Higher Biology
Unit 1
DNA and the Genome
Pupil Name and Class
Learning Intentions
1. The structure and replication of DNA
Structure of DNA
 Nucleotides are composed of deoxyribose sugar, phosphate and a
base.
 Nucleotides join together to form a sugar–phosphate backbone.
 Base pairing occurs between the two strands of DNA between
adenine, thymine and guanine, cytosine. These base pairs bond by
weak hydrogen bonds.
 The DNA helix is double stranded, and has an anti-parallel structure,
with deoxyribose and phosphate at 3' and 5' ends of each strand.
Organisation of DNA in different organisms
 Circular chromosomal DNA and plasmids can be found in
prokaryotes.
 Circular plasmids can be found in yeast
 Circular chromosome can be found in mitochondria and chloroplasts of
eukaryotes.
 Linear chromosomes can be found in the nucleus of eukaryotes. This
DNA is tightly packaged with associated proteins.
Replication of DNA
 Prior to cell division DNA is replicated by DNA polymerase. A primer is
required to start replication.
 DNA is unwound and unzipped to form two template strands. This
process occurs at several locations o the DNA molecule.
 DNA is replicated by DNA polymerase in only one direction; adding
complementary nucleotides to the deoxyribose (3') end of a DNA
strand.
 Fragments of DNA are joined together by ligase.
Polymerase chain reaction (PCR)
 PCR is the amplification of DNA (in vitro) using complementary primers
for specific target sequences at the two ends of the region to be
amplified.
 The stages in the process of PCR
 The applications of PCR
Structure of DNA
Key Concepts
 DNA is inherited.
 DNA is the genetic material of living things.
 DNA is located within the nucleus of all cells apart from red bl ood
cells.
 DNA is a long chemical sequence and this sequence contains the
information needed for that living thing to develop, survive and pass
its genetic information on to the next generation.
 The DNA chemical sequence differs between individuals. The
pattern of this sequence is called the genotype.
 DNA is composed of two polynucleotide chains.
 Nucleotides consist of a sugar, phosphate and base.
 Nucleotides bond to form a sugar–phosphate backbone.
 The two polynucleotide chains run antiparallel, with a deo xyribose
sugar at the 3′ end and a phosphate group at the 5′ end.
 The nucleic acid bases are paired by hydrogen bonding in the centre
to form a double helix.
 Base pairing is specific, with adenine pairing with thymine and
cytosine pairing with guanine.
DNA Structure
Two strands of nucleotides twisted into a right-handed double helix
The three components of nucleotides are:
 The bases are termed adenine, thymine, guanine and cytosine.
 The sugar is a deoxyribose with a pentameric (five-membered ring).
 Phosphate
Phosphate
group
Deoxy-ribose
sugar
Base - adenine guanine- cytosine
- thymine
- uracil
Nucleotide structure
These are defined by their ring structures.
The purine-containing nucleotides are guanine and adenosine and the
pyrimidine-containing nucleotides are cytosine and thymine.
Pairing occurs through hydrogen bonds. The G–C bonds are stronger
as there are three such bonds. The A–T bonds are weaker as there are
two such bonds.
The sugar–phosphate backbone
Backbone is composed of alternating sugar and phosphate molecules. Sugar
is joined to the phosphate group by ester bonds. This type of bonding is
termed phospho-diester bonding. These are strong covalent bonds.
Anti-parallel Nature
The molecule is anti-parallel and the pentameric ring structures point in
opposite directions on each strand. Phosphodiester bond links carbon 5’ to
carbon 3’ on next nucleotide
Organisation of DNA in different organisms
Key concepts
 DNA exists in very long molecules that are packaged and organised
in cells.
 The organisation of DNA is different in prokaryotes and eukaryotes.
 Prokaryotes usually have a single circular chromosome.
 Eukaryotes usually have several linear chromosomes, which are
packaged.
 Eukaryotic cells also contain mitochondrial DNA, and chloroplast
DNA in green plants.
 The DNA in chromosomes undergoes four stages of packaging to
achieve the most condensed state, seen during metaphase.
