Supplemental Methods
Methods S1. Cell Growth and Proliferation of AML cell lines and primary AML
samples.
BrDU incorporation of AML cell lines was analyzed on a FACS Canto A (Becton
Dickinson) using the FITC BrDU Flow Kit (BD Biosciences) per manufacturers
instructions. Cells were pulsed with BrDU for 1 hour prior to harvesting each
indicated time point. Trypan Blue exclusion was performed on each indicated time
point to determine cell viability and growth effects of rexinoids and retinoids
compared to DMSO treated control cells alone.
Methods S2. PCR amplification of shRNA sequences and cloning into MSCV-PIG.
MSCV-PIG was originally cloned by Scott Lowe and deposited into the Addgene
plasmid bank where it was purchased. Conversion of 21-mer shRNA sequences into
a 22-mer within a mir30 context derived 97bp ultramer was derived using the
shRNA retriever tool from Ravi Sachanadinams lab website at the following URL:
http://katahdin.cshl.org/html/scripts/resources.pl
Ultramers for each shRNA and PCR primers for addition of BglII and XhoI restriction
sites used are as follows:
PU1.1:
TGCTGTTGACAGTGAGCGCCGGATCTATACCAACGCCAAATAGTGAAGCCACAGATGTAT
TTGGCGTTGGTATAGATCCGTTGCCTACTGCCTCGGA
PU1.2:
TGCTGTTGACAGTGAGCGCGAAGAAGCTCACCTACCAGTTTAGTGAAGCCACAGATGTA
AACTGGTAGGTGAGCTTCTTCTTGCCTACTGCCTCGGA
BglII-forward:
AGATCTAGATGTTGCTGTTGACAGTGAGCG
Xho1-reverse:
CTCGAGCTCGAGTCCGAGGCAGTAGGC
Pfx platimum polymerase (Invitrogen) was used for ultramer PCR and conditions
used for amplification are as follows:
Volume (microliters)
5.0
5.0
4.0
1.25
1.25
0.5
1.0
1.0
31.0
Reagent
10X PCR enhancer
10X PCR buffer
dNTP (2.5mM each)
10 uM forward primer
10 uM reverse primer
PFx platimum polymerase
MsS04 (50 mM)
Template (0.1 uM)
H20
PCR conditions: 94oC 2min (1x), 94oC 15 sec, 56oC 30 sec, 68oC 25 sec (36x), 68oC 5
min. Amplicons were isolated on a 2% agarose gel and cloned into MSCV-PIG
digested with BglII and Xho prior to Alkaline Phosphatase treatment and
transformed into TOP10F’ (Invitrogen) competent cells for growth in 50 ug/ml
ampicillin LB agar plates at 37oC. Clones were selected by positive insert sizes of
122bp and maxi prep purified (Qiagen). Purified clones were sequenced by the Cell
Center Sequencing Facility (University of Pennsylvania) using forward and reverse
primers described above to verify sequences introduced by PCR.
Methods S3. Retroviral transduction of MSCVPIG-shRNA PU1.2-8 and MSCVPIG
shRNA PU1.1-13 into THP-1 cells.
MSCVPIG-empty, MSCVPIG-PU1.2-8, and MSCVPIG-PU1.1-13 were each (21
micrograms) co-transfected with pcGP (10 micrograms), and pVSV-G (5
micrograms) into 5 x 106 293T cells using Fugene 6 (Roche) per manufacturers
instructions. 24 hours post transfection, cells were analyzed for GFP expression and
supernatants were passed through a 0.45 micron syringe filter. 293T transfected
cell supernatant media was replaced with 293T media (10% FCS with DMEM).
Polybrene (500x, 4 mg/ml) and Hepes (100x, 1M) was added to the viral
supernatants prior to spin infection (2200 rpm, 90 minutes, in 6 well plates) of 3M
THP-1 cells (in log phase). Following spin infection, cells were brought up to 8 ml
volume with complete media (6 ml 10% FCS in RMPI + 2 ml viral supernatant cell
mix) and incubated overnight at 37oC. 48 hours post transfection, viral supernatants
were prepared as described and used to resuspend cells that were infected 24 hrs
post transfection following the same procedures described above. The following day
cells were checked for GFP expression and were expanded for 4 days prior to
differentiation induction by ATRA, bexarotene, LG100268, T0901317 and GW3965
as described in Figures 4, 6 and S8.
