Supplementary Material
1. Sample details
Samples of the liquid portion of the forestomach contents of three wild male
Eastern Grey kangaroos (M. giganteus) were collected under a Queensland
Parks
and
Wildlife
Scientific
Purposes
Permit
(permit
number
W0/001397/00/SAA). Samples were collected in the field near Milmerran,
Queensland from animals which had been euthanized as part of the regular
annual cull. The forestomach contents were immediately mixed with sterile,
anaerobic glycerol to give a final glycerol concentration of 30-40% (v/v).
These samples were placed on ice for short term transport, before being
frozen on dry ice for transport back to the laboratory, where they were
transferred to storage at -20 °C. Samples of rumen fluid from four Bos taurus
cattle that had been fed a diet consisting primarily of whole barley grain for
110 days were collected immediately after slaughter at Highchester Abattoir,
Beaudesert, Qld, Australia. Whole digesta samples were mixed with glycerol,
transported and stored as described above. Samples of rumen fluid of grassfed cattle were collected from three rumen fistulated B. taurus x B. indicus
cattle housed at the Centre for Advanced Animal Studies at Gatton,
Queensland. Liquid digesta was mixed with sterile anaerobic glycerol and
handled as described above. During collection of all samples, a portion of
liquid digesta was also collected into separate bottles which did not contain
glycerol. These bottles were transported on ice and frozen at the earliest
opportunity. This digesta was used for preparation of media for the incubation
experiment.
The kangaroo forestomach sample used for RNA-SIP was taken from an
archive of samples that were previously collected and frozen as described
above (Ouwerkerk et al., 2005; Ouwerkerk et al., 2009)
2. Summary of samples used in the experiments
Experiment 1 – Isotope tracing to compare the fates of carbon
dioxide/bicarbonate in the bovine rumen and kangaroo forestomach
Animal
Diet
Number of
animals
sampled
Isotope tracer
treatments
Macropus
giganteus
(eastern grey
kangaroo)
Bos indicus x
Bos taurus
Mixed
pasture
3
(1) 13C (5% label)
Incubation
sampling
time points
(hours)
0, 3, 6, 24, 48,
168
(2) 12C (no label)
Mixed
pasture
3
(1) 13C (5% label)
0, 3, 6, 24, 48,
168
(2) 12C (no label)
Bos taurus
Barley
ration
4
(1) 13C (5% label)
0, 3, 6, 24, 48,
168
(2) 12C (no label)
Experiment 2 – RNA stable isotope probing to identify bacteria
associated with metabolism of carbon dioxide/bicarbonate and
hydrogen.
Animal
Diet
Number of
animals
sampled
Macropus
giganteus
(eastern grey
kangaroo)
Mixed
pasture
1
Isotope tracer
treatments
Incubation
sampling
time point
(hours)
13
(1) C (99% label) 16
+ hydrogen
(2) 12C (no label)
(3) 13C (99% label)
without hydrogen
3. Media compositions
All media used were designed to approximately simulate the pH and major ion
concentrations of the bovine rumen and kangaroo forestomach. In the isotope
tracer experiments, the composition of the basal salt solution was identical for
each of the three systems that were investigated (kangaroo forestomach,
grass-fed bovine rumen and grain-fed bovine rumen). The only difference in
the media used for each of the three systems was the type of gut fluid that
was added. All media were adjusted to pH 7.0 prior to autoclaving.