 DNA combines with proteins to achieve its packaged state.
In the cells of both prokaryotes and eukaryotes DNA is organised into
structures called chromosomes. In eukaryotes these are linear and numerous,
whereas in prokaryotes there is usually a single circular chromosome.
Prokaryotes are a domain of organisms comprising the bacteria and
cyanobacteria, characterized by the absence of a distinct, membrane-bound
nucleus or membrane-bound organelles, and by DNA that is not organised
into chromosomes.
Eukaryotes are a domain of organisms having cells each with a distinct
nucleus within which the genetic material is contained. Eukaryotes include
fungi, plants, and animals.
Replication of DNA
Prior to cell division DNA is replicated by DNA polymerase.
Briefly the stages in DNA replication are:
1. A primer is required to start replication.
2. The DNA molecule unwinds
3. The DNA molecule unzips (as the weak hydrogen bonds, between
complementary bases, break). This happens at several locations along
the DNA molecule.
Helicase is the name of the enzyme involved.
4. Free DNA nucleotides align themselves with their complementary
nucleotide on the open chain at deoxyribose 3’ end.
4. New weak hydrogen bonds form between complementary bases
(remember A-T, G-C).
5. The other strand of DNA is copied in sections (fragments) and is called
the lagging strand.
6. Adjacent new nucleotides are linked through the sugar and phosphate
molecules by strong chemical bonds to form the “backbone” of the new
strand.
7. Fragments of DNA are joined together by ligase.
8. The new molecule winds up into a double helix.
Polymerase Chain Reaction
Key concepts





Small sections of DNA can be replicated in vitro using the PCR.
PCR manipulates the natural process of DNA replication.
PCR is now an automated technique widely used in many areas of
research and industry.
PCR requires template DNA, Taq polymerase, di-deoxynucleic
acids with each of the four DNA bases, Mg 2+ , primers and a buffer.
PCR involves continuous and repeated cycles of heating and
cooling.
PCR is a fundamental and everyday technique in many laboratories, whether
used by academia, industry or government. PCR is a valuable analytical tool
and is routinely used for research purposes; diagnosing diseases, be they
inherited or infectious, genetic fingerprinting, paternity cases, forensics, quality
assurance in the food industry and even molecular archaeology. However,
because of its incredible sensitivity scrupulous precautions have to be taken to
keep unwanted DNA out of a reaction mixture.
The technique
PCR was developed by Kary Mullis in the mid 1980s, revolutionising molecular
biology. He received the Nobel Prize for chemistry for its conception in 1993.
The technique enables specific sections of DNA to be amplified (replicated) in
vitro, producing millions of copies from a DNA template. Mullis developed the
technique manually, and it can still be carried out using water baths. However,
the technique is now fully automated in laboratories, using thermal cyclers no
bigger than a bread machine.
From a single piece of DNA, PCR is capable of making billions of
copies of a particular sequence. This relies on all the ingredients
needed for DNA replication being present: the target sequence, or
template DNA, free deoxynucleotides, DNA primers and heat -stable
DNA polymerase such as Taq polymerase. Typically the primers are
about 8-15 nucleotides long and are complimentary to the ends of the
target sequence.
Usually 30 cycles, or reactions, are carried out one after the other.
Each cycle is made up of three parts:
1.
Denaturation
2.
Annealing
3.
Extension
denaturation
The mixture is heated to 90°C to separate
the two strands of DNA.
The temperature is lowered to 55°C,
allowing the primers to specifically bind to
the target sequence by complimentary base
pairing.
By heating to 72°C Taq polymerase will
synthesise new DNA from the target
sequence.
annealing
extension
The technique manipulates the cell’s natural mechanism for replication by
using DNA polymerase and the following steps:
1.
2.
3.
4.
5.
Sample DNA is denatured by heating to give two polynucleotide
chains.
Sequence-specific primers, which are small sequences of singlestranded DNA anneal to the DNA flanking the section of interest.
One primer anneals to one strand (forward primer), another to the
other DNA strand (reverse primer).