Methods S4. PU.1 mRNA quantification of MSCVPIG-empty, MSCVPIG-PU1.2-8,
and MSCVPIG-PU1.1-13 transduced cell lines.
GFP positive cells were sorted on a FACS Aria (UPENN Flow Cytometry Facility) and
were expanded for 4 days following last spin infection for subsequence analysis of
PU.1 mRNA expression and protein expression. For PU.1 mRNA expression, 250,000
GFP+ sorted cells were prepared for RNA using RNeasy RNA isolation kit (Qiagen).
cDNA synthesis was performed on 1 microgram of RNA using iScript cDNA
Synthesis kit (Biorad). 50ng of cDNA per well was analyzed by using Taqman probes
for PU.1 and beta-actin in quadruplicate (Table S4) and TaqMan Gene Expression
MasterMix (Invitrogen) per manufacturers instructions.
Methods S5. SYBR Green and TaqMan Quantitative PCR conditions using the
ABI7500 real time PCR machine.
PCR specificity was verified using dissociation curves generated on an ABI 7500
machine (Applied Biosystems) following amplification using these conditions: 1
cycle (50oC 2 minutes, 95oC 10 minutes) and 40 cycles (95oC for 15 seconds with
annealing and extension at 60oC for 1 minute.)
Methods S6. Nuclear and Cytoplasmic Fractionation of PUER cells and protein
lysis of MSCVPIG-empty, MSCVPIG-PU1.2-8, and MSCVPIG-PU1.1-13
transduced GFP+ THP-1 cells.
2.5 x 106 cells PUER cells cultured in 10 cm plates in PUER media as previously
described1 and incubated with ethanol (No OHT), 1nM OHT, 10 nM OHT, and 100
nM OHT (using 2000X stocks for a final concentration of DMSO of 0.05%) for 18
hours prior to fractionation. NE-ER Nuclear and Cytoplasmic Extraction Reagents
(Thermo Scientific) were used to isolate nuclear and cytoplasmic fractions of PUER
cells per manufacturers instructions. 3 x 106 MSCVPIG-empty, MSCVPIG-PU1.1-13,
and MSCVPIG-PU1.2-8 transduced THP-1 cells were lysed in 1X RIPA buffer
supplemented with PMSF (Sigma) and 1X Complete Ultra Tablets, EDTA-free
(Roche).
Methods S7. Western blotting of PU.1 and PUER proteins using LiCOR
Quantitative Infrared Protein Detection System.
Protein concentrations were determined using Bradford reagent (Bio-Rad) and 100
micrograms of protein lysate per condition was loaded on to a 10% mini-PROTEAN
TGX precast gel for PUER lysates (Bio-Rad) and a 4-20% mini-PROTEAN TGX precast gel (Bio-Rad) for MSCVPIG-empty, MSCVPIG-PU1.1-13, and MSCVPIG-PU1.2-8
transduced THP-1 cells. Protein separation by electrophoresis was performed on a
Mini-Protein Cell Module (Bio-Rad) per manufacturers instructions. Protein
containing acrylamide gels were transferred onto methanol activated PVDF
membrane using the Trans-Blot SD Semi-Dry Transfer Cell (Bio-Rad) per
manufacturers instructions. Protein containing PVDF membranes were blocked for
1 hr at room temperature in Odyssey Blocking Buffer (Li-COR), and incubated
overnight with 6.7 microliters of rabbit polyclonal anti PU.1 (T-21), sc-352x (Santa
Cruz Biotechnologies) in 5 ml Odyssey Blocking Buffer. PVDF membrane was
washed 3 times for 20 minutes in 0.1% Tween20-PBS, and incubated with 1
microliter of monoclonal mouse anti-beta actin clone AC-15 (Sigma A1978) in 10 ml
Odyssey Blocking Buffer for 30 minutes, followed by 3 washes of 15 minutes each in
0.1% Tween20-PBS. PVDF protein membrane was incubated with 3 microliters of
IRDye 680RD goat anti-rabbit (926-68071, LiCOR Biosciences, for PU.1 antibodies)
and 4 microliters of IRDye 800CW goat anti-mouse IgG (926-32210, Li-COR
Biosciences, for beta-actin) in 10 ml Odyssey Blocking Buffer for 30 minutes in the
dark, followed by 3, 20 minute washes in 0.1% Tween20-PBS. Protein quantification
and imaging was performed on the Odyssey Infrared Imaging System (LiCOR
Biosciences) and analyzed using Application Software Version 3.0.30. Images shown
in Figures 3G and 4A were cropped in Photoshop (Adobe) to accommodate for space
in the figure, but were unmanipulated for accurate quantification by imaging
software.