Digesta based media for isotope tracing experiments
Per litre
Clarified rumen fluid or kangaroo forestomach fluid
NaCl
(NH4)2SO4
CaCl2
MgSO4
K2HPO4
NiCl2 x 6 H2O
Ascorbic acid
Myo-inositol
Niacinamide
Choline chloride
Trace Element Solution*
Resazurin
NaHCO3
330 ml
100 mg
50 mg
5 mg
5 mg
50 mg
10 mg
0.5 mg
0.5 mg
0.5 mg
0.5 mg
10.0 mL
0.02 mg
10.5 g
Minimal Carbon Anaerobic Salts (MCAS) medium
Per litre
NaCl
KH2PO4
(NH4)2SO4
CaCl2
MgSO4
K2HPO4
Trace Element Solution*
Cysteine-HCl
Resazurin
NiCl2 x 6 H2O
Ascorbic acid
Myo-inositol
Niacinamide
Choline chloride
3.6 g
50 mg
50 mg
5 mg
5 mg
50 mg
10.0 mL
0.22 g
0.02 mg
10 mg
0.5 mg
0.5 mg
0.5 mg
0.5 mg
*Trace element solution
per litre
MgSO4.H2O
MnSO4.H2O
NaCl
FeSO4.7H2O
CoCl2.6H2O
CaCl2
ZnSO4.7H2O
CuSO4.5H2O
AlK(SO4)2.12H2O
H3BO3
Na2MoO4.2H2O
NiSO4.6H2O
Na2SeO3
Na2WO4.2H2O
3g
0.5 g
1g
0.1 g
0.1 g
0.1 g
0.1 g
10 mg
10 mg
10 mg
10 mg
30 mg
20 mg
20 mg
4. Gas Chromatography - Isotope ratio mass spectrometry
Determination of carbon stable isotope ratios relative to the international
standard Vienna Peedee Belemnite (δ13CVPDB) (Coplen et al., 2006) was
conducted using an Agilent 7890A GC system (Agilent Technologies, Santa
Clara, CA, USA) coupled to an Isoprime GC5 oxidation furnace and an
Isoprime 100 isotope ratio mass spectrometer (Isoprime, Cheadle, UK). For
both headspace gases and VFAs, the gases eluting from the chromatographic
column were split into two streams. One of these was directed into an Agilent
5975C inert mass spectrometer detector (MSD), for sample identification and
quantification, while the other was directed through the GC5 furnace held at
990 °C to oxidise all carbon species into CO2. The CO2 exiting the furnace
was then directed into the IRMS for the determination of δ13C. The IRMS was
calibrated using laboratory standard gas Labgas 50:50, which is a 50:50 mix
of CH4 and CO2 (δ13CVPDB of -40.1‰ and -18.8‰ respectively) and
international standard NBS19 (δ13CVPDB +1.95‰).
For analysis of gas headspace samples, the gas chromatography column was
a 0.5 mm × 30 m Varian CP7352 (Agilent). Twenty microlitres of gas was
injected into the system manually via a split/splitless injector at a 20:1 split
ratio. The carrier gas was helium at a constant flow rate of 1.3 mL/min and the
column was held at a constant temperature of 40 °C. A standard curve for
methane concentration was constructed by performing 5 μL, 10 μL, 20 μL, 30
μL, 40 μL and 50 μL injections of a standard 2.5% methane sample and
plotting the resulting major beam area obtained from the IRMS.
Stable isotope analysis of VFAs was conducted by the method of Morrison et
al. (2004), The gas chromatography column was a 250 μm × 30 m VFWAXms (Agilent). One μL of aqueous solution containing VFAs was injected
manually at a split ratio of 2:1. The carrier gas was helium at a flow rate of 1.1
mL/min. Chromatographic separation of VFAs was achieved using a
temperature program which ramped the column oven from 70 °C to 180 °C
over 14 minutes. The concentrations of each VFA in the samples were
determined using a series of VFA standard solutions each of which contained
4.0 mM of the internal standard 3-methyl valeric acid. These standards were
used to construct calibration curves using the ratio of response (peak area)
obtained from the quadrupole MSD for each VFA to the response for the
internal standard.