Polymerase begins to replicate the DNA section of interest using
the primers as a starter sequence. The mixture also includes:
 dideoxynucleotides of each base type to enable the formation
of the new DNA strand
 Mg 2+ , which is a polymerase cofactor
 a buffer to keep the pH stable.
The mixture now contains the original template plus the newly
amplified sections.
The cycle begins again using the original and copied DNA as
templates.
At the end of each cycle the newly synthesised fragments act as fresh
templates so if there is a single piece of DNA to begin with then after
the first cycle there would be two, after the second cycle four, after the
third cycle eight, after the fourth cycle sixteen, and so on (doubles
every cycle). As the reaction is exponential, millions of copies are produced
in about 3 hours
The primers are written starting with the 5' end (phosphate of the first
nucleotide) and finishing with the 3' end (deoxyribose of the last
nucleotide).
5' (phosphate end) → CGAAATCGGTAGACGCTACG → 3' (deoxyribose end)
(primer 1/CHc)
5' (phosphate end) → GGGGATAGAGGGACTTGAAC → 3' (deoxyribose end)
(primer 2/CHd)
DNA polymerase will only add nucleotides to the 3' (deoxyribose) end
of the primer or to the growing chain of newly synthesised DNA. Only
bases which specifically compliment the DNA template will be joined to
the strand being synthesised, ensuring that the original DNA sequence
is copied letter for letter or base for base.
Each strand of DNA in the double helix runs in opposite directions, i.e. the strands are anti-parallel. The
arrows show the direction of synthesis.
Template DNA
Primer
3' (deoxyribose end)
5' (phosphate end)
.......GCTTTAGCCATCTGCGATGC.............. 5' (phosphate end)
CGAAATCGGTAGACGCTACG →
3' (deoxyribose end)
Primer
Template DNA
3' (deoxyribose end)
5' (phosphate end)
← CAAGTTCAGGGAGATAGGGG
5' (phosphate end)
.......GTTCAAGTCCCTCTATCCCC.............. 3' (deoxyribose end)
By knowing the target sequence it is possible to make billions of copies
of a chosen piece of DNA in a relatively short time. Since the primers
used in PCR are unique to each target sequence, the PCR reaction is
very specific and in theory can amplify a single DNA sequence from a
complex mixture of DNA molecules.
The following diagram illustrates the PCR technique.
Applications of PCR
PCR is used widely, for example:
1.
2.
3.
4.
5.
DNA profiling/fingerprinting: PCR is used to rapidly identify
individuals. Specific regions of DNA known to vary between
individuals are amplified using fluorescently labelled primers and
then analysed using capillary gel electrophoresis. Profiling is not
only used in forensics but also in plant variety identification,
paternity testing and evolutionary biology.
Disease diagnosis: DNA sequences that are known to indicate
certain genetic disorders or diseases are amplified using PCR for
the purposes of diagnosis.
Archaeological analysis: Ancient DNA, degraded over the years,
can be amplified and used in archaeological, paleontological and
evolutionary research.
Population studies: Analysis of human or other species’
population genetics can be rapidly performed using PCR analysis.
Sequencing: DNA sequence analysis previously took place
following lengthy cloning experiments, which have now been
replaced by PCR.
Learning Intentions
2. Gene expression
 Gene expression is controlled by the regulation of transcription and
translation.
 The genetic code used in transcription and translation is found in all
forms of life.
 The phenotype is determined by the proteins produced as the result of
gene expression, influenced by intra- and extra-cellular environmental
factors.
 Only a fraction of the genes in a cell are expressed.
Structure of RNA
 RNA is a single stranded molecule, has a replacement of thymine with
uracil and deoxyribose with ribose compared to DNA.
 mRNA is transcribed from DNA in the nucleus and translated into
proteins by ribosomes in the cytoplasm.
 rRNA and proteins form the ribosome.
 tRNA (transfer) amino acids to the ribosome. Each tRNA carries a
specific amino acid.