Supplemental Tables
Table S1. Primers used for Syber Green Quantification of mRNA by PCR.
Gene
C/EBP -F
C/EBP -R
C/EBP -F
C/EBP -R
PU.1-F
PU.1-R
GAPDH-F
GAPDH-R
Primer
5’-TCGGTGGACAAGAACAG-3’
5’-GCAGGCGGTCATTG-3’
5’-GCGTTCTCAAGGCCCCTT-3’
5’-GGGAGGGCGCCTTCAG-3’
5’-GCCGAGAACAACTTCACG-3’
5’-CAGATGCTGTCCTTCATGTCG-3’
5’-GACAGTCAGCCGCATCTTCTT-3’
5’-CCAATACGACCAAATCCGTTGAC-3’
Table S2. TaqMan Gene Expression Assays for quantification of mRNA by PCR.
Gene
PU.1
GAPDH
Beta-actin
RAR beta
TaqMan Gene Assay Number
Hs02786711
ABI 4352934E
ABI 43333762F
Hs00233405
Table S3. shRNA sequences used for clones in retroviral transduction of THP-1
cells using MSCV-PIG as described by Novershtern et al2.
MSCV-PIG shRNA
clone
PU.1.2-8
PU.1.1-13
Original
sequence
number
SPI1 sh1
SPI1_5
21 mer Sequence
region
GCCCTATGACACGGATCTATA
CGGATCTATACCAACGCCAAA
Exon
Exon
Table S4. Human AML cell lines used in differentiation, cell growth,
proliferation, and apoptosis studies. French American British (FAB)
classification and description for each leukemic cell line is listed.
AML Cell Line
KG1a
HL60
NB4
MOLM14
THP-1
FAB Subgroup Description
M0
Acute Myeloid Leukemia
undifferentiatied/early myeloblast
M2
Acute Myeloblastic Leukemia
M3
Acute Promyelocytic Leukemia (APL)
M5a
Acute Myelomonocytic Leukemia
M5
Acute Myelomonocytic Leukemia
Table S5. Primary AML samples used in colony forming assays, growth curves,
and differentiation by flow cytometry. Samples are referred to their collection ID
throughout the manuscript. AML classification and cytogenetics were determined at
the time of collection by hematopathologists in the Department of Pathology at the
Hospital of the University of Pennsylvania.
Collection AML type
Sample
Source
718
M4 myelomonocytic
pheresis
990
AML with inv(16)
pheresis
46,XX[25]
inv(16)(P13;q22) or
t(16;16)(p13;q22)
1932
NOS
pheresis
7/10/09: 46,XX[16]
1956
M4 myelomonocytic
pheresis
47,XX,+8[8]/46,XX[14]
2093
M4 myelomonocytic
pheresis
N/A
Cytogenetics
1.
Dahl R, Walsh JC, Lancki D, et al. Regulation of macrophage and neutrophil
cell fates by the PU.1:C/EBPalpha ratio and granulocyte colony-stimulating factor.
Nat Immunol. 2003;4(10):1029-1036.
2.
Novershtern N, Subramanian A, Lawton LN, et al. Densely interconnected
transcriptional circuits control cell states in human hematopoiesis. Cell.
2011;144(2):296-309. Prepublished on 2011/01/19 as DOI
10.1016/j.cell.2011.01.004.
Supplemental Figure Legends
Figure S1. Bexarotene and ATRA have variable effects on apoptosis and cell
growth of AML cell lines. AML cell lines treated with increasing concentrations of
bexarotene or with ATRA for 4 days compared to vehicle (DMSO) treated cells. (A)
The percentage of Annexin V+ 7AAD- cells analyzed by flow cytometry was variable
among AML samples and is noted as significantly higher than vehicle treated control
alone (* P<.05). Bar graphs represent the mean +/- standard deviation and are
representative of at least 4 independent experiments. (B) Viable cells were
quantified by trypan blue exclusion for each AML cell line treated with bexarotene
100 nM (closed circle and solid line), bexarotene 500 nM (closed diamond and solid
line), and ATRA 100 nM (open diamond and dashed line) at indicated time points.