Table S1. Composition of VFA standard solutions
VFA
Standard 1
Standard 2
Standard 3
acetic acid
propionic acid
iso-butyric acid
n-butyric acid
iso-valeric acid
n-valeric acid
3-methyl-valeric
acid (internal
standard)
5.521 mM
1.339 mM
0.535 mM
0.545 mM
0.455 mM
0.455 mM
3.986 mM
52.51 mM
13.39 mM
5.35 mM
5.45 mM
4.55 mM
4.55 mM
3.986 mM
105.02 mM
26.78 mM
10.70 mM
10.90 mM
9.10 mM
9.10 mM
3.986 mM
Response
factor
0.345
0.481
0.679
0.678
0.832
0.881
1.000
5. Resolution of 13C-labelled RNA by isopycnic centrifugation
13C-labelled
RNA was resolved from unlabelled RNA by isopycnic
centrifugation in caesium trifluoroacetate (CsTFA) using a protocol adapted
from Whiteley et al (2007). Gradients were formed in 5.1 polyallomer
ultracentrifuge tubes (Beckman Coulter, Gladesville, NSW ), which contained
4.083 mL of a 1.99 g/mL CsTFA solution (GE Life Science), 173.9 μL
deionised formamide and 840.2 μL of RNA solution containing a total of 600
ng of RNA. Control gradients were loaded with 300 ng each of
13C
and
12C-E
coli RNA prepared as described above. Tubes were centrifuged in an NVT100 rotor in an Optima L-XP ultracentrifuge (Beckman Coulter, Gladesville,
NSW ) at 53,800 rpm and 20 °C for 48-64 hours. After centrifugation, each
gradient tube was divided into 20 fractions by using a gradient fractionator
(Isco) to collect fluid at a controlled rate from the bottom of the tube. The
density of the solution in each fraction of the control gradient was determined
using a digital refractometer (Reichert, USA) to verify correct formation of
gradients during the centrifuge run. The densities of fractions of the sample
gradients were not measured to prevent carryover of RNA and cross-
contamination of samples. The RNA was recovered from each gradient
fraction by precipitation in isopropanol using certified nucleic acid–free
glycogen (Life Technologies, Mulgrave, Vic, Australia) as a carrier, and
resuspended in 30 μL nuclease free water. Profiles illustrating the quantity of
total RNA recovered from each gradient fraction are presented in figure S1.
6. 13C labelling of E. coli controls
As a control to allow the verification of gradient formation and separation of
13C
labelled (‘heavy’) and unlabelled (‘light’) RNA, E. coli strain YE263,
originally isolated from kangaroo foregut contents (Ouwerkerk et al., 2009),
was grown to stationary phase in M9 minimal medium (Sambrook et al., 1989)
supplemented with trace elements and vitamins (Joblin, 2005) plus 0.4% (w/v)
of either
12C
or
13C
6
glucose (Sigma-Aldrich, St. Louis, USA). Cultures were
passaged three times in this medium, then cells were recovered by
centrifugation, and RNA was extracted as described below.
7. Comparison of gradient fractions by denaturing gradient gel
electrophoresis
DGGE was used for preliminary comparison of the structure of bacterial
communities represented in the ‘heavy’ and ‘light’ fractions of CsTFA
gradients. For each gradient, 20 pg RNA recovered from each of the three
fractions corresponding to the ‘heavy’ RNA peak of the control gradient and
20 pg from each of the three fractions corresponding to the ‘light’ RNA peak of
the control gradient was reverse transcribed using the Thermoscript reverse
transcriptase kit (Invitrogen) according to the manufacturer’s instructions. The
resulting cDNA solution was used as template for amplification of the V3
region of the 16S rRNA gene using the forward primer 341F-GC (5’CGCCCGCCGCGCGCGGCGGGCGGGGCGGGGGCACGGGGGGCCTACG
GGAGGCAGCAG-3’) which includes a 5’ GC-clamp (indicated in bold) and
reverse primer 534R (ATTACCGCGGCTGCTGG) (Muyzer et al., 1993).
Thermocycling was performed according to the following; initial denaturation
at 95 °C for 5 min followed by 5 cycles of 30 s denaturation at 95 °C, 10 s
annealing at 65 °C and 30 s elongation at 72 °C. This was followed by a
touchdown phase consisting of nineteen cycles of 95 °C for 30 s, annealing
for 10 s (decreasing 0.5 °C per cycle from 65 °C) and 72 °C for 30 s. The final
phase consisted of 11 cycles of 95 °C for 30 s, 55 °C for 10 s and 72 °C for 30
s, with a final elongation step of 72 °C for 10 min.
PCR products were purified using the Qiagen PCR cleanup kit (Qiagen,
Doncaster, Victoria) according to the manufacturer’s instructions and
quantified using a Nanodrop 8000 (Thermo Scientific, DE, USA). A 20 ng
subsample of this product was then loaded into each well of a denaturing
gradient gel. The PCR products were separated by electrophoresis on an 8%
(wt/vol) polyacrylamide gel with a 30 to 60% urea/formamide gradient as
described previously (Martínez et al., 2012).
Representative denaturing gradient gels illustrating the changes in the
distribution of bacterial 16S amplicons between ‘heavy’ and ‘light’ gradient
fractions as isotope label was incorporated are presented in figures S2 and
S3.