Protein Synthesis
 Transcription of DNA into primary and mature RNA transcripts includes
RNA polymerase and complementary base pairing.
 The introns of the primary transcript of mRNA are non-coding and are
removed in RNA splicing.
 The exons are coding regions and are joined together to form mature
transcript. This process is called RNA splicing.
 Different mRNA molecules are produced from the same primary
transcript depending on which RNA segments are treated as exons
and introns.
 Translation of mRNA into a polypeptide by tRNA at the ribosome.
 Start and stop codons exist.
Proteins
 Proteins have a large variety of structures and shapes resulting in a
wide range of functions
 One gene can result in many proteins as a result of RNA splicing and
post-translational modification.
 Post translation protein structure is modified by cutting, folding and
combining polypeptide chains or by adding phosphate or carbohydrate
groups to the protein.
 Know examples of fibrous, globular and conjugated proteins proteins.
The genetic code used in transcription and translation is found in all forms of
life.
The phenotype is determined by the proteins produced as the result of gene
expression, influenced by intra- and extra-cellular environmental factors. Only
a fraction of the genes in a cell are expressed.
Gene expression is controlled by the regulation of transcription and
translation.
Structure of RNA
RNA stands for ribonucleic acid. There are three main differences
between RNA and DNA. RNA is single stranded, a uracil base has
replaced thymine and the nucleotide contains a ribose sugar instead of
deoxyribose sugar.
Phosphate
group
Base - adenine guanine- cytosine
- uracil
Ribose
sugar
- uracil
RNA
DNA
Single stranded
Double stranded
Uracil
Thymine
Ribose sugar
Deoxyribose sugar
There are three forms of RNA involved in protein synthesis: messenger
RNA (mRNA) and transfer RNA (tRNA). mRNA is formed inside the
nucleus from free nucleotides and carries a copy of the DNA code from
the nucleus to the ribosome to direct the synthesis of proteins. Do you
remember this from the cell ultrastructure and protein synthesis
sections in National 5?
The ribosomes are found in the cytoplasm either f loating freely or
attached to the rough endoplasmic reticulum. Ribosomes floating freely
are used to synthesis proteins for use within the cell; those attached to
the ER synthesise proteins for export or inclusion in the membrane.
Ribosomes are formed from proteins and a third type of RNA known as
ribosomal RNA (rRNA). Each tRNA carries a specific amino acid to the
ribosome for attachment to the peptide chain.
Use the information on the information cards to describe what is
happening at each stage in this diagram.
1.
Post translation protein structure modification by cutting and combining
polypeptide chains or by adding phosphate or carbohydrate groups to the
protein.
Proteins are held in a three-dimensional shape.
Proteins have a large variety of structures and shapes resulting in a wide
range of functions
Peptide bonds form to bind amino acids in a chain called a polypeptide,
polypeptide chains can be folded to form the 3 dimensional shape of a protein,
held together by hydrogen bonds and interactions between individual amino
acids.
2.
Fibrous proteins include silk, actin, collagen and keratin.
Globular proteins include hormones, antibodies, membrane proteins and
enzymes.
Conjugated proteins include haemoglobin.
3.
4.
Transcription
Transcription copies the information in DNA into an RNA molecule. This
occurs in the nucleus.
Transcription of DNA into primary and mature RNA transcripts involves RNA
polymerase and complementary base pairing.
RNA polymerase enzyme attaches to a sequence of DNA known as the
promoter. It then moves along the DNA, unwinding the double helix and
breaking the hydrogen bonds holding the base pairs together to create
a transcription bubble. This first stage is known as initiation.
This is followed by elongation, in which free RNA nucleotides enter the
transcription bubble and align with the complementary base pairs on
the DNA moving from 3’ to 5’. The RNA nucleotides are held in place
by hydrogen bonding while strong covalent bonds form between the
phosphate of one nucleotide and the 5’carbon of the adjacent
nucleotide.
The final stage is termination, in which the transcription termination
sequence is recognised on the DNA and the RNA polymerase enzyme
is released. The RNA that has been produced at this st age is known as
the primary transcript.
