA :NA :NA :NA (71)Name of Applicant : 1)KABUSHIKI KAISHA TOKAI RIKA DENKI SEISAKUSHO Address of Applicant :260, Toyota 3-chome, Ohguchi-cho, Niwa-gun, Aichi 480-0195, Japan. Japan (72)Name of Inventor : 1)TSURUTA, Hiroshi 2)MIZUSHIMA, Hiroki (32) Priority Date (33) Name of priority country (86) International Application No Filing Date (87) International Publication No (61) Patent of Addition to Application Number Filing Date (62) Divisional to Application Number Filing Date (57) Abstract : An ignition switch includes a rotor into which a vehicle key can be inserted, a switch body rotationally accommodating the rotor, anda key interlock mechanism integrally coupled to the switch body. The key interlock mechanism prevents removal of the vehicle key when the vehicle is traveling. No. of Pages : 38 No. of Claims : 10 The Patent Office Journal 18/12/2015 66035 (12) PATENT APPLICATION PUBLICATION (21) Application No.168/MUMNP/2015 A (19) INDIA (22) Date of filing of Application :23/01/2015 (43) Publication Date : 18/12/2015 (54) Title of the invention : BIOSENSOR COMPRISING METAL NANOPARTICLES (71)Name of Applicant : 1)UNIVERSIDAD DE ZARAGOZA (51) International classification :G01N33/543,G01N21/55 Address of Applicant :Campus plaza San Francisco Edificio (31) Priority Document No :P201231209 interfacultades C/ Pedro Cerbuna 12 E 50009 Zaragoza Spain (32) Priority Date :26/07/2012 2)FUNDACIN AGENCIA ARAGONESA PARA LA (33) Name of priority country :Spain INVESTIGACIN Y EL DESARROLLO (86) International Application No :PCT/ES2013/070549 3)CONSEJO SUPERIOR DE INVESTIGACIONES Filing Date :26/07/2013 CIENT•FICAS (87) International Publication No :WO 2014/016465 (72)Name of Inventor : (61) Patent of Addition to Application :NA 1)DEL PINO GONZ•LEZ DE LA HIGUERA Pablo Number :NA 2)PELAZ GARCIA Beatriz Filing Date 3)POLO TOBAJAS Ester (62) Divisional to Application Number :NA 4)GRAZš BONAV•A Valeria Filing Date :NA 5)MART•NEZ DE LA FUENTE Jesºs 6)PARRO GARCIA Victor (57) Abstract : The present invention discloses a biosensor for visual detection of an analyte based on the light to heat conversion properties of metal nanoparticles: the analyte is visually detected by the colour change in the support areas (where the analyte is present) produced as a result of the heat generated by the metal nanoparticles where they are irradiated with an external light source. Use of said biosensor in a method for the detection of analytes is also claimed. No. of Pages : 45 No. of Claims : 18 The Patent Office Journal 18/12/2015 66036 (12) PATENT APPLICATION PUBLICATION (21) Application No.178/MUMNP/2015 A (19) INDIA (22) Date of filing of Application :27/01/2015 (43) Publication Date : 18/12/2015 (54) Title of the invention : METHOD OF CONTROLLING SCAN SPEED OF SCANNER INCLUDING AUTOMATIC DOCUMENT FEEDER AND SCANNER PERFORMING THE SAME (51) International classification :H04N1/00 (71)Name of Applicant : (31) Priority Document No :61/714788 1)SAMSUNG ELECTRONICS CO. LTD. (32) Priority Date :17/10/2012 Address of Applicant :129 Samsung ro Yeongtong gu Suwon (33) Name of priority country :U.S.A. si Gyeonggi do 443 742 Republic of Korea Republic of Korea (86) International Application No :PCT/KR2013/009173 (72)Name of Inventor : Filing Date :15/10/2013 1)SUNG Byung jun (87) International Publication No :WO 2014/061953 (61) Patent of Addition to Application :NA Number :NA Filing Date (62) Divisional to Application Number :NA Filing Date :NA (57) Abstract : A scanner including an automatic document feeder includes a communication interface unit to perform a communication with an external printer; a scan operation performing unit to perform a scan operation; an automatic feeding unit to automatically feed scan target documents to the scan operation performing unit; and a controller to control the scan operation and a scan speed wherein when the communication interface unit receives a request speed for a scan operation from the external printer the controller adjusts a feeding interval between the scan target documents that are fed from the automatic feeding unit so that the scan operation is performed at the received request speed. No. of Pages : 23 No. of Claims : 15 The Patent Office Journal 18/12/2015 66037 (12) PATENT APPLICATION PUBLICATION (21) Application No.1950/MUM/2014 A (19) INDIA (22) Date of filing of Application :17/06/2014 (43) Publication Date : 18/12/2015 (54) Title of the invention : UNDERWATER DEVICE (51) International classification :A63B35/00, A63B35/12 (71)Name of Applicant : (31) Priority Document No :NA 1)YOGESH SINGH (32) Priority Date :NA Address of Applicant :EWS-194, NEW SUBHASH NAGAR, (33) Name of priority country :NA BHOPAL-462023, MADHYA PRADESH, INDIA Madhya (86) International Application No :NA Pradesh India Filing Date :NA (72)Name of Inventor : (87) International Publication No : NA 1)YOGESH SINGH (61) Patent of Addition to Application :NA Number :NA Filing Date (62) Divisional to Application Number :NA Filing Date :NA (57) Abstract : An under device capable of performing operations at the surface and under water through remote control access. The pair of wings are provided at either side of the underwater device. The movement of pair of wings creates gap between themselves and the said gap exerts force that drives the underwater device. An arrangement of pistons at the centre body of the underwater device facilitates balanced wings movement. The said device is capable of forward and backward movement. No. of Pages : 14 No. of Claims : 8 The Patent Office Journal 18/12/2015 66038 (12) PATENT APPLICATION PUBLICATION (21) Application No.1951/MUM/2014 A (19) INDIA (22) Date of filing of Application :17/06/2014 (43) Publication Date : 18/12/2015 (54) Title of the invention : NOVEL CELL SECRETOMES FOR WOUND HEALING (51) International classification :A61F (71)Name of Applicant : 2/00, 1)Indian Institute of Technology, Bombay A61F Address of Applicant :Powai, Mumbai 400 076 Maharashtra 13/00 India :NA (72)Name of Inventor : :NA 1)Prof. Jayesh Bellare :NA 2)Hemlata Chhabra :NA 3)Amit Kumar Jaiswal :NA 4)Dr. Vaijayanti Kale : NA 5)Dr. Meghana Kanitkar :NA 6)Richa Shukla :NA :NA :NA (31) Priority Document No (32) Priority Date (33) Name of priority country (86) International Application No Filing Date (87) International Publication No (61) Patent of Addition to Application Number Filing Date (62) Divisional to Application Number Filing Date (57) Abstract : The present invention relates to novel cell secretome protein compositions and a method of manufacturing the same as a one-step combined harvest and delivery system• for direct bandage style or salve style application onto wounds. In particular, the present invention relates to cell secretomes derived from Electrospun Nano-fiber Scaffold (ENS)-grown-Bone Marrow Progenitor Cells/ Bone Marrow and Peripheral Blood derived Cells (BMPCs) system. No. of Pages : 26 No. of Claims : 10 The Patent Office Journal 18/12/2015 66039 (12) PATENT APPLICATION PUBLICATION (21) Application No.1952/MUM/2014 A (19) INDIA (22) Date of filing of Application :17/06/2014 (43) Publication Date : 18/12/2015 (54) Title of the invention : DIESEL GENERATOR FOOTPRINT REDUCTION THROUGH INNOVATIVE DRIVE AND ALTERNATOR ARRANGEMENT (51) International classification :F02B 3/00, F02B 67/00 :NA :NA :NA :NA :NA : NA :NA :NA :NA :NA (71)Name of Applicant : 1)MAHINDRA & MAHINDRA LTD. Address of Applicant :AUTOMOTIVE & FARM EQUIPMENT SECTOR, MAHINDRA TOWERS, DR. G. M. BHOSALE MARG, WORLI, MUMBAI - 400018, MAHARASHTRA, INDIA. Maharashtra India (72)Name of Inventor : 1)TANMAY S. DESHPANDE 2)RAUT PARAG 3)KRISHNAMOORTHY R. (31) Priority Document No (32) Priority Date (33) Name of priority country (86) International Application No Filing Date (87) International Publication No (61) Patent of Addition to Application Number Filing Date (62) Divisional to Application Number Filing Date (57) Abstract : A diesel generator set providing footprint reduction through innovative drive and alternator, comprising a diesel engine; an alternator mounted above engine on an alternator chassis; shaft axis of the alternator disposed parallel to shaft axis of diesel engine; a power transmission means for operatively connecting diesel engine to alternator; fresh-air inflow and hot-air exhaust arrangement including inlet louvers on either side at flywheel end of the DG set, inlet louvers connected to suction ducts leading to alternator for effective cooling and hot-air exhaust ports thereof leading to engine chamber for mixing with fresh air coming into engine chamber for effective cooling of the diesel generator set; canopy structure completely enclosing the diesel generator set and a silencer, mounted on a base frame and the canopy structure provided with anti-vibration mounts arranged between the chassis and the base frame; and an arrangement for protecting this DG set from rain water. No. of Pages : 27 No. of Claims : 10 The Patent Office Journal 18/12/2015 66040 (12) PATENT APPLICATION PUBLICATION (21) Application No.186/MUMNP/2015 A (19) INDIA (22) Date of filing of Application :27/01/2015 (43) Publication Date : 18/12/2015 (54) Title of the invention : ALKYLENE EPOXIDATION WITH MESOPOROUS CATALYSTS (51) International classification :B01J23/30 (71)Name of Applicant : (31) Priority Document No :61/690475 1)UNIVERSITY OF KANSAS (32) Priority Date :27/06/2012 Address of Applicant :2385 Irving Hill Road Lawrence KS (33) Name of priority country :U.S.A. 66045 U.S.A. U.S.A. (86) International Application No :PCT/US2013/048077 (72)Name of Inventor : Filing Date :27/06/2013 1)SUBRAMANIAM Bala (87) International Publication No :WO 2014/004768 2)RAMANATHAN Anand (61) Patent of Addition to Application 3)GHANTA Madhav :NA Number 4)YAN Wenjuan :NA Filing Date (62) Divisional to Application Number :NA Filing Date :NA (57) Abstract : A process for epoxidizing an olefin comprising contacting an olefin with an oxidant in the presence of an insoluble oxidation catalyst in a solvent system comprising an organic water miscible solvent to form an alkylene oxide. The insoluble oxidation catalyst comprises a metal preferably selected from the group consisting of tungsten cerium and niobium. The metal is directly incorporated within a solid mesoporous silicate support such as one selected from the group consisting of KIT 5 KIT 6 and TUD 1. No. of Pages : 59 No. of Claims : 31 The Patent Office Journal 18/12/2015 66041 (12) PATENT APPLICATION PUBLICATION (21) Application No.1956/MUM/2014 A (19) INDIA (22) Date of filing of Application :17/06/2014 (43) Publication Date : 18/12/2015 (54) Title of the invention : A PROCESS FOR THE SYNTHESIS OF ZNIC (II) TETRA FLUORO BORATE SCHIFF'S BASE COMPLEX USING 4-BROMO-(2-CARBOXYPHENYL)-PYRIDINE-2-YL ETHYLENE AMINE AND 1,10-PHENANTHROLINE AS LIGANDS AND ITS ANTIBREAST CANCER ACTIVITY. (51) International classification :C07F 3/00, C07F 5/00 :NA :NA :NA :NA :NA : NA :NA :NA :NA :NA (71)Name of Applicant : 1)DR. S. V. RATHOD Address of Applicant :CHEMISTRY RESEARCH LABORATORY, BHAVAN'S H. SOMANI COLLEGE, CHOWPATTY, MUMBAI-400007, MAHARASHTRA, INDIA. Maharashtra India (72)Name of Inventor : 1)DR. S. V. RATHOD 2)SMT. SMITA S. GIRI (31) Priority Document No (32) Priority Date (33) Name of priority country (86) International Application No Filing Date (87) International Publication No (61) Patent of Addition to Application Number Filing Date (62) Divisional to Application Number Filing Date (57) Abstract : A process for the Synthesis of Zn (II) tetrafluoroborate Schiffs base complex using 4-Bromo-(2-carboxyphenyl)-pyridine-2-yl ethylene amine and 1,10-Phenanthroline as ligands and its antibreast cancer activity No. of Pages : 8 No. of Claims : 3 The Patent Office Journal 18/12/2015 66042 (12) PATENT APPLICATION PUBLICATION (21) Application No.1957/MUM/2014 A (19) INDIA (22) Date of filing of Application :17/06/2014 (43) Publication Date : 18/12/2015 (54) Title of the invention : MATERIAL FOR CONSTRUCTION INDUSTRY (51) International classification :C04B (71)Name of Applicant : 28/00, 1)COLLEGE OF ENGINEERING, PUNE (COEP) C04B32/00, Address of Applicant :Wellesly Road, Shivaji Nagar, PuneC04B18/06, 411005, Maharashtra, India Maharashtra India :NA (72)Name of Inventor : :NA 1)CHARTHAL JAYESH SURESH :NA 2)CHANDARANA SAURABH YOGESH :NA 3)MUNOT HEMA KISHOR :NA : NA :NA :NA :NA :NA (31) Priority Document No (32) Priority Date (33) Name of priority country (86) International Application No Filing Date (87) International Publication No (61) Patent of Addition to Application Number Filing Date (62) Divisional to Application Number Filing Date (57) Abstract : The present disclosure relates to a process for the preparation of geopolymer-composite articles. The process includes dry mixing a pre-determined amount of at least one aluminosilicate material and foundry sand to obtain a dry mixture; preparing an activating solution by admixing alkali solution(s) with alkali silicate solution(s) in a ratio ranging from 1: 1.5 to 1: 2; admixing the activating solution and the dry mixture to effect a geopolymerization reaction and obtain a slurry comprising a geopolymer; adding waste paper sludge into the slurry to obtain a pliable geopolymer matrix; molding the matrix followed by the step of curing to obtain the geopolymer-composite article. The pre-determined amount of the aluminosilicate material is determined on the basis of the reactivity of the activating agent with the aluminosilicate material by using Avogadro™s number, molarity of the alkali solution and impurities and losses during weighing and admixing of the aluminosilicate material. No. of Pages : 48 No. of Claims : 24 The Patent Office Journal 18/12/2015 66043 (12) PATENT APPLICATION PUBLICATION (21) Application No.188/MUMNP/2015 A (19) INDIA (22) Date of filing of Application :27/01/2015 (43) Publication Date : 18/12/2015 (54) Title of the invention : RECLOSING MECHANISM FOR CONTAINERS PARTICULARLY BEVERAGE CONTAINERS (51) International classification :B65D17/50 (71)Name of Applicant : (31) Priority Document No :P.399690 1)STRZELCZYK Mieczyslaw (32) Priority Date :27/06/2012 Address of Applicant :ul. Belgijska 1 64 100 Leszno Poland (33) Name of priority country :Poland Poland (86) International Application No :PCT/PL2013/000084 (72)Name of Inventor : Filing Date :24/06/2013 1)STRZELCZYK Mieczyslaw (87) International Publication No :WO 2014/003586 (61) Patent of Addition to Application :NA Number :NA Filing Date (62) Divisional to Application Number :NA Filing Date :NA (57) Abstract : The reclosing mechanism for containers particularly beverage containers has the latch (3) fitted slidingly in the opening (5). Formed on the top side of the latch (3) there is an attachment (14) shorter than the opening (5) and narrower than the latch (3) where the attachment (14) is fitted with a pull tab (4) longer than the attachment (14) and fixed to the attachment (14) with a hinge (6) and a connector (7) which serves as the seal before the first opening. Formed on the opposite longitudinal sides of the attachment (14) there are catches (8) fitted slidingly on the guides (13) formed on the longer side walls of the opening (5). On the top surface of the element in which the opening (5) is made there are protrusions (10) formed on the side of the pull tab (4) front on which the pull tab (4) rests and blocks the sliding of the latch (3) in the closed position. No. of Pages : 20 No. of Claims : 9 The Patent Office Journal 18/12/2015 66044 (12) PATENT APPLICATION PUBLICATION (21) Application No.2368/MUM/2014 A (19) INDIA (22) Date of filing of Application :22/07/2014 (43) Publication Date : 18/12/2015 (54) Title of the invention : WIRELESS COMMUNICATION DEVICES AND METHODS FOR PERFORMING A PACKETSWITCHED (PS) SERVICE APPLIED TO A MOBILE COMMUNICATIONS DEVICE WITH MULTIPLE SUBSCRIBER IDENTITY MODULES (SIMS) (51) International classification :H04W60/00 (71)Name of Applicant : (31) Priority Document No :14/304,081 1)MediaTek Inc. (32) Priority Date :13/06/2014 Address of Applicant :No. 1, Dusing Rd. 1st, Science-Based (33) Name of priority country :U.S.A. Industrial Park, Hsin-Chu 300, Taiwan, R.O.C. Taiwan (86) International Application No :NA (72)Name of Inventor : Filing Date :NA 1)Yi-Ting CHENG (87) International Publication No : NA 2)Peng-An CHEN (61) Patent of Addition to Application Number :NA Filing Date :NA (62) Divisional to Application Number :NA Filing Date :NA (57) Abstract : A wireless communication method for performing a packet-switched (PS) data service in a mobile communications device with a plurality of subscriber identity modules (SIM) is provided. A PS service is first performed with a first subscriber identity module. During performing the PS service with the first subscriber identity module, it is then determined packet loss status regarding whether a packet in the downlink transmission have been successfully received. A frequency for receiving signals on control channel or circuitswitched channel associated with the first subscriber identity module or signals on control channel or circuit-switched channel or packet-switched channel associated with a second subscriber identity module is adaptively adjusted according to the determination result while performing the PS service with the first subscriber identity module. No. of Pages : 28 No. of Claims : 14 The Patent Office Journal 18/12/2015 66045 (12) PATENT APPLICATION PUBLICATION (21) Application No.1906/MUM/2014 A (19) INDIA (22) Date of filing of Application :11/06/2014 (43) Publication Date : 18/12/2015 (54) Title of the invention : USER INTERFACE DESIGNING (51) International classification :G06F3/00, G06F9/06 (71)Name of Applicant : (31) Priority Document No :NA 1)TATA CONSULTANCY SERVICES LIMITED (32) Priority Date :NA Address of Applicant :Nirmal Building, 9th Floor, Nariman (33) Name of priority country :NA Point, Mumbai, Maharashtra 400021 Maharashtra India (86) International Application No :PCT// (72)Name of Inventor : Filing Date :01/01/1900 1)SARANGDHAR, Aniket Mohan (87) International Publication No : NA 2)SAKHARDANDE, Prachi (61) Patent of Addition to Application 3)THANAWALA, Rajiv :NA Number :NA Filing Date (62) Divisional to Application Number :NA Filing Date :NA (57) Abstract : A method for designing a user interface (UI) for an application includes receiving, from a user, a first response comprising user selected first answers and a second response comprising user selected second answers, to pre-defined questions. The method includes assigning significance to interface (STI) weightage to each user selected first answer with respect to pre-defined user experience parameters and assigning a significance to business (STB) weightage to each user selected second answer. Also, the method includes computing total actual effective weightage for each pre-defined user experience parameter based on STI weightages of user selected first answers and STB weightages of user selected second answers. The method further includes calculating total maximum effective weightage for each pre-defined user experience parameter based on maximum STI weightage and maximum STB weightage for each pre-defined question. Furthermore, the method includes