DMSO is shown (open diamond and dashed line). A significant difference in ATRA or
bexarotene treated cells compared to DMSO at 96 hours (* P<.05). ns, not
significant.
Figure S2. Bexarotene or ATRA treatment reduced BrDU incorporation and
G0/G1 and G2/M cell cycle status over a 96 hour time course for retinoid and
rexinoid differentiation responsive AML cell lines. AML cell lines treated with
DMSO (blue line), bexarotene 100 nM (green line), bexarotene 500 nM (purple line),
and ATRA 100 nM (yellow line) were pulsed labeled for 1 hour with BrDU at 12, 24,
36, 48, 72 and 96 hour time points. Cells were processed and stained with 7AAD per
manufacturers instructions (BrDU FITC Flow Kit) and quantitatively analyzed for
cell associated BrDU and total DNA (7AAD) for analysis of cells actively synthesizing
DNA in terms of their cell cycle position (BrDU=S phase, G0/G1 phase and G2/M
phase). The retinoid and rexinoid differentiation unresponsive cell line KG1a
demonstrated no changes in cellular BrDU uptake or percentage of cells at G1/G0 or
G2/M cell cycle stages. There was time dependent decrease in BrDU incorporation
for retinoid and rexinoid responsive AML cell lines demonstrating a reduction in
proliferation compared to DMSO treated control cells. Interestingly, there were
differences in cell cycle arrest (G0/G1 or G2/M between cell lines with ATRA or
bexarotene, demonstrating the heterogeneity between AML cells as well as
differences in mechanism of action for either compound on cell cycle arrest.
Figure S3. Bexarotene does not cooperate with ATRA to induce myeloid
differentiation in all AML cell lines. In contrast to previous reports suggesting
that RXR requires RAR for differentiation induction, most AML cell lines tested do
not cooperate with RAR to activate myeloid differentiation as seen by (A) CD11b
and (B) CD14 expression after the combined treatment of ATRA and bexarotene
compared to either drug alone. (C) Changes in cellular morphology associated with
differentiated myeloid cells correlated with induction of differentiation markers in
HL60 cells treated with ATRA (10 nM) and bexarotene (100 nM) compared to
vehicle treated control (DMSO). (C) The percentage of Annexin V+ 7AAD-positive
cells analyzed by flow cytometry was variable among AML samples and is noted as
significantly higher than vehicle treated control alone (* P<.05), while a significance
of a combined effect greater than either drug alone is indicated as  P<.05. ns, not
significant.
Figure S4. Morphological changes associated with myeloid maturation by
bexarotene do not require activation of RAR. Changes in cellular morphology
associated with differentiated myeloid cells correlates with induction of
differentiation markers in THP-1 or MOLM14 cells treated with bexarotene (500
nM). Single treatment with the pan RAR antagonist R041-5253 did not display
changes in morphology and were comparable to vehicle treated cells alone (DMSO).
Combination treatment with bexarotene and the pan RAR antagonist R041-5253
were comparable to bexarotene treatment alone.
Figure S5. The RARa antagonist ER50891 inhibits ATRA induced
differentiation but not bexarotene induced differentiation of HL60 and THP-1
cells. Cells were treated with ATRA (100 nM), bexarotene (500 nM), ER50891 (10
uM), ATRA + ER50891, and bexarotene + ER50891 for four days prior to analysis of
CD11b expression. ER50891 alone had no effect on differentiation induction but
significantly blocked differentiation of ATRA in HL60 and THP-1 cells. However,
ER50891 did not inhibit bexarotene induced differentiation in THP-1 and had only a
minor effect in HL60 cells, suggesting that RAR activation does not significantly
contribute to bexarotene induced differentiation.