This primary transcript now requires to be modified. The primary
transcript of RNA is composed of introns and exons. The introns are
non-coding regions of genes and so do not appear in the mRNA in
eukaryotic cells. The exons are coding regions of genes and so do
appear in the mRNA. The introns of the primary transcript of mRNA are
removed in RNA splicing.
In RNA splicing the primary transcript is cut at the boundaries between
the introns and exons. The introns are removed and the exons joined
together.
The mRNA can then leave the nucleus via a nuclear pore and enter the
cytoplasm.
Translation
Translation is the process in which a polypeptide is synthesised from
an mRNA template.
Translation of mRNA into a polypeptide by tRNA occurs at the
ribosome.
tRNA folds due to base pairing to form a triplet anticodon site and an
attachment site for a specific amino acid.
The triplet anticodon site is complimentary to the triplet codon site on
the mRNA. Each codon codes for a particular amino acid.
There are far more possible codons than amino acids. There are 64
(4 3 ) possible combinations of the four bases but only 20 amino acids
occurring in nature. This has led to more than one codon coding for an
amino acid. There are three codons that do not code for amino acids:
UGA, UAA and UAG. The occurrence of these in the genetic code
terminates translation and therefore they are known as stop codons.
The genetic code also includes start codons, where translation begins.
In eukaryotes this is almost always AUG, which also codes for the
amino acid methionine. In prokaryotes occasionally other codons may
be used.
During translation the mRNA passes through the ribosome. The codons
are recognised by tRNA. Each tRNA carries a particular amino acid.
The appropriate tRNA brings its amino acid to the ribosome as it moves
along the mRNA. Adjacent amino acids join with a peptide bond. The
tRNA then leaves the ribosome. This process continues until a stop
codon is reached and the polypeptide is released.
Proteins
One gene can result in many proteins as a result of RNA splicing and
post-translational modification.
Different mRNA molecules are produced from the same primary transcript
depending on which RNA segments are treated as exons and introns. This is
called alternative RNA splicing. The exons can be combined in different
ways through a variety of methods. The most common is exon skipping,
where an exon may be removed or included.
Once translation is complete the protein can be modified to alter the
protein’s function. Examples include the addition of a phosphate or
carbohydrate.
Learning Intentions
2. Gene Expression
Cellular differentiation
 The process by which a cell develops more specialised functions by
expressing the genes characteristic for that type of cell is called
differentiation.
 Differentiation into specialised cells occurs from meristems in plants;
embryonic and tissue (adult) stem cells in animals.
 Meristems are regions of unspecialised cells in plants that are capable
of cell division.
 Stem cells are relatively unspecialised cells in animals that can
continue to divide and can differentiate into specialised cells of one or
more types. In the very early embryo, embryonic stem cells
differentiate into all the cell types that make up the organism.
Research and therapeutic uses of stem cells
 Stem cell research provides information on how cell processes such as
cell growth, differentiation and gene regulation work.
 Stem cells can be used as model cells to study how diseases develop
or for drug testing.
 Stem cells can be use in the repair of diseased or damaged tissue e.g.
used in skin grafts, bone marrow transplants and cornea repair
 Sources of stem cells can include embryonic stem cells, tissue (adult)
stem cells and attempts to reprogram specialised cells to embryonic
state (induced pluripotent stem cells).
 Tissue (adult) stem cells replenish differentiated cells that need to be
replaced and give rise to a more limited range of cell types. Once a cell
becomes differentiated it only expresses the genes that produce the
characteristic for that cell type.
 The ethical issues of stem cell use and the regulation of their use.
Cellular differentiation
The process by which a cell develops more specialised functions by
expressing the genes characteristic for that type of cell is called differentiation.
Differentiation into specialised cells occurs from meristems in plants;
embryonic and tissue (adult) stem cells in animals.
Meristems are regions of unspecialised cells in plants that are capable of cell
division. Cells produced in meristems differentiate into specialised cells.