determining applicability index for each pre-defined user experience parameter for designing the UI. No. of Pages : 37 No. of Claims : 15 The Patent Office Journal 18/12/2015 66046 (12) PATENT APPLICATION PUBLICATION (21) Application No.185/MUMNP/2015 A (19) INDIA (22) Date of filing of Application :27/01/2015 (43) Publication Date : 18/12/2015 (54) Title of the invention : COMBINATION REINFORCING COUPLER AND COLUMN ALIGNMENT DEVICE (51) International classification :E04C5/16 (71)Name of Applicant : (31) Priority Document No :2012902731 1)M3S HOLDINGS PTY LTD (32) Priority Date :27/06/2012 Address of Applicant :c/o : Suite 1 10 Benson Street Toowong (33) Name of priority country :Australia Brisbane Queensland 4066 Australia Australia (86) International Application No :PCT/AU2013/000694 (72)Name of Inventor : Filing Date :26/06/2013 1)PROWSE Steven (87) International Publication No :WO 2014/000038 (61) Patent of Addition to Application :NA Number :NA Filing Date (62) Divisional to Application Number :NA Filing Date :NA (57) Abstract : An apparatus for aligning and joining construction elements comprising threaded studs or bars protruding from opposing elements; interlocking members adapted to screw together associated with each of the opposed studs; an adjustment nut screwable on one of the studs wherein the adjustment nut is screw jacked against one of the interlocking members to align the elements and then locked and encapsulated by screwing together the interlocking members. There can be additional stud or bar alignment means associated with the apparatus. No. of Pages : 21 No. of Claims : 15 The Patent Office Journal 18/12/2015 66047 (12) PATENT APPLICATION PUBLICATION (21) Application No.1944/MUM/2014 A (19) INDIA (22) Date of filing of Application :16/06/2014 (43) Publication Date : 18/12/2015 (54) Title of the invention : SENSOR DATA ANALYSIS-BASED ACTIVITY IDENTIFICATION (51) International classification :G06F 3/00, (71)Name of Applicant : G06F 17/00 1)TATA CONSULTANCY SERVICES LIMITED :NA Address of Applicant :Nirmal Building, 9th Floor, Nariman :NA Point, Mumbai, Maharashtra 400021 Maharashtra India :NA (72)Name of Inventor : :PCT// 1)CHATTOPADHYAY, Tanushyam :01/01/1900 2)MUKHERJEE, Dipti Prasad : NA 3)BATABYAL, Tamal :NA :NA :NA :NA (31) Priority Document No (32) Priority Date (33) Name of priority country (86) International Application No Filing Date (87) International Publication No (61) Patent of Addition to Application Number Filing Date (62) Divisional to Application Number Filing Date (57) Abstract : A method for identification of an activity performed by a subject based on sensor data analysis is described herein. In an implementation, the method includes capturing movements of the subject in real-time using a sensing device (126). At least one action associated with the subject is ascertained from a predefined set of actions. From the predefined set of actions, a plurality of actions can collectively form at least one activity. The ascertaining is based on captured movements of the subject and at least one predefined action rule. The at least one action rule is based on context-free grammar (CFG) and is indicative of a sequence of actions for occurrence of the at least one activity. Further, a current activity performed by the subject is dynamically determined, based on the at least one action and an immediately preceding activity, using a non-deterministic push-down automata (NPDA) state machine. No. of Pages : 37 No. of Claims : 20 The Patent Office Journal 18/12/2015 66048 (12) PATENT APPLICATION PUBLICATION (21) Application No.2042/MUM/2014 A (19) INDIA (22) Date of filing of Application :17/06/2014 (43) Publication Date : 18/12/2015 (54) Title of the invention : Extended Release pharmaceutical composition (51) International classification :A61K9/00 (71)Name of Applicant : (31) Priority Document No :NA 1)Intas Pharmaceuticals Ltd. (32) Priority Date :NA Address of Applicant :Intas Pharmaceuticals Ltd. 2nd Floor, (33) Name of priority country :NA Chinubhai Centre, Ashram Road, Ahmedabad 380009 Gujarat (86) International Application No :PCT// India Filing Date :01/01/1900 (72)Name of Inventor : (87) International Publication No : NA 1)Mayank Saxena (61) Patent of Addition to Application Number :NA 2)Piyush Kansagra Filing Date :NA 3)Balvir Singh (62) Divisional to Application Number :NA 4)Ashish Sehgal Filing Date :NA (57) Abstract : This present invention relates to extended release pharmaceutical composition of highly soluble active pharmaceutical substances comprising a drug matrix core containing the said active substance and non-swelling pH independent release retardant, and the said drug matrix core further comprises a functional coat, with the proviso that the said drug matrix core does not comprise water soluble fillers. No. of Pages : 22 No. of Claims : 10 The Patent Office Journal 18/12/2015 66049 (12) PATENT APPLICATION PUBLICATION (21) Application No.187/MUMNP/2015 A (19) INDIA (22) Date of filing of Application :27/01/2015 (43) Publication Date : 18/12/2015 (54) Title of the invention : METHOD FOR PRODUCING STABILIZED AMORPHOUS CALCIUM CARBONATE (51) International classification :C01F11/18 (71)Name of Applicant : (31) Priority Document No :61/680322 1)AMORPHICAL LTD. (32) Priority Date :07/08/2012 Address of Applicant :P.O. Box: 15021 84210 Beer Sheva (33) Name of priority country :U.S.A. Israel Israel (86) International Application No :PCT/IL2013/050670 (72)Name of Inventor : Filing Date :07/08/2013 1)MEIRON Oren (87) International Publication No :WO 2014/024191 2)ASHKENAZI Binyamin (61) Patent of Addition to Application :NA Number :NA Filing Date (62) Divisional to Application Number :NA Filing Date :NA (57) Abstract : Provided is a method for preparing a stable amorphous calcium carbonate (ACC) which can be obtained either in suspension or as a powder. The method comprises stepwise combination of a soluble calcium salt a soluble carbonate a first and second stabilizer and a water miscible organic solvent as described herein. The present invention further relates to stable ACC suspensions and dry powders produced by the method of the present invention. No. of Pages : 39 No. of Claims : 49 The Patent Office Journal 18/12/2015 66050 (12) PATENT APPLICATION PUBLICATION (21) Application No.1926/MUM/2014 A (19) INDIA (22) Date of filing of Application :13/06/2014 (43) Publication Date : 18/12/2015 (54) Title of the invention : ELECTROPARACETAMOL CRYSTALS GENERATED OUT OF VARYING DURATION OF EXPOSURE OF ELECTRIC FIELD (51) International classification :A61K 47/00, G03F 7/00 :NA :NA :NA :NA :NA : NA :NA :NA :NA :NA (71)Name of Applicant : 1)MR. MAHESH MISHRA Address of Applicant :PLOT NO: 61, DOYE LAYOUT, ZINGABAI TAKLI, NAGPUR, 440030 (MAHARASHTRA) Maharashtra India (72)Name of Inventor : 1)MR. MAHESH MISHRA 2)DR. AVINAS DORLE 3)DR.P.R.P. VERMA 4)MR. CHIRAG PATEL 5)MR. JAGDISH NIKOSE 6)MR. PRANAY BAGDE (31) Priority Document No (32) Priority Date (33) Name of priority country (86) International Application No Filing Date (87) International Publication No (61) Patent of Addition to Application Number Filing Date (62) Divisional to Application Number Filing Date (57) Abstract : The present invention pertains to pharma substance. The drug is often prescribed and also used as a part of self-medication. The inventors had been curious to see the effect of electric field on such substance so as to examine as to what kind of influence is caused on such substance and whether its efficacy is improved and reduced . Surprisingly it had resulted in to creation of electroparacetmol with outstanding efficacy in relation to pharmaceutical utility as compared to existing paracetamol. The electroparacetamol came to be prepared with the aid of a novel electro crystallizer. For this purpose the paracetamol sample was first converted in to a saturated solution and thereafter in to a supersaturated solution by heating the same up to 70 °C. After the process (given in detail earlier) electroparacetamol were obtained. Its analysis in the light of standard norms (flow ability, solubility, Raman spectrometry, etc.) proved it to be having unexpected enhanced pharmaceutical properties. No. of Pages : 29 No. of Claims : 14 The Patent Office Journal 18/12/2015 66051 (12) PATENT APPLICATION PUBLICATION (21) Application No.517/MUM/2014 A (19) INDIA (22) Date of filing of Application :14/02/2014 (43) Publication Date : 18/12/2015 (54) Title of the invention : A NOVEL ELECTRO CRYSTALLIZER (51) International classification :G01N25/14, B01L3/06, C40B40/10 :NA :NA :NA :NA :NA : NA :NA :NA :NA :NA (71)Name of Applicant : 1)MAHESH MISHRA Address of Applicant :PLOT NO: 61, DOYE LAY OUT, ZINGABAI TAKLI, NAGPUR-440030 (MAHARASHTRA) Maharashtra India (72)Name of Inventor : 1)MAHESH MISHRA 2)DR. AVINAS K DORLE 3)DR.P.R.P. VERMA (31) Priority Document No (32) Priority Date (33) Name of priority country (86) International Application No Filing Date (87) International Publication No (61) Patent of Addition to Application Number Filing Date (62) Divisional to Application Number Filing Date (57) Abstract : As the traditional crystallizer had not been satisfying the desired requirement i.e. as to what would happen if the varying electric current of desired strength passes through a substance keeping the other parameters viz. duration of exposure, potential differences , distance between the electrodes, types of current (AC/DC) and electrodes(siIver and gold) constant and vice versa. The objective was to see as to whether it affects further the basic characters of a substance. The