8. PCR for production of barcoded amplicons for 454 sequencing
PCR for generation of barcoded amplicons was performed as described
previously (Gulino et al., 2013) using Phusion high fidelity DNA polymerase
(Thermo Fisher, Waltham, MA, USA), and barcoded forward primer 341F (5’Fusion A-Barcode-CCTACGGGAGGCAGCAG-3’) (Watanabe et al., 2001)
and reverse primer 787R (5’-Fusion B–CTACCAGGGTATCTAAT -3’) (Baker
et
al.,
2003)
(Fusion
sequences
and
barcodes
available
at
http://www.roche.com.au). One set of barcoded primers was used for each
cDNA sample. This produced a total of six barcoded PCR products,
designated
12C+H
‘heavy’ and
13C-H
‘heavy’,
12C+H
‘light’,
13C+H
‘heavy’,
13C+H
‘light’,
13C-H
‘light’. The PCR products were visualised on a 2% agarose
gel, and bands corresponding to the correct sized product were excised and
purified using the QIAquick gel extraction kit. Three hundred nanograms of
the purified product was submitted to the Australian Genome Research
Facility, University of Queensland, for 454-sequencing.
9. Statistical analysis of pyrosequencing data to identify OTUs
significantly associated with CO2/H2 utilisation
To normalise differences in the total number of sequences obtained for each
gradient fraction (sampling depth), the OTU table containing the number of
sequences per OTU for each fraction was resampled using the rarefaction
function of QIIME to produce a new table containing 10,000 sequences per
sample. A 2x2 contingency table was then constructed for each OTU
consisting of the numbers of sequences in the ‘heavy’ and ‘light’ fractions
recovered from the control incubation (12C + H) and the heavy-isotope treated
incubation (13C + H). The X2 statistic was calculated for each OTU, and used
to obtain a p-value which indicated how significant the difference between the
control and isotope-treated incubations was in the distribution of sequences
between the ‘heavy’ and ‘light’ fractions. OTUs with significantly (p<0.001)
increased numbers of sequences in the ‘heavy’ fraction of the isotope-treated
incubation relative to the control incubation were considered representative of
organisms that incorporated the labelled CO2. Construction of contingency
tables and X2 analysis was conducted in R studio 2.15 (Bates et al., 2012). An
identical analysis was conducted to compare the heavy isotope and hydrogen
treated incubation with the heavy isotope incubation performed without
hydrogen. This was done to identify organisms that were able to incorporate
the
13C-label
but did not require high concentrations of hydrogen to do so.
These OTUs were removed from the final list of putative hydrogen/CO 2
metabolising organisms.
References
Baker GC, Smith JJ, Cowan DA (2003). Review and re-analysis of domain-specific
16S primers. J Microbiol Methods 55: 541-55.
Bates D, Chambers J, Dalgaard P, Falcon S, Gentleman R, Hornik K et al. (2012). R
Foundation for Statistical Computing: Vienna, Austria.
Coplen TB, Brand WA, Gehre M, Gröning M, Meijer HAJ, Toman B et al (2006).
New Guidelines for δ13C Measurements. Analytical Chemistry 78: 2439-2441.
Gulino L, Ouwerkerk D, Kang A, Maguire AJ, Kienzle M, Klieve AV (2013).
Shedding the light on the macropod foregut using 454-amplicon pyrosequencing.
PLos ONE 8: e1463.
Joblin KN (2005). Methanogenic archaea. In: Makkar HPS and McSweeney CS (eds).
Methods in gut microbial ecology for ruminants. Springer: Netherlands.
Martínez ED, Turnbull KE, Quigley SP, Streeter SJ, Swain A, Klieve AV et al
(2012). Liquid-phase denaturant gradient gel electrophoresis profiles of rumen
bacteria from Brahman cross steers selected into two groups on the basis of postweaning liveweight gain on low crude protein pasture. Animal Production Science 52:
647-652.
Morrison DJ, Cooper K, Waldron S, Slater C, Weaver LT, Preston T (2004). A
streamlined approach to the analysis of volatile fatty acids and its application to the
measurement of whole-body flux. Rapid communications in mass spectrometry 18:
2593-2600.
Muyzer G, de Waal EC, Uitterlinden AG (1993). Profiling of complex microbial
populations by denaturing gradient gel electrophoresis analysis of polymerase chain
reaction-amplified genes coding for 16S rRNA. Appl. Environ. Microbiol. 59: 695700.
Ouwerkerk D, Klieve AV, Forster RJ, Templeton JM, Maguire AJ (2005).