There are two types of meristem found in plants: apical and l ateral. The
apical meristems are found at root and shoot tips where plant growth
occurs. Lateral meristems (cambium) cause the plant to grow outwards
(horizontally) and are responsible for the thickening of stems in plants
which return year after year. This occurs in the cambium and is
responsible for the growth of wood on a tree trunk. The cells found in
apical meristems are a useful tool in plant tissue culture. They are
described as being totipotent, which means they are capable of
becoming any cell within the plant. These cells can therefore be used
to grow entirely new plants that are clones of the original plant.
Basically a piece of plant (shoot tip, node etc) is put in nutrient medium
that encourages growth. The composition of the medium can be
changed to produce a mass of undifferentiated cells called a callus or
an entire plant.
Stem cells are relatively unspecialised cells in animals that can continue to
divide and can differentiate into specialised cells of one or more types. In the
very early embryo, embryonic stem cells differentiate into all the cell types that
make up the organism.
Human embryonic stem cells can be grown in the lab from cells taken
from early embryos at a stage of development called the blastocyst.
The blastocyst is made up of two layers of cells – and outer layer that
would form part of the placenta, and an inner layer of cells that have
the ability to make all the tissues of the embryo. Embryonic stem cells
are derived by removing the outer layer and culturing the inner layer of
cells in the lab. These cells are described as being pluripotent. Tissue
(adult) stem cells replenish differentiated cells that need to be replaced
and give rise to a more limited range of cell types. These cells are
described as being multipotent and are sometimes referred to as
somatic stem cells. These multipotent cells replenish the cells that
make up particular organs in the body.
Research and therapeutic uses of stem cells
Stem cell research provides information on how cell processes such as cell
growth, differentiation and gene regulation work. Stem cells can be used as
model cells to study how diseases develop or for drug testing.
Stem cells can be use in the repair of diseased or damaged tissue e.g. used in
skin grafts, bone marrow transplants and cornea repair
Sources of stem cells can include embryonic stem cells, tissue (adult) stem
cells and attempts to reprogram specialised cells to embryonic state (induced
pluripotent stem cells). Tissue (adult) stem cells replenish differentiated cells
that need to be replaced and give rise to a more limited range of cell types.
Once a cell becomes differentiated it only expresses the genes that produce
the characteristic for that cell type.
Embryo cells must not be allowed to develop beyond 14 days, around the
same time a blastocyst would be implanted in a uterus.
Other ethical considerations include the use of induced pluripotent stem cells
and the use of nuclear transfer techniques.
Learning Intentions
3. Genome
 The genome of an organism is its hereditary information encoded in
DNA.
 DNA sequences that code for protein are defined as genes
 Most of the eukaryotic genome consists of these non-coding
sequences.
The structure of the genome
 Coding and non-coding sequences include those that regulate
transcription and those that are transcribed to RNA but are never
translated.
 Non-translated from of RNA include tRNA, rRNA (ribosomal) and RNA
fragments.
 Some non-coding sequences have no known function.
Mutations
 Mutations are changes in the genome that can result in no protein or
an altered protein being expressed.
 Single gene mutations involve the alteration of a DNA nucleotide
sequence as a result of the substitution, insertion or deletion of
nucleotides.
 Single nucleotide substitutions and inversion are point mutations and
can be silent, neutral, missense, or nonsense.
 Single-nucleotide substitutions include: missense, nonsense and
splice-site mutations.
 Splice site mutations can alter post-translational processing.
 Nucleotide insertions or deletions result in frame-shift mutations or an
expansion of a nucleotide sequence repeat.
 Regulatory sequence mutations can alter gene expression.
 Chromosome structure mutations involve duplication, deletion and
translocation.
 Mutations and gene duplication are important in evolution
 Polyploidy results from errors during the separation of chromosomes
during cell division can result in cells with whole genome duplications.
 Polyploidy is important in the evolution of human food crops.
 Polyploidy examples include banana (triploid) and potato (tetraploid) as
well as swede, oil seed rape, wheat and strawberry.
 Polyploidy is very rare in animals.
3. Genome
The genome of an organism is its hereditary information encoded in DNA.