curiosity compelled us here in to design a special type of electro crystallizer, which ultimately resulted in to innovation of a novel electro crystallizer. It have the facility varying either of duration of exposure, potential difference applied , current flow, distance between the electrodes, type of electrodes(Silver/gold) and type of electrical field (AC/DC) at a time and keeping the remaining constant. The electro crystallizer was validated for the said facility and the instrument found reliable. No. of Pages : 16 No. of Claims : 11 The Patent Office Journal 18/12/2015 66052 (12) PATENT APPLICATION PUBLICATION (21) Application No.169/MUMNP/2015 A (19) INDIA (22) Date of filing of Application :23/01/2015 (43) Publication Date : 18/12/2015 (54) Title of the invention : COVERAGE ENHANCEMENT TECHNIQUES FOR MACHINE TYPE COMMUNICATION DEVICES IN A WIRELESS NETWORK (51) International classification :H04W72/12,H04W72/04 (71)Name of Applicant : (31) Priority Document No :61/700240 1)QUALCOMM INCORPORATED (32) Priority Date :12/09/2012 Address of Applicant :ATTN: International IP Administration (33) Name of priority country :U.S.A. 5775 Morehouse Drive San Diego California 92121 1714 U.S.A. (86) International Application No :PCT/US2013/058776 (72)Name of Inventor : Filing Date :09/09/2013 1)XU Hao (87) International Publication No :WO 2014/043034 2)JI Tingfang (61) Patent of Addition to Application 3)GAAL Peter :NA Number 4)MALLADI Durga Prasad :NA Filing Date 5)CHEN Wanshi (62) Divisional to Application Number :NA 6)WEI Yongbin Filing Date :NA 7)SOMASUNDARAM Kiran (57) Abstract : Certain aspects provide a method for wireless communications by a first access point comprising determining a first schedule of intervals for the first access point to communicate with a first group of one or more wireless devices wherein intervals of the first schedule are synchronized with wake up or transmission cycles of the first group of one or more wireless devices and communicating with the first group of one or more wireless devices according to the first schedule. No. of Pages : 40 No. of Claims : 69 The Patent Office Journal 18/12/2015 66053 (12) PATENT APPLICATION PUBLICATION (21) Application No.167/MUMNP/2015 A (19) INDIA (22) Date of filing of Application :22/01/2015 (43) Publication Date : 18/12/2015 (54) Title of the invention : MODULAR BUILDING (51) International classification :E04B1/343,E04H1/02,E04B1/348 (71)Name of Applicant : (31) Priority Document No :2012902966 1)1 SPACE PTY LTD (32) Priority Date :11/07/2012 Address of Applicant :Level 3 35 Outram St West Perth (33) Name of priority country :Australia Western Australia 6005 Australia (86) International Application (72)Name of Inventor : :PCT/AU2013/000768 No 1)UNGER Susan :11/07/2013 Filing Date (87) International Publication :WO 2014/008548 No (61) Patent of Addition to :NA Application Number :NA Filing Date (62) Divisional to Application :NA Number :NA Filing Date (57) Abstract : A modular building unit for construction of a building comprises a structural frame 40 suitable for interconnection to another modular building unit in construction of the building; and a stud frame wall 80/82 internal to and fixed to the frame. The modular building unit is suitable for handling as a shipping container for transport. No. of Pages : 55 No. of Claims : 48 The Patent Office Journal 18/12/2015 66054 (12) PATENT APPLICATION PUBLICATION (21) Application No.1893/MUM/2014 A (19) INDIA (22) Date of filing of Application :10/06/2014 (43) Publication Date : 18/12/2015 (54) Title of the invention : A PROCESS FOR THE SYNTHESIS OF COPPER (II) PERCHLORATE SCHIFF'S BASE COMPLEX BY USING (2-CARBOXYPHENYL)-PYRIDINE-2-YL ETHYLENE AMINE AND OF 1, 10-PHENANTHROLINE AS LIGANDS AND ITS ANTIBREAST CANCER ACTIVITY. (51) International classification :C07F 1/08, C07D 213/00 :NA :NA :NA :NA :NA : NA :NA :NA :NA :NA (71)Name of Applicant : 1)DR. S. V. RATHOD Address of Applicant :CHEMISTRY RESEARCH LABORATORY, BHAVAN'S H. SOMANI COLLEGE, CHOWPATTY, MUMBAI-400007, MAHARASHTRA, INDIA. Maharashtra India (72)Name of Inventor : 1)DR. S. V. RATHOD 2)SMT. SMITA S. GIRI (31) Priority Document No (32) Priority Date (33) Name of priority country (86) International Application No Filing Date (87) International Publication No (61) Patent of Addition to Application Number Filing Date (62) Divisional to Application Number Filing Date (57) Abstract : A process for the Synthesis of copper (II) perchlorate Schiffs base complex by using (2-carboxyphenyl)-pyridine-2-yl ethylene amine and of 1, 10-Phenanthroline as ligand and its antibreast cancer activity. No. of Pages : 8 No. of Claims : 3 The Patent Office Journal 18/12/2015 66055 (12) PATENT APPLICATION PUBLICATION (21) Application No.1894/MUM/2014 A (19) INDIA (22) Date of filing of Application :10/06/2014 (43) Publication Date : 18/12/2015 (54) Title of the invention : A PROCESS FOR THE SYNTHESIS OF COPPER(II) PERCHLORATE SCHIFF'S BASE COMPLEX USING 4-NITRO(2-CARBOXYPHENYL)-PYRIDINE-2-YL ETHYLENE AMINE AND 1,10-PHENANTHROLINE AS LIGANDS AND ITS ANTIBREAST CANCER ACTIVITY (51) International classification :C07F 1/08, C07D 213/00 :NA :NA :NA :NA :NA : NA :NA :NA :NA :NA (71)Name of Applicant : 1)DR. S. V. RATHOD Address of Applicant :CHEMISTRY RESEARCH LABORATORY, BHAVAN'S H. SOMANI COLLEGE, CHOWPATTY, MUMBAI-400007, MAHARASHTRA, INDIA. Maharashtra India (72)Name of Inventor : 1)DR. S. V. RATHOD 2)SMT. SMITA S. GIRI (31) Priority Document No (32) Priority Date (33) Name of priority country (86) International Application No Filing Date (87) International Publication No (61) Patent of Addition to Application Number Filing Date (62) Divisional to Application Number Filing Date (57) Abstract : A process for the Synthesis of copper(II) perchlorate SchifPs base complex using 4-Nitro-(2-carboxyphenyl)-pyridine-2-yl ethylene amine and of 1,10-Phenanthroline as iigands and its antibreast cancer activity. No. of Pages : 8 No. of Claims : 3 The Patent Office Journal 18/12/2015 66056 (12) PATENT APPLICATION PUBLICATION (21) Application No.1896/MUM/2014 A (19) INDIA (22) Date of filing of Application :10/06/2014 (43) Publication Date : 18/12/2015 (54) Title of the invention : A PROCESS FOR THE SYNTHESIS OF COPPER(II) PERCHLORATE SCHIFF'S BASE COMPLEX FROM 4-BROMO-(2-CARBOXYPHENYL)-PYRIDINE-2-YL ETHYLENE AMINE AND 2,2'-BIPYRIDINE AND ITS ANTIBREAST CANCER ACTIVITY. (51) International classification :C07F 1/08, C07D 213/00 :NA :NA :NA :NA :NA : NA :NA :NA :NA :NA (71)Name of Applicant : 1)DR. S. V. RATHOD Address of Applicant :CHEMISTRY RESEARCH LABORATORY, BHAVAN'S H. SOMANI COLLEGE, CHOWPATTY, MUMBAI-400007, MAHARASHTRA, INDIA. Maharashtra India (72)Name of Inventor : 1)DR. S. V. RATHOD 2)SMT. SMITA S. GIRI (31) Priority Document No (32) Priority Date (33) Name of priority country (86) International Application No Filing Date (87) International Publication No (61) Patent of Addition to Application Number Filing Date (62) Divisional to Application Number Filing Date (57) Abstract : A process for the Synthesis of copper (II) perchlorate Schiffs base complex using 4-Bromo-(2-carboxyphenyl)-pyridine-2-yl ethylene amine and 2,2-Bipyridine as ligands and its antibreast cancer activity. No. of Pages : 8 No. of Claims : 3 The Patent Office Journal 18/12/2015 66057 (12) PATENT APPLICATION PUBLICATION (21) Application No.1609/MUM/2014 A (19) INDIA (22) Date of filing of Application :10/06/2014 (43) Publication Date : 18/12/2015 (54) Title of the invention : Method and System for Providing Modular Thermal Energy Charging and Storage System (51) International classification :H02J 7/00 (71)Name of Applicant : (31) Priority Document No :NA 1)Promethean Power Systems Inc (32) Priority Date :NA Address of Applicant :337 Summer Street, Boston, MA 02210 (33) Name of priority country :NA USA U.S.A. (86) International Application No :PCT// (72)Name of Inventor : Filing Date :01/01/1900 1)Sorin Grama (87) International Publication No : NA (61) Patent of Addition to Application Number :NA Filing Date :NA (62) Divisional to Application Number :NA Filing Date :NA (57) Abstract : The present invention there is provided a system and a method for providing modular thermal energy storage. Specifically, the system includes one or more thermal charging unit, a thermal storage unit and a controller unit. The thermal charging unit is provided for changing the temperature of a heat transfer fluid by heat transfer therebetween. The thermal storage unit having at least one thermal battery, receives the heat transfer fluid from the thermal charging unit, wherein the at least one thermal battery stores thermal energy therein. The controller unit controls working of the thermal storage unit and the thermal charging unit, also regulates flow of heat transfer fluid depending upon the temperature of the heat transfer fluid in the at least one thermal battery. No. of Pages : 23 No. of Claims : 14 The Patent Office Journal 18/12/2015 66058 (12) PATENT APPLICATION PUBLICATION (21) Application No.171/MUMNP/2015 A (19) INDIA (22) Date of filing of Application :23/01/2015 (43) Publication Date : 18/12/2015 (54) Title of the invention : MULTIPLE TIMING ADVANCE GROUPS (TAGS) FOR UL CARRIER AGGREGATION (CA) (51) International classification :H04W56/00 (71)Name of Applicant : (31) Priority Document No :61/684125 1)QUALCOMM INCORPORATED (32) Priority Date :16/08/2012 Address of Applicant :Attn: International IP Administration (33) Name of priority country :U.S.A. 5775 Morehouse Drive San Diego California 92121 1714 U.S.A. (86) International Application No :PCT/US2013/055470 (72)Name