Characterization of culturable anaerobic bacteria from the forestomach of an eastern
grey kangaroo, Macropus giganteus. Letters in Applied Microbiology 41: 327-333.
Ouwerkerk D, Maguire AJ, McMillen L, Klieve AV (2009). Hydrogen utilising
bacteria from the forestomach of eastern grey (Macropus giganteus) and red
(Macropus rufus) kangaroos. Animal Production Sciences 49: 1043-1051.
Sambrook J, Fritsch EF, Maniatis T (1989). Molecular Cloning - A Laboratory
Manual. Cold Spring Harbour Laboratory Press: New York.
Watanabe K, Kodama Y, Harayama S (2001). Design and evaluation of PCR primers
to amplify bacterial 16S ribosomal DNA fragments used for community
fingerprinting. J Microbiol Methods 44: 253-62.
Whiteley AS, Thomson B, Lueders T, Manefield M (2007). RNA stable-isotope
probing. Nature Protocols 2: 838-844.
Titles and legends to supplementary figures
Figure S1. RNA recovery from CsTFA gradients prepared with total RNA
extracted from kangaroo forestomach material that had been incubated for 3
hours, 16 hours or 7 days in the presence of ▲ unlabelled CO 2/HCO3- and H2,
■ 99 atom % 13CO2/H13CO3- and H2 or ● 99 atom % 13CO2/H13CO3- without
H2. □ Gradient controls consisted of an equimolar mix of unlabelled (‘light’)
RNA and labelled (‘heavy’) RNA extracted from E. coli grown in the presence
of
12C
or
13C
6
presence of
glucose. While incubation of forestomach material in the
13CO
13
2/H CO3
and H2 for 3 or 16 hours did not result in an
observable increase in buoyant density of RNA relative to controls incubated
in the presence of unlabelled CO2/HCO3- and H2, incubation for 7 days
resulted in complete incorporation of
13C
label. On the basis of these
observations 16 hours was chosen as the maximum incubation time that
resulted in specific incorporation of the isotope label by primary utilisers of the
CO2/HCO3- substrate.
Figure S2. Denaturing gradient gel comparing CsTFA gradient fractions for
the three incubation treatments after three hours incubation. No major
differences between the ‘heavy’ and ‘light’ gradient fractions could be
observed. (L – DGGE reference ladder,
12C
+ H2 – kangaroo forestomach
content incubated in the presence of H2 and unlabelled (12C) CO2/HCO3-,
13C+H
2
- kangaroo forestomach content incubated in the presence of H2 and
labelled (13C) CO2/HCO3-,
13C
(no H2)- kangaroo forestomach content
incubated in the presence of labelled (13C) CO2/HCO3, without H2)
Figure S3. Denaturing gradient gel comparing CsTFA gradient fractions for
the three incubation treatments after 16 hours incubation. Several instances
of
13C
labelling of specific organisms, represented by bands that appear in the
‘heavy’ fractions of the isotope labelled treatment while appearing only in the
‘light’ fractions of the no-label control incubation, can be observed (bands
indicated in boxes). (L – DGGE reference ladder,
12C
+ H2 – kangaroo
forestomach content incubated in the presence of H2 and unlabelled (12C)
CO2/HCO3-,
13C+H
2
- kangaroo forestomach content incubated in the
presence of H2 and labelled (13C) CO2/HCO3-,
13C
(no H2)- kangaroo
forestomach content incubated in the presence of labelled (13C) CO2/HCO3,
without H2)
Figure S4 Mean (± SE) changes relative to time 0 in concentration and
δ13CVDPB of butyrate (a,b) and valerate (c,d) in in vitro gut content
fermentations spiked with labelled (13C) HCO3-. ▲ Bovine rumen fluid (grainfed) (n=4) ● Bovine rumen fluid (grass-fed) (n=3) ■ Kangaroo forestomach
content (n=3).
Figure S5. Mean (± SE) changes relative to time 0 in concentration and
δ13CVDPB of acetate (a,b), propionate (c,d), butyrate (e,f) and valerate (g,h) in
in vitro gut content fermentations spiked with unlabelled (12C) HCO3-. ▲
Bovine rumen fluid (grain-fed) (n=4) ● Bovine rumen fluid (grass-fed) (n=3) ■
Kangaroo forestomach content (n=3).