DNA sequences that code for protein are defined as genes. A genome is
made up of genes and other DNA sequences that do not code for proteins.
Most of the eukaryotic genome consists of these non-coding sequences.
(a) The structure of the genome
Genes code for proteins. The genome is made up of genes and other
DNA that does not code for proteins:
eg Gene regulatory sequences, which control transcription, DNA, which
is transcribed into transfer RNA (tRNA) or ribosomal RNA (rRNA), and
small pieces of RNA and DNA sequences that have no known function.
Coding and non-coding sequences make up the genome.
Introns are common in eukaryotes and the number and length varies a
lot between species.
One gene can code for many different proteins depending on how many
exons or which exons are spliced together.
Proteins are mostly enzymes that carry out the ‘instructions’ of the
gene, giving us our characteristics. Often one characteristic is
controlled by more than one gene so it is a complex business.
(b) Mutations are changes in the genome that can result in no protein or
an altered protein being expressed.
Naturally occurring mutations are rare, they occur randomly and
spontaneously.
Mutations can be induced by mutagenic agents such as gamma rays, X-rays
and UV light. Tar in cigarettes, certain food additives and many chemicals are
thought to induce mutations.
Some mutagens are also carcinogens – cancer-causing mutations.
Most mutant alleles are recessive so are only seen in the phenotype when two
recessive alleles are present.
However, some are dominant (achondroplasia) and some are sex-linked
(haemophilia).
Some mutations give rise to better genes and provide alternative choices on
which natural selection can act. They are considered to be the raw material of
evolution.
(i) Gene Mutations
The three types of mutations you need to know about are nucleotide
substitution, insertion and deletion. You will also study examples of the
effects of mutations i.e. sickle cell anaemia.
Point mutation
Occurs at a single point – substitution.
Generally not too harmful, most of the protein remaining unaffected.
Only one amino acid affected so the protein will probably be functional.
(single nucleotide polymorphism)
Frame-shift mutation
After a deletion or insertion the open reading frame is moved one base pair
forward or backward.
This is generally harmful since all the amino acids in the primary structure of
the protein will have changed from the mutation onwards.
The protein will probably be non-functioning.
(ii) Chromosome structure mutations
Mutations and gene duplication are important in evolution e.g. evidence of
formation of human chromosome 2 from fusion of two ancestral chromosomes
and gene duplication leading to alpha and beta globins in haemoglobin.
Polyploidy
Occurs due to errors during the separation of chromosomes during cell
division can result in cells with whole genome duplications.
It is the failure of the spindle fibres, complete non-disjunction, which gives rise
to a doubling of the chromosome complement of the gamete cells. For
example, a plant which undergoes complete non-disjunction will form diploid
gametes. If these self-fertilise a tetraploid plant will result.
Polyploidy organisms have more than two sets of chromosomes: some
sources estimate that over 70% of flowering plants are polyploids.
Polyploids must have matching sets of homologous chromosomes in order to
be fertile.
Polyploidy examples include banana (triploid) and potato (tetraploid) as well as
swede, oil seed rape, wheat and strawberry.
Polyploidy is important in the evolution of human food crops.
Polyploidy is very rare in animals.
Learning Intentions
3. Genome
Evolution
 Evolution is the changes in organisms over generations as a result of
genomic variations.
Gene transfer
 Vertical (inheritance) from parent to offspring occurs as a result of
sexual or asexual reproduction.
 Horizontal inheritance in prokaryotes and viruses occurs as they can
exchange genetic material by conjugation. This can result in rapid
evolutionary change.
 Prokaryotes and viruses can also transfer sequences horizontally into
the genomes of eukaryotes.
Selection
 Natural selection is the non-random increase in frequency of DNA
sequences that increase survival.
 Sexual selection is an increase in successful reproduction.
Genetic drift
 The random increase and decrease in frequency of sequences,
particularly in small populations, as a result of neutral mutations and
founder effects.
Speciation
 Speciation is the generation of new biological species by evolution.
 A species is a group of organisms capable of interbreeding and
producing fertile offspring, and which does not normally breed with
other groups.