of Inventor : Filing Date :16/08/2013 1)GAAL Peter (87) International Publication No :WO 2014/028908 2)DAMNJANOVIC Jelena (61) Patent of Addition to Application 3)GHEORGHIU Valentin Alexandru :NA Number 4)KITAZOE Masato :NA Filing Date (62) Divisional to Application Number :NA Filing Date :NA (57) Abstract : Techniques are provided for assigning aggregated component carriers. For example a method may include receiving from a user equipment (UE) a set of rules associated with timing advance groups (TAGs) comprising allowable combinations of frequency bands. The method may include determining frequencies of aggregated component carriers. The method may include assigning the aggregated component carriers to at least one timing advance group based on the allowable combinations of frequency bands and the determined frequencies of the aggregated component carriers. No. of Pages : 44 No. of Claims : 23 The Patent Office Journal 18/12/2015 66059 (12) PATENT APPLICATION PUBLICATION (21) Application No.1908/MUM/2014 A (19) INDIA (22) Date of filing of Application :12/06/2014 (43) Publication Date : 18/12/2015 (54) Title of the invention : A PROCESS FOR THE PREPARATION OF XYLITOL FROM NATURAL XYLOSE. (51) International classification (31) Priority Document No (32) Priority Date (33) Name of priority country (86) International Application No Filing Date (87) International Publication No (61) Patent of Addition to Application Number Filing Date (62) Divisional to Application Number Filing Date (71)Name of Applicant : 1)PRAJ INDUSTRIES LIMITED :C07C29/00 Address of Applicant :PRAJ TOWER, 274-275, BHUMKAR :NA CHOWK, HINJEWADI ROAD, HINJEWADI, PUNE - 411057, :NA INDIA Maharashtra India :NA (72)Name of Inventor : :NA 1)SRINIVASAN RAJAGOPALAN :NA 2)TATYASO BHIKU YEWALE : NA 3)UMESH MANIKRAO INGLE :NA 4)IRFAN IMTIYAZ SHAIKH :NA 5)FAHMIN AHMED :NA 6)HARSHADA RATNAKAR PATIL :NA 7)SHRUTI SHRIKANT PANCHWAGH 8)MAHESH NANDAKUMAR WAVIKAR (57) Abstract : The invention relates to a process for the preparation of xylitol [a sugar alcohol] from natural xylose obtained from plant lignocellulosic materials. It particularly relates to the preparation of xylitol from a crude acid hydrolysed liquid part of lignocellulosic materials remaining after separation of cellulosic part from said lignocellulosic materials. No. of Pages : 19 No. of Claims : 10 The Patent Office Journal 18/12/2015 66060 (12) PATENT APPLICATION PUBLICATION (21) Application No.1923/MUM/2014 A (19) INDIA (22) Date of filing of Application :13/06/2014 (43) Publication Date : 18/12/2015 (54) Title of the invention : A SYSTEM FOR GENERATING BULK DOCUMENTS IN A PORTABLE FORMAT WITH INTERACTIVE FORMATS (51) International classification :G06F 17/00 :NA :NA :NA :NA :NA : NA :NA :NA :NA :NA (71)Name of Applicant : 1)AURIONPRO SOLUTIONS LIMITED Address of Applicant :35TH FLOOR, SUNSHINE TOWERS, TULSI PIPE ROAD, DADAR - (WEST), MUMBAI - 400 013. Maharashtra India (72)Name of Inventor : 1)AJAYKUMAR KUNNATH 2)NISHA SIDHWANI 3)MEHUL SHETH (31) Priority Document No (32) Priority Date (33) Name of priority country (86) International Application No Filing Date (87) International Publication No (61) Patent of Addition to Application Number Filing Date (62) Divisional to Application Number Filing Date (57) Abstract : The present invention discloses a software application configured to generate documents in a portable document format (PDF) which are dynamic in nature, to provide its access on various portable and non portable devices; to facilitate generation of bulk documents and enhance customer communications through its interactive feature. No. of Pages : 29 No. of Claims : 15 The Patent Office Journal 18/12/2015 66061 (12) PATENT APPLICATION PUBLICATION (21) Application No.1924/MUM/2014 A (19) INDIA (22) Date of filing of Application :13/06/2014 (43) Publication Date : 18/12/2015 (54) Title of the invention : AN APPARATUS AND METHOD FOR PROVIDING ZERO ATTRITION IN A PRESSURE SWING ADSORPTION SYSTEM (51) International classification :B01D 53/00, B01D53/047 :NA :NA :NA :NA :NA : NA :NA :NA :NA :NA (71)Name of Applicant : 1)RELIANCE INDUSTRIES LIMITED Address of Applicant :3rd Floor, Maker Chamber-IV, 222, Nariman Point, Mumbai-400021, Maharashtra, India. Maharashtra India (72)Name of Inventor : 1)GHADGE RAJARAM SHRIMANT 2)MOHARIR ARUN SADASHIO 3)MATHEW THOMAS (31) Priority Document No (32) Priority Date (33) Name of priority country (86) International Application No Filing Date (87) International Publication No (61) Patent of Addition to Application Number Filing Date (62) Divisional to Application Number Filing Date (57) Abstract : The present disclosure relates to an apparatus and method for providing zero attrition in a pressure swing adsorption system. The apparatus comprises a hopper having an upper portion extending into a lower portion in an operative vertical configuration. The hopper is adapted to hold adsorbent pellets. During operation, the apparatus is installed on an adsorption bed of a pressure swing adsorption system. The purity level of the affinity gas exiting the pressure swing adsorption system is continuously monitored. Particle escape during adsorption phase is monitored by observing the particle dust in exhaust gas flow during desorption phase. If the purity level of the affinity gas falls below a predetermined level or if particle passes through the exhaust, fresh adsorption pellets are ejected into the adsorption bed of the pressure swing adsorption system. No. of Pages : 14 No. of Claims : 5 The Patent Office Journal 18/12/2015 66062 (12) PATENT APPLICATION PUBLICATION (21) Application No.184/MUMNP/2015 A (19) INDIA (22) Date of filing of Application :27/01/2015 (43) Publication Date : 18/12/2015 (54) Title of the invention : TRANSPORT DEVICE FOR TRANSPORTING OBJECTS IN A CIRCULATING MANNER (51) International classification :B61B13/04,B65G35/06 (71)Name of Applicant : (31) Priority Document No :20 2012 007 288.9 1)MACHINES HIGHEST MECHATRONIC GMBH (32) Priority Date :27/07/2012 Address of Applicant :M¼hlgraben 43 a A 6343 Erl Austria (33) Name of priority country :Germany Austria (86) International Application No :PCT/EP2013/065658 (72)Name of Inventor : Filing Date :24/07/2013 1)ZOCCO Carmelo (87) International Publication No :WO 2014/016356 (61) Patent of Addition to Application :NA Number :NA Filing Date (62) Divisional to Application Number :NA Filing Date :NA (57) Abstract : Transport device for transporting objects (22) in a circulating manner along a circulating transporting path (10) in particular for a printing press having at least one transport carriage (20) to which an object (22) can be fastened and at least two processing devices (15 16) which are arranged along the transport path (10) for processing an object (22) wherein each transport carriage (20) has an individual drive (25) for moving the respective transport carriage (20) along the transport path (10) characterized in that each individual drive (25) has a stepping motor (25) for moving the respective transport carriage (20) along the transport path (10) and for positioning the transport carriage (20) at one of the processing devices (15 16) and in that there is a central control unit (40) which is set up to output a digital positioning command for the stepping motors (25) for moving the transport carriage (20) and for positioning the transport carriage (20) at one of the processing devices (15 16). No. of Pages : 14 No. of Claims : 9 The Patent Office Journal 18/12/2015 66063 (12) PATENT APPLICATION PUBLICATION (21) Application No.1936/MUM/2014 A (19) INDIA (22) Date of filing of Application :16/06/2014 (43) Publication Date : 18/12/2015 (54) Title of the invention : DESIGN AND FABRICATION OF A PLASTIC BOTTLE CRUSHER (51) International classification (31) Priority Document No (32) Priority Date (33) Name of priority country (86) International Application No Filing Date (87) International Publication No (61) Patent of Addition to Application Number Filing Date (62) Divisional to Application Number Filing Date (71)Name of Applicant : 1)SHRI RAMDEOBABA COLLEGE OF ENGINEERING :B30B1/38, B30B9/32 AND MANAGEMENT :NA Address of Applicant :SHRI RAMDEOBABA COLLEGE OF :NA ENGINEERING AND MANAGEMENT, RAMDEO TEKDI, :NA GITTIKHADAN, KATOL ROAD, NAGPUR 440013, :NA MAHARASHTRA, INDIA Maharashtra India :NA 2)PROF. Y. M. SONKHASKAR : NA (72)Name of Inventor : :NA 1)PROF. Y. M. SONKHASKAR :NA 2)MR. AMITKUMAR CHOUBEY 3)MR. ANURAG SAHU :NA 4)MR. AMRITPAL SINGH BHAMRA :NA 5)MR. RAGHAV SINGHAL 6)MR. SUNNY KASHWANI (57) Abstract : The Invention can help in avoiding the unethical practice of filling tap water and reselling of used bottles. Also by crushing the use of Plastic bottles beyond the Shelf life can be avoided. The Crushed Bottle can be used for recycling and thereafter reshaping of the waste plastic in a much more efficient method. By Crushing the volume of plastic Waste is considerably reduced. This reduced volume of waste helps in using the waste handling and disposing systems and equipments more efficiently. No. of Pages : 4 No. of Claims : 3 The Patent Office Journal 18/12/2015 66064 (12) PATENT APPLICATION PUBLICATION (21) Application No.1937/MUM/2014 A (19) INDIA (22) Date of filing of Application :16/06/2014 (43) Publication Date : 18/12/2015 (54) Title of the invention : A Seat with an Adjusting Mechanism for Postural Comfort (51) International classification :A47C7/00 (71)Name of Applicant : (31) Priority Document No :NA 1)Faurecia Interior Systems India Private Limited (32) Priority Date :NA Address of Applicant :Plot No.T-187, Pimpri Industrial Area (33) Name of priority country :NA (B.G. Block), Behind Bhosari Police Station, Bhosari, Pune, MH (86) International Application No :PCT// 411026 Maharashtra India Filing Date :01/01/1900 (72)Name of Inventor : (87) International Publication No : NA 1)DANANE Amit (61) Patent of Addition to Application Number :NA 2)CHATTERJEE Kalyanmoy Filing Date :NA (62) Divisional to Application Number :NA Filing Date :NA (57) Abstract : The present invention describes a seat with an adjusting mechanism for adjusting configuration of the seat for providing postural comfort to a person seating thereover. The adjusting mechanism having resting members, sliding blocks, links and a locking arrangement. The resting members are hinged together and are covered by a bolster. The sliding blocks are mounted on a guiding member and connected with a spring between. Further, the each of link links one of the sliding block with one of the resting member. Furthermore, the locking arrangement is configured between at least one of the resting members and the guiding member for restricting the movement of the resting members. Therefore, upon applying pressure on the seat and upon unlocking the locking arrangement, the resting members move, thereby moving sliding block through the links and upon achieving comfortable configuration of the resting members, the locking arrangement can be operated for locking and maintaining the position thereby providing postural comfort to the seated person. No. of Pages : 22 No. of Claims : 9 The Patent Office Journal 18/12/2015 66065 (12) PATENT APPLICATION PUBLICATION (21) Application No.252/MUM/2015 A (19) INDIA (22) Date of filing of Application :24/01/2015 (43) Publication Date : 18/12/2015 (54) Title of the invention : DESK-COMBINING APPARATUS FOR CORRECTION OF USER'S POSTURE (51) International classification (31) Priority Document No (32) Priority Date (33) Name of priority country :A47B83/02, A47B41/00 :10-20140008788 :24/01/2014 :Republic of Korea :PCT// :01/01/1900 : NA :NA :NA :NA :NA (71)Name of Applicant : 1)Gmax Co, Ltd. Address of Applicant :(Yangsan-dong) 89, Yangsantaekji-ro 37 beon-gil, Buk-gu, Gwangju, 500-896 Republic of Korea Republic of Korea (72)Name of Inventor : 1)YANG DON SEUNG 2)OH BYUNG YONG (86) International Application No Filing Date (87) International Publication No (61) Patent of Addition to Application Number Filing Date (62) Divisional to Application Number Filing Date (57) Abstract : Provided is an apparatus for correcting a posture attachable to a desk. The apparatus includes a desk fixing member of which a side surface has a C•-shape so as to be fixed on an upper plate of the desk and in which an inserting groove is formed along a vertical direction on a rear surface, an attaching member including a desk attaching unit which penetrates an upper surface or a lower surface of the desk fixing member and is attached on the upper plate of the desk, and an attachment-adjusting screw which adjusts a strength of attachment, a height adjusting member, a posture correcting pad, and a rotatable pad connecting member. No. of Pages : 21 No. of Claims : 4 The Patent Office Journal 18/12/2015 66066 (12) PATENT APPLICATION PUBLICATION (21) Application No.180/MUMNP/2015 A (19) INDIA (22) Date of filing of Application :27/01/2015 (43) Publication Date : 18/12/2015 (54) Title of the invention : METHOD OF MANAGING ROLE BASED DIGITAL RIGHTS IN A COMPUTER SYSTEM (51) International classification :G06F21/00,G06F21/10 (71)Name of Applicant : (31) Priority Document No :61/676489 1)CLAWD TECHNOLOGIES INC. (32) Priority Date :27/07/2012 Address of Applicant :330 rue Cormier Bureau 201 (33) Name of priority country :U.S.A. Drummondville Qubec J3C 8B3 Canada Canada (86) International Application No :PCT/CA2013/000645 (72)Name of Inventor : Filing Date :17/07/2013 1)MEUNIER Sebastien (87) International Publication No :WO 2014/015413 2)BELISLE Pierre (61) Patent of Addition to Application 3)DARTIGUES Guy :NA Number :NA Filing Date (62) Divisional to Application Number :NA Filing Date :NA (57) Abstract : A computer system manages role based digital rights by creating a chain of trust that originates with a user who purports to act as a registration authority whose status can be verified to ascertain that the user is licensed to act as the registration authority. The registration authority creates an organization account and a first member whose status is verified by consulting a status verification server. Derivative authorities granted to members are predicated on the first member and ultimately the registration authority to ensure that there is a chain of trust linking each member of an organization back to the registration authority. No. of Pages : 58 No. of Claims : 31 The Patent Office Journal 18/12/2015 66067 (12) PATENT APPLICATION PUBLICATION (21) Application No.1900/MUM/2014 A (19) INDIA (22) Date of filing of Application :10/06/2014 (43) Publication Date : 18/12/2015 (54) Title of the invention : METHOD OF PROVIDING CROWD FUNDED PRIZE OFFERING ENTERTAINMENT EVENTS. (51) International classification :G06Q 10/00, G07F 17/00, A63F 9/00 :NA :NA :NA :NA :NA : NA :NA :NA :NA :NA (71)Name of Applicant : 1)AMIT KUMAR JAIN Address of Applicant :F/1402, ROYAL CLASSIC BUILDING, LOKHANDWALA, LINK ROAD, ANDHERI (WEST)-400 053, MAHARASHTRA, INDIA. Maharashtra India (72)Name of Inventor : 1)AMIT KUMAR JAIN (31) Priority Document No (32) Priority Date (33) Name of priority country (86) International Application No Filing Date (87) International Publication No (61) Patent of Addition to Application Number Filing Date (62) Divisional to Application Number Filing Date (57) Abstract : The present invention implements a method that facilitates the creation, organization, regulation, publication, participation and monetization of crowd funded question-based gaming events wherein players participating in a game answer questions regarding micro and macro outcomes that occur in real life events available in public domain (such as a sports match or a news of public interest) or real life events not available in public domain (such as a neighbourhood baseball game) to win prizes. These questions inherently require a certain level of skill to be answered, for instance, predicting the winner of a football match requires knowledge of the forms of the teams playing and the players involved, amongst many other things. No. of Pages : 32 No. of Claims : 30 The Patent Office Journal 18/12/2015 66068 (12) PATENT APPLICATION PUBLICATION (21) Application No.1903/MUM/2014 A (19) INDIA (22) Date of filing of Application :10/06/2014 (43) Publication Date : 18/12/2015 (54) Title of the invention : A NOVEL PROCESS FOR SYNTHESIS OF ATOVAQUONE (51) International classification :C07C45/61, C07C49/603 (71)Name of Applicant : (31) Priority Document No :NA 1)LUPIN LTD. (32) Priority Date :NA Address of Applicant :159, CST Road, Kalina, Santacruz (33) Name of priority country :NA (East), Mumbai 400 098, Maharashtra Maharashtra India (86) International Application No :PCT// (72)Name of Inventor : Filing Date :01/01/1900 1)ROY, Bhairab, Nath (87) International Publication No : NA 2)SINGH, Girij, Pal (61) Patent of Addition to Application 3)LATHI, Piyush, Suresh :NA Number 4)AGRAWAL, Manoj; :NA Filing Date (62) Divisional to Application Number :NA Filing Date :NA (57) Abstract : The present invention provides a process of preparation of Atovaquone more particularly the present invention relates to a novel cost effective and industrial feasible process, without separation of any diastereoisomers or geometric isomers of intermediates obtained during the preparation of Atovaquone No. of Pages : 27 No. of Claims : 21 The Patent Office Journal 18/12/2015 66069 (12) PATENT APPLICATION PUBLICATION (21) Application No.1938/MUM/2014 A (19) INDIA (22) Date of filing of Application :16/06/2014 (43) Publication Date : 18/12/2015 (54) Title of the invention : 3-AMINO-2-CYANO-3-(METHYLTHIO)-(SUBSTITUTED AMINO)ACRYLAMIDE DERIVATIVES (51) International classification :C07D 265/00 :NA :NA :NA :PCT// :01/01/1900 : NA :NA :NA :NA :NA (71)Name of Applicant : 1)L.M College of Pharmacy Address of Applicant :P. O. Box 4011, Opp. Gujarat University, University Road, Navarangpura, Ahmedabad-380009, Gujarat, INDIA Gujarat India (72)Name of Inventor : 1)Dr. CHHABRIA Mahesh T. 2)Dr. SINGH Rajesh 3)GADANI, Yash R 4)PRAJAPATI, Paresh (31) Priority Document No (32) Priority Date (33) Name of priority country (86) International Application No Filing Date (87) International Publication No (61) Patent of Addition to Application Number Filing Date (62) Divisional to Application Number Filing Date (57) Abstract : ABSTRACT The present invention relates to novel 3-amino-2-cyano-3-(methylthio)-(substituted amino)acrylamide derivatives, compound of formula I which are useful as antihyperlipidemic agents. The present invention also provides a process for their preparation, pharmaceutical compositions, and a method for treating mammals in need thereof which comprises administering to said host an effective amount of a 3-amino-cyano-3-(methylthio)-(substituted amino)acrylamide derivatives, compound of formula I of the present invention No. of Pages : 47 No. of Claims : 7 The Patent Office Journal 18/12/2015 66070 (12) PATENT APPLICATION PUBLICATION (21) Application No.1911/MUM/2014 A (19) INDIA (22) Date of filing of Application :12/06/2014 (43) Publication Date : 18/12/2015 (54) Title of the invention : A PROCESS FOR PRODUCTION OF L-ASPARAGINASE WITH ANTI-LEUKEMIC ACTIVITY FROM CIRCINELLA SYDOWII (51) International classification :C12N 