Figure S6. ATRA, bexarotene, or LG100268 induced differentiation of PUER
cells requires a threshold level of PU.1 in the nucleus that is not achieved by
lower concentrations of OHT. (A) 4 day treatment of PUER cells with 1nM OHT
demonstrate that CD11b induction is not increased (Red histogram, DMSO) when
compared to basal levels PU.1 in PUER cells (black histogram, No OHT). PUER cells
treated with 1 nM OHT and ATRA (blue histogram), bexarotene (green histogram)
or LG100268 (orange histogram) demonstrated similar CD11b levels to vehicle
control (DMSO, red histogram), demonstrating that insufficient levels of nuclear
PU.1 are available to induce differentiation. Fluorescence minus 1 control (gray
histogram) of CD11b was included to compare basal CD11b levels (black histogram,
No OHT) above non-specific fluorescence in all three figures. (B) Graphical
representation of relative quantification of cytoplasmic PUER and nuclear PUER
compared to No OHT for PUER nuclear and cytoplasmic fractions with indicated
concentrations of OHT 18 hours after treatment. PUER protein quantification values
were normalized to cellular actin for each fraction prior to comparison to No OHT.
Figure S7. Single and combined effects of LXR  agonists T0901317,
GW3965, the ROR  inverse agonist SR1001, bexarotene and the pure RXR
agonist LG100268 on RARbeta expression and apoptosis in THP-1 cells. (A).
Taqman RAR beta gene expression relative to beta-actin 20 hours following
indicated treatments of THP-1 cells. Relative to the significant induction of RARbeta
by ATRA, single and combination treatments with bexarotene, LG100268,
T0901317 and GW3965 did not significantly induce RAR beta expression,
suggesting that RAR activation does not play a role in LXR/RXR mediated differentiation induction of THP-1 cells. (B) Single treatment of all compounds on
THP-1 cells at 96 hours demonstrate minimal effects on apoptosis (annexin
V+/7AAD-) and necrosis (Annexin V+/7AAD+) compared to vehicle (DMSO) treated
cells alone. The combination of LXR  agonists and bexarotene or LG100268
demonstrated the greatest increases in apoptotic and necrotic cells compared to
either drug alone. Combination treatment with SR1001 had no effects on apoptosis
or necrosis. All panels are representative of at least 3 independent experiments.
Figure S8. Differentiation induction and apoptosis by combined bexarotene
and T0901317 LXR/RXR activation in AML cells is specific to activation of RXR
and requires threshold levels of PU.1. A time course of LXR/RXR activation by
bexarotene (blue histogram) and T0901317 (green histogram) demonstrates a
gradual induction of (A) differentiation markers CD11b and CD14 followed by an
increase in (B) apoptotic cells by Day 4, suggestive of terminal differentiation
pathways following maturation and not drug induced cytotoxicity. Use of the pan
RXR antagonist LG101208 (alone - blue histogram) combined with bexarotene and
T0901317 (purple histogram) completely inhibited CD11b and CD14 expression
and apoptosis induced by the combination of bexarotene and T0901317 (orange
histogram) compared to DMSO control (red histogram) demonstrating that potent
myeloid differentiation induction and apoptosis is specific to RXR activation. (C)
GFP+ THP-1 PU.1 shRNA cells described in Figure 4 were treated for 3 days with
combinations of bexarotene and T0901317 or GW3965 and assayed for CD11b
expression. LG100268 induced differentiation of THP-1 cells was significantly
reduced with PU.1 shRNA suppression (MSCVPIG shPU1.2-8 and MSCVPIG shPU1.113 compared to MSCVPIG empty). As expected CD11b induction by the combination
of bexarotene with T0901317 was reduced but to a lesser extent than seen with the
combination of bexrotene and GW3965. As GW3965 is a pure LXR / agonist, the
significant reduction of CD11b induction by suppressing PU.1 in THP-1 cells
suggests a more prominent role for PU.1 in LXR/RXR mediated differentiation. All
panels (A-C) are representative of at least 3 independent experiments.
Figure S9. Differentiation induction following activation of LXR/RXR in
primary AML cells. Increased expression of CD11b/CD15 double positive cells in
the myeloid blast gate on Day 6 by combined treatment with bexarotene or
LG100268 with T0901317 demonstrates that differentiation induction is specific to
LXR/RXR activation and not RAR activation. Percentages of cells for CD11b and
CD15 expression are indicated in each panel. (All panels are representative of at
least 3 independent experiments.