 The importance of geographical barriers in allopatric speciation.
 The importance of behavioural or ecological barriers in sympatric
speciation.
 Hybrid zones form in regions where the ranges of closely related
species meet e.g. hooded crow and carrion crow zone in Scotland.
Inheritance
Genetic sequences are inherited vertically from parent to offspring as a
result of sexual or asexual reproduction. Prokaryotes can exchange
genetic material horizontally, resulting in rapid evolutionary change
(conjugation). Prokaryotes and viruses can transfer sequences
horizontally into the genomes of eukaryotes.
HORIZONTAL GENE TRANSFER by CONJUGATION
E. coli
P.syringae
pillus
chromosome
antibiotic resistance gene
Bacteria can pick up pieces of DNA from its
surroundings - from another bacteria that has died.
Selection.
Natural selection is the non-random increase in frequency of sequences
that increases survival (natural selection) or successful reproduction
(sexual selection). The non-random reduction in frequency of
deleterious sequences. The differences in outcome as a result of
stabilising, directional and disruptive selection.
Characteristics which increase the chances of mating may become
exaggerated but may also decrease the organism’s chances of
survival.
Genetic drift.
Genetic drift is the change in the frequencies of alleles in a population that
occur by chance, rather than because of natural selection, ie the random
accumulation of mutations in the absence of natural selection (selection
pressure).
The random increase and decrease in frequency of sequences,
particularly in small populations, as a result of neutral mutations and founder
effects.
The founder effect, a type of genetic drift, is the loss of genetic variation that
occurs when a new population is established by a very small number of
individuals from a larger population.
Speciation
‘On the other hand, ‘we may feel sure that any variation in the least
degree injurious would be rigidly destroyed. This preservation of
favourable variations and the rejection of injurious variat ions, I call
natural selection.’
Charles Darwin (1859) on the origin of species by the means of natural
selection.
Speciation is the generation of new biological species by evolution. A
species is a group of organisms capable of interbreeding and
producing fertile offspring, and which does not normally breed with
other groups.
It is difficult to apply the species definition to asexually reproducing organisms.
There are different definitions of the term species e.g. biological species
concept and phylogenetic species concept.
Allopatric speciation is the evolution of new species in populations that
are geographically isolated from one another. Geographical barriers
are important in allopatric speciation.
Sympatric speciation is the evolution of new species in populations that
live in the same geographic area. Behavioural or ecological barriers are
in place to prevent gene exchange within a given area. Behavioural
barriers, such as breeding patterns or rituals, and ecological barriers,
such as food availability, may operate in sympatric speciation.
The formation of hybrid zones in regions where the ranges of closely
related species meet e.g. hooded crow and carrion crow zone in Scotland.
Learning Intentions
3. Genome
Genomic sequencing
 The sequence of nucleotide bases can be determined for individual
genes and entire genomes.
 To compare sequence data, computer and statistical analyses
(bioinformatics).
Evidence for evolution
 Evidence from phylogenetics and molecular clocks has been used to
determine the main sequence of events in evolution.
 The use of sequence data to study the evolutionary relatedness among
groups of organisms.
 The use of sequence data and fossil evidence to determine the
main sequence of events in evolution of life: cells, last universal
ancestor, photosynthetic organisms, eukaryotes, multicellularity,
animals, land plants, vertebrates.
Comparison of genomes from different species
 Comparison of genomes reveals that many genes are highly conserved
across different organisms.
 Many genomes have been sequenced, particularly of disease-causing
organisms, pest species and species that are important model
organisms for research.
Personal genomics and health – Pharmacogenetics
 Analysis of an individual’s genome may lead to personalised medicine
through knowledge of the genetic component of risk of disease and
likelihood of success of a particular treatment.
 Comparison of individual’s genomes focuses on point mutations,
repetitive sequence errors and blocks of duplication and deletion.
 There are difficulties in distinguishing between neutral and harmful
mutations in both genes and regulatory sequences, and in
understanding the complex nature of many diseases.