1/00, C12N 9/00 :NA :NA :NA :PCT// :01/01/1900 : NA :NA :NA :NA :NA (71)Name of Applicant : 1)DBT & DR. H.S. GOUR CENTRAL UNIVERSITY, SAGAR Address of Applicant :DEPARTMENT OF APPLIED MICROBIOLOGY, DR. HARISINGH GOUR, VISHWAVIDAYALAYA, SAGAR (M.P) 470003, INDIA Madhya Pradesh India (72)Name of Inventor : 1)RAMRAJ UPADHYAY 2)AKANSHA SAXENA 3)NAVEEN KANGO (31) Priority Document No (32) Priority Date (33) Name of priority country (86) International Application No Filing Date (87) International Publication No (61) Patent of Addition to Application Number Filing Date (62) Divisional to Application Number Filing Date (57) Abstract : A process for production of L-asparaginase with anti-leukemic activity from Circinella sydowii, the process comprising the steps of: isolation and identification of fungi Circinella sydowii (NFCCI 3195) from various soil habitats; primary screening of the fungi for potential of L-asparaginase activity by tubed agar method; secondary screening of the potential fungi for glutanase activity; production of L-asparaginase by Circinella sydowii (NFCCI 3195) in optimized physiochemical conditions; and characterization of Lasparaginase produced by Circinella sydowii (NFCCI-3195); wherein the optimized physiochemical conditions include incubation period that is preferably 3 days; incubation temperature that is in the range of 30-35°C; pH of the medium that is preferably 9; a carbon source that may be cellulose for biomass yield (mg) and lactose for L-asparaginase activity (µ/ml); a nitrogen source that may be soybean meal for Biomass Yield (mg) and L-asparagine for L-asparaginase activity (µ/ml); and L-asparagine in the range of 1% to 3%. No. of Pages : 22 No. of Claims : 8 The Patent Office Journal 18/12/2015 66071 (12) PATENT APPLICATION PUBLICATION (21) Application No.1912/MUM/2014 A (19) INDIA (22) Date of filing of Application :12/06/2014 (43) Publication Date : 18/12/2015 (54) Title of the invention : A COCONUT CUTTING MACHINE (51) International classification :A23N5/03, A23N5/00 (71)Name of Applicant : (31) Priority Document No :NA 1)MARICO LIMITED (32) Priority Date :NA Address of Applicant :Grande Palladium, 7th floor, Kalina (33) Name of priority country :NA Santacruz (E), Mumbai 400098, India; Maharashtra India (86) International Application No :PCT// (72)Name of Inventor : Filing Date :01/01/1900 1)SUBIN, Panachepallil Joy (87) International Publication No : NA (61) Patent of Addition to Application :NA Number :NA Filing Date (62) Divisional to Application Number :NA Filing Date :NA (57) Abstract : ABSTRACT A COCONUT CUTTING MACHINE The present disclosure provides a machine for cutting coconut into substantially two equal halves comprising: means for cutting coconut; means for transferring and centering coconut proximal towards the means for cutting coconut; means for pushing the centered coconut towards the means for cutting coconut to facilitate cutting of the coconut into substantially two equal parts; and means for providing power to said means. More specifically, the present disclosure provides a machine for cutting coconut into substantially two equal halves irrespective of the size and positioning of the coconut in the machine. No. of Pages : 10 No. of Claims : 10 The Patent Office Journal 18/12/2015 66072 (12) PATENT APPLICATION PUBLICATION (21) Application No.1897/MUM/2014 A (19) INDIA (22) Date of filing of Application :10/06/2014 (43) Publication Date : 18/12/2015 (54) Title of the invention : A CABLE MANAGEMENT SYSTEM (51) International classification :F16L3/22, F16B 37/00 :NA :NA :NA :PCT// :01/01/1900 : NA :NA :NA :NA :NA (71)Name of Applicant : 1)Emerson Network Power, Energy Systems, North America, Inc., Address of Applicant :4350 Weaver Parkway Warrenville, IL United States U.S.A. (72)Name of Inventor : 1)DIAS KENNETH 2)MALI RAKESH MAHALING (31) Priority Document No (32) Priority Date (33) Name of priority country (86) International Application No Filing Date (87) International Publication No (61) Patent of Addition to Application Number Filing Date (62) Divisional to Application Number Filing Date (57) Abstract : A cable management system for managing cables inside an enclosure includes a panel, a plurality of pegs, a self-clinching fastener assembly for each peg and a cable tie. The panel is assembled inside the enclosure. The pegs are removably secured to the panel, wherein each peg has at least one hole configured thereon. The self-clinching fastener assembly for each peg facilitates removable, air-tight securement of the peg to the panel. Each self-clinching fastener assembly includes a self-clinch stud. The self-clinch stud flushes with the other side of the panel when mounted on panel to configure an air-tight connection between the self-clinch stud and the panel. The self-clinch stud threadably engages with the pegs to facilitate removable securement of the pegs to the panel. The cable tie is functionally coupled to the pegs and configures an adjustable gripping loop for gripping cables of different configurations. No. of Pages : 25 No. of Claims : 7 The Patent Office Journal 18/12/2015 66073 (12) PATENT APPLICATION PUBLICATION (21) Application No.1898/MUM/2014 A (19) INDIA (22) Date of filing of Application :10/06/2014 (43) Publication Date : 18/12/2015 (54) Title of the invention : TOPICAL PHARMACEUTICAL COMPOSITION (51) International classification :A61K31/00, A61K9/00 :NA :NA :NA :PCT// :01/01/1900 : NA :NA :NA :NA :NA (71)Name of Applicant : 1)CIPLA LIMITED Address of Applicant :Cipla House, Peninsula Business Park, Ganpatrao Kadam Marg, Lower Parel, Mumbai 400013, Maharashtra. India. Maharashtra India (72)Name of Inventor : 1)MALHOTRA, Geena 2)RAUT, Preeti (31) Priority Document No (32) Priority Date (33) Name of priority country (86) International Application No Filing Date (87) International Publication No (61) Patent of Addition to Application Number Filing Date (62) Divisional to Application Number Filing Date (57) Abstract : The present invention relates to topical pharmaceutical compositions comprising an anti-inflammatory agent in combination with an antibacterial agent, particularly for the treatment of acne. No. of Pages : 26 No. of Claims : 10 The Patent Office Journal 18/12/2015 66074 (12) PATENT APPLICATION PUBLICATION (21) Application No.1899/MUM/2014 A (19) INDIA (22) Date of filing of Application :10/06/2014 (43) Publication Date : 18/12/2015 (54) Title of the invention : DYE BLOCKING PRINTING INK SYSTEM FOR PRINTING ON POLYESTER BLENDED FABRICS (51) International classification :C09D11/02, B41J2/01 (71)Name of Applicant : (31) Priority Document No :NA 1)FUJIFILM SERICOL INDIA PVT. LTD. (32) Priority Date :NA Address of Applicant :10/11 B.U. Bhandari Industrial Estate, (33) Name of priority country :NA Sanaswadi, Taluka; Shirur, Pune 412208, Maharashtra, India. (86) International Application No :NA Maharashtra India Filing Date :NA (72)Name of Inventor : (87) International Publication No : NA 1)MOTUPALLI PRASANNA RAGHAV RAO (61) Patent of Addition to Application 2)KAMMILI NARENDRA KOTESWARA RAO :NA Number :NA Filing Date (62) Divisional to Application Number :NA Filing Date :NA (57) Abstract : The present disclosure relates to a dye blocking printing ink to stop dye migration from fabric to print, particularly in polyester blended and 100% polyester fabrics. The dye blocking printing ink of present disclosure comprises a resin devoid of vinyl chloride moiety, a plasticizer, a wetting agent and a formaldehyde free discharge agent. A process for printing fabrics using the dye blocking printing ink of the present disclosure is also disclosed. No. of Pages : 24 No. of Claims : 11 The Patent Office Journal 18/12/2015 66075 (12) PATENT APPLICATION PUBLICATION (21) Application No.181/MUMNP/2015 A (19) INDIA (22) Date of filing of Application :27/01/2015 (43) Publication Date : 18/12/2015 (54) Title of the invention : RESIDUE HYDROCRACKING (51) International classification :C10G65/02,C10G47/00 (71)Name of Applicant : (31) Priority Document No :13/566682 1)LUMMUS TECHNOLOGY INC. (32) Priority Date :03/08/2012 Address of Applicant :1515 Broad Street Bloomfield NJ 07003 (33) Name of priority country :U.S.A. 3096 U.S.A. U.S.A. (86) International Application No :PCT/US2013/050487 (72)Name of Inventor : Filing Date :15/07/2013 1)MUKHERJEE Ujjal K. (87) International Publication No :WO 2014/022082 2)BALDASSARI Mario C. (61) Patent of Addition to Application :NA Number :NA Filing Date (62) Divisional to Application Number :NA Filing Date :NA (57) Abstract : A process for upgrading residuum hydrocarbons and decreasing tendency of the resulting products toward asphaltenic sediment formation in downstream processes is disclosed. The process may include: contacting a residuum hydrocarbon fraction and hydrogen with a hydroconversion catalyst in a hydrocracking reaction zone to convert at least a portion of the residuum hydrocarbon fraction to lighter hydrocarbons; recovering an effluent from the hydrocracking reaction zone; contacting hydrogen and at least a portion of the effluent with a resid hydrotreating catalyst; and separating the effluent to recover two or more hydrocarbon fractions. No. of Pages : 34 No. of Claims : 25 The Patent Office Journal 18/12/2015 66076 (12) PATENT APPLICATION PUBLICATION (21) Application No.1913/MUM/2014 A (19) INDIA (22) Date of filing of Application :13/06/2014 (43) Publication Date : 18/12/2015 (54) Title of the invention : DRIVE ASSEMBLY FOR SUGAR CANE DIFFUSER (51) International classification :A45B 3/00, F16M 13/00 :NA :NA :NA :NA :NA : NA :NA :NA :NA :NA (71)Name of Applicant : 1)TUKARAM MUGUTRAO KARNE Address of Applicant :SHREYAS ORNATE, 95TULASIBAGWALE COLONY, SAHKARNAGAR-2, PUNE411009, M. S. INDIA. Maharashtra India (72)Name of Inventor : 1)TUKARAM MUGUTRAO KARNE (31) Priority Document No (32) Priority Date (33) Name of priority country (86) International Application No Filing Date (87) International Publication No (61) Patent of Addition to Application Number Filing Date (62) Divisional to Application Number Filing Date (57) Abstract : Disclosed is a drive assembly for a sugar cane diffuser. The drive assembly comprises a plurality of bed plate screens, a plurality of drives, a plurality of motors, a plurality of gear boxes, a plurality of first drums, a second drum, a plurality of screws, a plurality of bearings and a plurality of screws. The plurality of drives is adapted to carry a wire rope thereon. The wire rope is laid down in a single loop such that each drive of the plurality of drives gets connected to each bed plate screen of the plurality of bed plate screens. The drive assembly is simple and easy to operate and maintain. The drive assembly provides very high juice extraction. No. of Pages : 15 No. of Claims : 7 The Patent Office Journal 18/12/2015 66077 (12) PATENT APPLICATION PUBLICATION (21) Application No.3638/MUM/2014 A (19) INDIA (22) Date of filing of Application :18/11/2014 (43) Publication Date : 18/12/2015 (54) Title of the invention : REVERSIBLE ACCESS COVERS AND ASSEMBLIES (51) International classification :B65D83/10, (71)Name of Applicant : A61M5/00 1)EJ Australia Pty Ltd :2014902307 Address of Applicant :9 Delta Street GEEBUNG Queensland :17/06/2014 4034 Australia Australia :Australia (72)Name of Inventor : :PCT// 1)McMANUS, Thomas Oliver :01/01/1900 : NA :NA :NA :NA :NA (31) Priority Document No (32) Priority Date (33) Name of priority country (86) International Application No Filing Date (87) International Publication No (61) Patent of Addition to Application Number Filing Date (62) Divisional to Application Number Filing Date (57) Abstract : Access™ cover which can be mounted in a frame, where the frame is mountable at an entrance to a pit, manhole or the like. The access cover includes a cover body, which has a substantially planar surface on a first face; one or more ribs, flanges or like protrusions extending from the opposed, second face of the cover body, forming an infill pattern; and a peripheral rim about the second face of the body. The peripheral rim has a first pair of opposed external faces substantially perpendicular to the planar surface, and a second pair of opposed external faces at respective obtuse and acute angles, to the planar surface. By providing complementary internal faces in the frame; the access cover can be mounted in the frame with either the first face or second face directed upwardly. No. of Pages : 19 No. of Claims : 10 The Patent Office Journal 18/12/2015 66078 (12) PATENT APPLICATION PUBLICATION (21) Application No.174/MUMNP/2015 A (19) INDIA (22) Date of filing of Application :23/01/2015 (43) Publication Date : 18/12/2015 (54) Title of the invention : VIBRATION DEVICE FOR EXCAVATOR (51) International classification :E02F3/12,E21B28/00 (71)Name of Applicant : (31) Priority Document No :10-2012-0077598 1)S & C CO.LTD. (32) Priority Date :17/07/2012 Address of Applicant :80(dohwa dong) Songnim ro 307beon (33) Name of priority country :Republic of Korea gil Nam gu Incheon 402 060 Republic of Korea Republic of Korea (86) International Application No :PCT/KR2013/006383 (72)Name of Inventor : Filing Date :17/07/2013 1)LEE Seong Chan (87) International Publication No :WO 2014/014264 (61) Patent of Addition to Application :NA Number :NA Filing Date (62) Divisional to Application Number :NA Filing Date :NA (57) Abstract : Disclosed is a vibration device for an excavator. The present invention relates to a vibration device for an excavator the device comprising: an external body which has an accommodation section inside thereof; a main vibration body which is embedded in the external body and which has a mounting bracket formed at the bottom for detaching and attaching tools and equipment; and a sliding apparatus which is installed between one side surface of the main vibration body and the external body wherein the main vibration body is a box like body which consists of a plurality of supporting plates so as to have a space in the inside thereof; a reduction gear which is connected to a hydraulic motor and which rotates and operates by means of the drive of the hydraulic motor; a first eccentric member which is engaged with the reduction gear and performs an eccentric operation; and a second eccentric member which is engaged with the first eccentric member and performs an eccentric operation. No. of Pages : 26 No. of Claims : 11 The Patent Office Journal 18/12/2015 66079 (12) PATENT APPLICATION PUBLICATION (21) Application No.243/MUM/2015 A (19) INDIA (22) Date of filing of Application :23/01/2015 (43) Publication Date : 18/12/2015 (54) Title of the invention : VALVE CLOSURE MECHANISM AND AN AIR BLAST VALVE USING SAID VALVE CLOSURE MECHANISM (51) International classification :C02F1/763, (71)Name of Applicant : G05D11/006 1)Beth-El Zikhron Ya™akov Industries, Ltd :IL 231140 Address of Applicant :Derekh Avshalom 1, P.O. Box 166, :24/02/2014 Zikhron Yaakov 30900, ISRAEL Israel :Israel (72)Name of Inventor : :PCT// 1)Jonathan SCHNEIDER :01/01/1900 : NA :NA :NA :NA :NA (31) Priority Document No (32) Priority Date (33) Name of priority country (86) International Application No Filing Date (87) International Publication No (61) Patent of Addition to Application Number Filing Date (62) Divisional to Application Number Filing Date (57) Abstract : A valve closure mechanism having a moveable plate (28) that is displaceable relative to at least one fixed plate (26, 27), each of the plates having perforations (30, 31) that are mutually offset between one plate and another, so that in an open position of the valve the perforations in each plate allow air to pass therethrough and in a closed position of the valve the moveable plate makes abutting contact with the at least one fixed plate such that at least some of the perforations in each plate are sealed by the plate complementary thereto. No. of Pages : 37 No. of Claims : 19 The Patent Office Journal 18/12/2015 66080 (12) PATENT APPLICATION PUBLICATION (21) Application No.1932/MUM/2014 A (19) INDIA (22) Date of filing of Application :14/06/2014 (43) Publication Date : 18/12/2015 (54) Title of the invention : A CURCUMIN HYDROGEL SPONGE FOR WOUND HEALINGA CURCUMIN HYDROGEL SPONGE FOR WOUND HEALING (51) International classification (31) Priority Document No (32) Priority Date (33) Name of priority country (86) International Application No Filing Date (87) International Publication No (61) Patent of Addition to Application Number Filing Date (62) Divisional to Application Number Filing Date (71)Name of Applicant : :A61K 1)MOMIN, Munira Mahmadali 36/00, Address of Applicant :Oriental College of Pharmacy, Sector-2, A61K 9/00 Plot: 3,4,5, Sanpada, Navi Mumbai-400705, Maharastra, INDIA :NA Maharashtra India :NA 2)KHURADE, Suvarna Tukaram :NA 3)BUTTE, Kishor Dasharath :PCT// 4)KHANEKAR, Pallavi Vasudeo :01/01/1900 5)MHATRE, Supriya Sudhakar : NA (72)Name of Inventor : :NA 1)MOMIN, Munira Mahmadali :NA 2)KHURADE, Suvarna Tukaram :NA 3)BUTTE, Kishor Dasharath :NA 4)KHANEKAR, Pallavi Vasudeo 5)MHATRE, Supriya Sudhakar (57) Abstract : The present invention provides a curcumin hydrogel sponge comprising curcumin, honey, hydrogel base and auxiliary polymer and process for preparing the same. No. of Pages : 33 No. of Claims : 7 The Patent Office Journal 18/12/2015 66081 (12) PATENT APPLICATION PUBLICATION (21) Application No.1933/MUM/2014 A (19) INDIA (22) Date of filing of Application :16/06/2014 (43) Publication Date : 18/12/2015 (54) Title of the invention : A COMPUTER IMPLEMENTED SOCIAL MEDIA INTERACTION PLATFORM (51) International classification :G06Q50/00 (71)Name of Applicant : (31) Priority Document No :NA 1)DEWAN MOHAN (32) Priority Date :NA Address of Applicant :1147B, Mohan Villa, Shivaji Nagar, (33) Name of priority country :NA Pune 411045. Maharashtra, India Maharashtra India (86) International Application No :PCT// (72)Name of Inventor : Filing Date :01/01/1900 1)DEWAN MOHAN (87) International Publication No : NA (61) Patent of Addition to Application Number :NA Filing Date :NA (62) Divisional to Application Number :NA Filing Date :NA (57) Abstract : A computer implemented system and method for providing a social media interaction platform is disclosed. The social media interaction platform comprises a user interface wherein users can simultaneously view multiple social media sites and transfer content between the social media sites. To interact through the social media interaction platform, users have to login to the platform, whereupon, on successful authorization the user interface enables users to login to different social media sites from a displayed menu having a list of different social media sites. On selection of desired social media sites, an authentication request is displayed on the user interface asking for authorized user™s social media credentials. On successful authentication of the authorized user, content of the selected social media sites is displayed to allow the authenticated user to interact on the selected social media sites, and modify, add, delete and exchange data between the selected social media accounts. Fig.2 No. of Pages : 17 No. of Claims : 10 CONTINUED TO PART- 2 The Patent Office Journal 18/12/2015 66082